University of Ghana http://ugspace.ug.edu.gh
DEVELOPMENT OF HIGH YIELDING TOMATO (Solanum lycopersicum L.) LINES 
WITH RESISTANCE TO TOMATO YELLOW LEAF CURL DISEASE (TYLCD) 
 
BY 
 
LEANDER DEDE MELOMEY 
(10512765) 
 
 
THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN 
PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE AWARD OF 
DOCTOR OF PHILOSOPHY DEGREE IN PLANT BREEDING 
 
 
 
 
WEST AFRICA CENTRE FOR CROP IMPROVEMENT  
COLLEGE OF BASIC AND APPLIED SCIENCES 
UNIVERSITY OF GHANA 
LEGON 
 
 
 
 
 
 
 
DECEMBER, 2018 
 
 
 
University of Ghana http://ugspace.ug.edu.gh
DECLARATION 
I hereby declare that except for a reference to other peoples’ work, which has been duly cited, 
this thesis is a result of my original findings and has neither in whole nor part, been presented 
for a degree in Ghana or elsewhere. 
 
……………………………….. 
LEANDER DEDE MELOMEY 
(Student) 
 
 
 
 
 ………………………………… 
PROF. SAMUEL KWAME OFFEI 
(Supervisor) 
 
 
 
 
 
…………………………………. 
PROF. KWADWO OFORI 
(Supervisor) 
 
 
 
 
 
………………………………………. 
Dr. AGYEMANG DANQUAH 
(Supervisor) 
 
 
…………………………………… 
  PROF. ERIC YIRENKYI DANQUAH 
(Supervisor) 
 
 
i 
 
University of Ghana http://ugspace.ug.edu.gh
ABSTRACT 
Tomato (Solanum lycopersicum L.) is the most important vegetable in Ghana in terms of area 
under cultivation and consumption, but production is challenged by lack of improved cultivars 
and the Tomato Yellow Leaf Curl Disease (TYLCD). In Ghana, tomato breeding programmes 
have focused on evaluation and screening of cultivars for fruit quality and resistance to the 
TYLCD but very little has been done to improve the crop through breeding. The objective of 
this study was to introgress TYLCD resistance genes into farmer-preferred tomato cultivars. 
Tomato farmers were involved in the breeding programme through a Participatory Rural 
Appraisal in six tomato growing communities in the Ashanti, Brong Ahafo and Upper East 
Regions. Farmers identified TYLCD as the most important biotic stress and proposed that 
TYLCD resistance, high yield and long shelf life must be prioritized in tomato improvement. 
To identify tomato accessions with farmers’ preferred traits, diversity among 123 assembled 
germplasm was determined based on morphological traits valued by the fresh market and 348 
SNP markers. The 123 accessions were evaluated in an augmented design with 11 accessions 
and two checks in each of the 11 blocks. However, 119 accessions were used for data analysis. 
The first five principal components explained 80% of the variation. Fruit shape, ribbing at 
peduncle end, fruit green shoulders, number of locules, growth type, shape at blossom end, 
fruits per plant, firmness, reproductive duration, yield and weight per fruit contributed to most 
of the variation. The accessions were grouped into two clusters with cluster I having 81 
accessions and 37 accessions in cluster II. There was one outlier. A total of 338 SNP markers 
were polymorphic among 96 accessions. There was population overlap though major groupings 
were observed for PGRRI, UC Davis and improved accessions. The two most widely grown 
cultivars; Power Rano and Peto Mech clustered with the improved accessions from Legon, 
Syngenta, Wienco and Technisem. 
ii 
 
University of Ghana http://ugspace.ug.edu.gh
To identify TYLCD resistant accessions, specific SCAR and SSR markers linked to the known 
TYLCD resistance genes were used to amplify the presence or absence of the genes in 21 
tomato accessions. The accessions were thereafter screened in TYLCD hot spot in a 
randomized complete block design at Akumadan in the Ashanti Region and Vea in the Upper 
East Region. The genes ty-5 and Ty-6 were discovered in accession GH9233 (Pimplifolium) 
and the Ty-6 gene was found in Pimpinellifolium x Wosowoso. Pimplifolium expressed high 
level of resistance to TYLCD at both Akumadan and Vea. 
To identify lines with good general combining abilities and specific crosses that show good 
fruit quality and yield; crosses were made between 5 locally adapted cultivars on one hand with 
three exotic lines and Pimplifolium each carrying two of the six TYLCD resistance genes, 
following North Carolina II mating design. The generated 20 F1s were evaluated in the field in 
a randomized complete block design with three replications. GCA was significant for all traits 
studied. Peto Mech was a good combiner for fruit quality traits such as fruit length and fruit 
hardness. AVTO1311 x Peto Mech had positive SCA for fruit hardness. Pimplifolium x Power 
had the highest significant SCA estimate for fruits per plant. Lorry Tyre had the highest GCA 
effect for fresh tomato yield. Lorry Tyre x AVTO1311 had the highest yield per plant. Lorry x 
AVTO1429 had the highest fruit weight. AVTO1311 and AVTO1429 were good general 
combiners for fruit weight. The observed heterosis for yield and fruit quality together with the 
TYLCD resistance offer opportunities for the development of new hybrids. To confirm the 
presence of the TYLCD resistance genes, three primers genotyped 57%, 81% and 67% of Ty-
2, Ty-3 and ty-5 heterozygous alleles respectively in the F1 plants.  
 F2 population from Power Rano and AVTO1429 were studied for segregation of Ty-2 and Ty-
3 genes. Seven and three homozygous resistant plants for Ty-2 and Ty-3 respectively genes 
were identified. This will enable the screening of F3 families in Tomato Yellow Leaf Curl 
Disease hotspot. 
iii 
 
University of Ghana http://ugspace.ug.edu.gh
DEDICATION 
I dedicate this work to my husband and children as well as my parents and siblings. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
iv 
 
University of Ghana http://ugspace.ug.edu.gh
ACKNOWLEDGEMENTS 
I would like to thank God Almighty for granting me the grace to successfully complete this 
thesis. The Director and Staff of WACCI, through whose efforts and support I got the funding 
from Syngenta Foundation for Sustainable Agriculture (SFSA) and German Academic 
Exchange Service (DAAD) for my studies. 
I am also grateful to the many collaborators and practitioners, who by sharing their experiences 
and insights in breeding and tomato cultivation, have helped me to carry out my research 
successfully. These individuals and institutions include Dr. Francis K. Padi, Dr. Eugene 
Agbicodo, Dr. Joseph H. K. Bonney, Mr. Erasmus Kotey, Staff of Biotechnology Laboratory, 
Staff of the Virology Department of the Noguchi Medical Research Institute, University of 
Ghana, Mr. Christian Amenorkpor, Mr. Nicholas Agyekum, Mr. Yaw Kofi, Agricultural 
Extension Agents of Ministry of Food and Agriculture (MoFA) and the WACCI Class of 2018 
(PhD Cohort 8). 
Last but not least, I am grateful to my research and thesis supervision team; Prof. Samuel 
Kwame Offei, Prof. Kwadwo Ofori, Prof. Eric Yirenkyi Danquah and Dr. Agyemang Danquah 
for their guidance and reassuring faith during the period of developing my thesis 
 
 
 
 
 
 
 
 
 
v 
 
University of Ghana http://ugspace.ug.edu.gh
TABLE OF CONTENTS 
DECLARATION ..................................................................................................................................... i 
ABSTRACT ............................................................................................................................................ ii 
DEDICATION ....................................................................................................................................... iv 
ACKNOWLEDGEMENTS .................................................................................................................... v 
LIST OF FIGURES ............................................................................................................................... xi 
LIST OF TABLES ............................................................................................................................... xiv 
CHAPTER ONE ..................................................................................................................................... 1 
1. GENERAL INTRODUCTION ........................................................................................................... 1 
CHAPTER TWO .................................................................................................................................... 4 
2.0 LITERATURE REVIEW ................................................................................................................. 4 
2.1 Biology of tomato ............................................................................................................................. 4 
2.1.1 Origin and domestication of tomato ........................................................................................... 4 
2.1.2 Taxonomy of tomato .................................................................................................................. 5 
2.3 Economic importance of tomato ....................................................................................................... 6 
2.4 Constraints to tomato production ...................................................................................................... 7 
2.5 Diversity in tomato ........................................................................................................................... 8 
2.6 Estimation of genetic diversity in tomato ......................................................................................... 8 
2.6.1 Morphological characterization of tomato ................................................................................. 9 
2.6.2 Molecular characterization of tomato ...................................................................................... 10 
2.7 Improving tomato for yield and fruit quality traits ......................................................................... 11 
2.8 Tomato Yellow Leaf Curl Disease (TYLCD). ................................................................................ 13 
2.8.1 History of TYLCD ................................................................................................................... 13 
2.8.2 Tomato Yellow Leaf Curl Virus (TYLCV) ............................................................................. 14 
2.8.3 Phylogeny of TYLCV .............................................................................................................. 15 
2.9 Mode of Acquisition and transmission of TYLCV ......................................................................... 15 
2.10 Breeding for TYLCD resistant varieties ....................................................................................... 16 
2.10.1 Identification of resistant genes ............................................................................................. 17 
2.10.2 Sources and mapping of TYLCD resistant genes .................................................................. 17 
2.10.3 Effectiveness of TYLCD resistance genes against TYLCD .................................................. 18 
2.10.4 Populations for marker assisted breeding of TYLCD resistant varieties ............................... 19 
2.10.5 Methods of screening lines against TYLCD .......................................................................... 20 
2.10.5.1 Disease severity rating of TYLCD .................................................................................. 20 
2.10.5.2 Detection of TYLCV in infected whitefly and tomato plants ............................................. 22 
2.10.6 Development of TYLCD resistance tomato in Ghana ....................................................... 24 
2.11 Conclusion .................................................................................................................................... 28 
CHAPTER THREE .............................................................................................................................. 29 
vi 
 
University of Ghana http://ugspace.ug.edu.gh
3.0 Farmers’ perception of Tomato Yellow Leaf Curl Disease (TYLCD) and its implication on tomato 
breeding ................................................................................................................................................ 29 
3.1 Introduction ..................................................................................................................................... 29 
3.2 Material and Methods ..................................................................................................................... 31 
3.2.1 Study area................................................................................................................................. 31 
3.2.2 Selection of Farmers ................................................................................................................ 31 
3.3 Results ............................................................................................................................................. 33 
3.3.1 Focal Group Discussion ........................................................................................................... 33 
3.3.2 Demographic characteristics of questionnaire respondents ..................................................... 36 
3.3.3 Tomato Production ....................................................................................................................... 37 
3.3.4 Constraints to tomato production ................................................................................................. 39 
3.3.5 Perception of biotic constraints to tomato production among farmers ........................................ 40 
3.3.6.1. Farmers’ perception of the control of TYLCD ........................................................................ 47 
3.3.7 Incidence and severity score of TYLCD in the regions studied .................................................. 49 
3.4 Discussion ....................................................................................................................................... 50 
3.4.1 Tomato production constraints................................................................................................. 50 
3.4.2 Incidence and Severity of TYLCD .......................................................................................... 52 
3.5 Conclusion ...................................................................................................................................... 52 
CHAPTER FOUR ................................................................................................................................. 53 
4.0 Diversity analysis of tomato accessions based on morphological traits and SNPs markers ........... 53 
4.1 Introduction ..................................................................................................................................... 53 
4.2 Materials and Methods .................................................................................................................... 54 
4.2.1 Genetic Materials and Experimental site ................................................................................. 54 
4.2.2 Experimental Design and Field Layout ................................................................................... 55 
4.2.3 Nursery and Agronomic practices ................................................................................................ 56 
4.2.4 Data Collection ........................................................................................................................ 56 
4.2.4.1 Morphological Parameters ................................................................................................ 56 
4.2.4.2 Phenological parameters ................................................................................................... 56 
4.2.4.3 Yield parameters ............................................................................................................... 57 
4.2.4.4 Fruit quality Parameters .................................................................................................... 57 
4.2.5 Analysis of phenotypic data ..................................................................................................... 58 
4.2.6 Analysis of molecular data ....................................................................................................... 58 
4.3 Results ............................................................................................................................................. 59 
4.3.1 Variability in qualitative traits ................................................................................................. 59 
4.3.2 Genetic variation for vegetative, reproductive and fruit quality traits ..................................... 60 
4.3.3 Means of various traits studied for the 119 tomato accessions evaluated ................................ 60 
4.3.4 Principal Component Analysis................................................................................................. 62 
4.3.5 Biplot Analysis ......................................................................................................................... 64 
vii 
 
University of Ghana http://ugspace.ug.edu.gh
4.3.6 Cluster Analysis ....................................................................................................................... 65 
4.3.7 SNPs analysis of tomato accessions ......................................................................................... 68 
4.3.8 Principal Coordinate Analysis ................................................................................................. 71 
4.3.9 Association between SNP markers and shape at blossom end................................................. 73 
4.4 Discussion ....................................................................................................................................... 75 
4.5 Conclusion ...................................................................................................................................... 78 
CHAPTER FIVE .................................................................................................................................. 79 
5.0 Screening of tomato accessions for TYLCD resistance and identification of resistance genes ...... 79 
5.1 Introduction ..................................................................................................................................... 79 
5.2 Materials and Methods .................................................................................................................... 80 
5.2.1 Screening for known Ty gene Loci in the assembled germplasm............................................ 80 
5.2.1.1 DNA Extraction ................................................................................................................ 80 
5.2.1.2 Polymerase Chain Reaction (PCR) ....................................................................................... 81 
5.2.2 Field screening of tomato accessions against TYLCD in Akumadan and Vea and molecular 
confirmation of viral DNA in infected Plants ................................................................................... 82 
5.2.2.1 Experimental design .............................................................................................................. 83 
5.2.2.2 Agronomic practices ......................................................................................................... 83 
5.2.2.3 Molecular confirmation of viral DNA in infected leaf samples............................................ 83 
5.2.2.4 Polymerase Chain Reaction .............................................................................................. 83 
5.2.2.5. Visual Scoring of TYLCD symptoms at Akumadan and Vea ......................................... 84 
5.2.2.6 Yield and Yield Component Data ..................................................................................... 85 
5.2.3 Data Analysis ........................................................................................................................... 85 
Phenotypic Analysis ...................................................................................................................... 85 
5.3 Results ............................................................................................................................................. 85 
5.3.1 Amplification of known TYLCD resistance genes in tomato accessions ................................ 85 
5.3.1.1 Marker Analysis .................................................................................................................... 85 
5.3.2 Incidence and Severity of TYLCD resistance in Akumadan and Vea Irrigation site .............. 88 
5.3.2.1 Disease incidence ratings ...................................................................................................... 88 
5.3.2.2 Disease severity rating .......................................................................................................... 91 
5.3.2.4 Yield and Yield Component traits at Akumadan Dam site ....................................................... 93 
5.3.2.5 Yield and Yield Components traits at Vea Irrigation site ..................................................... 94 
5.3.3 PCR amplification of TYLCV DNA in infected tomato samples ............................................ 95 
5.3.3.1 TYLCV DNA in infected Samples in Akumadan Dam site ..................................................... 95 
5.4 Discussion ..................................................................................................................................... 100 
5.4 .1 Confirmation and identification of TYLCD resistance genes ............................................... 101 
5.5 Conclusion .................................................................................................................................... 103 
CHAPTER SIX ................................................................................................................................... 104 
6.0 Combining Ability Analysis for Fruit Quality and Yield in tomato (Solanum lycopersicum L.) . 104 
viii 
 
University of Ghana http://ugspace.ug.edu.gh
6.1 Introduction ................................................................................................................................... 104 
6.2 Materials and Methods .................................................................................................................. 105 
6.2.1 Plant Materials ....................................................................................................................... 105 
6.2.2 Greenhouse Experiment: Crossing Block .............................................................................. 105 
6.2.3 Confirmation of TYLCD resistance genes in F1 Plants ............................................................. 105 
6.2.4.1 Nursery and Agronomic practices ................................................................................... 107 
6.2.4.2 Experimental site ................................................................................................................ 107 
6.2.4.3 Data collection .................................................................................................................... 107 
6.2.4.4 Data Analysis .......................................................................................................................... 108 
6.3 Results ........................................................................................................................................... 109 
6.3.1 Confirmation of Tomato Yellow Leaf Curl Virus Resistance genes (TYLCD resistance genes) 
in 20 F1 hybrids ............................................................................................................................... 109 
 ........................................................................................................................................................ 110 
6.3.2 Variability in parental and progeny for fruit quality and yield component traits .................. 111 
6.3.4 Combining ability analysis..................................................................................................... 113 
6.3.4.1 Estimation of General Combining Ability (GCA) effects .................................................. 115 
6.3.4.2 Estimation of Specific Combining Ability Effects ............................................................. 117 
6.3.4.3 Relative contribution of Additive and Non-Additive Gene action to various traits in tomato
 ........................................................................................................................................................ 119 
6.3.5 Mean performance of parents and 20 F1 hybrids evaluated for various traits in tomato........ 120 
6.3.6 Heterosis ................................................................................................................................ 120 
6.4 Discussion ..................................................................................................................................... 124 
6.4.1 Confirmation of TYLCD resistance gene in 20 F1 hybrids .................................................... 124 
6.4.2 Specific Combining Ability Effects ....................................................................................... 125 
6.5 Conclusion .................................................................................................................................... 126 
CHAPTER SEVEN ............................................................................................................................ 127 
7.0 Segregation pattern for fruit quality and TYLCD resistance loci in tomato (Solanum lycopersicum 
L.) F2 population ................................................................................................................................. 127 
7.1 Introduction ................................................................................................................................... 127 
7.2 Materials and Methods .................................................................................................................. 128 
7.2.1 Plant materials and Experimental Site ....................................................................................... 128 
7.2.3 Nursery and Agronomic practices .......................................................................................... 128 
7.2.4 Statistical analysis ...................................................................................................................... 128 
7.3 Results ........................................................................................................................................... 128 
7.4 Discussion ..................................................................................................................................... 130 
7.5 Conclusion .................................................................................................................................... 130 
CHAPETR EIGHT ............................................................................................................................. 131 
8.1 General Conclusion and Recommendation ................................................................................... 131 
ix 
 
University of Ghana http://ugspace.ug.edu.gh
REFERENCES ................................................................................................................................... 133 
APPENDIX ......................................................................................................................................... 150 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
x 
 
University of Ghana http://ugspace.ug.edu.gh
LIST OF FIGURES 
Figure 3. 1: Distribution of respondents with respect to source of seeds for tomato production
 ................................................................................................................................................ 38 
 
Figure 3. 2: Frequency of seed acquisition for tomato cultivation among respondents in six 
farming communities in three regions in Ghana ............................................................. 38 
 
Figure 3. 3: Sources of Awareness of TYLCD among tomato farmers in six communities in 
three regions in Ghana. ....................................................................................................... 42 
 
Figure 3. 4: Proportion of respondents among tomato farmers in six tomato farming 
communities in three regions in Ghana that perceived various crop plants as alternative 
host of the whitefly .............................................................................................................. 43 
 
Figure 3. 5: Proportion of respondents that ascribed various leaf symptoms of infection by 
TYLCD in six tomato farming communities in three regions in Ghana ...................... 44 
 
Figure 3. 6: Proportion of farmers in six communities in three regions in Ghana that identified 
particular tomato varieties as susceptible to TYLCD ..................................................... 45 
 
Figure 3. 7: Frequency of TYLCD occurrence in farmers’ field based on respondents in six 
tomato growing communities in three regions in Ghana. .............................................. 46 
 
Figure 4. 1: Proportion of fruit shape distribution of 123 accessions evaluated ........................ 60 
 
Figure 4. 2: Biplot analysis of thirteen traits of the 119 tomato accessions studied ................. 65 
 
Figure 4. 3: Clustering based on reproductive and fruit quality traits of 119 tomato accessions
 ................................................................................................................................................ 67 
 
Figure 4. 4: Principal Coordinate Analysis of 96 tomato accessions based on 338 SNP markers
 ................................................................................................................................................ 72 
 
Figure 4. 5: Principal Coordinate Analysis for 96 tomato accessions based on association 
between 338 SNPs and Fruit shape at blossom end ........................................................ 74 
  
 
Figure 6. 1: Relative contribution of Additive and Non-Additive Genes to various traits in tomato.
 .............................................................................................................................................. 119 
 
 
 
 
 
 
xi 
 
University of Ghana http://ugspace.ug.edu.gh
LIST OF PLATES 
 
Plate 5. 1: PCR amplification products of Ty-2 gene obtained from 21 accessions of tomato 
germplasm using T0302 F/R primer pair. Lanes: 1= C-1, 2=C-2, 3=BG9, 4=G5, 5=W, 
6=G153, 7=N, 8=G121, 9=R, 10=G9, 11= D1, 12=D2, 13=D3, 14=D4, 15=A, 16=B, 
17=S1, 18=S2, 19=TH, 20=LT, 21=D5; M=2- Log DNA ladder; -Ve = Negative 
control (sterile nuclease free water) . Susceptible: 800 bp; Resistant: 900 bp ........... 86 
 
Plate 5. 2: PCR amplification products of Ty-2 gene obtained from 11 accessions of tomato 
germplasm using P1-16 F/R primer pair. Lanes: 1= A1, 2=A2, 3=A3, 4=A4, 5=D1, 
6=D2, 7=D3, 8=D4, 9=G5, 10=G121, 11= 153; -ve = Negative control (sterile 
nuclease free water); M=2- Log DNA ladder. Susceptible Band: 600 bp; Resistant 300 
bp ................................................................................................................................ 86 
 
Plate 5. 3: PCR amplification products of Ty-3 gene obtained from 21 accessions of tomato 
germplasm using P6-25F/R primer pair. Lanes: 1= C-1, 2=C-2, 3=BG9, 4=G5, 5=W, 
6=G153, 7=N, 8=G121, 9=R, 10=G9, 11= D1, 12=D2, 13=D4, 14=D3, 15=A, 16=B, 
17=S1, 18=S2, 19=TH, 20=LT, 21=D5; M=2- Log DNA ladder; -Ve = Negative 
control (sterile nuclease free water), +Ve = Positive control (B);. Susceptible Band: 
320 bp; Resistant: 450 bp ........................................................................................... 87 
 
Plate 5. 4: PCR amplification products of ty-5 gene obtained from 16 accessions of tomato 
germplasm using F/R primer pair. Lanes: 1= C-1, 2=C-2, 3=G9, 4=G5, 5=W, 6=G153, 
7=LA3473 P1, 8=LA3473 P2, 9=L14440 P1, 10=GLA14440 P2, 11= D1, 12=D2, 
13=D3, 14=D4, 15=A; M=2- Log DNA ladder; -Ve = Negative control (sterile 
nuclease free water). Susceptible: 170 bp; Resistant: 175 bp .................................... 87 
 
Plate 5. 5: PCR amplification products of Ty-6 gene obtained from 21 accessions of tomato 
germplasm using SLM10-46 F/R primer pair. Lanes: 1= C-1, 2=C-2, 3=BG9, 4=G5, 
5=W, 6=G153, 7=N, 8=G121, 9=R, 10=G9, 11= D1, 12=D2, 13=D4, 14=D3, 15=A, 
16=B, 17=S1, 18=S2, 19=TH, 20=LT, 21=D5; M=2- Log DNA ladder; -Ve = Negative 
control (sterile nuclease free water); +Ve = Positive control (B). Susceptible: 220 bp; 
Resistant: 255 bp ........................................................................................................ 88 
 
Plate 5. 6: PCR amplification products of TYLCV DNA from 21 tomato accessions using 
AV494/AC1048F/R primer pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 6=D6, 
7=D5, N=8, 9=G48, 10=G153, 11=121, 12=TH, 13=A, 14=G9, 15=W, 16=B, 17= R, 
18=S1, 19= G5, 20=D9, 21=D8;  M=2- Log DNA ladder; -Ve = Negative control 
(sterile nuclease free water) ........................................................................................ 96 
 
Plate 5. 7: PCR amplification products of TYLCV DNA from 21 tomato accessions using 
PTYv787/PTYc1121 F/R primer pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 
6=D6, 7=D5, N=8, 9=S2, 10=G153, 11=121, 12=TH, 13=A, 14=G9, 15=W, 16=B, 
17= R, 18=S1,19= G5, 20=D9, 21=D8; M=2- Log DNA ladder; +Ve = Positive control 
obtained from infected sample from farmers’ field in Akumadan ............................. 97 
xii 
 
University of Ghana http://ugspace.ug.edu.gh
 
Plate 5. 8:  PCR amplification products of TYLCV DNA from 21 tomato accessions using 
GHF/GHR primer pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 6=D6, 7=D5, 
N=8, 9=S2, 10=G153, 11=121, 12=TH, 13=A, 14=G9, 15=W, 16=B, 17= R, 18=S1, 
19=G5, 20=D9, 21=D8;  M=2- Log DNA ladder; -Ve = Negative control (sterile 
nuclease free water). ................................................................................................... 97 
 
Plate 5. 9: PCR amplification products of TYLCV DNA from 21 tomato accessions using 
AV494/AC1048 F/R primer pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 6=D6, 
7=D5, N=8, 9=S2, 10=G153, 11=121, 12=TH, 13=A, 14=G9, 15=W, 16=B ........... 98 
 
Plate 5. 10: PCR amplification products of TYLCV DNA from 21 tomato germplasm using 
AV494/AC1048F/R primer pair.  Lanes: 17= R, 18=S1, 19= G5, 20=D9, 21=D8; 
M=2- Log DNA ladder; +Ve = Positive control obtained from infected samples from 
farmers’ field in Akumadan. ...................................................................................... 98 
 
Plate 5. 11: PCR amplification products of TYLCV DNA from 21 tomato germplasm using 
PTYv787/PTYc1121 F/R primer pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 
6=D6, 7=D5, N=8, 9=S2, 10=G153, 11=121, 12=Th, 13=A, 14=G9, 15=W, 16=B, 
17= R, 18=S1, G5, 20=D9, 21=D8; M=2- Log DNA ladder; +Ve = Positive control 
obtained from infected sample from farmers’ field in Akumadan; -Ve = Negative 
control (sterile nuclease free water). .......................................................................... 99 
 
Plate 6. 1: PCR amplification products of Ty-2 gene obtained from F1 hybrids using P1-16 F/R 
primer pair. Lanes: (a) 1-8 = C-1 x D4,  9-12 = C-2 x D4; (b) 1-4 = C-2 x D4, 5-9 = 
G9 x D4, 10-17 = W x D4, 18-20 = R x D4; (c) 1-5 = D4 = AVTO1429 (Resistant 
Male Parent)   C-1= Power Rano and C-2 = Peto Mech (Susceptible Female Parents ); 
M=100 kb DNA ladder. Susceptible Band: 600 bp, Resistant 300 bp ..................... 109 
 
Plate 6. 2: PCR amplification products of Ty-3 gene obtained from F1 hybrids using P6-25 F/R 
primer pair. Lanes: (a) 1-8 = C-1 x D4,  9-13 = C-2 x D4; (b) 1-3 = C-2 x D4, 4-8 = 
G9 x D4, 9-14 = W x D4; (c) 1-2 = W  x D4, 3-9 = R x D4,  D4 = AVTO1429 (Resistant 
Male Parent)   C-1= Power Rano and  C-2 = Peto Mech (Susceptible Female Parents 
); M=100 kb DNA ladder. Susceptible Band: 320 bp, Resistant 420 bp ................. 110 
 
Plate 6. 3:  PCR amplification products of ty-5 gene obtained from F1 hybrids using TM273 
F/R primer pair. Lanes: (a) 1-8 = C-1 x G5,  9-15 = C-2 x G5, 16-19 = G9 x G5; (b) 1-
4 = G9 x G5, 5-9 = W x G5, 10-12 = R  x G5; (c) 1-6 = R x G5,  G5 = Pimplifolium 
(Resistant Male Parent)   C-1= Power Rano and C-2 = Peto Mech  (Susceptible Female 
Parents ); M=2- Log DNA ladder. Susceptible Band: 175 bp, Resistant 230 bp ..... 110 
 
 
 
xiii 
 
University of Ghana http://ugspace.ug.edu.gh
LIST OF TABLES 
Table 2. 1: Primers and sequences for amplification of TYLCV DNA ...................................... 23 
 
Table 2. 2 Primers and sequences for amplification of TYLCV DNA ....................................... 24 
 
Table 3. 1: Gender, age and educational background of tomato farmers from six tomato 
producing communities in Ghana………………………………….……………36 
 
Table 3. 2: Number of years of experience in tomato farming and size of farm owned by                 
tomato farmers in six tomato-farming communities in Ghana ...................................... 37 
 
Table 3. 3: Perception of tomato farmers of the key production constraints in six farming 
communities in Ghana ........................................................................................................ 40 
 
Table 3. 4: Perception of tomato farmers of the importance of weeds and insect pests as 
constraints to tomato cultivation in three Regions in Ghana ......................................... 40 
 
Table 3. 5: Perception of tomato farmers of the importance of diseases of tomato in Ashanti, 
Brong-Ahafo and Upper East Regions of Ghana ............................................................ 41 
 
Table 3. 6: Farmers’ knowledge of the vector of Tomato Yellow Leaf Curl Disease in six 
tomato farming communities in Ghana ............................................................................ 42 
 
Table 3. 7: Farmers’ knowledge of the symptoms expression of Tomato Yellow Leaf Curl 
Disease on stem of tomato plant in six tomato farming communities in Ghana ......... 44 
 
Table 3. 8: Farmers’ perception of the period of first symptom expression in tomato to TYLCD 
infection in the field ............................................................................................................ 45 
 
Table 3. 9 Measures adopted by farmers to control TYLCD ....................................................... 47 
 
Table 3. 10: Farmers ranking of preferred traits that must be considered in breeding for a new 
tomato variety....................................................................................................................... 49 
 
Table 3. 11: TYLCD incidence and severity scores in six tomato farming communities in 
Ghana based on a rapid field survey ................................................................................. 49 
 
Table 4. 1: Distribution of descriptor of qualitative traits of tomato germplasm……………59 
 
xiv 
 
University of Ghana http://ugspace.ug.edu.gh
Table 4. 2: Mean square for various traits used in comparing 123 tomato genotypes .............. 60 
 
Table 4. 3: Ranges of reproductive, yield component and fruit quality traits of 26 0f 123 tomato 
germplasm. ........................................................................................................................... 62 
 
Table 4. 4: Eigenvalues and cumulative proportion due to thirteen phenotypic traits studied 
among 123 tomato genotypes ............................................................................................ 63 
 
Table 4. 5: Contribution of traits to total variation accounted for by the first five principal 
components following analyses of 123 tomato varieties in the field ............................ 63 
 
Table 4. 6: Class attributes obtained from the hierarchical cluster analyses among 123 tomato 
accessions among 123 tomato accessions based on 13 traits in a field evaluation. 
…………………………………………………………………………………...…..66 
 
Table 4. 7: Range of key descriptive statistics for measuring informativeness of 48 of the 338 
SNPs markers based on 96 tomato accessions of Ghanaian and Exotic origin ........... 68 
 
Table 4. 8: Level of heterozygosity of 82 tomato accessions genotyped with 338 SNP markers
 ................................................................................................................................................ 70 
 
Table 4. 9: Mean square for 123 accessions based on 338 SNP markers. .................................. 71 
 
Table 4. 10: Percentage of variation explained by the first 3 axes that explained variation among 
123 tomato accessions based on 338 SNP markers ........................................................ 71 
 
Table 4. 11: Percentage of variation explained by the first 3 principal components for 
association between 348 SNPs and Fruit shape at blossom end ................................... 73 
 
Table 5. 1: List of primers used in the amplification of TYLCD resistance genes……..……80 
 
Table 5. 2: List of Accessions used for detection of known TYLCD screening in Ashanti and 
Upper East Region ............................................................................................................... 81 
 
Table 5. 3: PCR conditions for primers used in the amplification of TYLCD resistance genes.
 ................................................................................................................................................ 82 
 
Table 5. 4 Primers used in the amplification of TYLCV in infected samples. .......................... 84 
 
Table 5. 5: Shows the incidence of TYLCD on tomato at 30 DATS, 45 DAT and 60 DAT at 
Akumadan. ............................................................................................................................ 90 
xv 
 
University of Ghana http://ugspace.ug.edu.gh
Table 5. 6: TYLCD severity on tomato at 30 DATS, 45 DAT and 60 DAT at Akumadan and 
vea .......................................................................................................................................... 92 
 
Table 5. 7  Means of yield and yield component traits of evaluated tomato genotypes in 
Akumadan ............................................................................................................................. 94 
 
Table 5. 8 Means of yield and yield component traits of evaluated tomato genotypes in 
Vea…………………………………………………………………………………………..95 
 
Table 5. 9 Scores of 5 TYLCV detection primers in 21 tomato genotypes.............................. 100 
 
Table 6. 1: Primers used for the Amplification of TYLCD resistance genes in tomato leaf 
samples……………………………………………………………………..……106 
 
Table 6. 2: PCR conditions for primers used the amplification of TYLCD resistance genes.
 .............................................................................................................................................. 106 
 
Table 6. 3: Mean squares for vegetative, reproductive traits and fruit quality traits for the 20 
tomato hybrids and 9 parents evaluated.......................................................................... 112 
 
Table 6. 4: Mean squares for combining ability for vegetative, reproductive and yield 
component traits studied among parents and F1 hybrids. ............................................. 114 
 
Table 6. 5: Mean square for combining ability for fruit quality traits studied among parents and 
F1 hybrids. .......................................................................................................................... 114 
 
Table 6. 6: GCA effects for male and female parents for vegetative, reproductive, yield 
component and fruit quality traits in tomato .................................................................. 116 
 
Table 6. 7: Specific combining ability effects for vegetative and reproductive traits studied in 
tomato .................................................................................................................................. 118 
 
Table 6. 8:  Mean performances of parents and the F1s evaluated for vegetative reproductive, 
yield and fruit quality traits .............................................................................................. 121 
 
Table 6. 9: Mid parent and better heterosis of 20 F1 hybrids evaluated for vegetative, 
reproductive, yield and yield component traits in tomato ............................................ 122 
 
Table 6. 10: Mid parent and better heterosis of 20 F1 hybrids evaluated for yield and fruit quality 
traits in tomato ................................................................................................................... 123 
 
xvi 
 
University of Ghana http://ugspace.ug.edu.gh
Table 7. 1: Segregation pattern of 38 F2 plants for obtained from Power Rano x AVTO1429 segregating 
for Ty-2 genes ...................................................................................................................... 129 
 
Table 7. 2: Segregation pattern of 38 F2 plants for obtained from Power Rano x AVTO1429 segregating 
for Ty-3 ................................................................................................................................. 129 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
xvii 
 
University of Ghana http://ugspace.ug.edu.gh
LIST OF ABBREVIATIONS 
AEA Agricultural Extension Agents 
AFLP Amplified Fragment Length Polymorphism 
ANOVA Analysis of Variance 
AVRDC World Vegetable Centre 
BNARI Biotechnology and Nuclear Agriculture Research Institute 
CSIR Centre for Scientific and Industrial Research 
DNA Deoxyribonucleic Acid 
F1 First Filial Generation 
F2 Second Filial Generation 
FAOSTAT Food and Agriculture Organization Statistical Database 
FGD Focal Group Discussion 
FOFCREC Forest and Horticultural Crops Research Centre 
GCA General Combining Ability 
IPGRRI International Plant Genetic Resources Institute 
KNUST Kwame Nkrumah University of Science and Technology 
MAS  Marker Assisted Selection 
MoFA Ministry of Food and Agriculture 
PCA  Principal Component Analysis 
PCoA Principal Coordinate Analysis 
PCR Polymerase Chain Reaction 
PIC Polymorphic Information Content 
PRA Participatory Rural Appraisal 
QTL Quantitative Trait Loci 
RAPD Random Amplified Polymorphic DNA  
xviii 
 
University of Ghana http://ugspace.ug.edu.gh
RELP Restriction Fragment Length Polymorphism 
SCA Specific Combining Ability 
SNP Single Nucleotide Polymorphism 
SolCAP Solanaceae Coordinated Agricultural Project 
SSR Simple Sequence Repeats 
TAS-ELISA Triple Antibody Sandwich and Enzyme-linked Immunosorbent Assay 
TGRC Tomato Genetic Research Centre 
ToMoV Tomato Mosaic Virus 
TYLCAxV Yellow Leaf Curl Axarquia Virus  
TYLCD Tomato Yellow Leaf Curl Disease 
TYLCGHV Tomato Yellow Leaf Curl Ghana Virus 
TYLCKV Tomato Yellow Leaf Curl Kumasi Virus 
TYLCMLV Yellow Leaf Curl Mali Virus  
TYLCSDV) Tomato Yellow Leaf Curl Sudan Virus 
TYLCSV Yellow Leaf Curl Sardinia Virus 
TYLCV Tomato Yellow Leaf Curl Virus 
TYLCVMaIV Tomato Yellow Leaf Curl Malaga Virus 
UC University of California 
UPOV International Union for the Protection of New Varieties of Plants 
WACCI West Africa Centre for Crop Improvement 
  
 
 
 
xix 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER ONE 
1. GENERAL INTRODUCTION 
Tomato (Solanum lycopersicum, L.) belongs to the family Solanaceae. It is the most important 
vegetable in Africa but the second most important vegetable in the world after potato 
(FAOSTAT, 2016). Tomato originated from South America and was domesticated in Central 
America (Bhattarai et al., 2018). Tomato was introduced to Ghana between the 16th and 17th 
century and has since then become the most important vegetable in Ghana (Norman (1992). It 
also contributes significantly to the livelihood improvement of those involved in its production 
(Horna et al., 2006).  
Tomato production in Africa stands at 19.79 million tonnes with an average yield of 15.59 
tonnes per hectare. Comparatively, total tomato production in Ghana is approximately 366,772 
tonnes with an average yield of 7.8 tonnes per hectare (FAOSTAT, 2016). 
In Ghana, tomato production is seasonal and highly rain-fed (Osei et al., 2013). During the 
rainy season, the Ashanti and Brong Ahafo Regions supply the bulk of the tomato consumed. 
Harvest is abundant and most of the tomatoes are wasted due to poor shelf life. As a result, 
prices are generally low and this serves as a disincentive to tomato farmers. The tomato 
produced in these areas are poor in colour, acidic and watery; making them less suitable for 
industrial processing (Robinson and Kolavalli, 2010).  
Tomato production in the dry season does not meet the high demand. Local production is 
augmented by fresh tomato importation from Burkina Faso (Horna et al., 2006). This low 
production is attributed to biotic and abiotic stresses. One of the most important biotic stresses 
is the Tomato Yellow Leaf Curl Disease (TYLCD) caused by the whitefly-transmitted Tomato 
Yellow Leaf Curl Virus (Horna et al., 2006; Osei et al., 2012). 
 
 
University of Ghana http://ugspace.ug.edu.gh
The first epidemics of TYLCD was reported in 1960 and led to total yield loss in tomato 
growing areas in Israel (Cohen et al., 1961). The TYLCD caused severe damage in the Eastern  
Mediterranean Basin, North and Central Africa, Southeast East Asia, Southern Europe and 
Central America (Pico et al., 1996). In West Africa, TYLCD has been threatening tomato 
production for many years and this had led to farmers in the TYLCD hotspots to misuse 
chemicals or abandon production during disease peak periods (Dagnoko et al., 2011). In Ghana, 
TYLCD was reported to drastically affect tomato production during the dry season and could 
lead to total yield loss (Osei et al., 2012). A complex of fungal and viral diseases was a major 
problem to tomato production in Upper East Region in 2002 (Horna et al., 2006). In 2014, 
farmers in the Agotime-Ziope District of the Volta region were reported to have lost virtually 
all their investment following the TYLCD infection of over 1,000 hectares of tomato farms in 
the area (Duodo, 2014). 
Over the years, cultural, chemical and physical approaches have been used to control TYLCD, 
but with limited success. The best strategy to combat TYLCD is to breed for Tomato Yellow 
Leaf Curl Disease resistance. The wild tomato relatives served as source of TYLCD resistance 
since no resistance gene was identified Solamum lycopersicum (Pico et al., 1996). Breeding for 
resistance involves either introducing the disease resistance genes from wild tomato species 
into cultivated tomato (Pilowsky and Cohen, 1990) or the transgene strategy; introducing viral 
genes into cultivated tomato (Kunik et al. 1994). The past three and half decades have been 
devoted to development of TYLCD-resistant cultivars through the identification of resistant 
sources, generation of single gene resistant breeding lines and identification of molecular 
markers linked to resistance genes (Gordon, 2009).  Six TYLCD resistance genes Ty1/3, Ty-1, 
Ty-2, Ty-4 ty-5 and Ty-6 have been identified and currently, the focus is on pyramiding of 
multiple TYLCD resistance genes into single cultivars (Hanson et al., 2016).   
2 
 
University of Ghana http://ugspace.ug.edu.gh
In Ghana, there has been little effort devoted to the development of improved tomato varieties. 
Past breeding programmes focused on evaluation and screening of exotic and local cultivars 
for fruit quality (Blay et al., 1999; Gongolee 2014) and TYLCD resistance. Most of the exotic 
cultivars have better fruit quality but are susceptible to TYLCD. The local cultivars, 
Pimpinellifolium and its derivatives tend to be tolerant to the TYLCD at various locations (Osei 
et al., 2013; Asare-Bediako et al., 2017 and Segbefia et al., 2018). However, crosses between 
Pimpinellifolium and Roma, Wosowoso and Chery tomato resulted in fruits that were tiny and 
unsuitable for the fresh market (Segbefia et al., 2015).  
To lessen the impact of TYLCD on tomato production in Ghana, it will be necessary to identify 
which of the TYLCD resistance genes in elite breeding lines will be effective against the local 
strains of TYLCV in Ghana. This could be followed by Marker Assisted Selection (MAS) of 
lines that combine both fruit quality with TYLCD resistance genes.   
The development of tomato lines with high fruit yield and desirable fruit quality for fresh 
market as well as tolerant to TYLCD were major considerations in this study. In this regard, 
the main research objective was to introgress TYLCD resistance genes into farmer-preferred 
tomato cultivars in Ghana.  
The specific objectives of the study were to: 
1. identify production constraints and farmers’ preferred traits of tomato cultivars; 
2. identify accessions with superior fruit and yield-related traits;  
3. determine genetic diversity of tomato germplasm in Ghana; 
4.  identify local and exotic tomato germplasm with TYLCD resistance to Ghanaian 
isolates of Tomato Yellow Leaf Curl Virus (TYLCV); and   
5.  identify F2 plants with homozygous TYLCD resistance gene loci. 
 
3 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER TWO 
2.0 LITERATURE REVIEW 
2.1 Biology of tomato 
2.1.1 Origin and domestication of tomato 
 
The wild relatives of cultivated tomato (Solanum lycopersicum L.) originated from Western 
South America from northern Ecuador, through Peru, to northern Chile and in Galapagos Island 
(Peralta and Spooner, 2007). According to Rick and Holle (1990), the closest ancestor of 
cultivated tomato is the wild cherry tomato (S. lycopersicum var. cerasiforme). 
Over the years, wild tomatoes have been domesticated through intensive selection and plant 
breeding. Two hypotheses have been propounded for the original site of tomato domestication; 
one stipulates Peru (de Candolle 1882) and the other Mexico. It is, however, presumed that 
Mexico is probably the site of domestication and Peru is the centre of diversity (Larry et al., 
2007). The first hypothesis was based on botanical evidence complemented with linguistic, 
historical aspects (Luckwill, 1943) and recently molecular studies (Nesbitt and Tanksley, 
2002). The second hypothesis is supported by the evidence of pre-Columbian cultivation in 
Mexico but no evidence in South America. This is further supported by the argument that the 
name tomato comes most probably from the Mexican Nahua peoples’ word ‘Tomatl’ which 
describes ‘plants bearing globous and juicy fruit (Sahagún, 1988). The biloculed domesticated 
forms found in south Mexico and Guatemala are the oldest cultivated types (Harlan, 1971).  
Tomato is not an indigenous crop in West Africa; it was introduced to Africa in the 16th century 
by European merchants and has since been integrated into various dishes. Tomato cultivation 
in West Africa was documented in 1898 and by 1920s, tomato was sold in local markets (Tew, 
1920). Norman (1992) asserts that tomato was introduced to Ghana between the 16th and 20th 
century and has since become an important component of most Ghanaian meal. 
4 
 
University of Ghana http://ugspace.ug.edu.gh
2.1.2 Taxonomy of tomato 
 
Galen, a Greek naturalist in the 14th century named a plant that was unknown as Lycopersicon, 
which means ‘wolf peach’. When tomato was first introduced into Europe in the 16th century, 
early European botanist recognized the close relationship of tomato with the genus Solanum 
and commonly referred to them as S. pomiferum (Luckwill, 1943). However, Anguillara (1561) 
identified the newly introduced tomato as the plant named Lycopersicon by Galan, hence 
Tournefort (1694) considered cultivated tomato to be within the distinct genus Lycopersicon 
and used the multilocular nature of the tomato fruit to distinguish Lycopersicon from Solanum. 
In the following century, Linnaeus (1753) classified tomato into the genus Solanum and under 
the specific name Solanum lycopersicum. Miller (1754) agreed with Tournefort’s classification 
and officially described the genus Lycopersicon. Jessieu (1789) included tomato in the genus 
Solanum. In addition, Linnaeus described a second wild species from Peru, S. peruvianum 
(Jessieu, 1789). The classification of tomato under Lycperisicon continues until the 1990s 
(Rick et al., 1990).  
With the advent of molecular tools, the phylogenetic relationships within the Solanaceae were 
examined and Spooner et al. (1993) examined the outgroup relationship of tomato and other 
members of the Solanaceae based on chloroplast DNA restriction site data. Further molecular 
studies confirmed that tomato is in the genus Solanum lycopersicum (Peralta and Spooner 
2001). Taken into consideration the morphological characters, phylogenetic relationships and 
geographical distribution, thirteen species of wild tomato including the cultivated tomato 
(Solanum lycopersicum L.) and four closely related species have been grouped as part of the 
tomato clade. 
 
 
5 
 
University of Ghana http://ugspace.ug.edu.gh
2.2 Climatic and soil conditions for tomato production 
The countries with higher yields do not have ideal conditions for tomato production, neither do 
they devote more land for tomato production. These countries largely produce tomato under 
greenhouse conditions (Peralta and Spooner, 2001). 
Tomato requires a minimum of 8 hours of continuous sunlight per day, 3 to 4 months of warm, 
clear and fairly dry weather to produce the best of fruits. The optimum temperature ranges for 
tomato growth range from 21 to 27 oC (Van Dam, 2005). The night temperature requirement 
of tomato falls between 12.8 oC and 23 oC to set fruits. Beyond night temperatures of 29 oC 
there will be poor color development in tomato. High temperature above 32 oC adversely affect 
flower formation, fruit setting, vegetative growth development and yield (Berry and Rafique-
Ud-Din, 1988). Growth totally ceases when temperatures are over 34.7 oC throughout the day. 
Tomato requires loose, well-drained soil but will grow in any garden soil. The ideal soil type 
for early tomato variety is sandy loam while clay loam is suitable for late varieties. The 
optimum soil pH for tomato growth is between 6.0 and 7.0. The soil should be evenly moist 
with regular supply of water and maintained at about 60% field capacity (Tran, 2005). 
2.3 Economic importance of tomato 
Tomato is the second most important vegetable in the world based on area under cultivation as 
well as income generation (FAOSTAT, 2016). Tomato is consumed raw or processed into 
various forms such as paste, puree, juices and whole peeled tomato. It is an important source 
of various nutrients. Fresh tomato is composed of vitamin A and C, minerals, high amount of 
water and low calories. The stage of maturity of tomato fruits affect the vitamin A content of 
the fruit. Tomato is also an important source of carotenoids (Wilcox et al., 2003) and lycopene; 
a natural antioxidant (Shih et al., 2004). 
6 
 
University of Ghana http://ugspace.ug.edu.gh
The five leading producers of tomato in the world are China, India, United States of America, 
Turkey and Egypt. The world tomato production in 2014 was 177 million tonnes with average 
yield of 37 tonnes per hectare (FAOSTAT, 2016).  
 Tomato is the most important vegetable in Ghana (Osei et al., 2008). It is an indispensable 
nutrient in most Ghanaian dishes (Tambo and Gbemu, 2010). Tomato production in Ghana 
presented a huge opportunity for economic growth and this has led to increased production as 
well as the establishment of tomato processing factories across the country. By 1968, three 
stated-owned tomato factories were established in Ghana. These three tomato processing 
factories were located in Pwalugu (Northern belt), Wenchi (middle belt) and Nsawam 
(Southern belt). The highest average yield recorded in Ghana’s history was 10.2 t/ha in 1996 
and 1998 while the lowest recorded yield was 3.8 t/ha in 2005. As of 2016, the average tomato 
yield was about 7.8 t/ha and production was 366,772 tonnes (FAOSTAT, 2016). Tomato 
production in the country was further enhanced by the completion of the Tono dam in 1985 
which served an area of 24,000 hectares for growing crops.  
 
2.4 Constraints to tomato production 
Tomato production is faced with many challenges throughout the world. The constraints 
encompass adaptability, fruit quality, biotic and abiotic stresses. In Ghana, tomato cultivars 
mostly grown have poor colour, poor shelf life and watery (Robinson and Kolavalli, 2010). 
Abiotic constraints include inadequate irrigation facilities and high temperature (Horna et al., 
2008). Among the biotic constraints of tomato production, pests and diseases are the most 
devastating. Throughout the world, the three most important diseases of tomato are Tomato 
Yellow Leaf Curl Virus Disease (TYLCD) caused by Begomoviruses, late blight caused by 
Phytopthora infestans and bacterial wilt caused by Rastonia solanacearum. These diseases are 
very important because the pathogens responsible for them are genetically diverse and frequent 
7 
 
University of Ghana http://ugspace.ug.edu.gh
mutation gives rise to new forms. Various resistance genes have been identified and 
introgressed into commercial cultivars (Hanson et al., 2016). Among these three most 
important diseases, TYLCD is the most devastating tomato disease in Ghana. Breeding to 
address these major constraints in tomato production usually commences with characterization 
of existing germplasm (Ziaf et al, 2016) for adaptability, fruit quality or disease resistance. 
2.5 Diversity in tomato 
Tomato is a diploid (2n=24), however, Rick (1976) reported some spontaneous tetraploids. The 
genetics of tomato has been extensively studied over a century ago and this has resulted in a 
deeper understanding of the genetics, breeding and evolution. Originally, tomatoes were pea-
sized berries but domestication and plant breeding have resulted in increased fruit sizes (Soyk 
et al., 2017). The genetic variation within cultivated tomato is about 5% (Miller and Tanksley 
1990).  Nonetheless, there has been constant interspecific hybridization in tomato breeding and 
this has resulted in higher genetic distance and greater allelic richness in contemporary 
cultivated varieties compared to landraces and vintage varieties. In addition, breeding for 
market specialization and fruit characteristics has resulted in genetic differentiation within 
contemporary varieties (Sim et al., 2011). Initially, introgressing agronomic traits from the 
wild into cultivated tomato had challenges such as linkage between favourable and 
unfavourable effects of introgressed fragments. However, with the advent of molecular biology 
in the 80’s, significant progress has been made in characterizing the genetic diversity in both 
wild and cultivated tomato as well as intraspecific and interspecific hybridization.  
2.6 Estimation of genetic diversity in tomato 
Through domestication and artificial selection, the genomic compositions and population 
structure of available germplasm resources have changed (Huang et al. 2012). This variability 
has been standardized in the International Plant Genetic Resources Institute (IPGRI, 1996) 
8 
 
University of Ghana http://ugspace.ug.edu.gh
tomato descriptor and the International Union for Protection of New Varieties of Plants 
(UPOV, 2011) tomato descriptor.  The classification and standardized evaluation take into 
consideration several morphological attributes such as fruit weight, fruit shape and colour 
(Paran and Van Der Knaap, 2007), physico-chemical, sensory quality and nutritional 
composition. 
In-depth analysis of population structure is a prerequisite for any breeding programme in order 
to get targeted improvement in the traits. Understanding genetic variation is important for 
genetic resource conservation and breeding programmes. Estimation of diversity in germplasm 
can be carried out in various ways such as evaluation of phenotypic variation or morphological 
characterization, biochemical characterization and molecular characterization. 
2.6.1 Morphological characterization of tomato 
Morphological characterization is a simple technique of quantifying genetic variability. 
Nonetheless, both morphological and biochemical characterizations are not much reliable due 
to genotype by environment interaction. 
Availability of diverse germplasm, as well as characterization of diverse germplasm, is a 
prerequisite for any breeding programme (Ziaf et al., 2016). Cultivated tomato has a very 
limited genetic variability compared to its wide relative (Miller and Tanksley, 1990) and this 
makes it difficult to identify polymorphisms between elite germplasm (Sim et al., 2009). It has 
also been reported that the diversity of cultivated tomato has been reduced over the past decades 
due to the disappearance of local varieties (Yi et al., 2008) and the breeding for market 
specializations as well as geographic adaptations (Sim et al., 2011). Initially, genetic variation 
studies focused on the differences between the wild species and cultivated varieties. Recent 
studies have focused on the variations within modern varieties (Corrado et al., 2013). 
9 
 
University of Ghana http://ugspace.ug.edu.gh
 Genetic variation in wild species has been a source of fruit quality trait, disease and insects 
resistance in modern plant breeding programmes (Rick and Chetelat, 1995). Understanding the 
genetic diversity is very significant in plant breeding applications (Mohammadi and Prasanna, 
2003) such as analysis of genetic variability in cultivars (Smith, 1988), identification of 
parental combinations needed for generating segregating populations with maximum genetic 
variability for further selection (Barrett and Kidwell, 1998) and introgression of desirable genes 
from diverse germplasm into available genetic base (Thompson and Nelson, 1998). To develop 
desired tomato cultivars, it is necessary to catalogue genetic variability within the available 
germplasm (Islam et al., 2004).  
 2.6.2 Molecular characterization of tomato 
Molecular characterization is preferred due the ubiquitousness, repeatability, stability and the 
high reliability of this method. Molecular characterization is not affected by the environment 
and exhibits higher levels of polymorphism. Over the years, molecular markers developed and 
used for characterization and variety identification included Restriction Fragment Length 
Polymorphism (RELP), Random Amplified Polymorphic DNA (RAPD), Amplified Fragment 
Length Polymorphism (AFLP), Simple Sequence Repeats (SSRs) and Single Nucleotide 
Polymorphisms (SNPs).  
Molecular techniques have been utilized to pinpoint genomic regions of specific traits.  Genetic 
control of complex traits has been understood using ad hoc techniques which have led to the 
identification of key alleles controlling diverse agronomic traits originating from the wild. 
Presently, the knowledge of the diversity in the tomato has been enhanced with the full 
sequence of the tomato genome, the emergence of omics and next generation sequencing 
techniques. Employing QTL mapping technique in natural populations or genome-wide 
association studies facilitates the genetic characterization of complex traits and germplasm 
management in both wild and cultivated tomato. Several breeders have studied genetic 
10 
 
University of Ghana http://ugspace.ug.edu.gh
diversity in tomato germplasm for improvement of various growth and yield-related traits (Blay 
et al., 1999; Saleem et al., 2015).  
2.7 Improving tomato for yield and fruit quality traits 
Over the years, tomato breeding activities have focused on improving fruit quality and or 
breeding for stress tolerance. Understanding the genetic and molecular diversity for fruit 
quality, yield and yield component parameters are important for selecting diverse parents.  
Most fruit quality characteristics that have been researched include size, shape, total solids or 
brix, pH, colour, firmness, ripening, nutritional quality and flavor. Fruit colour is of much 
importance to the fresh market and this is on the rise because of the increasing awareness of 
the health benefits of carotenoids. Total solids have been extensively worked on because of its 
importance to the processing industry. In general, fruit shape is a quantitatively inherited trait 
and it involves 4 to 17 loci (Gonzalo and van der Knaap, 2008). However, elongated fruit shape 
and blockiness in tomato is controlled by only one major locus (Grandillo et al., 1996). 
Elongated fruit shape and blockiness are preferred for processing (van der Knaap and Tanksley, 
2003) since these traits prevent the fruit from rolling off the conveyer belts (Visa et al., 2014). 
Blockiness can be at stem-end or blossom-end. Blossom-end blockiness was strongly 
correlated with fruit size (van der Knaap and Tanksley, 2003).  Stem-end blockiness was 
reported to be controlled by the same loci that controlled heart shape and both are strongly 
correlated (van der Knaap and Tanksley, 2003). Cultivated tomatoes vary in sizes which range 
from 5 mm in tom berries and 1-2cm in cherry tomato to 10 cm or more in diameter (beef 
steak). Due to market specialization commercial varieties are typically 5-6 cm in diameter 
(Patil, 2015). Fruit, shape and size are affected pleiotropically by locule number (Rodriguez et 
al., 2011). The shelf life of tomato is very important for transportation, marketing and domestic 
use. Shelf life is controlled by both genetic and environmental factors particularly temperature. 
11 
 
University of Ghana http://ugspace.ug.edu.gh
Besides biochemical changes, fruit firmness, number of locules per fruit, fruit pericarp 
thickness influence the shelf life of tomato (Bekov, 1968). 
Improvement of tomato fruit quality in Ghana commenced in the 1950s when cultivars such as 
OK, MH series (Mc Ewen, 1961) and Wosowoso (Schippers, 2000) were developed. Agble 
(1978) began breeding for processing quality traits, shelf life and heat tolerance by making 
crosses between local accessions with heat tolerance and exotic accessions with nonripening 
gene (norA). Nevertheless, due to lack of continuity, no variety was released despite the positive 
outlook (Orchard and Suglo, 1999). 
In addition, between 1994 and 2000, a research team led by the National Research Institute 
(NRI) in the UK focused on pure line selection of local landraces in the Brong Ahafo Region 
of Ghana with the ultimate aim of releasing pure strains of good open-pollinated varieties. Six 
varieties consisting of three local and three introduced varieties were used in that study. These 
varieties were selected based on farmers and traders preferred traits (fruit quality, good taste 
and longer shelf life). A tomato breeder seed production trial was then established at Wa in the 
Upper West Region with five selected varieties. The research was not very successful because 
there was no long-term impact due to lack of sustainable seed distribution systems to ensure 
that the resource-poor farmers have access to the developed varieties. Tomato varieties that are 
currently grown by Ghanaian farmers are mostly imported varieties and farmer-selected 
varieties. A very important pure line grown in Ghana particularly in the Brong Ahafo Region 
is the Power Rano (a cross between Power and Laurano varieties) which was identified by the 
NRI researchers in the 1990s based on its good production and local processing qualities 
(Robinson and Kolavalli, 2010).   
12 
 
University of Ghana http://ugspace.ug.edu.gh
However, since the NRI tomato breeding work ended in 2000 there have been no breeding 
programmes and no systematic seed multiplication in the country (Robinson and Kolavalli, 
2010; Osei et al., 2013). 
 
2.8 Tomato Yellow Leaf Curl Disease (TYLCD) 
2.8.1 History of TYLCD 
 
One important stress of tomato that has been focused on extensively is the TYLCD. TYLCD 
has been reported to be the most devastating tomato disease in the tropics and subtropics. It 
affects tomato grown in open fields or greenhouse and caused yield loss up to 100% in many 
countries including Ghana (Polston and Anderson, 1997; Horna et al., 2006; Yongping et al., 
2008).  
It was first reported in the Middle East in 1931 but has since then spread to various parts of the 
world (Czosnek and Laterrot, 1997).  In the 1960s the first epidemic of TYLCD was reported 
in Israel (Urbino et al., 2008). This was followed by a report in Europe (Kheyr-Pour et al., 
1991), Asia (Rochester, et al., 1990), South America, Africa (Harrison et al., 1991) and 
Australia (Dry et al., 1993). TYLCD originated from the Middle East and the symptom was 
first reported in the Jordan Valley in Israel in the late 1920s (Pico et al., 1996). At the time of 
discovery of this disease, the plant growth was characterized by severe stunting, erect shoots, 
small and yellowing of leaves. As the disease progressed, the leaves became chlorotic and 
curled upward. Plants that were affected at an early stage produced no marketable fruits. The 
name Tomato Yellow Leaf Curl Disease (TYLCD) was coined based on the symptom 
expression (Cohen and Harpaz, 1964). By the summer of 1959, there was a serious outbreak 
of the disease that led to total yield loss in tomato growing regions in Israel (Cohen et al., 1961) 
and this devastating loss was strongly correlated with significant increase in whitefly (Bemisia 
13 
 
University of Ghana http://ugspace.ug.edu.gh
tabaci) population. Again, it was noticed that the population of whitefly skyrocketed due to the 
initiation of large-scale cotton cultivation in Jordan and Bet She’an Valleys. The cotton served 
as an alternate host for the white fly (Cohen and Lapidot, 2007). Further laboratory-controlled 
transmission tests confirmed the disease was whitefly vectored and viral in nature (Cohen and 
Harpaz, 1964). Since the causal agent is a virus it was named as Tomato Yellow Leaf Curl 
Virus (TYLCV). By the 1965 TYLCD symptoms were described in some African countries 
such as Sudan and Egypt in 1966 (Makkouk and Laterrot, 1983). By the mid-1970s similar 
virus symptoms were reported in West African countries like Nigeria (Lana and Wilson, 1976) 
and by late 1970s and early 1980s it had spread to Senegal, Cape Verde, Gambia, Mauritania, 
Cote d’Ivoire and Mali (D’hondt and Russo. 1985). The symptoms observed in all these 
countries were not the same but similar. Molecular tools were used to characterize the virus in 
the late 1980s (Navot et al., 1989). It was realized that the different clades of virus species have 
diverged from Mediterranean and African viral species as far back as 130 million years ago 
with the separation of Americas from Gondwana landmass (Seal et al., 2006).  
 
2.8.2 Tomato Yellow Leaf Curl Virus (TYLCV) 
 
TYLCV is a virus from the genus Begomovirus and the family Geminiviridae. Begomoviruses 
are the largest and most economically important genus of the family Geminiviridae (Fauquet 
and Stanley, 2005). The viruses have a wide host range including tomato, tobacco, pepper, 
petunia, melon, watermelon, squash, gourd, common bean, soybean, lima bean, mung bean, 
cowpea, cassava, cotton and okra (Seal et al., 2006). Geminiviruses are characterized by unique 
Gemini shape of fused icosahedral viral particle and the genus consist of viruses with both 
monopartite and bipartite genomes. The TYLCV has a single-stranded circular DNA and a 
genome size of about 2.8 kb (Moriones and Navas-castillo, 2000).  
 
14 
 
University of Ghana http://ugspace.ug.edu.gh
2.8.3 Phylogeny of TYLCV 
 
Phylogenetic studies have determined that TYLCD associated viruses from the Mediterranean 
Basin and northern Sub –Saharan Africa consist of six distinct virus species commonly referred 
to as TYLCV cluster (Abhray et al., 2007). The first TYLCV cluster is Tomato Yellow Leaf 
Curl (TYLCV) – a Mediterranean species first isolated in Israel, the second cluster is Tomato 
Yellow Leaf Curl Sardinia Virus (TYLCSV), a Western Mediterranean species common in 
Italy and Spain. Recombination between TYLCV and TYLCSV has resulted in two viral 
species, Tomato Yellow Leaf Curl Malaga Virus (TYLCVMaIV, Monci et al., 2002) and 
Tomato Yellow Leaf Curl Axarquia Virus (TYLCAxV, Garcia-Andres et al., 2006). The third, 
fourth, and fifth clusters were found in West Africa; Tomato Yellow Leaf Curl Mali Virus 
(TYLCMLV) present in Mali (Dembele and Noussourou, 1991), Ghana (Osei et al., 2008), 
Benin, Burkina Faso, Niger, Senegal and Togo (Chen et al., 2009) as well as Ethiopia (Shih et 
al., 2006). The sixth cluster is the Tomato Yellow Leaf Curl Sudan Virus (TYLCSDV) found 
in Sudan and Yemen (Abhary et al., 2007).  
In addition to the six TYLCV clusters, there are 51 whitefly transmitted tomato virus species 
(Fauquet and Stanley, 2005). 
2.9 Mode of Acquisition and transmission of TYLCV 
The TYLCV is mostly transmitted by the whitefly, Bemisia tabacci biotype B (Gennadius), 
which also belongs to the family Aleyrodidae, and order Hemiptera. Whitefly is also known as 
one of the most important and widely distributed insect pests in the tropics and subtropics 
(Brown et al., 1995).  
Whitefly ranges between 1 to 2 mm in size and is normally found in clusters on the underside 
of the leaves. They are very active during the daytime and are capable of reproducing 
throughout the year in warm climates. The larva and adult whiteflies pick up virus particles 
15 
 
University of Ghana http://ugspace.ug.edu.gh
when feeding on infected plants. It takes 16-35 days for the whitefly to develop from egg to 
adult depending on the temperature. 
With the continuous movement of the adult whitefly and subsequent feeding on susceptible 
healthy plants, the virus is spread from one plant to the other. The whiteflies feed by sucking 
plant juices from the phloem and cause injury to the plant in several ways. Due to the high 
population of whiteflies feeding at the same time, there are normally chlorotic spots at the 
feeding sites on leaf surfaces and the production of a sticky substance known as honeydew. 
The honeydew produced may lead to discoloration of leaves and fungi diseases on the surface 
of the leaves when conditions are favourable.  
Transmission of the virus by the whitefly is in a persistent circular non-propagative manner. 
There has been evidence that TYLCV can be transmitted from infectious males to female or 
vice versa through copulation (but not among insects of the same sex) and subsequently 
transmitted to a tomato plant. It can also be transovarially transmitted to progeny through the 
egg for two generations (Ghanim et al., 1998). This insect to insect transmission can increase 
the population of whiteflies that are able to transmit the virus.  
TYLCV is poorly transmitted by mechanical inoculation and grafting. TYLCV cannot be 
transmitted by contact between plants. Recently, Kil et al (2016) presented the first report of 
TYLCV seed transmission in tomato plants. 
Tomatoes serve as the primary host for the vector. However, there are other alternate hosts like 
cucumbers, cotton, eggplants, potatoes, tobacco, beans, peppers and some weeds among over 
300 species within 63 families (Mound and Halsey, 1978).  
2.10 Breeding for TYLCD resistant varieties  
 Worldwide breeding for TYLCD resistance varieties began in the 1960s and has been based 
on the identification of resistance genes from wild species of tomato and followed by 
16 
 
University of Ghana http://ugspace.ug.edu.gh
introgression of TYLCD resistance genes into cultivated tomato. This is because cultivated 
tomato is inherently susceptible to the viruses (Vidavsky and Czosnek, 1998). However, the 
success has been slow due to the complex genetics of the resistance (Lapidot and Friedmann, 
2002) and the numerous virus strains as well as differences in virulence. Breeding for resistance 
can be achieved by making crosses between wild tomato and cultivated tomato, followed by 
phenotypic or molecular selection of progenies from segregating populations or from 
backcrosses (Barbieri et al., 2010). Progress in developing resistant varieties with the 
conventional approach was slow due to the type of resistance and the different strains of the 
virus causing TYLCD (El-Dougdoug et al., 2013). However, there has been considerable 
progress with the dawn of marker-assisted breeding. The first commercially tolerant cultivar 
was TY-20, with resistance from L. peruvianum. This cultivar was known to show delayed 
symptoms and accumulation of viral DNA (Rom et al., 1993). 
2.10.1 Identification of resistant genes 
 
Depending on the plant source, resistance has been reported to be controlled by one to six genes 
and these genes have been introgressed into cultivated tomato (Ji et al. 2009 and Hanson et al., 
2016). Breeding for TYLCD resistance started with the use of conventional breeding 
techniques. This involved the identification of a source of resistance, usually from the wild 
tomato species. These sources of resistance include S. pimpinellifollium, S. peruvianum, S. 
chilense, S. habrochaites and S. cheesmaniae (Ji et al., 2007a). 
2.10.2 Sources and mapping of TYLCD resistant genes 
 
Most of the TYLCD resistance genes with the exception of Ty-2 and Ty-5 were all derived 
from S. chilense. Ty-1, Ty-3 and Ty-3a genes were derived from S. chilense accessions LA1969, 
LA2779 and LA1932 (Scott et al., 1996; Ji et al., 2007a) respectively. All three (3) genes were 
located on the long arm of chromosome 6 (Zamir et al., 1994). Ty-3 is 15 cM away from Ty-1 
17 
 
University of Ghana http://ugspace.ug.edu.gh
and both genes have been demonstrated to be allelic (Verlaan et al., 2013). LA1932 was the 
donor for Ty-4 but mapped to chromosome 3 (Ji et al. 2009). Recently, Ty-6 was derived from 
LA2779 (also a donor for Ty-3) and mapped to chromosome 10 (Hutton et al., 2012). 
 Ty-2 was derived from S. habrochaites f. glabratum accession B6013 and was mapped to 
chromosome 11 (Hanson et al., 2000, Yang et al., 2014) while ty-5 was mapped to chromosome 
4 (Anbinder et al., 2009) and first derived from a breeding line TY-172; a progeny purported 
to be developed from a cross of four S. peruvianum accessions. Nonetheless, there is an ongoing 
debate as to whether ty-5 originated from S. peruvianum. Recently, it emerged that ty-5 is 
recessively inherited (hence the symbol ty-5).  
 
2.10.3 Effectiveness of TYLCD resistance genes against TYLCD 
 
Ty-1 and Ty-2 genes express complete or nearly complete dominance (Hanson et al., 2000; 
Zamir et al., 1994) and effective against only monopartite TYLCV whereas Ty-3 is incomplete 
dominant or more additive (Ji et al., 2007a) and effective against both TYLCV and the bipartite 
ToMoV (Agrama and Scott, 2006; Ji et al., 2007a). Ty-4 alone is also effective against TYLCV, 
however, combining Ty-3 and Ty-4 had greater resistance than Ty-3 alone in Guatemala (Ji et 
al., 2009).  The resistance of genotypes homozygous for Ty-3 and Ty-4 was significantly higher 
than genotypes with Ty-3 alone, which in turn were significantly more resistant than 
commercial hybrids heterozygous for Ty-1 (Ji et al., 2009). Ty-6 has an additive effect and is 
known to be highly effective with Ty-3 or Ty-5 and it is broadly effective against monopartite 
and bipartite virus. Ty-6 has moderate resistance to TYLCV but high resistance to ToMoV 
(Scott and Hutton, 2015). 
 Ty-1 and Ty-2 are both dominant and provide high levels of resistance to many strains of 
TYLCV, they are widely utilized by breeders. Yet, neither gene is effective against bipartite 
begomoviruses, and the resistance of both genes has been overcome by some strains of TYLCV 
18 
 
University of Ghana http://ugspace.ug.edu.gh
(Ji et al., 2007a). There is evidence, however, that Ty-2 can provide an enhanced level of 
resistance to bipartite begomoviruses when pyramided with Ty-3, potentially making it a more 
attractive tool to breeders. In 2009, scientists at the World Vegetable Center (AVRDC) 
pyramided multiple TYLCD resistance genes into their breeding lines. Various breeders have 
used these breeding lines to develop tomato with resistance against the TYLCD (DFID 
research, 2012). In addition, AVRDC gives high priority to the incorporation of Ty-3 into new 
breeding lines. Their current results from TYLCD screening indicate that Ty-3 reduced tomato 
Yellow Leaf Curl Disease symptom severity but did not prevent virus infection. Similarly, they 
found out that Ty-3 and Ty-2 combination did not eliminate the virus and recommended that 
pyramiding new resistance gene combinations such as Ty-3, ty-5 and Ty-2 should be explored 
(Hanson et al., 2016). 
2.10.4 Populations for marker assisted breeding of TYLCD resistant varieties 
 
Known primers for the various TYLCD resistance genes can be used to screen for 
polymorphism in breeding population to identify lines or plants that carry the resistant genes. 
Field screening in a hot spot or controlled inoculation can also be carried out to identify lines 
or plants that are resistant to TYLCD. 
Primers can be used to determine heterozygous or homozygous loci of a particular Ty gene in 
early generation such as F2 progenies and F3 families derived from marker selected F2 plants 
(Barbieri et al., 2010). This can be supplemented by challenging these populations with 
different isolates of the TYLCV either under controlled environment or in a disease hot spot. 
In pyramiding TYLCD resistance genes, two F2 populations (from a biparental cross) 
segregating for Ty-3 and Ty-2 were used as a base population and then further advanced to F6 
based on disease response and horticultural traits (Prasanna et al., 2015). A three-parent cross 
was used to develop multiple disease resistant lines. TYLCD intensive selection was carried 
19 
 
University of Ghana http://ugspace.ug.edu.gh
out at F1 - F4 generations. Plants identified with MAS were further assessed in the field for 
Tomato Yellow Leaf Curl Disease severity (Hanson et al., 2016).  
2.10.5 Methods of screening lines against TYLCD 
 
The deployment of phenotypic and molecular selection procedures leads to cost-effective and 
speedy development of TYLCD resistance. An efficient phenotypic screening procedure 
validates the marker-assisted selection.  
Various screening procedures for TYLCD resistance have been used over the years; however, 
the choice of screening method would depend on the reliability and cost-effectiveness 
considering the population size. Generally, there are two screening methods namely field 
screening in a disease hotspot and greenhouse or growth room screening method (Controlled 
Environment). 
 Field screening methods should be considered when breeding is done in the region where the 
cultivar will be released and there are established disease hotspots. Greenhouse screening or 
growth room screening permits the screening of materials irrespective of the region where it 
will be released. It only requires the right source of inoculum for the screening process and the 
mimicking of the environmental conditions that will exist in the target region. Greenhouse 
screening enables quick assessing of disease reaction, escape from other pest and diseases, 
reduces sources of environmental variation by the use of the particular pathogen strain and the 
appropriate pathogen concentration (Hanson et al., 2016). 
2.10.5.1 Disease severity rating of TYLCD 
In order to group genotypes on the basis of their level of resistance to TYLCD, several scoring 
scales have been used for TYLCD disease severity. One of the most commonly used is the 
scale developed by Lapidot and Friedman (2002). Severity scores are based on 0 = 4 scale 
where; 0 = No symptoms; 1 = Slight yellowing (mild symptom); 2 = Leaf curling and yellowing 
20 
 
University of Ghana http://ugspace.ug.edu.gh
(moderate symptom); 3 = Yellowing, Curling and Cupping (severe symptom); 4 = Severe 
stunting, curling and cupping; plant stops growth (very severe symptom). Using this scale, 
scoring of plants is done at 30, 60 and 75 days after transplanting.  
Friedmann et al. (1998)  also used the following scale; 0 = no visible symptoms, inoculated 
plants show the same growth and development as non-inoculated plants; 1 = very slight 
yellowing of leaflet margins on apical leaf; 2 = some yellowing and minor curling of leaflet 
ends; 3 = a wide range of leaf yellowing, curling and cupping, with some reduction in size, yet 
plants continue to develop; and 4 = very severe plant stunting and yellowing, pronounced leaf 
cupping and curling, and plant growth stops.  
Another scale, though different from the first two discussed above, ranges from 0-3 as follows; 
0 = symptomless and 3 = severe symptoms. All plants that scored 0 were classified as resistant 
and all plants between1-3 were classified as susceptible (Kasrawi, 1989). 
The most recent scoring scale used was the 1–6 severity scale, where: 1 = healthy, no 
observable symptoms; 2 = very mild with slight yellowing and mosaic on top leaves and no 
leaf curling; 3 = mild yellowing, mosaic and/or slight leaf curling on youngest leaves, severe 
symptoms; 4 = moderate yellowing and/or leaf curling on the youngest (top) leaves; 5 = severe 
yellowing and blistering and/or severe leaf curling plus some leaf size reduction on the 
youngest leaves of the main stem and/or at least one branch; and 6 = very severe yellowing, 
blistering and/or very severe leaf curling, leaf deformation, leaf size reduction and stunting.  
The disease severity scoring was done every seven days after 17 and19 days old seedlings were 
exposed to the whiteflies (Hanson et al., 2016). 
 
 
21 
 
University of Ghana http://ugspace.ug.edu.gh
2.10.5.2 Detection of TYLCV in infected whitefly and tomato plants  
 
In order to confirm that plants that do not show symptoms in the field are truly resistant, 
detection of TYLCV in plant samples is carried out. There are various ways of detecting 
TYLCV in infected plants. These include the use of Polymerase Chain Reaction (PCR) and 
Triple Antibody Sandwich and Enzyme-linked Immunosorbent assay (TAS - ELISA) 
techniques (Gajanandana et al., 2002).  
PCR is a widely used technique in plant pathology for the detection of disease-causing 
organisms in infected plants, for cloning of genomic fragments of the pathogen (Henson and 
French, 1993), determination of the composition of pathogen population and genetic diversity 
of the pathogen (Robertson et al., 1991). PCR specificity is based on the set of oligonucleotide 
primers that are complementary to regions flanking the DNA sequence to be amplified. 
TYLCV DNA can be extracted from tissues in whiteflies squashed on the membrane, following 
hybridization with a radiolabeled (Navot et al., 1989) or with a chromogenic DNA probe 
(Zilberstein et al., 1989). TYLCV DNA can also be amplified from nucleic acids isolated from 
tomato plants and from individual whiteflies by PCR (Navot et al., 1992). In addition, TYLCV 
DNA can be amplified by combining both TAS-ELISA and PCR methods. PCR amplifies 
nucleic acids and can be used to overcome the many challenges associated with serological 
detection methods such as low titer of antigen, cross-reaction of antibodies with heterologous 
antigens and developmental or environmental regulation of antigen production, In the PCR 
detection of TYLCV in plants, different degenerate and specific primers have been used 
depending on the virus isolates and the availability of the primers. Table 2.1 lists primers used 
to differentiate isolates of TYLCV. 
 
 
22 
 
University of Ghana http://ugspace.ug.edu.gh
Table 2. 1: Primers and sequences for amplification of TYLCV DNA 
Isolates Primers nt Sequence (5’-3’) Size 
position (bp) 
TYLCV TYv2337 2337 ACGTAGGTCTTGACATCTGTTGAGCTC 634 
TYc138 188 AAGTGGGTCCCACATATTGCAAGAC 
TYLCV- TYm2664 2664 ATTGACCAAGATTTTTACACTTATCCC 316 
Mld 
Tyc138 138 AAGTGGGTCCCACATATTGCAAGAC 
TYLCSV Almv2516 2516 TTTTATTTGTTGGTGTTTGTAGTTGAAG 433 
-ES 
Almc115 115 ATATTGATTGGTTTTTTCAAACTTAGAAG 
 
Also, Osei et al. (2012) and Segbefia et al. (2015) used the primers in Table 2.2 for detection 
of TYLCV from symptomatic tomato leaf samples in Ghana. The last three primers have been 
developed for Tomato Yellow Leaf Curl Ghana Virus (TYLCGHV), Tomato Yellow Leaf Curl 
Kumasi Virus (TYLCKV) and Tomato Yellow Leaf Curl Virus Mali (TYLCMV). Again, Bang 
et al. (2014) used AV494/AC1048 and PTYc787/PTYc1121 in detecting TYLCV in infected 
tomato plants.  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
23 
 
University of Ghana http://ugspace.ug.edu.gh
Table 2. 2: Primers and sequences for amplification of TYLCV DNA 
Primers Sequence (5’-3’) Primer type Reference 
PARc1496 GCAGGCCCACATYGTCTYCCNGT Degenerate Rojas et al. 
PAL1v1978 AATACTGCAGGGCTTCTRTACATRGG  (1993)  
 
AV494 GCCCATGTATAGAAAGCCAAG  Degenerate Wyatt and Brown 
(1996)  
AC1048 GGATTAGAGGCATGTGTACATG 
 
PTYc787 GTTCGATAATGAGCCCAG Degenerate Zhou et al. 
PTYc1121 ATGTAACAGAAACTCATG (2008) and Salati 
 et al. (2002)  
GHF GCCCGAAAGCTTCGTTGTTTTCCCGCT Specific Osei et al. (2008)  
GHR 
ACGGATGGCCGCTTTGGGT ATTCG  
KF GGACCCGGCGCACTATTTATGTTGGC  Specific Osei et al. (2008)  
KR 
ACCCCATTACCCCAATACCA  
MF TGGCCGCGCCCTTCCTTTTGT  Specific Osei et al. (2008)  
MR 
ACCAATGGCTCCCCAAAGCGT  
 
2.10.6 Development of TYLCD resistance tomato in Ghana 
 
TYLCD is a major tomato disease in Ghana and Africa as a whole and can cause massive yield 
loss (Osei et al., 2012). Considering the importance of TYLCD in Ghana, most of the research 
works focused on screening tomato accessions for TYLCD resistance. The USAID West 
African Regional Programme identified research on Virus resistance (VR) as a priority, and 
Ghana was included in seven members’ regional investigation of tomato virus complex (Horna 
et al., 2006). The Agricultural Biotechnology Support Project II (ABSPII) aimed to improve 
agricultural production in developing countries through Biotechnology. The project was 
initiated in 2005 to address tomato production constraints in West Africa. This project was a 
partnership among researchers from AVRDC, Cornell University and University of California-
Davis (UC Davis). The ABSII established the Regional Vegetable Germplasm Trailing 
Network that evaluated, 100 putatively TYLCD resistant tomato varieties that were adaptable 
to the growing conditions of West Africa which from 2005 through 2008. In the 2005-2006 
growing, only 40 varieties were evaluated. The resistant varieties used for the entire trial were 
24 
 
University of Ghana http://ugspace.ug.edu.gh
mainly F1 hybrids since they were sourced from commercial seed companies and some 
breeding lines from breeding institutions. Based on the TYLCD scoring scale, at the end of the 
2007-2008 multilocational trails, varieties such as Lety F1 scored below 1, Yosra scored 1, 
Atak, Bybal and Gempride scored between 1.0 and 2.0 in Ghana (Navrongo and 
Technimanitia). The lower score was an indication of tolerance under the disease pressure. It 
was noted that the varieties suffered under farmers’ field compared to research stations under 
comparable disease pressure. At the various trial locations, farmers-preferred Lety F1, Yosra, 
Atak and Bybal. Due to the competitive nature of the tomato breeding industry in the developed 
world, some of the selected varieties were no longer in use in the countries where they were 
originally bred (Gordon, 2009). 
Fifteen (15) tomato accessions (collected from AVRDC-Taiwan and CSIR - Crops Research 
Institute, Ghana) that have been reported to be resistant to TYLCD, as well as susceptible 
checks, were screened against the TYLCD in a greenhouse at the Kwame Nkrumah University 
of Science and Technology (KNUST) in Kumasi. These 15 accessions were later evaluated in 
the field at Afari (hot spot) in the Ashanti Region. The whiteflies used for the greenhouse 
inoculation were collected from infested tomato plants at Akumadan, Agogo and Afari. The 
incidence and severity of TYLCV were scored 30 days, 45 days and 60 days after transplanting 
using the 0-4 severity scale developed by Lapidot and Friedmann in 2002. At 60 days after 
transplanting in the greenhouse, accessions A2 (FLA456-4), G14 (WSP2F7 (3) PT.3) and G15 
(WSP27F7 (3) PT.3) expressed moderate symptoms in terms of incidence of the TYLCV while 
accessions A8 (99S-C-39-20), A9 (H24), G13 (WS273.3LARGE) and G12 (WSP2F1PT.3) 
showed mild symptom of the disease. A1 (TY52), A3 (FLA478-6-3-0), A6 (TLB111), A7 (LA 
1969) expressed slight severity symptoms of the disease. Accessions G11 (PIMPILIFOLIUM) 
and A1 (FLA505) had the lowest incidence compared to accessions A10 (CLN2026D), G13 
(WS273.3LARGE) and A4 (FLA653-3-1-0) that had the highest incidence of TYLCV 
25 
 
University of Ghana http://ugspace.ug.edu.gh
infection in the field. At 60 days after transplanting only accession, A1 (FLA505) showed no 
TYLCV (Osei et al., 2010). 
Again, thirty (30) accessions (including the 15 accessions that were screened in the greenhouse 
and the field in 2010) were screened against the local strains of the virus in Afari in the Ashanti 
Region. Some of these accessions were reported to be resistant in other countries. Only two 
accessions (Local Rano and Petomech-Ghana/France) out of the 30 accessions expressed mild 
symptoms while accessions WSP2F1pt.3 and Tomato Red Cloud expressed moderate 
symptoms after 60 days of transplanting.  In order to confirm the resistance or susceptibility 
observed in the field, six viral detection primers were used to screen all the 30 tomato 
accessions.  From the results obtained in that study, none of the primers amplified viral DNA 
in Tomato Red Cloud. For WSP2F1pt.3, only one of the six primers (PAL/PAR) amplified the 
viral DNA. Only MF/MR primer amplified the viral DNA in Local Roma. For Petomech 
(Ghana/France), two primers (GHF/GHR and KR/KF) amplified the viral DNA. 
Again, between 2010 and 2011, seven (7) tomato varieties were grown in the fields in the 
University of Ghana and the Volta region of Ghana. The symptom expression of the varieties 
against the TYLCV was confirmed in the laboratory using some of the primers listed above in 
addition to Beta 01/02. From the field screening, it was found out that Burkina (obtained from 
farmers in the Volta region) had the highest TYLCD incidence, followed by Petomech and the 
susceptible check. However, Petomech expressed higher severity than Burkina. Both severity 
and incidence were lower in the hybrids with the exception of F1Thorgal that showed no 
symptom. AC1048/AV494 detected the most viral DNA in the samples collected. The primer 
set T0302-F/T0302-R did not amplify the Ty-2 gene in any of the varieties evaluated. However, 
Primer P6-25-F/P6-25-R amplified a band size of approximately 400 bp in F1 Jaquar, F1 Nadira 
and S. Pimpinellifolium (Ossom, 2012). 
26 
 
University of Ghana http://ugspace.ug.edu.gh
Between 2011 and 2012, a group of researchers also evaluated the susceptibility of ten (10) 
accessions to TYLCD under field conditions. The accessions include Solanum 
Pimpinellifolium, Wosowoso, Chery red, Roma, Hyb -1 (Wosowoso x S. Pimpinellifolium), 
Hyb - 2 (Roma x S. Pimpinellifolium), Hyb - 3 (Cherry red x S. Pimpinellifolium), BC-
1[Wosowoso x (Wosowoso x S. Pimpinellifolium)], BC-2 [Roma x (Roma x S. 
Pimpinellifolium)] and BC-3 [C-Red x (C-red x S. Pimpinellifolium)]. The results from the 
phenotypic screening were verified with molecular markers. This work also deployed both 
triple antibody sandwich enzyme-linked immunosorbent assay (TAS - ELISA) and PCR 
method (using the primers in Table 2.2) for the TYLCV detection in order to recommend a 
better way of detecting TYLCV Virus in infected samples. A TAS-ELISA kit with a known 
TYLCV-infected Nicotiana benthamiana positive control was used for the study. The study 
confirmed the superior sensitivity of the PCR technique as a TYLCV detection method 
compared to the TAS – ELISA technique (Segbefia et al., 2015). 
Recently, there was a phenotypic evaluation of 36 local tomato genotypes for resistance against 
TYLCD in two locations (University of Cape Coast and Asuansi) in Ghana. The results showed 
that five accessions (K005 - Petomec, K100 - Local 3, K213 -AVTO 9804, K116 - Ashanti 2 
and K042 - Tomatose) out of the 36 genotypes were selected for mild severity. Among them, 
2 genotypes showed severe symptoms (K027 - Local, K202 - AVTO 0102) and one genotype 
(LV - Fadzebegye) showed moderate severity. In order to confirm the infection or otherwise 
of the eight tomato accessions selected for mild and severe symptom expression, two of the 
viral detection primers (AV494/AC1048 and PTYv787/PTYc1121) were used for the detection 
of the virus in infected plant samples. (Asare-Bediako et al., 2017).   
 
 
27 
 
University of Ghana http://ugspace.ug.edu.gh
2.11 Conclusion 
Significant progress has been made in improving fruit quality and the introgression of Ty 
resistant genes into cultivated tomato in advanced breeding programmes. These lines are 
available for further breeding and adaptation to various locations in the world. Many 
commercial varieties with different level of resistance have also been developed. However, 
more research is required particularly in breeding for location-specific resistance and 
pyramiding of multiple Ty resistant genes together with other important tomato disease 
resistance genes into commercial varieties. In Ghana, very little tomato research targeted fruit 
quality improvement. Although various screening of tomato accessions against the TYLCD 
have been carried out, more research must be carried out on identifying which of the TYLCD 
resistance genes is resistant to the local TYLCV strains and introgress those resistance genes 
into adapted varieties. Improving yielding and fruit quality together with TYLCD resistance 
will largely address the challenges of tomato production in Ghana. 
 
 
 
 
 
 
 
 
 
28 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER THREE 
3.0 Farmers’ perception of Tomato Yellow Leaf Curl Disease (TYLCD) and its 
implication on tomato breeding 
3.1 Introduction 
Pests and diseases are the major biotic factors that affect tomato production in Ghana, and this 
together with other production constraints has resulted in Ghana’s inability to meet the demand 
for tomato. TYLCD was reported to be the most devastating tomato disease in Ghana and can 
result in 100% yield loss (Osei et al., 2012). Mitigating the impact of TYLCD on tomato yield 
can lead to an increase in tomato production.  
Modern plant breeding programmes must be market-driven (Horna et al., 2006) and since 
farmers are the direct beneficiaries of a breeding programme it is necessary to understand their 
perceptions of tomato production constraints especially to the most devastating disease, 
TYLCD. TYLCD is one of the three most important tomato diseases in the world (Hanson et 
al., 2016). 
Over the years, most tomato farmers in Ghana relied on seeds of imported tomato hybrids, 
improved pure lines and local pure lines. The imported pure lines and hybrids are not adapted 
to the Ghanaian growing conditions in Ghana whereas the locally-adapted pure lines have poor 
fruit colour, low brix, many seeds and high-water content (Robinson and Kolavalli, 2010). On 
the contrary, the tomato preferred by the market is expected to have deep red colour, higher 
brix, ability to withstand travel shock and have long shelf life. In order to successfully produce 
fruits with these market-preferred traits, the variety must be able to withstand the high 
incidence of pests and diseases in the growing areas. 
Designing and implementation a breeding programme to address these challenges will require 
a better understanding of farmers’ perceptions of the disease and fruit quality traits that must 
be considered in a breeding programme (Sperling et al., 2001). A major approach to get farmers 
29 
 
University of Ghana http://ugspace.ug.edu.gh
involved from the onset of the breeding programme is through Participatory Rural Appraisal 
(PRA). 
Involving farmers at the start of the breeding programme enables them to own the project and 
makes adoption of a new variety very easy. The involvement of Ghanaian farmers in a breeding 
programme has become imperative following the recent report on farmers’ rejection of seeds 
supplied by the government under the Ministry of Food and Agriculture flagship programme 
‘Planting for Food and Jobs programme’. The reason given by the farmers for the rejection is 
that the seeds, especially vegetables, are not adaptable to local conditions. In the case of tomato, 
the Agricultural Extension Agents (AEAs) were concerned that the tomato seeds being 
supplied will not withstand pests and diseases in the growing areas.  Farmers resorted to using 
their own sources of seeds which are unimproved and low yielding. This obviously will defeat 
the objective of increasing production of some of the country’s major crops in order to make 
the nation food secure (Gakpo, 2017).  
The objectives of this study were to: 
i) identify tomato production constraints of farmers in Ghana. 
ii) determine farmers’ perceptions or knowledge of the impact of TYLCD and 
strategies employed to control the disease. 
iii) identify the set of traits preferred by farmers in tomato to guide the development of 
new varieties. 
 
 
 
 
 
30 
 
University of Ghana http://ugspace.ug.edu.gh
3.2 Material and Methods 
3.2.1 Study area 
 
Participatory Rural Appraisal (PRA) was carried out in three regions of Ghana where tomato 
is predominantly grown. These regions included the Ashanti Region (Akumadan), Brong 
Ahafo Region (Tuobodom and Benekrom) and the Upper East Region (Vea, Tono and 
Pwalugu). Akumadan is located in the Offinso North district in the deciduous forest zone of 
Ghana. Tuobodom is in the Techniman North district and Benekrom is within the Dormaa 
Municipality, which borders Côte D’Ivoire. Tuobodom and Benekrom are located in 
Transitional zones. The forest and transitional zones are characterized by bi-modal rainy 
seasons; April through June and September through November. Vea, Tono and Pwalugu are 
located in the Bongo, Kassena-Nankana and Talensi districts respectively. The Upper East 
Region is located in the Sudan Savannah Zone and bordered to the north by Burkina Faso. This 
zone is characterized by one rainy season from May/June to September/ October and the annual 
rainfall during the period is 800 and 1,100mm (GSS, 2013). Tono and Vea are within the 
Kassena Nankana East Municipality.  
These communities were chosen in consultation with the Agricultural Extension Agents 
(AEAs) of the Ministry of Food and Agriculture (MoFA) and all the farmers selected were 
tomato farmers. 
3.2.2 Selection of Farmers 
 
Multistage sampling technique was deployed in the selection of the respondent for this study. 
The first stage involved purposive sampling of districts that were engaged in tomato 
production. Secondly, with the aid of the Agricultural Extension Agents (AEAs) at the various 
districts, six communities were purposively sampled based on the level of tomato production. 
With the assistance of the AEAs, experienced tomato farmers were selected for focal group 
31 
 
University of Ghana http://ugspace.ug.edu.gh
discussion in three out of the six communities (one per Region). This was followed by 
questionnaire administration to farmers in all the 6 communities. Ten farms per community 
were randomly selected and visited to assess the incidence and severity of TYLCD. A total of 
one 107 tomato farmers participated in the PRA. The participants were selected at random 
regardless of their age, gender, experience in farming and their social status in the community. 
3.2.3 Survey procedure and data analysis. 
The PRA tools employed in the study were Focal Group Discussions (FGDs) and Key 
Informant (KI) interviews using a semi-structured questionnaire. FGD was held in each district, 
followed by semi-structured questionnaire administration and farm visit.  The questionnaire is 
presented in Appendix. Each FGD consisted of 20 tomato farmers and 10 farms were 
subsequently visited. Farmers were not given prior information on TYLCD hence topics 
discussed included the tomato variety being grown in the community, preferred characteristics 
of these varieties as well as production and marketing constraints. This was to avoid any biases 
in their response.  To further understand specific issues, a formal survey was carried out 
involving 107 farmers (including some of the farmers who participated in the FGD). The 
number of questionnaires administered per locality was 22 in Ashanti Region, 40 in Brong 
Ahafo Region and 45 in Upper East Region. The number of tomato farmers differed for the 
communities. The PRA was carried out during the dry season because of the high prevalence 
of TYLCD during that period. Appiah et al. (2012) reported high prevalence of white fly during 
the dry season. In the Upper East Region, farms were visited during the fruiting stage (February 
2016) of the plants. In the Ashanti and Brong Ahafo Regions, most of the farms were visited 
immediately after transplanting (September 2016) and a follow-up visit was made at the 
fruiting stage (November 2016). In each location, 10 farms were visited and the incidence and 
severity of TYLCD were scored. Farmers identified various diseases with the aid of a 
32 
 
University of Ghana http://ugspace.ug.edu.gh
publication titled ‘A visual guide: Tomato foliage, stem and Root problems’ (Missouri 
Botanical Garden). 
3.2.4 Data Analysis 
Statistical Package for Social Sciences (SPSS) version 21 was used to analyze the data 
collected from the administered questionnaire. Descriptive statistics such as frequency, 
percentages and charts were used to describe the attributes of the variables collected. 
3.3 Results 
3.3.1 Focal Group Discussion 
 
From the Focal group discussion in the Ashanti Region (Akumadan), it was established that 
the tomato varieties grown were Petomech, Power Rano, Akoma and Konkon. According to 
the farmers, Petomech was preferred because it had a relatively long shelf life and for the other 
varieties it was due to higher yields. These varieties took about 80 days to mature when the 
weather was favourable. Akumadan has two tomato growing seasons due to the bimodal 
rainfall pattern in the region. The first season is from February to May and the second season 
is from August to November. From the FGD, it was realized that the farmers were aware of the 
presence of Tomato Yellow Leaf Curl Disease in their farms. The local name given to this 
disease was ‘anointing’. The name was derived from the symptoms they observed in the fields. 
According to them, an infected plant looked yellow which can be likened to the colour of 
anointing oil used for spiritual purposes and the leaves then cupped as if raising one’s hands 
up in preparedness to receive blessings; hence the name ‘anointing.’ 
The farmers were of the view that there was no control for the disease. The farmers also 
mentioned other diseases like root-knot nematode and black spot as well as pests such as 
whiteflies and caterpillar.  
33 
 
University of Ghana http://ugspace.ug.edu.gh
The farmers indicated that tomato is imported from Burkina Faso into markets in Ghana from 
December to March when there is no production in Akumadan. They also alluded to the fact 
that Burkina Faso uses irrigation for production during that dry season.   
Tuobodom was one of the two communities visited in the Brong Ahafo Region and the only 
tomato variety grown there was Power. The variety is known to show good performance in the 
area. According to the farmers, any other tomato variety including Petomech produced very 
tiny non-marketable fruits and they attributed it to the nature of their soil. According to them, 
Power takes 60-80 to reach maturity. The tomato-growing period in Tuobodom is similar to 
that of Akumadan. They also mentioned a number of diseases in the area and these included 
TYLCD, root-knot nematodes, damping off and Black Spot. Damping off was observed in 
most of their nurseries during our farm visits. At the nursery, seeds were broadcast and a large 
number of the seedlings were dying. The farmers described the symptoms of TYLCD and 
considered it as the most devastating disease in the area. The local name given to the TYLCD 
was ‘Mathwo’. This name was attributed to the symptoms since infected leaves were reduced 
in size, hardened and the stems were stunted. Some pests mentioned were caterpillar (locally 
called ‘Twenwomutae’), cricket and red mite. According to the farmers present at the FGD, 
the season during the PRA was the first time they were experiencing a massive outbreak of red 
mites.  
Farmers in Tuobodom also complained about unstable prices for their produce and varying box 
sizes used by marketers in buying their produce and therefore called for standardization. 
Farmers in Tuobodom believed that tomato imported from Burkina Faso had long shelf life 
and reiterated their inability to farm in the dry season was because of lack of irrigation facilities.  
According to the farmers in Dormaa, they cultivated many improved tomato varieties. The 
choice of a variety depended on the performance of the variety in the previous season. Hence, 
34 
 
University of Ghana http://ugspace.ug.edu.gh
a different variety could be grown in successive season based on the performance of the variety 
in the previous year. Farmers claimed they produce premium tomato because they use 
improved seeds whereas the other two communities mostly used saved seeds. They also had 
well-raised nurseries and all tomato plants were staked. The farmers practiced shifting 
cultivation because of the availability of land. Dormaa also has two growing seasons; the first 
season is from March to June and the second from August to October. They indicated that 
TYLCD used to be a problem in the area. They did not have problem with the Ghana-Burkina 
Faso tomato trade because they are engaged in Ghana-Côte D’Ivoire tomato trade 
The three major tomato growing areas in the Upper East Region namely Pwalugu, Vea and 
Tono cultivated Petomech, UC 82, Tropimec and ‘No name’ (likely to be Petomech). The 
farmers’ choice of variety was determined by the preference of the market women. According 
to the farmers, these varieties are high yielding and have long shelf life. The first planting 
season is from September-February and the second is from November-March. The harvesting 
period partly coincides with that of Burkina Faso. Farmers were unhappy with Ghana-Burkina 
Faso tomato trade because the harvest period coincides with that of Burkina Faso. The farmers 
alleged that the market women preferred to go to Burkina Faso because they take the 
opportunity to trade in other commodities. According to them the market women buy items 
from Ghana and conceal them under the tomato boxes and these items are sold in Burkina Faso 
to earn West African CFA franc and in return buy tomato back to Ghana. Some of the farmers 
also said because they did not get government support, they are unable to produce in larger 
quantities and the quality of their tomato was not as good as tomato from Burkina Faso. This 
was attributed to pests and diseases, particularly TYLCD. Most farmers in Pwalugu were 
growing onions because of poor market as well as pests and diseases.  In Tono, some farms 
outside the irrigation plots were prone to animal grazing. 
 
35 
 
University of Ghana http://ugspace.ug.edu.gh
3.3.2 Demographic characteristics of questionnaire respondents 
The results showed that 74% of the 107 respondents were men and 26% were women (Table 
3.1). The respondents belonged to different age categories with 39% of them between 31 and 
40 years, 31% were between 41 and 50 years and 16% were above 50. A few farmers (3%) had 
tertiary education with the majority (58%) of them having primary and Junior High School 
education. Fifteen percent (15%) had secondary school certificate while 22% of the farmers 
did not have any formal education. 
 
Table 3. 1: Gender, age and educational background of tomato farmers from three regions in 
Ghana 
Attribute Percentage (%) of respondents 
Sex  
a. Male 74 
b. Female 26 
Age (Years)  
a. 18 - 30 14 
b. 31 - 40 39 
c. 41 - 50 31 
d. Above 50 years 16 
Educational level of farmers  
a. No formal  22 
b. Primary 33 
c. JHS 25 
d. Secondary 15 
e. Technical/Vocational 2 
f. Tertiary 3 
 
36 
 
University of Ghana http://ugspace.ug.edu.gh
3.3.3 Tomato Production 
Most of the farmers (86%) have been growing tomato for upwards of 6 years while 1% of the 
farmers had less than one year’s experience in tomato cultivation (Table 3.2). Majority (63%) 
of the respondents owned 1-3 acres of tomato farm, 13% owned 4-6 acres of tomato farm and 
6% owned between 7 and 14 acres. A few (1%) of the farmers owned 19 acres and above. 
Table 3. 2: Number of years of experience in tomato farming and size of farm owned by                  
farmers in six tomato-farming communities three regions in Ghana 
Years of farming Percentage (%) of respondents 
a. Less than a year 1 
b. 1-5 years 13 
c. 6-10 years 43 
d. more than 10 years 43 
Size of farm  
a. >1 acre 16 
b. 1-3 acres 63 
c. 4 – 6 acres 13 
d. 7 – 10 acres 6 
e. 11 - 14 acres 1 
f. > 19 1 
 
The respondents obtained their seeds from different sources. Majority (41 %) of respondents 
obtained seeds from Agro-seed shops, 36% used saved seeds and the rest of the respondents 
obtained seeds from other sources (Figure 3.1). 
 
37 
 
University of Ghana http://ugspace.ug.edu.gh
2%
12%
1%
8% 41%
Agro-seed shops
Saved seeds
Market
36% Research Institutions
Agro-seed shops and
saved seeds
Saved + Market
 
Figure 3. 1: Distribution of respondents with respect to source of seeds for tomato 
production 
 
About (60%) of the farmers purchased new seeds every season. Some 37% on the other hand 
only used saved seeds. Only one percent obtained new seeds when a new variety is introduced 
(Figure 3.2).  
 
70
60
50
40
30
20
10
0
Every season Every two (2) When there is Never Others
years a new variety
Frequency of seed acqusistion
  
Figure 3. 2: Frequency of seed acquisition for tomato cultivation among respondents in six 
farming communities in three regions in Ghana 
 
38 
 
Proportion of farmers (%)
University of Ghana http://ugspace.ug.edu.gh
3.3.4 Constraints to tomato production 
In the six communities, each respondent listed a varied number of constraints to tomato 
production in Ghana (Table 3.3). Across the three Regions, farmers perceived pests and 
diseases as the most important constraints to tomato production. Pest and diseases were scored 
91%, 100% and 96% in Ashanti, Brong Ahafo and Upper East Regions respectively. For 
drought, 90% of respondents in the Brong Ahafo Region, indicated this as a major production 
constraint, followed closely by Ashanti Region (81%) and 31% of farmers in the Upper East 
Region. Again, 90% of respondents in Brong Ahafo Region perceived the cost of fertilizer and 
insecticides as high and a constraint to production, the second highest being in the Upper East 
Region (78%) and the least number of respondents indicating cost of agrochemicals as a 
production constraint was observed in the Ashanti Region (59%).  All respondents in the Brong 
Ahafo Region viewed inadequate financing as a major production challenge, followed by 
Ashanti Region (86%) and lastly Upper East Region with 68% of respondents. 
Lack of technical support from Agricultural Extension Agents had the lowest number of 
respondents classifying it as a major production constraint in the three regions. Three percent 
(3%) of farmers in Brong Ahafo Region, 23% in Ashanti Region and 24% in Upper East Region 
viewed extension services as a major challenge. Many farmers (82%) in the Ashanti Region 
perceived low-quality seeds as a major challenge to production, whereas only 43% of 
respondents in the Brong Ahafo and 18% in the Upper East Region considered it as a major 
production constraint. 
 
 
 
 
39 
 
University of Ghana http://ugspace.ug.edu.gh
Table 3. 3: Perception of tomato farmers of the key production constraints in six farming 
communities in three regions in Ghana 
Constraints Ashanti Region  Brong Ahafo Region  Upper East Region  
Drought 81% 90% 31% 
High cost of fertilizer 59% 90% 78% 
and insecticides 
Inadequate finance 86% 100 68% 
Lack of technical 23% 3% 24% 
support from AEAs 
Low-quality seeds 82% 43% 18% 
Pests and diseases 91% 100% 96% 
Others 50 48% 56% 
 
 
3.3.5 Perception of biotic constraints to tomato production among farmers 
Many farmers (45%) in the Ashanti Region ranked caterpillar as the most important pest (Table 
3.4).  For the Brong Ahafo Region, 25% of the farmers ranked caterpillar as the most important 
pest. In the Upper East Region, 47% of the farmers ranked whitefly as the most important pest.  
  
 
Table 3. 4: Perception of tomato farmers of the importance of weeds and insect pests as 
constraints to tomato cultivation in three regions in Ghana 
Pests Ranking per Region (%) 
 Ashanti Region  Brong Ahafo Region  Upper East Region  
 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 
Grasshoppers - - 18 - - 15 20 20 13 - 4 7 9 7 - 
Caterpillar 45 32 5 - - 25 20 28 5 - 27 29 18 - - 
Weeds - - 14 - - 3 - - - - - - - - - 
Whiteflies 5 - - - - 3 5 5 5  47 24 9 4 - 
Butterfly - - - - - - - - -  - 4 2 2 - 
Stem borer - - - - - - - - -  - 2 - - - 
Others - 9 5 5  30 23 18 3   13 16 9 4 
 
Note: 1-Most important; 2-Very important; 3-important; 4-Less important; 5-Least important; 6-Not 
important 
 
Tomato Yellow Leaf Curl Disease (TYLCD) was ranked as the most important disease of 
tomato in all the three regions (Table 3.5).  Many farmers (68%) in Ashanti Region ranked 
40 
 
University of Ghana http://ugspace.ug.edu.gh
TYLCD as the most important disease of tomato compared to 18% of farmers in the Brong 
Ahafo Region. Fusarium wilt was perceived to be present in only the Ashanti Region.  
 
Table 3. 5: Perception of tomato farmers of the importance of diseases of tomato in three 
regions in Ghana 
Disease Ranking per Region (%) 
 Ashanti Region  Brong Ahafo Region  Upper East Region  
 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 
Damping - - - - - 5 23 13 10 - - 4 2 - - 
off 
Early 14 41 14 18 - 3 3  8 - - - - - - 
Blight 
Late Blight - - - - - - 3 8 8 - - - - - - 
Fusarium 14 5 14 - - - - - - - - - - - - 
Wilt 
Bacteria - - - - - - - - - - 4 7 9 - - 
Wilt 
TYLCD 68 23 5   18 5 8 3 3 58 9 7 2  
Blossom 5 14 - - - - - - - - 2 2 - - - 
end rot 
Nematode - - - - - 5 3 - - - 2 2 2 - - 
Others  - 14  5  60 3 18 - - 11 47 9 - - 
Note: 1-Most important; 2-Very important; 3-important; 4-Less important; 5-Least important; 6-Not 
important 
 
 
3.3.6 Farmers’ knowledge, perception and experiences concerning TYLCD prevalence 
All the respondents except 5% were aware of TYLCD (Figure 3.3). Eighty-four (84) % of 
respondent indicated that they observed the disease on their farms and 1% of farmers read it in 
a scientific publication as well as observed it on the farm. A total of 76% of the respondents 
interviewed did not know about the cause of TYLCD and 6% of respondents stated that 
TYLCD is caused by whitefly (Table 3.6).  
 
 
 
41 
 
University of Ghana http://ugspace.ug.edu.gh
90
80
70
60
50
40
30
20
10
0
Not aware Personal Report by Personal Personal
observation in other farmers observation in observation in
my farm my farm + my farm +
Report by scientific
other farmers publication
Sources of awareness of TYLCD
 
Figure 3. 3: Sources of Awareness of TYLCD among tomato farmers in six communities in 
three regions in Ghana. 
 
 
Table 3. 6: Farmers’ perception of the vector of Tomato Yellow Leaf Curl Disease in six 
tomato farming communities in three regions in Ghana 
Causes of TYLCD Percent (%) of respondents 
Don't know 76 
Aphid 1 
Red mite 3 
Whitefly 6 
Caterpillar 6 
Grasshopper 2 
Whitefly and Grasshopper 1 
Caterpillar and Grasshopper 2 
Whitefly and Caterpillar 1 
Others 2 
 
Figure 3.4 shows that 40% of the respondents indicated pepper as an alternative host of 
whitefly. Some 25% of the respondents also indicated that pepper and eggplants were alternate 
hosts of the vector and 7% also mentioned eggplant as an alternate host of the vector. Nine 
percent (9%) of respondents did not have an idea about the alternate host of the vector.  
 
42 
 
Proportion of farmers (%)
University of Ghana http://ugspace.ug.edu.gh
No idea (9%)
Others (17%)
Pepper + 
Cassava, (2%)
Pepper (40 %)
Pepper + 
eggplant (25%)
Eggplant (7%)
 
Figure 3. 4: Proportion of respondents among tomato farmers in six tomato farming 
communities in three regions in Ghana that perceived various crop plants as 
alternative host of the whitefly 
 
 
Respondents expressed the symptoms of TYLCD they observed in their fields and 45% 
indicated yellowing and curling of leaves, 22% mentioned yellowing of leaves and 10% 
indicated curling and cupping as well as yellowing and reduction of leaves (Figure 3.5). 
43 
 
University of Ghana http://ugspace.ug.edu.gh
50
45
40
35
30
25
20
15
10
5
0
No idea Curling Curling, Curling, Yellowing Yellowing Yellowing Blackspots
and capping capping, and curled and
capping and yellowing reduced
yellowing and
reduced
leaf size
Symptoms of TYLCD on leaves
 
Figure 3. 5: Proportion of respondents that ascribed various leaf symptoms of infection by 
TYLCD in six tomato farming communities in three regions in Ghana 
 
Respondents also described symptoms of TYLCD on infected stems (Table 3.7). Majority 
(46%) of the respondents indicated stunted growth, 18% indicated hardened stem, 16% 
indicated both stunted and hardened stem, 14% did not have an idea and the rest of the 
respondents indicated rots and death among others. 
 
 
Table 3. 7: Farmers’ knowledge of the symptoms of Tomato Yellow Leaf Curl Disease on 
stem of tomato plant in three regions in Ghana 
Symptoms on stems Percent (%) of respondents 
no idea 14 
Stunted growth 46 
Hardened stem 18 
Stunted growth and hardened stem 16 
Rots 1 
Death 1 
Others 4 
  
 
44 
 
Proportion of farmers (%)
University of Ghana http://ugspace.ug.edu.gh
Majority of the respondents (60%) indicated that the plants expressed symptoms after 3-4 
weeks after transplanting (Table 3.8). Some 14% of respondents also indicated 1-2 weeks after 
transplanting. The rest of the respondents indicated 5-6 weeks after transplanting, at the nursery 
and others.  
Table 3. 8: Farmers’ perception of the tomato stage of growth of first symptom expression 
following TYLCD infection in the field in three regions in Ghana  
Period of first symptom Frequency Percent (%) of 
respondents 
 0-Absent 1 1 
At the nursery 8 7 
1-2 weeks after transplanting 15 14 
3-4 weeks after transplanting 64 60 
5-6 weeks after transplanting 10 9 
7 weeks and above 2 2 
Others 7 7 
 
Farmers’ perception of varieties of tomato that were commonly affected by the TYLCD in their 
communities is represented in Figure 3.6. Twenty-eight percent (28%) of respondents indicated 
all varieties, whereas 26% and 10% specified Petomech and Power Rano, respectively. Other 
varieties mentioned were Tropimec, ‘No name’ and UC 82. 
Petomech and  
Tropimech No name (1%) None (6%)
(8%)
Petomech and 
Petomech
No name (14%)
(26%)
Others (2%)
Tropimech
(2%)
UC (3%)
All the varieties
(28%) Power Rano
(10%)
 
Figure 3. 6: Proportion of farmers in six communities in three regions in Ghana that 
identified particular tomato varieties as susceptible to TYLCD 
45 
 
University of Ghana http://ugspace.ug.edu.gh
Most of the (58%) respondents indicated that the disease affected their farm every season, 22% 
of respondents also stated yearly and a few of the respondents (5%) indicated every other year 
(Figure 3.7). 
 
70
60
50
40
30
20
10
0
Every season Yearly Every (2) years Others
Frequency of TYLCD  ocurrence
 
Figure 3. 7: Frequency of TYLCD occurrence in farmers’ field based on respondents in six 
tomato growing communities in three regions in Ghana. 
 
 
With regards to the level of incidence of TYLCD that farmers experienced annually, 36% of 
respondents stated that between 25% and 50% of their farms got infected by the TYLCD, 25% 
indicated that between 50% and 75% (Figure 3.8). Twenty percent (20%) of respondents 
indicated that the TYLCD disease infected less than 25% whereas 6% of respondents noted 
that 100% incidence.  
 
 
 
 
46 
 
Proportion of farmers (%)
University of Ghana http://ugspace.ug.edu.gh
A total of 38 of the farmers experienced yield loss between 25%; and 50% and 26 of the farmers 
also experienced yield loss of between 50% and 75%. Eighteen and 6 of farmers lose up to 
25% and 100%, respectively, of their yield due to the disease (Table 3.9).  
 
Table 3.9: Farmers’ perception of estimated yield loss caused by TYLCD in three regions in 
Ghana 
 No. of farmers Description of yield loss 
18 Up to 25% yield loss 
38 Between 25% and 50% yield loss 
26 Between 50% and 75% 
19 Between 75% and 100% yield loss 
6 100% yield loss 
  
 
3.3.6.1. Farmers’ perception of the control of TYLCD  
According to 27% of the respondents, there was no control for TYLCD, 58% indicated 
chemical spraying. Two percent (2%) indicated separating new field from existing tomato 
farms. In addition, 1% each indicated practicing crop rotation, and farm sanitation as methods 
of TYLCD control (Table 3.10).  
Table 3. 10: Measures adopted by farmers to control TYLCD  
Control measures Percent (%) of respondents 
No control 27 
Separate old field from new field 2 
Practicing crop rotation 1 
Proper farm sanitation 1 
Chemical spraying 58 
Combination of at least two practices 5 
Roguing 6 
 
Majority of the respondents (67) had no idea of the use of TYLCD resistant varieties as a means 
of controlling TYLCD (Figure 3.8). A total of 30% of respondents knew TYLCD resistant 
varieties could be used as a means of controlling TYLCD.  
 
47 
 
University of Ghana http://ugspace.ug.edu.gh
Yes (30%)
No (3%)
No idea (67%)
 
Figure 3. 8: Farmers’ knowledge about the use of resistant TYLCD variety as a means of 
control 
 
Tomato farmers in Ashanti Region wanted breeders to consider yield as the most important 
trait in the development of a new variety (Table 3.11). TYLCD resistance or tolerance should 
be considered as the second most important trait with shelf life as the third most important trait 
in developing a new variety and heat tolerance was the least important trait to them. Tomato 
farmers in Brong Ahafo Region ranked heat tolerance as the most important trait to be 
considered by breeders in the development of a new variety. In Upper East, TYLCD was the 
most important trait that must be considered by breeders. This should be followed by yield and 
then shelf life.  
 
 
 
 
48 
 
University of Ghana http://ugspace.ug.edu.gh
Table 3. 11: Farmers ranking of preferred traits that must be considered in breeding a new 
tomato variety  
Traits Ashanti Region  Brong Ahafo Region Upper East Region  
Yield 1 3  2 
Shelf life 3 5 3 
Big Fruit  4 4 6 
Drought Tolerance 5 2 5 
Heat Tolerant 6 1 4 
TYLCD resistance 2 6 1 
Note: 1-Most important; 2-Very important; 3-important; 4-Less important; 5-Least important; 6-Not 
important 
3.3.7 Incidence and severity score of TYLCD in the regions studied 
All the three villages in Upper East recorded 100% incidence, however, Dormaa recorded 1% 
TYLCD incidence (Table 3.12). Tono had the highest TYLCD severity score of 4 and Dorma 
had the least severity score of 2.   
Table 3. 12: TYLCD incidence and severity scores in 10 farms of six tomato farming 
communities in each of the three regions in Ghana based on a rapid field survey 
Village Incidence (%) Mean severity score 
Akumadan 84 3 
Tuodobom 85 3 
Dormaa 1 2 
Vea,  100 3 
Tono 100 4 
Pwalugu  100 3 
Severity score: Healthy, 2 – Very Mild, 3 - Mild, 4 – Moderate, 5 – Severe, 6-Very Severe 
 
 
 
 
 
 
 
 
49 
 
University of Ghana http://ugspace.ug.edu.gh
3.4 Discussion 
3.4.1 Tomato production constraints 
 
The farmers mentioned a number of tomato production constraints. The most important tomato 
production constraints in all the three regions were pests and diseases. Other constraints 
peculiar to a particular locality were also mentioned. Farmers in Ashanti and Brong Ahafo 
mentioned drought as one of the constraints to tomato production. High cost of fertilizer and 
insecticides was of concern to farmers in Brong Ahafo and Upper East as compared to Ashanti 
Region. Lack of adequate finance was an absolute problem in Brong Ahafo relative to Ashanti 
and Upper East Region. This finding is consistent with Robinson and Kolavalli (2010) who 
reported high per unit input price, pests and diseases as reasons for low productivity of tomato 
in Ghana.   
Paramount among the diseases of tomato in the six tomato growing communities was the 
TYLCD. In this study, 84% of the farmers were aware of the TYLCD and Asare-Bediako et 
al. (2017), reported 92.6% of the farmers were aware of TYLCD. The farmers described 
different TYLCD symptoms on leaves which included yellowing, curling, cupping and reduced 
leaf size. They also mentioned symptoms associated with the stem such as stunted growth, 
hardened stem and eventual death of the plant. With the exception of hardened stems, all the 
symptoms described by the farmers are characteristics of TYLCD (Hanson et al., 2016; Yan et 
al., 2018). Majority (60%) of the farmers observed the symptoms of TYLCD 3-4 weeks after 
transplanting and others also observed it as early as one week after transplanting. Mensah-
Wonkyi (2014) reported 78% of the farmers observed the symptoms in their farms during the 
flowering stage. TYLCD infection at an early stage of the plant development can lead to total 
yield loss (Levy and Lapidot, 2008).  
50 
 
University of Ghana http://ugspace.ug.edu.gh
Majority of the farmers indicated that TYLCD affected their farm every season and others 
indicated yearly. This gives an indication of the prevalence of the disease in the various 
communities. According to the farmers, TYLCD affects more than half of the entire farm and 
in some cases, the disease affects the entire farm. This infection leads to more than 50% yield 
loss or total yield loss. Aare-Bediako et al. (2017) reported in a survey carried out in the Central 
Region, farmers lost 10% to 40% of their yield due to TYLCD infection. 
Although many respondents indicated that TYLCD was the most important problem of tomato, 
a few indicated that whitefly transmits the disease. This is not surprising since majority of the 
respondents said they did not know the cause of the disease. This is consistent with the work 
of Mensah-Wonkyi (2014) in the Central Region where majority of the farmers were aware of 
TYLCD but did not know the vector of the virus. Some farmers attributed it to climatic factors. 
In the present study, many farmers attributed it to other pests such as aphids, red mite, and 
caterpillar. The whitefly is the vector that transmits Tomato Yellow Leaf Curl Virus (TYLCV) 
that causes TYLCD.  
Farmers were aware of alternate host of whiteflies in their fields. Some of the alternate hosts 
listed were pepper, garden egg and cassava. Although tomato serves as the primary host for the 
whitefly or virus, there are other hosts. These include cucumbers, cotton, eggplants, potatoes, 
tobacco, beans, peppers and some weeds among over 300 species within 63 families (Mound 
and Halsey, 1978).  
 Albeit TYLCD was the most devastating, some farmers believed there is no control. Some 
farmers resorted to chemical spraying in an attempt to control it. Asare-Bediako et al. (2017) 
also reported that 60.4% of farmers managed TYLCD by spraying. The use of chemicals has 
been partially effective because the vector has to be eliminated before it transmits the virus. 
There are also concerns that the vector may develop pesticide resistance (Lapidot, 2003). 
51 
 
University of Ghana http://ugspace.ug.edu.gh
Majority of the farmers have no idea that Tomato Yellow Leaf Curl Disease Resistant tomato 
cultivars exist and can be used to control the disease. 
Many farmers indicated none of the variety they grow presently is resistant or tolerant to the 
disease. The farmers in all the communities studied suggested that high yield, TYLCD 
resistance and long shelf life must be considered in developing a new variety.  
 
3.4.2 Incidence and Severity of TYLCD  
 
TYLCD was present in all the areas studied. In the middle belt, TYLCD was more severe in 
Tuobodom than Akumadan and in the Upper belt; Vea recorded the lowest severity score and 
Tono recorded the highest severity score.  High incidence of TYLCD was reported in Ashanti 
Region and Upper East Region (Horna et al., 2006; Osei 2013).  The severity recorded in this 
study was lower due to the growth stage of the plants during the survey period. This is 
consistent with the results of Asare-Bediako et al. (2017) who reported that even though 
TYLCD was present in the study area, the severity was low. 
3.5 Conclusion 
This study identified major tomato production constraints and farmers’ preferred traits that 
must be taken into consideration in developing a new variety. There were several tomato 
production constraints in Ghana. However, the TYLCD was the major biotic constraint to 
tomato production in the communities studied. All the farmers were aware of the existence and 
the devastating nature of TYLCD. Majority of the farmers estimated between 50-100% of yield 
loss due to TYLCD. Farmers relied on pesticides in an attempt to control TYLCD. Tomato 
farmers in all the communities studied ranked yield, TYLCD resistance and long shelf life as 
important traits that must be considered in developing a new variety. 
 
52 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER FOUR 
4.0 Diversity analysis of tomato accessions based on morphological traits and SNPs 
markers 
4.1 Introduction 
Tomato is an important ingredient in most Ghanaian meals served in households and hotels. 
Notwithstanding the importance of tomato in Ghana, cultivation over the years has failed to 
reach its potential (Robinson and Kolavalli, 2010). Ghana produced 366,772 tonnes of tomato 
in 2016 with an estimated yield of 7.8 t/ha compared to 10.2 t/ha in Burkina Faso, 15.59 t/ha 
across the African continent and 37 t/ha world average output (FAOSTAT, 2016).  
The low yields recorded in Ghana is attributed to non-availability of quality tomato varieties 
adapted to local production environment, inadequate irrigation facilities as well as prevalence 
of pests and diseases. Tomato production in Ghana is dominated by imported pure lines, 
unadaptable hybrids, farmer-selected cultivars as well as local landraces (Osei et al., 2014; 
MoFA, 2018). Many farmers still prefer to grow local cultivars because of their adaptability to 
local growing conditions. However, these varieties have high water content, many seeds and 
poor colour (Robinson and Kollavalli, 2010).  
In order to alleviate the current challenges of the tomato industry in Ghana, there is the need 
for a comprehensive breeding programme that will address these important constraints of 
tomato production in Ghana. To implement this comprehensive breeding programme, analysis 
of the diversity in the country’s tomato germplasm collection as well as introduced lines is a 
prerequisite (Mohammadi and Prasanna, 2003; Ziaf et al, 2016). 
There have been series of germplasm collections before 1980s to 2012 by the Plant Genetic 
Resources Research Institute of the Council for Scientific and Industrial Research (CSIR-
PGRRI) and National Agriculture Research Programme from all the ten regions in Ghana. The 
2012 tomato germplasm collection extended to two districts in Burkina Faso (Kougoussi and 
53 
 
University of Ghana http://ugspace.ug.edu.gh
Yako), Asian Vegetable Research Development Centre (AVRDC), the Rural Development 
Administration in Taiwan, National Institute of Horticulture and Herbal Science (NIHHS) and 
the Republic of Korea (Osei et al., 2013). Some of this assembled germplasm together with 
imported cultivars have been evaluated for morphological and agronomic traits (Blay et al., 
1999; Kugblenu et al., 2013, Osei et al., 2013; Osei et al., 2015). Morphological traits are 
simple approaches to estimate genetic diversity and cultivar development (Fufa et al., 2005). 
However, morphological traits are prone to phenotypic plasticity (Govindaraj et al., 2015).  
The current development in molecular studies has become important in the establishment of 
diversity in a germplasm pool. Gongolee (2014) evaluated some introduced fresh market 
tomato for genetic variability and adaptability in Ghana using Simple Sequence Repeat (SSR) 
markers. Although, SSR has been used to establish genetic variability and population structure 
in tomato and other species (Aguirre et al., 2016), SNPs have become the choice of DNA 
marker for high throughput analysis of plants due to availability of cost-effective, accurate and 
fast genotyping assays (Zhao et al., 2010 and Corrado et al., 2013). 
This study sought to establish the genetic diversity among the assembled germplasm based on 
morphological traits valued by the fresh tomato market and use SNP markers to characterize 
the collection to provide baseline information for further breeding of the crop. The objective 
of this study was to determine the genetic diversity of tomato germplasm in Ghana based on 
important traits for development of commercial varieties. 
4.2 Materials and Methods 
 
4.2.1 Genetic Materials and Experimental site 
 
A total of 123 accessions (Table S1) consisting of cultivated landraces, commercial varieties 
and breeding lines used for the study were obtained from the Plant Genetic Resource Research 
Institute (PGRRI) of the Council for Scientific and Industrial Research (CSIR), Forest and 
54 
 
University of Ghana http://ugspace.ug.edu.gh
Horticultural Crops Research Centre (FOHCREC), of the University of Ghana (Legon), 
Department of Crop Science, University of Ghana (Legon), Biotechnology and Nuclear 
Agriculture Research Institute (BNARI), Tomato Genetic Research Centre, University of 
California (TGRC, UC), Syngenta Seed (Switzerland), Wienco Ghana Limited, Technisem 
(France) and Agrimat Limited (Ghana). The accessions from FOHCREC, Department of Crop 
Science, Syngenta seed, Wienco and Agrimat were improved lines and varieties. The field 
experiment was carried out at the University of Ghana Farms between latitude 5° 38 45 N and 
longitude 00o 11 13 E. The soil type was Haatso Series and average rainfall was 809 mm. The 
minimum temperature was 23.8 °C and the maximum temperature was 31.2 °C.  
Of the 123 tomato accessions grown in the field, 96 of them were used for the SNPs based 
genotyping. Leaf discs were obtained from freshly harvested leaf of selected plant of each 
accession for genotyping. The Genotyping was performed at LGC Genomics, UK using the 
core set of 384 tomato KASP assays developed during the Solanaceae Coordinated Agricultural 
Project (Sim et al., 2013). These markers were evenly distributed across the tomato genome, 
based on both genetic and physical maps. 
 
4.2.2 Experimental Design and Field Layout 
The experiment was laid out in an augmented design. There were 11 blocks and 11 accessions 
in each block with 2 standard varieties repeated in each block. The two standard varieties were 
Power Rano and Peto Mech. These varieties were used as standards based on their wide 
cultivation by farmers within the country. Two-row plots were used with inter-row spacing of 
rows 1m and intra-row spacing of 0.5 m. The row length was 4.5 m and there were 10 plants 
per row.  
 
55 
 
University of Ghana http://ugspace.ug.edu.gh
4.2.3 Nursery and Agronomic practices 
Tomato seeds of each accession were planted in nursery trays on 1st April 2016. Three seeds 
were planted per cell of the nursing tray and were later thinned to one seedling per cell. Thirty-
day-old seedlings were transplanted to the field. Watering was done when necessary. At two 
weeks after transplanting, N.P.K. 15-151-15 was applied at the rate of 8-10g per plant. At four 
weeks after transplanting, Sulphate of Ammonia was applied at the rate of 5g per plant. 
Calcium nitrate (Fertigation grade) was applied at fruiting at the rate of 150 g/L. 
 
4.2.4 Data Collection 
Vegetative, reproductive and fruit quality traits were recorded based on the International Plant 
Genetic Resources Institute (IPGRI, 1996) tomato descriptor and the International Union for 
the Protection of New Varieties (UPOV, 2011) tomato descriptor.   
4.2.4.1 Morphological Parameters 
1. The plants of each accession were observed and scored as either determinate, semi-
determinate and indeterminate 
2. Foliage density: The foliage of plants per accession were visualized and scored as sparse, 
intermediate and dense. 
3. Leaf coverage: The leaf coverage was scored based on visual observation of how the fruits 
of the plants were covered with leaves and recorded as exposed, intermediate or exposed. 
4.2.4.2 Phenological parameters  
1. Days to first flowering: Number of days from transplanting to the date the first plant 
had an open flower was recorded 
2. Days to first maturity: the number of days from transplanting to the date the first fruit 
turned red. 
56 
 
University of Ghana http://ugspace.ug.edu.gh
3. Reproductive duration was estimated as the difference between days to first flowering 
and days to first maturity. 
4.2.4.3 Yield parameters 
1. Number of fruits per plant: The total number of fruits harvested from each accession 
was counted. 
2. Fruit weight: The total weight of fruits per harvest was recorded and divided by the 
number of fruits 
3. Yield: Total weight of fruits per plot in g was converted to tonnes per hectare. 
4.2.4.4 Fruit quality Parameters 
1. Fruit green shoulders: The absence or presence of green shoulder on fruits was checked 
visually on fully developed fruits before colour breaks. 
2. Green stripes: Matured green fruits were visually observed and scored as either present 
or absent of green stripes. 
3. Shape of fruit: Shape of ten fruits selected at random was observed visually and scored 
as flattened, slightly flattened, rounded, high rounded, heart-shaped, cylindrical and 
pyriform. 
4. Fruit shape at blossom end: Ten ripe fruits were observed visually and the fruit shape 
at blossom end was scored as indented, flat and pointed. 
5. Number of locules: Ten fruits were selected randomly and cut horizontally into two 
halves and the number of locules was counted. 
6. Ribbing at peduncle end: Ten fruits were observed visually and the number of ribbings 
counted was recorded 
7. Total soluble solids (o Brix): Drop of extracted juice from two composite samples (made 
from 5 fruits each) was placed on the prism of a handheld refractometer and the average 
of the two readings was recorded. 
57 
 
University of Ghana http://ugspace.ug.edu.gh
4.2.5 Analysis of phenotypic data 
The phenotypic data were analyzed using GenStat version 12th Edition. Four accessions out of 
the 123 accessions were not included in the analysis of the quantitative traits due to insufficient 
data. Multivariate analysis was also done using XLSTAT 2018.5.51780. Cluster analysis was 
performed using agglomerative hierarchical clustering based on Unweighted Pair-Group 
Average.  
 
4.2.6 Analysis of molecular data 
 
The SNP data from the 348 loci were analyzed and 10 SNP markers that were not informative 
were removed. The GenAlEx 6.501 programme was used for the estimation of the following 
parameters: observed and expected heterozygosities, polymorphic information content and 
principal coordinate analysis. 
 
58 
 
University of Ghana http://ugspace.ug.edu.gh
4.3 Results  
4.3.1 Variability in qualitative traits 
 
There was considerable variation among the genotypes for the qualitative traits studied (Table 
4.1). Of the 123 accessions studied, 6% were determinate, 36 were semi-determinate and 58 
were indeterminate. 11% of the germplasm evaluated had sparse foliage density, 34% had 
intermediate foliage density and 55% had dense foliage density. In terms of leaf coverage of 
fruits, 6% had exposed fruits, 39% had few leaves covering the fruits and 55% had their fruits 
hidden. A total of 67% of the accessions did not have green shoulders. All the accessions, with 
the exception of 1% did not have green stripes. Most of the fruits had pointed shape at blossom 
end (50%), followed by flat shape at blossom end (36%) and the least was indented at blossom 
end (14%). Majority of the accessions had intermediate fruit firmness (49%), followed by firm 
(37%) and soft (14%). The most common fruit shape recorded was flattened (30%), followed 
by highly rounded (28%) and slightly flattened (27%) - (Figure 4.1).  
Table 4. 1: Distribution of qualitative traits of 123 tomato germplasm. 
Traits Description and class Frequency of class % 
  0 1 2 3 4 5 6 7 8 9 
GT 1= Determinate; 2 =Indeterminate  42 58           
FD 3= Sparse; 5= Interminate; 7= Dense    11 34 55  
FGS 0= Absent; 1= Present  67 33         
LC 3= Sparse; 5= Intermediate; 7= Dense       6   3 4   5 5    
FGSt 1= Absent; 9= Present  99      1 
SBE 1= Indent; 2= Flat; 3 =Pointed 36 14 50  
FF 3= Soft; 5= Intermediate; 7= Firm    14  49  37   
FS 1= Flattened; 2= slightly flattened;   30 27 3 28 2 6 2 2  
 3= Rounded; 4= High rounded;             
 5= Heart-shaped; 6= Cylindrical;           
 7= Pyriform; 8= Ellipsoid           
GT= Growth Type; FD= Foliage Density; LC= Leaf Coverage; FGS= Fruit Green Shoulders; FGSt= Fruit Green 
Stripes; SBE= Shape at Blossom end; FF= Fruit Firmness; FS= Fruit Shape. 
 
 
59 
 
University of Ghana http://ugspace.ug.edu.gh
6% 2% 2%
2%
30%
Flattened
Slightly flattened
Rounded
28%
Highly rounded
Heart shaped
Cylindrical
3% 27% Pyriform
Ellopsoid
 
 
Figure 4. 1: Proportion of fruit shape distribution of 123 accessions evaluated  
4.3.2 Genetic variation for vegetative, reproductive and fruit quality traits  
 
There were significant differences (p < 0.01) among genotypes for number of days to first fruit 
set (NDFFS), days to maturity (TM), reproductive duration (RD) and number of fruits per plant 
(Table 4.2).  
Table 4. 2: Mean square for various traits of 119 tomato genotypes 
Sources of  Mean Square 
variation Days to first Days to Reproductive Fruits/plant Brix 
fruit set maturity duration 
      
Genotype 49.27** 142.96** 106.50*** 2339.35*** 0.61 
 
 
4.3.3 Means of various traits studied for the 119 tomato accessions evaluated 
 
Number of days to first fruit set (NDFFS) varied from 11 Days after Transplanting (DAT) in   
GH9185 to 67 DAT in genotype 08TEP080187 (Table 4.3). The NDFFS in GH9185 was 
significantly different from all the other genotypes. Power Rano produced fruits earlier (28 
DAT) than Peto Mech (34 DAT). Days to maturity (TM) also varied from 49 DAT in F1 Cobra 
26 to 101 DAT for 10TEP080188. Genotypes Tom 1999 had the shortest reproductive duration 
60 
 
University of Ghana http://ugspace.ug.edu.gh
(18 DAT) and was not significantly different from F1 Cobra 26 (19), GH9111 (I9), 
08TEP070547 (19), BA-5 Pimpinellifolium x Wosowoso (20), LA3152 (22), and GH9208 (23) 
days.  
Genotype LA2644 had the lowest fruit weight of 1.96 g/fruit whereas genotype Tomato oxheart 
had the heaviest fruit (240 g/fruit). The weight of Peto Mech (38 g/fruit) was significantly 
heavier than Power Rano (31 g/fruit). On the contrary, Power Rano recorded an average of 31 
fruits/plant which was significantly many more fruits than Peto Mech that had an average of 
22 fruits/plant. Genotype GH9078 had the highest number of fruits of 273 fruits/plant and was 
significantly different from all the 119 genotypes evaluated. In terms of yield, GH9310 gave 
the highest yield of 55.46 t/ha. Power Rano yielded 36.79 t/ha but was not significantly 
different from Peto Mech (32.2 t/ha). The expanded table is in the Appendix (Table S2). 
 
 
 
 
 
 
 
 
 
 
61 
 
University of Ghana http://ugspace.ug.edu.gh
Table 4. 3: Means of reproductive, yield component and fruit quality traits of 26 of 119 
tomato germplasm.   
Genotype NDFFS TM RD FPP Weight Yield Brix 
(days) (days) (days) (g/fruit) (t/ha) 
08TEP070547 50 69 19 12 52.51 25.32 3.95 
08TEP080187 67 101 33 17 9.04 18.66 4.41 
10TEP080188 32 101 68 56 4.14 27.65 5.61 
14A112 31 62 31 2 50.8 28.17 4.60 
15TEP070136 52 90 38 4 54.32 19.71 3.60 
Pimpinellifolium x Woso    33 53 20 55 9.99 33.00 5.10 
F1 Cobra 26 30 49 19 19 49.66 39.70 2.90 
F1 Nadira 29 55 26 19 53.78 44.61 2.30 
GH 9114 (Lorry Tyre) 35 62 27 44 30.24 41.33 3.25 
GH9078 30 54 24 273 13.24 46.00 5.45 
GH9107  32 60 28 83 17.91 39.52 4.95 
GH9111 32 51 19 59 8.18 29.75 5.90 
GH9185  11 60 49 50 8.12 20.36 4.50 
GH9208  28 51 23 141 5.6 44.67 5.5 
GH9233  25 52 27 215 3.25 36.23 5.90 
GH9310  28 53 24 176 14.22 55.46 5.71 
Heinz 1370 51 101 49 6 45.24 17.30 4.80 
LA1793 33 93 60 27 17.86 19.63 4.05 
LA1802 38 99 61 6 23.18 15.15 4.50 
LA2644 31 64 33 113 1.96 25.39 6.45 
LA3012 31 101 70 6 20.71 15.78 4.15 
LA3152 34 56 22 7 51.03 24.53 4.50 
LA4285 41 101 60 8 39.47 16.30 4.55 
Larisa 20 58 38 4 73.26 24.03 3.50 
Tom 1999 34 52 18 17 44.38 25.12 4.90 
Tomato Oxheart 33 73 39 20 240.43 52.71 4.41 
GH9193 (Power Rano) 28 56 28 31 30.51 36.79 4.49 
Peto Mech 34 63 29 22 38.22 32.20 4.01 
NDFFS=Number of days to first fruit set; TM=Time to fruit maturity: RD=Reproductive Duration; 
Fr/Pl=Fruits per plant 
 
4.3.4 Principal Component Analysis 
 
The principal component analysis (PCA) indicated that the first five principal components 
explained more than 80% of the phenotypic variation among the 119 genotypes with the first 
two components accounting for 53% of the variation (Table 4.4).  
62 
 
University of Ghana http://ugspace.ug.edu.gh
Table 4. 4: Eigenvalues and cumulative proportion due to thirteen phenotypic traits studied 
among 119 tomato genotypes 
No. PC1 PC2 PC3 PC4 PC5 
Eigenvalue 4.5 2.42 1.38 1.11 1 
Proportion 0.35 0.19 0.11 0.09 0.08 
Cumulative  0.35 0.53 0.64 0.72 0.8 
 
The first principal component was dominated by fruit attributes including fruit shape, ribbing 
at peduncle end, fruit green shoulders (FS), number of locules (NL), growth type (GT), shape 
at blossom end number (SaBE), fruits per plant (FPP) and firmness.  The second principal 
component was dominated by days to first maturity, reproductive duration and yield (Table 
4.5) 
 
Table 4. 5: Contribution of traits to total variation accounted for by the first five principal 
components following analyses of 119 tomato varieties in the field 
 Variables F1 F2 F3 F4 F5 
FS 0.588 0.102 0.031 0.018 0.060 
Ribbing 0.557 0.027 0.233 0.001 0.000 
FGS 0.355 0.001 0.158 0.001 0.214 
NL 0.501 0.036 0.289 0.001 0.021 
GT 0.401 0.010 0.070 0.027 0.024 
SaBE 0.760 0.009 0.002 0.012 0.035 
FPP 0.445 0.130 0.232 0.030 0.003 
WPF 0.243 0.008 0.247 0.019 0.381 
Yield 0.172 0.386 0.004 0.064 0.128 
Firmness 0.404 0.111 0.004 0.005 0.001 
DM 0.035 0.820 0.038 0.034 0.011 
NDFFS 0.014 0.197 0.002 0.728 0.043 
RD 0.022 0.579 0.073 0.173 0.076 
Variables in bold correspond for each variable to factor for which the squared cosine is largest 
 
 
 
 
 
 
63 
 
University of Ghana http://ugspace.ug.edu.gh
4.3.5 Biplot Analysis 
 
 The distribution of 119 tomato accessions in space of the first two principal components from 
the biplot analysis based on 13 traits is shown in Figure 4.2. Based on the angles between the 
vector variables, fruit shape (FS), growth type (GT), shape at blossom end (SaBE), weight per 
fruit (WPF) and firmness were positively correlated. Ribbing (R) was positively correlated with 
fruit green shoulders (FGS), and number of locules (NL) whereas fruit per plant (FPP) and 
yield were also positively correlated. The number of days to first fruit set (NDFFS), 
reproductive duration (RD) and days to maturity (DM) were highly correlated. Fruit per plant 
(FPP) was negatively correlated with yield  
Accessions were grouped into three clusters. The first cluster was made up of late maturing 
genotypes. These included 08TEP080187, 10TEP080188, LA4285, Tom Sonia, Heinz 1370, 
LA1793 and 15TEP070136. The second cluster was made up of local cultivars such as 
genotypes GH 9078, GH 9233, GH 9235. GH 9310 among others. They had the lowest fruit 
weight but produced the highest number of fruits. Genotypes GH 9185, GH 9239 GH 9128, 
GH 9163 and GH 9107 among others had the highest number of locules and the highest number 
of ribbings. The third cluster was made up of commercial and improved varieties. They were 
heavy and firm (Figure 4.2).  
 
64 
 
University of Ghana http://ugspace.ug.edu.gh
6
2 - 031 LA1802
DM
5 LA4285
08TEP080187
2-175 Tom SoniaHeinz 1370
RD
10TEP080188
LA1793
4
15TEP070136
3
NDFFS
LA2-225
2 LA2369 LA0348
GH9185 GH9285 Tomato Oxheart
NL 08TEP07LA05241627 08TEP070547
Ribbing TLrAop32im51ec
1 GH 923G9H 9128 Money maker 08TEP070728
GH 9163 GH9116 DyvinLeA R34Z72 WPF
GH9237 LA2644
GH9107 GH9
G2P2Ho4 w91eG5r H8R a9n1o1F4GGSH9238 GH9200 Tom 4223
GH9247 LA3152 Larisa Zumorned
0
GH9184 08TEP070545GH9166 GHG9H190192 1 GH9305 GH 9281 08GTHEP90077035 50 Tropic ToLmA2 T8A2M1GH9160 GH9111 LA3044 P Strain B
GH9104 GH9251 Tomaland F1 JaTgouamr  T2+a0Np0ir0vNL ich
aena14A112
GH 9137 GH9207 14TRTAoPoTGmem1tTG 14TAT101342 1a
o034 T 1T3MT0Ae8Tc1h0
SaBE
o3m71 aDtIoA13BN8OU2UC7 82
-1 BAB-A4 -W1 Wildi l*d  N*
H
L R
9o1m52a  Tomato TO 687 F1 Hybrid
GH9098 BA-5 Wild * WosoF08TEPw
1o Tsohorgal NS 504070549 Prado F1 Boma VF UN
T1o6m124 1ITNEADTI1O01394 Tom MARIA
GH9311 GH9243 
GH9150 1124TTAATT0100N116k34a51n3sah HT
EM14STDA 2T011001 3F815
GH9131 LA4T4o4m2  191949TA
STh1a0k1ti3m8a3n
GHGH9233 -2 G9H20982 35
GH9246 GH9190 14A113 FS
FPP NS577 T
Firmness
F1 CoFo1bm rNa  aE2dM6irEaR
GH9310 GH9078
-3
Yield
-4
-5 -4 -3 -2 -1 0 1 2 3 4
F1 (34.59 %)
Active variables Active observations
 
Figure 4. 2: Biplot analysis of thirteen traits of the 119 tomato accessions studied 
 
4.3.6 Cluster Analysis 
 
The hierarchical cluster analysis grouped the 119 tomato accessions into two clusters with 
Tomato oxheart as an outlier (Figure 4.3). Cluster I was made up of 81 genotypes (green 
colour), cluster II (blue) was made up of 37 genotypes. The variance within cluster II was about 
four times the variance in cluster 1(Table 4.6). 
 
65 
 
F2 (18.58 %)
University of Ghana http://ugspace.ug.edu.gh
Table 4. 6: Class attributes obtained from the hierarchical cluster analyses among 119 tomato 
accessions based on thirteen traits in a field evaluation 
Class 1 2 3 
Genotypes 81 37 1 
Sum of weights 81 37 1 
Within-class variance 719.476 3035.482 0.000 
Maximum distance to centroid 61.706 168.780 0.000 
 
 
Genotypes in clusters I and II had about 54 % similarity. Genotype tomato oxheart was very 
high yielding, had the heaviest fruits, few fruits per plant, fruit green shoulders, many ribbings, 
many locules, heart-shaped, pointed shape at fruit blossom end, soft fruit and had determinate 
growth. Cluster II was mainly made up of the Ghanaian accessions which were largely 
characterized by medium to very high yielding, low fruit weight, many fruits per plant, many 
ribbings, many locules, flattened or slightly flattened fruit shapes, flat or indented shape at 
blossom end, mostly intermediate firmness, semi-determinate and indeterminate growth. Some 
of these genotypes had very high brix. Cluster I was made up of the commercial varieties, 
improved lines, introduced lines and a few local accessions. The three most widely grown 
accessions in Ghana were in cluster I. The commercial varieties were typically medium 
yielding, medium in weight, not too many fruit per plant, less ribbings, few locules, slightly 
flattened, rounded to high rounded fruit shape, flat or pointed shape at blossom end, 
intermediate to firm fruits with determinate or semi-determinate growth.  
 
66 
 
University of Ghana http://ugspace.ug.edu.gh
 
 
0.5432015
0.5932015
0.6432015
0.6932015
0.7432015
0.7932015
0.8432015
0.8932015
0.9432015
0.9932015
 
 Figure 4. 3: Clustering based on reproductive and fruit quality traits of 119 tomato accessions 
67 
 
Similarity
GH9185 
10TEP080188
GH 9239 
GH9150 
LA4442
GH9109 
F1 Thorgal
BA-5 Wild * Wosowoso
GH9111
GH9098 
GH9251 
GH9160 
GH9190
GH9184 
GH9104 
GH9121 
GH 9158 
GH9224
GH9107 
GH9310 
GH9078
GH9233 
GH9235
GH9208 
GH9311 
NS577
GH9152 
GH9305
BA-1 Wild * Roma 
BA-4 Wild * Wosowoso
GH9243 
GH9166
GH 9137 
GH9246 
GH9207
LA2644
GH9131 
Tomato Oxheart
14TAT101353
Tom INDIO
14TAT101385
14TAT101382
Roma Tomato
14TAT101394
Tom TAMP
08TEP070550
Tomaland
12TAT001641
Tom 2000
NL
Tom EMER
F1 Nadira
F1 Cobra 26
14A113
Prado F1
14TAT101383
NS 504
Boma VF
EMSD 2010 F1
08TEP070549
Larisa
Shalctiman
Tom DIABOU
F1 Jaguar +
08TEP070547
Tom 1999
NO7
Tropimec
LA3251
UC 82
Tom MARIA
08TEP070546
LA3044
Zumorned
LA3152
Dyvine RZ
Strain B
Tom 4223
14TAT101342
Tom3308
14A112
Tropic
Tom Sonia
LA2-225
LA0348
15TEP070136
08TEP070728
Nkansah HT
GH 9163 
UN1621E
Tomato TO 687 F1 Hybrid
GH9247 
GH9073 
Power Rano
GH9116 
GH9237 
GH 9114
GH9128 
GH 9281 
GH9238 
GH9200 
Tapiche
08TEP070545
Money maker
LA2821
Peto Mech
14TAT101371
LA2369
Heinz 1370
2 - 031
LA3472
Nirvana
LA2127
GH9285 
08TEP080187
LA1793
2-175
LA1802
LA4285
University of Ghana http://ugspace.ug.edu.gh
4.3.7 SNPs analysis of tomato accessions 
  
Majority of the markers (97.04%) were polymorphic but 10 (2.96%) were monomorphic. A 
total of 330 of the 338 markers typed more than 90 individuals at a locus (Table 4.7). The 
observed homozygosity ranged from 0 to 0.94 with an average of 0.13 while the expected 
heterozygosity ranged from 0.06 to 0.50 with an average of 0.38. The Polymorphic Information 
Content (PIC) values also ranged from 0.06 to 0.38 with an average of 0.30. Of the 338 markers, 
61% had a PIC of 0.30 to 0.38. The expanded table is in the Appendix (Table S4) 
Table 4. 7: Range of key descriptive statistics for measuring the informativeness of 48 of the 
338 SNPs markers based on 96 tomato accessions  
  
Locus N Hobs HExp PIC Locus N Hobs HExp PIC 
  
S48097 82 0.00 0.25 0.22 S11092 90 0.13 0.46 0.35 
  
S13458 95 0.00 0.06 0.06 S11205 96 0.15 0.39 0.31 
  
S100154 96 0.10 0.49 0.37 S11205 96 0.15 0.39 0.31 
  
S100197 94 0.16 0.28 0.24 S11231 95 0.20 0.50 0.37 
  
S100205 96 0.10 0.49 0.37 S11281 95 0.06 0.19 0.17 
  
S100240 96 0.08 0.36 0.29 S11543 95 0.21 0.46 0.35 
  
S100246 93 0.08 0.09 0.09 S11588 96 0.06 0.10 0.09 
  
S100269 96 0.16 0.35 0.29 S12200 93 0.16 0.50 0.37 
  
S100516 96 0.16 0.50 0.37 S12201 96 0.20 0.44 0.34 
  
S100561 96 0.22 0.48 0.36 S12212 94 0.12 0.49 0.37 
  
S100691 96 0.07 0.44 0.34 S12213 96 0.12 0.49 0.37 
  
S100743 96 0.16 0.50 0.37 S12372 96 0.16 0.42 0.33 
  
S100810 94 0.04 0.17 0.16 S12414 94 0.14 0.43 0.34 
  
S100981 96 0.03 0.18 0.16 S12421 91 0.11 0.25 0.22 
  
S100987 96 0.12 0.29 0.24 S12501 95 0.05 0.09 0.09 
  
S100995 95 0.17 0.46 0.35 S12535 96 0.06 0.12 0.11 
  
S101009 96 0.05 0.18 0.16 S12536 96 0.06 0.12 0.11 
  
S101067 96 0.08 0.40 0.32 S12638 96 0.17 0.48 0.36 
  
S101068 95 0.08 0.27 0.23 S12647 96 0.23 0.49 0.37 
  
S101085 96 0.12 0.23 0.20 S12656 94 0.12 0.29 0.25 
  
S10372 96 0.14 0.34 0.28 S12664 95 0.02 0.08 0.08 
  
S10686 96 0.13 0.29 0.25 S12718 96 0.17 0.44 0.34 
  
S10796 96 0.07 0.20 0.18 S12749 95 0.28 0.44 0.34 
  
S10958 96 0.13 0.33 0.28 S17645 96 0.94 0.0.50 0.38 
N=Number of individuals typed at the locus, Hobs=Observed heterozygosity, Hexp=Expected 
heterozygosity, PIC=Polymorphic Information Content
68 
 
University of Ghana http://ugspace.ug.edu.gh
Among the 96 accessions genotyped at 338 loci, the least number of heterozygous loci was 1 
and the maximum number of heterozygous loci was 137 (Table 4.8). Of the 39 of local 
accessions genotyped, 12 of them had the lowest number of heterozygous loci values ranging 
from 1-10 (0.003-0.03 heterozygosity) and 9 genotypes had the highest number of 
heterozygous loci between 50 (0.15 heterozygosity) to 124 (0.37 heterozygosity). Of the 18 
UC Davis accessions genotyped, 2 had the highest number of heterozygous loci values of 30 
and 34 respectively. Five (5) out of 15 accessions received from FOHCREC had the lowest 
number of heterozygous loci between 1 (0.003 heterozygosity) and 3 (0.009 heterozygosity). 
All the accessions received from Wienco recorded high heterozygosity (0.10-0.40).  The three 
most widely grown accessions (Peto Mech, Power Rano and GH9114) had heterozygous loci 
of 1, 2 and 3 respectively. The expanded table is in the Appendix (Table S5). 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
69 
 
University of Ghana http://ugspace.ug.edu.gh
Table 4. 8: Level of heterozygosity of 82 of the 96 tomato accessions genotyped with 338 
SNP markers   
 #  #  Het Sample #  #  Het Het 
Sample Loci Het Loci loci 
 loci   
GH 9131 337 1 0.003 GH_9243 333 17 0.05 
  
Nkansah HT 335 1 0.003 BA-5xWoso 333 18 0.05 
  
Peto Mech 297 1 0.003 GH 9237 336 19 0.06 
  
Money maker 338 2 0.006 GH 9235 335 19 0.06 
  
LA3472 338 2 0.006 GH 9107 330 21 0.06 
  
GH 9128 337 2 0.006 GH 9160 336 22 0.07 
  
GH_9200 337 2 0.006 GH 9121 333 22 0.07 
  
LA2-225 337 2 0.006 UC_82 333 26 0.08 
  
Tomaland 337 2 0.006 GH 9305 334 27 0.08 
  
LA1793 336 2 0.006 GH 9104 330 27 0.08 
  
LA3012 335 2 0.006 Tropimec 334 28 0.08 
  
Power Rano 335 2 0.006 LA3473 338 30 0.09 
  
Boma VF 334 2 0.006 GH 9238 335 31 0.09 
  
GH 9073 334 2 0.006 GH 9078 336 32 0.10 
  
LA4440B 333 2 0.006 GH 9163 334 32 0.10 
  
UN1621E 332 2 0.006 LA1018 337 34 0.10 
  
Heinz 1370 337 3 0.009 GH_9247 333 34 0.10 
  
LA2821 337 3 0.009 Roma tomato 310 32 0.10 
  
GH 9114 336 3 0.009 BA-1xRoma 324 38 0.12 
  
LA4442 336 3 0.009 GH 9109 333 40 0.12 
  
LA3044 336 3 0.009 GH 9116 313 44 0.14 
  
LA3152 336 3 0.009 GH 9207 331 50 0.15 
  
LA2644 336 3 0.009 #15063 335 63 0.19 
  
LA4440 335 3 0.009 GH 9285 331 65 0.20 
  
GH 9184 335 3 0.009 NS577 330 65 0.20 
  
LA2369 335 3 0.009 GH 9285 331 65 0.20 
  
LA3151 334 3 0.009 NS577 330 65 0.20 
  
LA2127 338 4 0.012 GH 9224 334 71 0.21 
  
LA0348 338 4 0.012 GH_9152 332 71 0.21 
  
GH 9281 334 4 0.012 GH_9098 331 71 0.22 
  
GH 9233 331 4 0.012 Shaktiman 334 76 0.23 
  
GH 9310 334 5 0.015 Nirvana 334 80 0.24 
  
GH 9190 333 5 0.015 Dyvine_RZ 335 81 0.24 
  
GH 9137 333 7 0.021 F1_Nadira 328 89 0.27   
Tomato Oxheart 333 9 0.027 Tom_Sonia 333 100 0.30 
  
GH 9239 332 10 0.03 NO7 332 104 0.31 
  
LA1802 336 11 0.033 Zumorned 335 108 0.32 
  
GH 9158 333 14 0.042 F1_Jaguar+ 332 108 0.33   
GH 9246 334 15 0.045 GH_9150 333 109 0.33 
  
BA-4xWoso 337 17 0.05 Tom_TAMP 329 133 0.40 
  
GH 9311 335 124 0.37 F1 Thorgal 332 137 0.41 
# Loci=Number of Loci; #Het Loci=Number of heterozygous loci; Het=Heterozygosity
70 
 
University of Ghana http://ugspace.ug.edu.gh
4.3.8 Principal Coordinate Analysis 
 
Most of the variation was accounted for by variation among individuals within populations 
(52%) compared to variation within individuals (34%) or among populations (16%) though all 
three sources of variation were significant (Table 4.9). The first three principal coordinate axis 
explained more than 36% of the total variation (Table 4.10).  
 
Table 4. 9: Mean square for 119 accessions based on 338 SNP markers. 
Source df MS Variation % 
Among Populations 6 358.420*** 16% 
Among Individuals within populations 89 95.341*** 52% 
Within Individuals 96 22.396*** 32% 
 
 
Table 4. 10: Percentage of variation explained by the first 3 axes among 96 tomato 
accessions based on 338 SNP markers  
Axis PC 1 PC 2 PC 3 
Percentage (%) 20.3 8.6 4.73 
Cumulative Percentage (%) 20.3 28.9 33.62 
 
Majority of the accessions from PGRRI were distributed in the first quadrant. Power Rano, 
Peto Mech and most of the commercial materials were in the second quadrant. Most of the 
accessions from UC Davis were scattered in the third and fourth quadrants (Figure 4.4). 
 
 
71 
 
University of Ghana http://ugspace.ug.edu.gh
Peto_Mech
LA3044
#15LA0633151
NS577 ToLA4N44iTr0vo
mamn__Ma4A2R23IA
Tropimec
BA-1xRoma F1_NaLNdAiOr3
Sh T1
15
oTa74moAmN
2
_1SE_1_M353E0R48
UC_82 LA444E0M
Fa1FSkT_1DtoT_i_mhJ2aoa_0grnS1ugo0arl+B Zumor
n_niFea1Nkansah_HT d
GGHGHHG__9
_
H90
927148930 Tropic Tom_INDIO
GH_ _9121 TomT_oTmA_MDPIABOUGGH9GH_2H9_319_3039911063 GH_9150 ToTmo_m2_010909H9einz_1370Power_Rano AGRIMAT
GHG_GG9GHGH0HH_H_9_9_9_8919932251G10348855H65372_9251 NLGGHH__99212044BAB-A4-x5WxWosooso
BNARI
GH_9207 GHL_A93244773
Roma_tomato Legon
GH_9239
GH_9107 LA2369
GH_9160 LA1802 PGRRIGH_9184 LA0348
GH_9285
LA3012 TechnisemGH_9166
UCDavies
DGyvHi_n9e3_1R1Z
LA4442 LA2-225 WIENCO
GH_9281 Boma_VFLA2644 GH_9131Tomato_Oxheart
GHG_H9_1911416
UGNGLA2127 GH1
H_69_9238H_9202170E30
GH_9128GH_9237
LLAA21802118
LA1793
LA347MT2oomnaelya_nmdaker
Coord. 1
 
Figure 4. 4: Principal Coordinate Analysis of 96 tomato accessions based on 338 SNP 
markers 
 
 
 
 
 
 
 
 
 
72 
 
Coord. 2
University of Ghana http://ugspace.ug.edu.gh
 
4.3.9 Association between SNP markers and shape at blossom end 
 
Shape at blossom end appeared to have association with the SNP markers (Table 4.11). The 
PCoA showed that the first three axes explain 65.41% of total percentage variation for the 
association of fruit shape at blossom end with the SNP markers.  
 
Table 4. 11: Percentage of variation explained by the first 3 principal components for 
association between 338 SNPs and fruit shape at blossom end 
Axis PC 1 PC 2 PC 3 
Percentage (%) 51.5 9.1 4.81 
Cumulative Percentage (%) 51.5 60.6 65.41 
 
 
There was no association between the SNPs and all the traits studied with the exception of 
shape at blossom end. The association between the SNPs and fruit shape at blossom end 
grouped the accessions into II clusters. The first cluster was made up fruits with flat blossom 
end shape and the second cluster was made up of fruits with pointed blossom end shape (Figure 
4.5). 
 
73 
 
University of Ghana http://ugspace.ug.edu.gh
Principal Coordinates (PCoA)
Peto_Mech
NS577
LA3152LA3151
UC_82
GH_9246
GH_9078 #1T5o0m63_4223
GH_92B3A3-1xRoma
flat
14A113
GH_9239 GH_9107 Tom_MARIA
GGHH_G_99H103_G197H_9G1H2_19251
Roma_toTmomat_o330L8A3044
08163 indentedGH_91G6H0G_H92_941390
GH_G9H18_491 Nkansah_
EHSMhTSaDkt_i2m0a1n0_F1GH_920B87A5-4xWoso NO7Tom_EMERGGGHGHH_H_9_9_91291023094B04
Nirvana
A5-5xWoso TFo1m__ZN1uaN99S
pointed
GH_9235 GH_9150 F1_TThrmodoir
_9a504
F1_Jagruopgariamnrl+eedc
LAG2H1_2G971H5_29281 GH_9166Tropic Tom_INDIOGH_91G5LH8A_2962447 ToWmo_s2o0w0o0Tsoo _Sonia
GH_9116 T m_TToAmM_PDIABOUPower_Rano
GH_9311 LA1802
GDHy_v9i2n8e5_RZ LA0348
GUGHNH_19_62923GH_912801
87E3 LAL4A4147293GH LA2821LA_19011381 LA2369 Heinz_1370GH_9200 BomTao_mVaFto_Oxheart
GH_9237 LA3472TMooLmAnae2ly-a2_n2md5aker
Coord. 1
 
Figure 4. 5: Principal Coordinate Analysis for 96 tomato accessions based on association 
between 338 SNPs and Fruit shape at blossom end 
 
 
 
 
 
 
 
 
 
 
 
 
74 
 
Coord. 2
University of Ghana http://ugspace.ug.edu.gh
4.4 Discussion 
The success of a crop improvement programme depends on the extent of genetic variability 
existing in the germplasm. The extent of genetic variability can determine the pace and 
quantum of genetic improvement through selection or hybridization.  
This study revealed the level of diversity within the tomato accessions based on morphological 
and molecular markers. There was significant variation among the accessions for the various 
traits studied and this agrees with the findings of Osei et al., (2014). The result is consistent 
with the findings of Kumar et al. (2013) who reported significant variation in days to maturity, 
number of fruits per plant and average fruit weight. Tembe et al. (2018) also reported 
significant variation in number of fruits per plant, fruit weight, fruit length and diameter. 
 It was found out that most of the local accessions had dense foliage density compared to the 
improved materials. The unimproved accessions were either semi-determinate or intermediate  
Consumer and farming community preference for tomato traits vary from geographical area to 
the other throughout the world. Fruit shape, size, ribness and firmness are major traits 
consumers look out for in purchasing tomato. In this study, the predominant shape observed in 
the unimproved accessions was flat type and this agrees with the work done by Brewer et al. 
(2007) and Patil (2015). However, the improved varieties were typically rounded and high 
rounded and this agrees with the assertion that breeding techniques focused on developing 
rounded shape rather than flattened shape (NCARS, 1990). It was also observed that fruits that 
were flat or slightly flat were either soft or intermediate and ribbed compared to the high 
rounded shape fruits that were firm and smooth. Firmness of fruit plays an important role in 
the shelf life of tomato. Accessions that are pure lines based on the molecular analysis and were 
very firm can be exploited in developing fruits with long shelf life.   
75 
 
University of Ghana http://ugspace.ug.edu.gh
 The unimproved accessions had very high brix compared to the improved accessions. The brix 
range of the accessions evaluated in this study agrees with the study of other authors who 
reported total soluble solids content ranged from 3.17 to 5.00 Brix (Shankar et al. 2013); 338 
to 10.25 0 Brix (Reddy et al., 2013); 5.58 to7.53 0 Brix (Manna and Paul, 2012). Krishna et al. 
(2018) reported that breeding for bigger fruits dilutes the soluble sugar contents.  
Yield is an important trait for both fresh market and processing, however, yield and yield 
component traits. The results of this study on variation in the weight per fruit and fruit yield 
agrees with various works such as 18-147 g (Chernet et al., 2013); 40.2-105.53 g (Shankar et 
al., 2013); 23-102.33 g (Reddy et al. 2013); 18-162 g and yield of 1.41-8.24 kg/plant (Patil, 
2015) 
Fruit per plant had negative correlation with weight per fruit but positively correlated with 
yield. This is because accessions with many fruits had smaller fruit sizes and were high 
yielding. This is is consistent with the findings of Tembe et al. (2018). However, Henareh et 
al. (2015) reported negative significant correlation between number of fruits per plant and 
yield. It was attributed to the large number of cherry tomato in their collection. 
The 119 tomato germplasm studied were grouped into two distinct clusters. The outlier 
genotype (Tomato Oxheart) was made of one unique genotype that was high yielding, heavy 
and heart shaped. The accession can be utilized in improving fruit size. Cluster II was made up 
of genotypes that were not appealing to the fresh market but might be utilized for improving 
other traits particularly earliness. Genotypes in cluster I was largely made up of improved 
materials including the two most preferred varieties in Ghana. The few unimproved accessions 
found in this cluster can be utilized in a breeding programme for the fresh market. It was 
surprising to find the two most preferred varieties in Ghana among cluster II. This was 
intriguing because Power Rano was local accession and Peto Mech was an imported variety. 
76 
 
University of Ghana http://ugspace.ug.edu.gh
The number of heterozygous loci also had wide value range. The expected heterozygosity and 
polymorphic information content are used to measure the genetic diversity (Sim et al., 2012). 
From the results, few SNPs loci had low PIC values, which indicates a low allelic variation in 
the marker loci and their distribution among the tomato accession. Many loci (61%) showed 
PIC values of 0.30 to 0.38. PIC of 3 indicates moderate informativeness of the SNP markers 
used (Mateescum et al., 2005). Corrado et al. (2013) reported 30% of 175 SNPs had PIC of 
0.30 to 30.37 in 214 tomato accessions. Cortes et al. (2011) reported PIC of < 0.20 and 
maximum value of 0.500 in common bean. Majority of the genotypes he reported had PIC of 
0.40. The observed heterozygosity had a wider range compared to the expected heterozygosity. 
Observed heterozygosity was as high as 0.94. The first two principal components in this study 
(20.3% and 8.6%) were lower than 22% and 16% reported by Sim et al. (2012), using 7,720 
SNPs (SolCAP SNP array) on a collection of 426 tomato accessions. The first three principal 
components are the most important in reflecting the variation with accessions (Adebisi et al., 
2012) and therefore since the variation of the principal components was higher than 25%, then 
the information can be utilized together with cluster analysis to identify related genotypes 
(Ahmad et al., 2015). There were larger populations overlap for both coordinates, though major 
grouping can be seen for PGRRI, UC Davies and improved accessions.  
It was realized that most of the accessions except those from IPRRI (local cultivars) and UC 
Davis had a high level of heterozygousity. The three most cultivated accessions tomato in 
Ghana, namely; Peto Mech, Power Rano and Lorry had low heterozygous loci and were widely 
separated in the PCoA. The genetic distance among tomato accessions gives an indication of 
the genetic relatedness.  
 
 
77 
 
University of Ghana http://ugspace.ug.edu.gh
4.5 Conclusion  
The accessions were grouped into two clusters. Most of the Ghanaian accessions were in cluster 
II and had many fruits, ribbing at peduncle and locules. The fruits were also soft; making them 
unsuitable for fresh market. Based on both morphological traits and molecular markers the 
widely grown accessions; Peto Mech, Power Rano and GH9114 were in the same cluster as the 
improved varieties. The SNPs markers used distinguished pure lines and heterozygous lines as 
well as established the genetic similarity among accessions. Peto Mech and Power Rano were 
in the same cluster. Accessions from UC Davis area valuable addition to diversity in the 
accessions from PGRRI. Pure lines with good fruit quality traits can be utilized in future 
breeding programmes.  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
78 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER FIVE 
5.0 Screening of tomato accessions for TYLCD resistance and identification of 
resistance genes 
5.1 Introduction 
Tomato production in Ghana is confronted with many constraints particularly pest and diseases. 
Among the diseases of tomato in Ghana, Tomato Yellow Leaf Curl Disease (TYLCD) is the 
most devastating which results in low or no yield (Osei et al., 2012).  
Considering the worldwide importance of TYLCD, much effort has been devoted to its control. 
Earlier TYLCD prevention techniques focused on physical and chemical barriers that prevent 
whiteflies access to the plants. Recently, cultural practices aiming to reduce the viral inoculum 
load have led to some significant success (Ucko et al., 1998; Salati et al, 2002). However, the 
most viable option today is breeding varieties that are resistant to the virus or the whitefly 
vector (Polston and Lapidot, 2007). Six TYLCD resistance genes; Ty-1/Ty-3, Ty-2, Ty-3, Ty-4, 
ty-5, Ty-6 have been mapped from wild tomato species and introgressed into cultivated tomato 
(Ji et al., 2007 a, b, c; Verlaan et al., 2013; Hutton and Scott, 2015; Hanson et al., 2016). 
Even though various management techniques and resistant cultivars have been developed and 
deployed worldwide, TYLCD is still devastating in West Africa because of delayed adoption 
of effective TYLCD control techniques leading to very low yields and increased tomato 
imports. 
In Ghana, most tomato research works have focused on screening exotic and local germplasm 
for resistance or susceptibility to the TYLCD (Osei et al., 200; Ossom 2012; Asare-Bediako et 
al., 2017; Segbefia et al., 2018). However, little effort has been made on identifying the known 
genes that confer resistance to the local TYLCV strains in Ghana and subsequently 
introgressing these genes into locally adapted lines. 
79 
 
University of Ghana http://ugspace.ug.edu.gh
Hence, the objective of this work was to identify TYLCD resistant materials and to introgress 
known TYLCD resistance genes into locally adapted cultivars.   
5.2 Materials and Methods 
5.2.1 Screening for known Ty gene Loci in the assembled germplasm  
 
Primers for known TYLCD resistance genes (Table 5.1) were used to confirm or amplify new 
resistance genes in tomato accessions. The accessions used for the study were 21 as listed in 
Table 5.2. Some accessions were selected based on reported level of tolerance to TYLCD. 
Some accessions had different combinations of TYLCD resistance genes while some were 
selected based on their wide cultivation in Ghana. Other accessions were dropped because of 
insufficient seeds. The experiment was carried out at the Biotechnology Centre, University of 
Ghana.  
Table 5. 1: List of primers used in the amplification of TYLCD resistance genes 
Ty Marker Sequence PCR product (bp) 
gene name 
Ty-2 T0302 F: TGGCTCATCCTGAAGCTGATAGCGC Resistant: 900 
R: AGTGTACATCCTTGCCATTGACT Susceptible: 800 
 
Ty-2 P1-16 F: CACACATATCCTCTATCCTATTAGCTG Resistant: 300 
R: CGGAGCTGAATTGTATAAACACG Susceptible: 600 
 
Ty-3 P6-25 F: GGT AGT GGA AAT GAT GCTGCTC Resistant: 450, 650 
R: GCT CTG CCT ATT GTC CCA TAT ATA Susceptible: 320 
ACC 
ty-5 TM273 F: GGTGCTCATGGATAGCTTAC Resistant:175 
R: CTATATAGGCGATAGCACCAC Susceptible 170 
Ty-6 SLM10-46 F: TCGAGCTGGTACATAGCTTCAT Resistant: 255 
R: CATCTGACACTTGGTCCAGAA Susceptible: 220 
 
 
5.2.1.1 DNA Extraction  
 
 Fresh leaf samples (200 mg) were harvested from the tomato genotypes at 14 days after 
germination and DNA was extracted using the CTAB method (Lodhi et al., 1994). The quality 
80 
 
University of Ghana http://ugspace.ug.edu.gh
of the DNA was determined by running the extracted DNA on 1% agarose gel stained with 
ethidium bromide. The DNA was stored in −20° C for later use. 
 
Table 5. 2: List of Accessions used for detection of known TYLCD resistance genes and 
field screening in Ashanti and Upper East Regions 
 Accession Code Reported TYLCD Source 
resistance genes 
1 AVTO1219 D1 Ty-1/Ty-3, Ty-2 AVRDC 
2 AVTO1311 D2 Ty-1/Ty-3 AVRDC 
3 AVTO1429 D4 Ty-2, Ty-3 AVRDC 
4 AVTO1424 D5 Ty-2, Ty-3 AVRDC 
5 AVTO9802 D6 Ty-1, Ty-2 AVRDC 
6 AVTO0301 D8 Ty-2 AVRDC 
7 AVTO1350 D9 Ty-1, Ty-2 AVRDC 
8 GH9233 (Pimplifolium)  G5 unknown PGRRI 
9 Pimpinellifolium x Wosowoso G121 unknown BNARI 
10 LA4440a G153 unknown UC Davis 
11 GH 9193 (Power Rano) C-1 unknown PGRRI, Bunso 
12 GH 9114 (Lorry Tyre) G9 unknown PGGRI, Bunso 
13 Peto Mech  C-2 unknown Agrimat 
14 Nadira N unknown Technisem 
15 Tomato T0 687 F1 Hybrid G47 unknown Syngenta  
16 Tapiche G48 unknown Syngenta  
17 P005A A unknown Farmer 
18 P005B B unknown Farmer 
19 Thorgal TH unknown  Technisem 
20 Wosowoso W unknown Crop Science 
21 Power R unknown Farmers 
 
 
5.2.1.2 Polymerase Chain Reaction (PCR) 
 
A total of 25µl reaction mix was used for the amplification of the known TYLCD resistance 
genes. The reaction mix contained 1x OneTaq, 2X Master Mix with Standard Buffer, 0.2µM of 
forward and reverse primers and 100 ng of DNA. The amplification was done in a pre-heated 
Applied Biosystems 2720 Thermal Cycler with different conditions for each primer (Table 
5.3). 
The PCR products were separated on 1.5% agarose gel stained with ethidium bromide and 
visualized under UV light. 
81 
 
University of Ghana http://ugspace.ug.edu.gh
Table 5. 3: PCR conditions for primers used in the amplification of TYLCD resistance genes. 
P1-16  (Hanson, 2016) P6-25   (Ji et al., 2010) TM273 (Hanson, 2016) 
   
Temp. (℃)     Time(min) Temp.(℃)     Time(min) Temp.(℃)     Time(min) 
1. 95                      10:00 1. 94                  04:00 1. 95                 5:00 
2. 94                       0:30 (34x) 2. 94               00:30 (35x) 2. 94                 0:30 (34x) 
3. 55                       0:45 3. 53               1:00  3. 55                 0:30 
4. 72                       0:45 4. 72               1:00 4. 72                 0:30 
5. 72                       5:00 5. 72                10:00 5. 72                 5:00 
6. 20                       ∞ 6. 20                 ∞ 
SLM10-60,  (Hanson, 2016)   
 
Temp. (℃)     Time(min) 
1. 95                       5:00 
2. 94                       0:30 (34x) 
3. 58                       0:30 
4. 72                       0:30 
5. 72                       5:00 
6. 20                       ∞ 
 
 
 
5.2.2 Field screening of tomato accessions against TYLCD in Akumadan and Vea and 
molecular confirmation of viral DNA in infected Plants 
 
 A total of 21 tomato accessions (Table 5.2) were screened for their reaction to TYLCV in two 
disease hotspots at the Dam site in Akumadan (Ashanti Region) and Vea Irrigation Site (Upper 
East Region) to ascertain the resistance of the tomato accessions to the local strains of TYLCV 
present in the areas.  
 
 
 
 
 
82 
 
University of Ghana http://ugspace.ug.edu.gh
5.2.2.1 Experimental design 
 
Both field experiments were laid out as Randomized Complete Block Design (RCBD) with 
three (3) replications. Every genotype was planted in two rows of 10 plants per row. The rows 
were 1m apart. Plants within a row were 0.5 m apart and the row length was 4.5 m.  
 
5.2.2.2 Agronomic practices 
 
Tomato seeds of each accession were sowed in nursery trays. Thirty-day-old seedlings were 
transplanted to the field. Watering was done when necessary. At two weeks after transplanting, 
N.P.K. 15-151-15 was applied at the rate of 10g per plant. At four weeks after transplanting, 
Sulphate of Ammonia was applied at the rate of 5g per plant. Calcium nitrate (Fertigation 
grade) was applied at fruiting at the rate of 150 g/L. Fruit borers were controlled with Dipel at 
the rate of 100 g/100 L of water. 
 
5.2.2.3 Molecular confirmation of viral DNA in infected leaf samples 
 
Fresh leaves of infected plants of 21 tomato accessions were sampled at 60 days after 
transplanting (DAT) from both locations and stored on ice and brought to the Biotechnology 
Laboratory, University of Ghana for DNA extraction using CTAB method. 
 
5.2.2.4 Polymerase Chain Reaction 
 
A total of 25µl reaction mix was used for the amplification of the viral DNA in the infected 
samples. The reaction mix contained 1x OneTaq, 2X Master Mix with Standard Buffer, 0.2µM 
of forward and reverse primers and less than 100 ng of DNA. Three (3) degenerate and two (2) 
specific primers (Table 5.4) were used. PCR conditions used for all the five primers were; 94° 
83 
 
University of Ghana http://ugspace.ug.edu.gh
C for 1 minute, 94° C for 1 min (30 cycles), annealing temperature of 53° C for 1 min, 72° C 
for 1 min, final extension of 72° C for 10 min and held at  4° C infinity. The PCR products 
were separated on 1.5% agarose gel stained with ethidium bromide and visualized under UV 
light. 
Table 5. 4: Primers used in the amplification of TYLCV in infected samples 
Marker Name Primer sequence References 
PARc1496/PAL1v1978 F:5'GCATCTGCAGGCCCACATYGTCTTYCCNGT  Rojas et al. 
R: 5'AATACTGCAGGGCTTCTRTACATRGG  (1993)  
  
AV494/AC1048  F: GCCCATGTATAGAAAGCCAAG  Wyatt and 
 R: GGATTAGAGGCATGTGTACATG  Brown 
 (1996)  
 
PTYv787/PTYc F: 5-GTTCGATAATGAGCCCAG-3  Zhou et al. 
1121  R: 5-ATGTAACAGAAACTCATG-3  (2008)  
 
GHF/GHR  F: GCCCGAAAGCTTCGTTGTT TTCCCGCT  Osei et al. 
R: ACGGATGGCCGCTTTGGGT ATTCG  (2008  
 
KF/KR  F: GGACCCGGCGCACTATTTAT GTTGGC  Osei et al. 
 R: ACCCCATTACCCCAATACCA  (2008  
 
 
 
 
5.2.2.5. Visual Scoring of TYLCD symptoms at Akumadan and Vea 
 
The incidence and severity of the disease was scored at 30, 45 and 60 days after transplanting 
(Lapidot and Friedman, 2002) using the scale 1–6 severity, where: 1 = healthy, no observable 
symptoms; 2 = very mild with slight yellowing and mosaic on top leaves and no leaf curling; 
3 = mild yellowing, mosaic and/or slight leaf curling on youngest leaves, severe symptoms; 4 
= moderate yellowing and/or leaf curling on the youngest (top) leaves; 5 = severe yellowing 
and blistering and/or severe leaf curling plus some leaf size reduction on the youngest leaves 
of the main stem and/or at least one branch; 6 = very severe yellowing, blistering and/or very 
84 
 
University of Ghana http://ugspace.ug.edu.gh
severe leaf curling, leaf deformation, leaf size reduction and stunting (Hanson et al., 2016).  The 
TYLCD incidence was calculated as follows (Imran et al., 2012); 
 
 Number of infected plants Disease Incidence =  x 100 
Total number of plants
 
 
 
Number of infected plants 
Disease Incidence =  x 100 
5.2.2.6 Yield and Yield TCootmal pnounmebnetr D oaf tpala nts
 
Data were also collected on number of fruits per plant, average fruit weight, yield, fruit 
diameter and fruit length. 
5.2.3 Data Analysis  
     
Phenotypic Analysis  
GenStat statistical package Edition 12.1 was used to analyze the quantitative data. Means were 
separated by Fisher’s protected Least Significant Difference (LSD) at 95% confidence interval. 
5.3 Results 
5.3.1 Amplification of known TYLCD resistance genes in tomato accessions 
 
The reliability and diagnostic capabilities of five molecular markers previously reported to be 
linked to TYLCD resistance genes were evaluated and validated for the purpose of 
introgression.  
5.3.1.1 Marker Analysis 
 
The gels for primer T0302 showed susceptible band in most of the samples.  For the other 
primers, only gels showing at least one resistant band for the 21 accessions were presented 
amplified at least one The Ty-2 linked marker (T0302 F/R) produced  susceptible fragment of 
approximately 800 bp in accessions C-1 (Power Rano), BG9, G5 (Pimplifolium), G153 
(LA4440a), R (Power), G9 (Lorry Tyre), AVTO1311, P005B, Tapiche, Thorgal and LT (Plate 
85 
 
University of Ghana http://ugspace.ug.edu.gh
5.1). Another Ty 2 linked marker P1-16 F/R (Ty-2), amplified resistant fragment of 
approximately 300 bp in accessions D1 (AVTO1219) and D4 (AVTO1429) (Plate 5.2). Ty-3 
linked marker P6-25 amplified resistant band (450 bp) in genotypes D1 (AVTO1219), D2 
(AVTO1311), D4 (AVTO1429) and (G48) Tapiche (Plate 5.3).  The ty-5 primer TM273 
amplified about 230 bp in genotype G5 (Pimplifolium) (Plate 5.4). The Ty-6 primer SLM10-
46 amplified a band of approximately 255 bp in genotypes G5 (Pimplifolium) and G121 
(Pimpinellifolium x Wosowoso) (Plate 5.5).  
 
M   1     2      3    4    5       6    7    8     9  10    11   12    13   14  15  16   17   18   19   20    21   -
ve 
 
 
800 bp 
 
 
 Plate 5. 1: PCR amplification products of Ty-2 gene obtained from 21 accessions of tomato germplasm using 
T0302 F/R primer pair. Lanes: 1= C-1, 2=C-2, 3=BG9, 4=G5, 5=W, 6=G153, 7=N, 8=G121, 9=R, 
10=G9, 11= D1, 12=D2, 13=D3, 14=D4, 15=A, 16=B, 17=S1, 18=S2, 19=TH, 20=LT, 21=D5; 
 M=2- Log DNA ladder; -Ve = Negative control (sterile nuclease free water) . Susceptible: 800 
bp; Resistant: 900 bp 
 
   M            1             2            3           4              5         6             7         8          9        10          11        -Ve           
 
 
 
 
  300 bp 
 
 
Plate 5. 2: PCR amplification products of Ty-2 gene obtained from 11 accessions of tomato germplasm using P1-
 16 F/R primer pair. Lanes: 1= A1, 2=A2, 3=A3, 4=A4, 5=D1, 6=D2, 7=D3, 8=D4, 9=G5, 10=G121, 
11= 153; -ve = Negative control (sterile nuclease free water); M=2- Log DNA ladder. Susceptible 
 
Band: 600 bp; Resistant 300 bp 
  
86 
  
 
University of Ghana http://ugspace.ug.edu.gh
 
 
    M   1    2     3    4    5    6    7     8    9   10  11  12  13   14   15 16  17  18   19   20 21  -Ve  +Ve        
  
 
 
 
450 bp 
300 bp  
 
   
 
 
 Plate 5. 3: PCR amplification products of Ty-3 gene obtained from 21 accessions of tomato germplasm using 
P6-25F/R primer pair. Lanes: 1= C-1, 2=C-2, 3=BG9, 4=G5, 5=W, 6=G153, 7=N, 8=G121, 9=R, 
 10=G9, 11= D1, 12=D2, 13=D4, 14=D3, 15=A, 16=B, 17=S1, 18=S2, 19=TH, 20=LT, 21=D5; M=2- 
Log DNA ladder; -Ve = Negative control (sterile nuclease free water), +Ve = Positive control (B);. 
 Susceptible Band: 320 bp; Resistant: 450 bp 
  
 
    M       1        2       3       4       5       6       7       8       9      10    11    12     13     14     15    -ve    
  
 
 
 
 
 
 
 
230 bp 
 
 
Plate 5. 4: PCR amplification products of ty-5 gene obtained from 16 accessions of tomato germplasm using 
 F/R primer pair. Lanes: 1= C-1, 2=C-2, 3=G9, 4=G5, 5=W, 6=G153, 7=LA3473 P1, 8=LA3473 
P2, 9=L14440 P1, 10=GLA14440 P2, 11= D1, 12=D2, 13=D3, 14=D4, 15=A; M=2- Log DNA 
 
ladder; -Ve = Negative control (sterile nuclease free water). Susceptible: 170 bp; Resistant: 175 bp 
 
 
 
 
 
87 
 
University of Ghana http://ugspace.ug.edu.gh
 
 
M   1     2     3    4      5    6     7     8     9   10   11  12   13  14   15  16   17   18  19   20     21 - Ve  +Ve   
 
 
 
 
 
 
 
255 bp  
 
Plate 5. 5: PCR amplification products of Ty-6 gene obtained from 21 accessions of tomato germplasm 
using SLM10-46 F/R primer pair. Lanes: 1= C-1, 2=C-2, 3=BG9, 4=G5, 5=W, 6=G153, 7=N, 
8=G121, 9=R, 10=G9, 11= D1, 12=D2, 13=D4, 14=D3, 15=A, 16=B, 17=S1, 18=S2, 19=TH, 
20=LT, 21=D5; M=2- Log DNA ladder; -Ve = Negative control (sterile nuclease free water); 
+Ve = Positive control (B). Susceptible: 220 bp; Resistant: 255 bp 
 
5.3.2 Incidence and Severity of TYLCD resistance in Akumadan and Vea Irrigation site 
 
5.3.2.1 Disease incidence ratings 
 
Variation in disease incidence was significant (5%) at all the various stages of growth at both 
locations at 30 DAT, 45 DAT and 60 DAT.  
All the accessions screened against the local strain of TYLCV in Akumadan expressed 
symptoms by 60 DAT (Table 5.5). On the contrary, not all the accessions expressed TYLCD 
symptoms by 60 DAT at Vea irrigation site. The TYLCD incidence ranged from 1.67% to 
60%, 13.33% to 91.17% and 44.68% to 100% at 30 DAT, 45 DAT and 60 DAT respectively 
in Akumadan. At 60 DAT genotype Pimplifolium had the lowest incidence (44.68%) while 
genotypes AVTO1311, AVTO1424, AVTO030, Lorry Tyre, Peto Mech and Tomato T0 687 
F1 Hybrid had the highest incidence (100%).   
88 
 
University of Ghana http://ugspace.ug.edu.gh
The TYLCD incidence at Vea ranged from 0% to 20.86%, 0% to 39.2% and 0% to 84.17% at 
30 DAT, 45 DAT and 60 DAT respectively. Pimplifolium recorded no symptoms throughout 
the experiment (Table 5.5).  
 
 
 
 
89 
 
University of Ghana http://ugspace.ug.edu.gh
Table 5. 5: Incidence of TYLCD on plants of 21 tomato accessions at 30 DATS, 45 DAT and 60 DAT at Akumadan and Vea 
 Akumadan  Vea 
Genotype 30 DAT 45 DAT 60 DAT  Genotypes 30 DAT 45 DAT 60 DAT 
Peto Mech 51.33 72.20 100.00   Peto Mech 20.86 39.27 84.17 
AVTO1311 44.00 91.17 100.00  Thorgal 12.17 27.57 66.78 
AVTO1424 60.00 88.93 100.00  Lorry Tyre 17.2 30.87 62.30 
AVTO0301 58.33 77.23 100.00  P005B 12.26 22.14 61.43 
Tomato T0 687 F1 Hybrid 56.67 86.90 100.00  AVTO9802 1.75 9.45 60.81 
Lorry Tyre 47.33 69.03 100.00  Tomato T0 687 F1 Hybrid 0.00 11.60 59.19 
AVTO1429 29.33 72.67 97.90  AVTO0301 17.55 17.55 58.46 
AVTO1219 54.00 86.67 97.60  AVTO1424 3.33 5.73 56.93 
Tapiche 53.67 73.8 96.97  Nadira 1.85 5.92 52.42 
AVTO1350 35.33 54.00 96.67  LA4440a 0.00 20.20 51.50 
AVTO9802 42.67 69.60 96.30  Tapiche 6.67 20.9 47.17 
LA4440a 25.67 65.37 96.30  AVTO1350 1.85 17.67 47.14 
P005A 38.33 72.63 95.57  Pimpinellifolium x Wosowoso 0.00 19.60 43.63 
Thorgal 41.33 71.00 95.23  Power 12.2 38.33 41.64 
Power 28.67 52.70 89.97  AVTO1311 0.00 3.72 37.8 
Nadira 42.00 50.80 89.93  Power Rano 14.07 22.17 27.40 
P005B 35.00 72.63 88.80  P005A 9.27 14.76 26.67 
Power Rano 19.67 60.70 86.77  AVTO1219 2.38 2.38 21.57 
Wosowoso 10.43 83.00 86.37  AVTO1429 0.00 2.08 18.09 
Pimpinellifolium x Wosowoso 13.00 29.97 74.63  Wosowoso 5.88 6.67 5.59 
Pimplifolium 1.67 13.33 44.68  Pimplifolium 0.00 0.00 0.00 
Mean 37.50 66.20 92.10  Mean 6.63 16.10 44.3 
L.s.d (5%) 29.20 25.08 20.01 L.s.d 11.489 13.18 21.18 
 
 
90 
 
University of Ghana http://ugspace.ug.edu.gh
5.3.2.2 Disease severity rating 
 
Generally, all the genotypes expressed very severe symptoms in Akumadan than Vea. At 
Akumadan, severity values ranged from 1 to 4, 2 to 5 and 2 to 5 at 30 DAT, 45 DAT and 60 
DAT respectively (Tables 5.6). At Vea, TYLCD severity ranged from 1 to 3, 1 to 4 and 1 to 4 
at 30 DAT, 45 DAT and 60 DAT respectively.  
Pimplifolium expressed very mild with slight yellowing and mosaic on top leaves and no leaf 
curling at 60 DAT at Akumadan. P005B expressed moderate yellowing and/or leaf curling on 
the youngest (top) leaves while P005A, Power Rano and Peto Mech expressed severe 
yellowing and blistering and/or severe leaf curling plus some leaf size reduction on the 
youngest leaves of the main stem and/or at least one branch. At Vea, genotypes carrying various 
resistance genes such as Pimplifolium (ty-5 and Ty-6) appeared healthy, no observable 
symptoms; AVTO1429 (Ty-2, Ty-3), and AVTO1219 (Ty-1/3, Ty-2), AVTO1311 (Ty-1/3) 
expressed moderate yellowing and/or leaf curling on the youngest (top) leaves.  
Pimpinellifolium x Wosowoso (Ty-6) expressed mild yellowing, mosaic and/or slight leaf 
curling on youngest leaves, severe symptoms at 60 DAT.  
 
 
 
 
 
 
 
91 
 
University of Ghana http://ugspace.ug.edu.gh
Table 5. 6: Severity ratings of TYLCD on infected tomato at 30 DATS, 45 DAT and 60 DAT at Akumadan and Vea 
 Akumadan  Vea 
Genotypes 30 DAT 45 DAT 60 DAT   Genotypes 30 DAT 45 DAT 60 DAT 
P005A 2 4 5  Power Rano 3 4 4 
Power Rano 2 4 5  AVTO1311 1 2 4 
Peto Mech 2 3 5  AVTO1424 1 2 4 
AVTO1219 3 4 5  AVTO9802 1 2 4 
AVTO1311 2 4 5  AVTO0301 3 4 4 
AVTO1429 2 4 5  AVTO1350 2 3 4 
AVTO1424 2 4 5  LA4440a 2 2 4 
AVTO9802 2 4 5  Tomato T0 687 F1 Hybrid 1 3 4 
AVTO0301 4 4 5  Tapiche 2 3 4 
AVTO1350 2 4 5  Lorry Tyre 2 3 4 
Tomato T0 687 F1 Hybrid 2 5 5  Power 2 3 4 
Tapiche 3 4 5  P005A 2 2 3 
Lorry Tyre 3 5 5  P005B 2 3 3 
Nadira 2 4 5  Peto Mech 2 3 3 
Power 3 3 5  AVTO1219 1 1 3 
Thorgal 3 4 5  AVTO1429 1 1 3 
Wosowoso 2 4 5  Pimpinellifolium x Wosowoso 1 2 3 
P005B 2 4 4  Nadira 2 2 3 
LA4440a 2 4 4  Thorgal 2 3 3 
Pimpinellifolium x Wosowoso 2 2 3  Wosowoso 2 2 3 
Pimplifolium 1 2 2 Pimplifolium 1 1 1 
1=Healthy, 2=Very mild, 3=Mild, 4=Moderate, 5=Severe, 6=Very severe 
 
 
 
 
92 
 
University of Ghana http://ugspace.ug.edu.gh
5.3.2.4 Yield and Yield Component traits at Akumadan Dam site 
There were significant variations among accessions for the yield and yield component traits 
studied. Number of fruits per plant, average fruit weight, fruit length and fruit diameter were 
significant at 5% at both locations. In Akumadan, the highest fruits per plant was produced by 
Pimplifolium (58 fruits/per plant), followed by Pimpinellifolium x Wosowoso (48 fruits/plant), 
Power Rano (6 fruits/plant) and P005A with 6 fruits/plant (Table 5.7). Although Pimplifolium 
recorded the highest number of fruits, it had the lowest weight per fruit (7.65 g) with Thorgal 
being the heaviest fruit (72.64 g). Genotypes Pimpinellifolium x Wosowoso, Pimplifolium and 
P005A gave the maximum yields of 26.58 t/ha, 24.06 t/ha and 17.96 t/ha respectively. Lorry 
Tyre was the widest fruit (29.02 mm) and AVTO1219 was the least in diameter (12.65 mm). 
Nadira had the highest fruit length of 27.69mm and Pimplifolium had the lowest fruit length 
of 10.12 mm. 
 
 
 
 
 
 
 
 
 
93 
 
University of Ghana http://ugspace.ug.edu.gh
Table 5. 7: Means of yield and yield component traits of 21 tomato genotypes evaluated at 
Akumadan 
Genotype No. of Fruit Yield Fruit Fruit 
fruits/ weight (t/ha) Diameter Length 
Plant (g) (mm) (mm) 
AVTO1219 1 8.85 0.06 12.65 14.79 
AVTO1311 1 29.56 0.5 19.42 19.95 
AVTO1429 1 52.63 2.22 23.58 22.77 
AVTO1424 1 31.99 0.42 19.32 20.63 
AVTO0301 1 19.24 0.41 18.02 21.36 
AVTO1350 1 13.35 0.4 14.8 19.37 
Tomato T0 687 F1 Hybrid 1 56.6 3.95 21.81 26.62 
Tapiche 1 70.69 4.28 23.18 27.17 
AVTO9802 2 19.7 1.87 17.39 19.34 
Lorry Tyre 2 68.66 6.45 29.02 25.06 
Power 2 50.04 5.7 25.63 20.65 
Peto Mech 3 31.73 4.87 18.26 22.73 
LA4440a 3 19.08 3.19 21.93 17.09 
Thorgal 3 72.64 11.71 27.39 21.36 
P005B 4 54.32 10.74 22.8 24.62 
Nadira 4 44.04 6.81 21 27.69 
Wosowoso 4 56.26 10.93 27.67 18.76 
P005A 6 68.36 17.97 27.61 20.37 
Power Rano 6 44.62 13.24 24 19.15 
Pimpinellifolium x Wosowoso 48 10.29 26.58 14.3 10.83 
Pimplifolium 58 7.65 24.06 12.98 10.12 
Mean 7 39.5 7.45 21.08 20.5 
L.s.d (5%) 16 22.84 12.286 4.98 3.716 
 
 
5.3.2.5 Yield and Yield Components traits at Vea Irrigation site 
At Vea, Pimplifolium produced the highest number of fruits per plant (37 fruits/plant), with 
LA4440a producing the lowest (2 fruit/plant). Pimplifolium recorded the lowest average fruit 
weight (7.15 g) while Lorry Tyre recorded the highest average fruit weight (103.29 g). Power 
gave the highest fruit yield (48.74 t/ha) followed by B (34.14 t/ha) and Nadira (30.79 t/ha). The 
widest diameter was recorded in Lorry Tyre (59.75mm) and the Nadira had the longest fruit 
length of 51.47 mm (Table 5.8). 
94 
 
University of Ghana http://ugspace.ug.edu.gh
Table 5. 8: Means of yield and yield component traits of 21 tomato genotypes evaluated at Vea 
Genotype No. of Fruit Yield Fruit Fruit 
fruits/ weight (t/ha) diameter Length 
plant (g) (mm) (mm) 
LA4440a 2 17.42 1.96 12.24 7.94 
AVTO1219 4 34.64 6.93 42.07 41.88 
AVTO1311 4 31.88 6.96 42.4 41.75 
AVTO0301 4 31.51 6.72 36.37 45.06 
P005A 5 55.21 14.07 26.88 20.82 
AVTO1424 5 40.99 9.89 39.02 38.55 
Lorry Tyre 5 103.29 26.07 59.75 39.81 
AVTO1429 6 61.41 22.47 45.7 39.71 
AVTO9802 6 44.35 13.16 39.46 48.63 
AVTO1350 6 37.7 11.9 34.84 42.35 
Thorgal 6 52.16 16.4 45.58 35.75 
Wosowoso 6 89.96 25.72 56.31 35.48 
Peto Mech 7 50.4 17.91 41.69 48.46 
Tapiche 7 55.25 17.95 44.24 46.77 
P005B 10 70.13 34.14 44.46 44.91 
Power Rano 10 48.86 24.24 44.36 36.61 
Tomato T0 687 F1 Hybrid 11 41.79 22.66 41.71 50.39 
Nadira 11 59.31 30.79 43.79 51.47 
Power 13 78.14 48.74 56.09 42.98 
Pimpinellifolium x Wosowoso 17 10.72 8.45 37.6 34.88 
Pimplifolium 37 7.15 12.9 23.07 30.17 
Mean 9 48.7 18.1 40.8 39.3 
L.s.d (5%) 5 20.65 12.826 13.68 16.31 
 
 
 
5.3.3 PCR amplification of TYLCV DNA in infected tomato samples 
5.3.3.1 TYLCV DNA in infected Samples in Akumadan Dam site 
The primer pair AV494/AC1048 F/R detected TYLCV DNA in infected samples; C-1 (Power 
Rano), 153 (LA4440a), G9 (Lorry Tyre), A (P005A), R (Power) collected from the disease trial in 
Akumadan and the amplicon size was ~550 bp (Plate 5.6). The PTYv787/PTYc1121 F/R primer 
pair also amplified 300 bp in C-1 (Power Rano), N (Nadira), G153 (LA440a), TH (Thorgal), R 
(Power), G5 (Pimplifolium) and D8 (AVTO030). Genotypes G153 (LA4440a), TH (Thorgal), R 
(Power) and G5 (Pimplifolium) exhibited multiple bands (Plate 5.7). The amplicon (~600 bp) for 
GHF/GHR primer was amplified in genotypes C-1 (Power Rano), D1 (AVTO1219), G153 
95 
 
University of Ghana http://ugspace.ug.edu.gh
(LA4440a), TH (Thorgal), A (P005A), G9 (Lorry Tyre), R (Power), G5 (Pimplifolium) and D8 
(AVTO030) (Plate 5.8). Although genotypes D2 (AVTO1311), D4 (AVTO1429), D6 
(AVTO9802), D5 (AVTO1424), C-2 (Peto Mech), B (P005A) and G48 (Tapiche) expressed 
TYLCV symptoms in the field, none of the primer sets amplified viral DNA in them. 
PARc1496/PAL1v1978 and KF/KR did not amplify TYLCV DNA in any of the infected samples 
collected. 
 
 M    1      2      3    4    5      6     7      8     9   10   11   12    13   14   15   16 17   18   19   20    21   -Ve   M 
 
 
M    1      2      3    4    5      6     7      8     9   10   11   12    13   14   15   16 17   18   19   20    21   -ve   M 
550 bp  
 
550 bp 
Plate 5. 6: PCR amplification products of TYLCV DNA from 21 tomato accessions using AV494/AC1048F/R 
primer pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 6=D6, 7=D5, N=8, 9=G48, 10=G153, 11=121, 
12=TH, 13=A, 14=G9, 15=W, 16=B, 17= R, 18=S1, 19= G5, 20=D9, 21=D8;  M=2- Log DNA ladder; -
Ve = Negative control (sterile nuclease free water) 
 
 
 
 
 
 
 
96 
 
University of Ghana http://ugspace.ug.edu.gh
 
   M    1     2     3    4     5     6     7     8     9   10 11  12   13 14   15 16  17   18  19   20    21  +Ve  M 
 
 
   M    1     2     3    4     5     6     7     8     9   10  11  12   13  14   15  16  17   18  19   20    21  +ve  M 
1100 bp  
 
300 bp 
300 bp 
 
300 bp 
Plate 5. 7: PCR amplification products of TYLCV DNA from 21 tomato accessions using PTYv787/PTYc1121 
F/R primer pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 6=D6, 7=D5, N=8, 9=S2, 10=G153, 
11=121, 12=TH, 13=A, 14=G9, 15=W, 16=B, 17= R, 18=S1,19= G5, 20=D9, 21=D8; M=2- Log 
DNA ladder; +Ve = Positive control obtained from infected sample from farmers’ field in Akumadan 
 
 
 
M    1    2     3     4    5    6     7    8    9   10   11   12 13  14   15  16  17  18   19   20   21 –Ve M 
 
 
 
600 b p 
 
Plate 5. 8: PCR amplification products of TYLCV DNA from 21 tomato accessions using GHF/GHR primer 
pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 6=D6, 7=D5, N=8, 9=S2, 10=G153, 11=121, 12=TH, 
13=A, 14=G9, 15=W, 16=B, 17= R, 18=S1, 19=G5, 20=D9, 21=D8;  M=2- Log DNA ladder; -Ve = 
Negative control (sterile nuclease free water).  
 
 
 
 
97 
 
University of Ghana http://ugspace.ug.edu.gh
5.3.3.2 TYLCV DNA in infected Samples in Vea Irrigation site  
Two primers amplified the viral DNA in the infected samples collected from the Vea irrigation 
site.  Primer AV494/AC1048 F/R gave an amplicon size of about ~75 bp in samples D4 
(AVTO1429), N (Nadira), G153 (LA4440a), A, G9 (Lorry Tyre) in addition to ~550 bp in 
genotypes A (P005A) and G9 (Lorry Tyre) (Plate 5.9 and Plate 5.10). PTYv787/PTYc1121 F/R 
amplified double bands in two samples; D4 (AVTO1429) and D6 (AVTO9802) (Plate 5.11) out 
of the 21 infected samples.  Primers PARc1496/PAL1v1978, GHF/R and KF/KR did not produce 
any amplicon when used to screen infected samples collected from Vea.   
 
Plate 5. 9: PCR amplification products of TYLCV DNA from 21 tomato accessions using AV494/AC1048 F/R 
primer pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 6=D6, 7=D5, N=8, 9=S2, 10=G153, 11=121, 
12=TH, 13=A, 14=G9, 15=W, 16=B 
 
 
Plate 5. 10: PCR amplification products of TYLCV DNA from 21 tomato germplasm using 
AV494/AC1048F/R primer pair.  Lanes: 17= R, 18=S1, 19= G5, 20=D9, 21=D8; M=2- 
Log DNA ladder; +Ve = Positive control obtained from infected samples from farmers’ 
field in Akumadan 
 
 
98 
 
University of Ghana http://ugspace.ug.edu.gh
 
 
 M  1   2    3    4     5    6   7    8    9   10   11 12  13 14  15  16  17  18  19  20 21  +Ve - Ve 
  
 
 1000 bp  
bp 
 
  
 300 bp 
 
Plate 5. 11: PCR amplification products of TYLCV DNA from 21 tomato germplasm using 
PTYv787/PTYc1121 F/R primer pair.  Lanes: 1=C-1, 2=D1, 3=D2, 4=C-2, 5=D-4, 6=D6, 
7=D5, N=8, 9=S2, 10=G153, 11=121, 12=Th, 13=A, 14=G9, 15=W, 16=B, 17= R, 18=S1, 
G5, 20=D9, 21=D8; M=2- Log DNA ladder; +Ve = Positive control obtained from infected 
sample from farmers’ field in Akumadan; -Ve = Negative control (sterile nuclease free 
water) 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
99 
 
University of Ghana http://ugspace.ug.edu.gh
The viral DNA marker analyses of the infected samples collected from both Akumadan and Vea 
are summarized in Table 5.9. 
 
Table 5. 9: Scores of 5 TYLCV detection primers in 21 tomato genotypes 
 Primers 
Genotype           AV4/AC  PTY/PTYc GHF/GHR  PAR/PAL KF/KR  
 Aku Vea Aku Vea Akum Aku/Vea Aku/Vea 
P005A + + _ _ + _ _ 
P005B _ _ _ _ _ _ _ 
Power Rano + _ + _ + _ _ 
Peto Mech _ _ _ _ _ _ _ 
AVTO1219 _ _ _ _ + _ _ 
AVTO1311 _ _ _ _ _ _ _ 
AVTO1429 _ + _ + _ _ _ 
AVTO1424 _ _ _ _ _ _ _ 
AVTO1350 _ _ _ + _ _ _ 
AVTO030 _ + + _ + _ _ 
AVTO1350 _ _ _ _ _ _ _ 
Pimpinellifolium _ _ _ _ _ _ _ 
x Wosowoso 
LA4440a + + + _ + _ _ 
Pimplifolium _ _ + _ + _ _ 
Lorry Tyre + + _ _ + _ _ 
Nadira _ + + _ _ _ _ 
Power + _ - _ + _ _ 
Tomato T0 687 F1 _ _ _ _ _ _ _ 
Hybrid  
Tapiche _ _ _ _ _ _ 
Thorgal _ _ + _ + _ _ 
Wosowoso _ _ _ _ _ _ _ 
Aku=Akumadan; AV4/AC=AV494/AC1048 F/R; PTY/PTYc=PTYv787/PTYc1121 F/R; 
PAR/PAL=PARc1496/PAL1v1978 
 
 
 
 
 
 
  
100 
 
University of Ghana http://ugspace.ug.edu.gh
5.4 Discussion 
5.4 .1  Confirmation and identification of TYLCD resistance genes 
The deployment of tomato cultivars with resistance has been considered to be the most effective 
strategy to reduce yield losses caused by viral diseases (Lapidot and Friedman, 2002). The PCR 
carried out in the study confirmed the presence of the TYLCD genes in accessions AVTO1219 
(Ty-3), AVTO1311 (Ty-2, Ty-3), AVTO1429 (Ty-2, Ty-3) and identified ty-5, Ty-6 in Pimplifolium 
and Ty-6 in Pimpinellifolium x Wosowoso. The expected band sizes for ty-5 are 170/175 bp but in 
the current study, the band sizes amplified were approximately 200/230 bp. The amplified band 
size of approximately 230 bp amplified in this study could be due to a variant of the ty-5 gene 
present in Pimplifolium.  Chen et al (2015) reported that in ty-5 susceptible S. chilense, AVRDC–
TM273 yielded different banding patterns than in S. lycopersicum and attributed it to the presence 
of different alleles at this locus in S. chilense than in cultivated tomato. 
Over the years the main objective of several breeding programmes has been the effectiveness of 
different resistance sources in different locations and their response to different begomoviruses 
(Picó et al., 1999). All the 21 genotypes screened showed variation for TYLCD incidence and 
severity at both locations. The symptom expression varied among the genotypes, growth stage and 
location. Incidence and severity were lower at early stages of growth but severe at later stages of 
growth. Accessions expressed severe symptoms in Akumadan than at Vea due to the high disease 
pressure in Akumadan. TYLCD resistance in cultivars can breakdown occasionally under high 
disease pressure (Zamir et al., 1994) and this might be the reason why although some accessions 
have resistance genes but expressed severe disease symptoms in Akumadan. The same accession 
had different severity score in Akumadan and Vea. Lapidot et al. (2000) reported that the 
variability in screening conditions and assays leads to contradictory results where different 
resistance levels have been attributed to the same genetic sources. Pimplifolium had 2 and 1 
severity score and Vea respectively. This is an indication of a high level of resistance to the 
101 
 
University of Ghana http://ugspace.ug.edu.gh
TYLCD at both locations. Hanson et al. (2016) reported that lines from CLN3241 which expressed 
disease severity score of less than 3 had a high level of resistance to TYLCTHV and ToLCTWV. 
This is consistent with the findings of Asare-Bediako et al. (2017) who reported that the severity 
of TYLCD in the Central region was lower because farmers were growing Pimpinellifolium or 
improved form of Pimpinellifolium.  
Due to the high level of resistance of Pimplifolium, it produced the highest yield compared to all 
the others in Akumadan. Although Pimplifolium showed TYLCD symptoms in Akumadan and 
two sets of primer pairs amplified the viral DNA in the samples collected, it was effective against 
the strains of the virus in both locations. The presence of the TYLCD resistance genes in 
AVTO1219, AVTO1311 and AVTO1429 did not reflect in their reaction to the local strain of 
TYLCV in Akumadan. However, at Vea irrigation site AVTO1219, AVTO1311 and AVTO1429 
were more tolerant of the TYLCD than the most preferred variety (Peto Mech).  TYLCD resistance 
genes present a range of resistance levels, differential responses to isolates, strains and species 
(Prasanna et al., 2015).  
 
AV494/AC1048 F/R amplified a band size of ~550 bp in some infected samples from both 
locations. The results from this study, however, is at variance with the band size of 2500 bp 
reported by Osei et al. (2012). In addition to the ~550 bp, AV494/AC1048 F/R also amplified 75 
bp in some of the samples collected from Vea but not Akumadan. This band size was not reported 
in previous studies. The band size of 300 bp produced by PTYv787/PTYc1121 F/R primer pair is 
in agreement with the works of Nakhla et al., (1993) and Asare-Bediako et al. (2017). Primers 
PARc1496/PAL1v1978 and KF/KR did not produce any amplicon in the samples collected from 
Akumadan. In addition to these two primers, GHF/GHR did not also detect viral DNA in the 
samples collected from Vea and this could be attributed to the absence of the particular viral 
102 
 
University of Ghana http://ugspace.ug.edu.gh
strains, low viral concentration or absence of complementary sequence at primer annealing sites 
(Potter, 2003; Rotbi et al., 2015).  
5.5 Conclusion 
This is the first report on the detection of ty-5 and Ty-6 in Pimplifolium and also Ty-6 in 
Pimpinellifolium x Wosowoso in Ghana. Even though two of the viral primers detected viral DNA 
in Pimplifolium, it expressed a high level of resistance at both locations and therefore ty-5 and Ty-
6 can be introgressed into the locally adapted cultivars. Although the accessions (AVTO1219, 
AVTO1311, AVTO1429) with different TYLCD resistance genes obtained from AVRDC 
expressed severe symptoms in Akumadan and mild symptoms at Vea, the genes can be pyramided 
together with the ty-5 and Ty 6 genes amplified in Pimplifolium into locally adapted cultivars. 
 
 
 
 
 
 
 
 
 
 
 
  
103 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER SIX 
6.0 Combining Ability Analysis for Fruit Quality and Yield in tomato (Solanum 
lycopersicum L.)  
6.1 Introduction 
Tomato production in Ghana is dominated by unadapted imported hybrids or farmer saved seeds 
(Osei at al., 2015). Farmers are unable to realize the full potential of these imported hybrids due 
to the unadaptability to the local growing conditions. Additionally, fruits produced from farmers’ 
cultivars are generally watery, poor in colour and have poor shelf life (Robinson and Kollavali, 
2010). Tomato production in Ghana is plagued with high incidence of pests and diseases; 
particularly Tomato Yellow Leaf Curl Virus Disease (TYLCD). TYLCD have been reported to 
cause severe yield loss in most important tomato production areas throughout the country (Horna 
et al., 2006; Osei et al., 2012; Duodo, 2014). 
To mitigate against these tomato production constraints, a breeding strategy that will combine 
increased yield, fruit quality together with TYLCD resistance will be very useful. This will involve 
a hybridization programme that will utilize lines with different Tomato Yellow Leaf Curl Disease 
Resistance genes (TYLCD resistance genes), some level of fruit quality traits with locally adapted 
cultivars. It is important to combine all these traits in a single variety because high yielding and 
quality fruit will not be realized when TYLCD is prevalent.  
 In estimating the potential of pure lines for hybrid development, the general and specific 
combining abilities (GCA and SCA) are the most important indicators (Zengin et al., 2015). North 
Carolina II analysis provides information on GCA and SCA effects of parents and can be used to 
estimate the various types of gene action. 
 The objective of this work was to identify lines with good general combining abilities and specific 
crosses that combine well for fruit quality, yield and TYLCD resistance. 
104 
 
University of Ghana http://ugspace.ug.edu.gh
6.2 Materials and Methods 
6.2.1 Plant Materials 
 
The genetic materials used for this study were made up of six locally-adapted genotypes and three 
exotic lines. The locally-adapted genotypes include Lorry Tyre, Peto Mech, Power Rano, Power, 
Wosowoso and Pimplifolium sourced from the Plant Genetic Resource Research Institute 
(PGRRI), University of Ghana, farmers and Agrimat Limited. Pimplifolium and its improved 
forms have been reported to have high tolerance to TYLCD in Ghana. The other locally-adapted 
genotypes are susceptible to the TYLCD.  The exotic lines have different combination of TYLCD 
resistance genes (AVTO1219 – Ty-1/T-y3, Ty-2; AVTO1311 – Ty-1/3 and AVTO1429- Ty-2, Ty-
3) as well as good fruit characteristics. They were sourced from the World Vegetable Centre in 
Taiwan (AVRDC).  
6.2.2 Greenhouse Experiment: Crossing Block 
 
The crossing block was made up of five females and four males. The five females included Lorry 
Tyre, Peto Mech, Power Rano, Power and Wosowoso. The males included three AVTO1219, 
AVTO1311   AVTO142) and the local Pimplifolium. The mating design used was North Carolina 
II design (5 x 4 NCII design).  
6.2.3 Confirmation of TYLCD resistance genes in F1 Plants 
Leaf samples of 8 plants were harvested from each set of the 20 F1 plants and stored on ice and 
transported to the Virology Department of the Noguchi Memorial Institute for Medical Research, 
University of Ghana. DNA was extracted from the plant samples using QIAamp DNA Mini kit 
(Qiagen, Hilden, Germany). The quantity and quality of the DNA were checked using the Thermo 
Scientific NanoDrop (2000C spectrophotometer). The presence of the TYLCD resistance genes 
(TYLCD resistance genes) in the 20 F1 hybrids were confirmed by Polymerase Chain reaction 
(PCR) using the markers listed below (Table 6.1).  
105 
 
University of Ghana http://ugspace.ug.edu.gh
The PCR conditions are presented in Table 6.2. The PCR products were separated on ethidium 
bromide stained 1.5% agarose gel and visualized under UV light. 
 
Table 6. 1: Primers used for the Amplification of TYLCD resistance genes in tomato leaf 
samples 
Ty Marker Sequence PCR product (bp) 
gene name 
Ty-2 P1-16 F: CACACATATCCTCTATCCTATTAGCTG Resistant: 300 
R: CGGAGCTGAATTGTATAAACACG Susceptible: 600 
 
Ty-3 P6-25 F: GGT AGT GGA AAT GAT GCTGCTC Resistant: 450, 650 
R: GCT CTG CCT ATT GTC CCA TAT ATA Susceptible: 320 
ACC 
Ty5 TM273 F: GGTGCTCATGGATAGCTTAC Resistance:175 
 R: CTATATAGGCGATAGCACCAC Susceptible: 170 
  
 
 
Table 6. 2: PCR conditions for primers used the amplification of TYLCD resistance genes. 
P1-16  (Hanson, 2016) P6-25   (Ji et al., 2010) TM273 (Hanson, 2016) 
   
Temp. (℃)     Time(min) Temp.(℃)     Time(min) Temp.(℃)     Time(min) 
1. 95                      10:00 1. 94                 4:00 1. 95                 5:00 
2. 94                       0:30 2. 94 
0C          00:30 (35x) 2. 94                 0:30 (34 x) 
0
(34x) 3. 53 C          1:00  3. 55                 0:30 
0
3. 55                       0:45 4. 72 C          1:00 4. 72                 0:30 
0
4. 72                       0:45 5. 72  C          10:00 5. 72                 5:00 
5. 72                       5:00 6. 20                 ∞ 
6. 20                       ∞  
 
 
6.2.4 Field Experiment: Experimental Design and Field Layout 
The F1s (20) together with their parents (9) were laid out in a Randomized Complete Block Design 
(RCBD) with three (3) replication. Each genotype was planted in two rows with each row 
consisting of 10 plants. The inter-row spacing was 1m and intra-row spacing was a row 0.5 m.  
 
 
106 
 
University of Ghana http://ugspace.ug.edu.gh
6.2.4.1 Nursery and Agronomic practices 
Three seeds were sown in each cell of the nursery trays and thinned to one per cell after 14 days 
of nursing. Thirty-day-old seedlings were transplanted to the field. At two weeks after 
transplanting, N.P.K. 15-151-15 was applied at the rate of 8-10g per plant. At four weeks after 
transplanting, Sulphate of Ammonia was applied at the rate of 5g per plant. Sulphate of Ammonia 
was applied at the rate of 5g per plant. Calcium nitrate (Fertigation grade) was applied at fruiting 
at the rate of 150 g/L. 
6.2.4.2 Experimental site 
The crosses were carried OUT in a greenhouse at the West Africa Centre for Crop Improvement 
(WACCI) at the University of Ghana Farms, Legon from June - October 2017. The crosses 
together with their parents were evaluated from February-May 2018 in the field at the University 
of Ghana Farms. The farm is between latitude 5o 38 45 N and longitude 00o 11 13 E. The soil type 
was Haatso Series with an average rainfall of 809 mm. The minimum temperature was 23.8 oC 
and the maximum temperature of 31.2oC.  
6.2.4.3 Data collection 
 
Data on vegetative, reproductive, yield and fruit quality were collected based on the tomato IPGRI 
and the UPOV tomato descriptors. The following vegetative and reproductive data were collected: 
foliage density, leaf coverage, days to first flowering, number of primary branches, plant height at 
maturity (cm) and days to first fruit set. The following yield and yield component data were also 
measured: fruit length (mm), fruit diameter (mm), number of fruits per plant, fruit weight (g) per 
plant and yield per plant (g). The fruit quality data collected also include fruit green shoulders, 
fruit green stripes, fruit hardness (N/cm2), pericarp thickness (mm), number of locules, ribbing, 
pH and shelf life. 
107 
 
University of Ghana http://ugspace.ug.edu.gh
6.2.4.4 Data Analysis 
Analysis of Variance was estimated using GenStat version 12th Edition. The General and Specific 
Combining Ability were estimated using Analysis of Genetic Designs in R (AGD-R) version 3.0 
(2015-08-28) developed by CIMMYT. 
Mid-parent heterosis and heterosis over better-parent (Heterobeltiosis) were calculated in terms of 
increase or decrease of hybrid over average of both parents or better-parent (Hayes et al., 1995). 
Mid parent heterosis (%) = [(F1-MP)/MP] x 100 
Heterobeltiosis (%) = [(F1-BP)/BP] x 100 
 
 
 
 
 
 
 
 
 
  
108 
 
University of Ghana http://ugspace.ug.edu.gh
6.3 Results 
6.3.1 Confirmation of Tomato Yellow Leaf Curl Virus Resistance genes (TYLCD resistance 
genes) in 20 F1 hybrids 
Primer P1-16 amplified resistance band (300 bp) or heterozygous bands (300 and 600 bp) in 57% 
of 5 different F1 hybrids with D4 (AVTO1429) as the donor parent (Plate 6.1). Primer P6-25 also 
amplified 81% heterozygous bands (320 bp and 420 bp) in the 5 F1 hybrids with D4 (AVTO1429) 
as the donor parent (Plate 6.2). Primer TM273 confirmed the heterozygous state of ty-5 genes in 
67% of 5 different hybrids with the Pimplifolium as donor parent (Plate 6.3). 
 
Plate 6. 1: PCR amplification products of Ty-2 gene obtained from F1 hybrids using P1-16 F/R primer pair. Lanes: 
(a) 1-8 = C-1 x D4,  9-12 = C-2 x D4; (b) 1-4 = C-2 x D4, 5-9 = G9 x D4, 10-17 = W x D4, 18-20 = R 
x D4; (c) 1-5 = D4 = AVTO1429 (Resistant Male Parent)   C-1= Power Rano and C-2 = Peto Mech 
(Susceptible Female Parents ); M=100 kb DNA ladder. Susceptible Band: 600 bp, Resistant 300 bp 
 
 
 
 
 
 
109 
 
University of Ghana http://ugspace.ug.edu.gh
 
Plate 6. 2: PCR amplification products of Ty-3 gene obtained from F1 hybrids using P6-25 F/R primer pair. Lanes: 
(a) 1-8 = C-1 x D4,  9-13 = C-2 x D4; (b) 1-3 = C-2 x D4, 4-8 = G9 x D4, 9-14 = W x D4; (c) 1-2 = W  x 
D4, 3-9 = R x D4,  D4 = AVTO1429 (Resistant Male Parent)   C-1= Power Rano and  C-2 = Peto Mech 
(Susceptible Female Parents ); M=100 kb DNA ladder. Susceptible Band: 320 bp, Resistant 420 bp 
 
 
Plate 6. 3:  PCR amplification products of ty-5 gene obtained from F1 hybrids using TM273 F/R primer pair. Lanes: 
(a) 1-8 = C-1 x G5,  9-15 = C-2 x G5, 16-19 = G9 x G5; (b) 1-4 = G9 x G5, 5-9 = W x G5, 10-12 = R  x 
G5; (c) 1-6 = R x G5,  G5 = Pimplifolium (Resistant Male Parent)   C-1= Power Rano and C-2 = Peto 
Mech  (Susceptible Female Parents ); M=2- Log DNA ladder. Susceptible Band: 175 bp, Resistant 230 
bp 
 
 
 
 
110 
 
University of Ghana http://ugspace.ug.edu.gh
6.3.2 Variability in parental and progeny for fruit quality and yield component traits 
There were significant differences (p < 0.01) among the 20 hybrids and parents for vegetative, 
reproductive and fruit quality traits for (Table 6.3).  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
111 
 
University of Ghana http://ugspace.ug.edu.gh
Table 6. 3: Mean squares for vegetative, reproductive and fruit quality traits for the 20 tomato hybrids and 9 parents evaluated 
Source df Days to Number Height at Days to Fruit Fruit Fruit/plant Weight/ Yield/ Pericarp Fruit pH Shelf life 
of first of maturity first length diameter plant (g) plant (g) thickness hardness (days) 
variation flowering branches (cm) fruit set (mm) (mm) (mm) (N/cm2) 
     (mm)        
   
Genotype 28 51.04*** 2.89*** 395.22*** 80.76*** 334.91*** 284.71*** 3320.16*** 2095.89*** 291462*** 3.12*** 111.15*** 0.06** 47.09*** 
            
   
Rep 2 3.36 2.31 7.48 3.724 1.19 26.80 155.30 4.61 158417 0.42 1.465 0 11.94 
            
   
Error 56 3.37 0.35 13.79 5.486  6.392 79.58 38.46 57672 0.24 2.018 0.02 5.4 
***highly significant difference observed among means (P < 0.001); **highly significant difference observed among means (P < 0.01) 
 
 
 
 
 
 
 
 
112 
 
University of Ghana http://ugspace.ug.edu.gh
6.3.4  Combining ability analysis 
 
Analysis of variance for mean square was significant for all traits studied (Tables 6.4 and Table 
6.5). The narrow sense heritability (h2) of the traits studied ranged from 0.56 for number of 
branches to 0.95 for fruit diameter. High heritability was observed for days to first flowering 
(0.84), days to first fruit set (0.81), fruit length (0.87), fruit diameter (0.95), fruit per plant 
(0.90) weight per fruit (0.85) and pH (0.81). Heritability was low for number of branches (0.56) 
and yield (0.59). 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
113 
 
University of Ghana http://ugspace.ug.edu.gh
Table 6. 4: Mean squares and heritability for vegetative, reproductive and yield component traits studied among parents 
Source of df Days to Number of  Height at maturity Days to fruit/plant Fruit length Fruit diameter Weight/fruit Yield/plant 
variation  first branches (cm) fruit set (mm) (mm) (g) (g) 
flowering 
Rep 2 6.02 1.67 10.47 6.65 130.94 2.63 15.72 28.54 146034.90 
Genotypes 19 54.15** 1.65** 402.39** 85.12** 4075.60** 308.29** 174.75** 1566.66** 220184.05** 
Female (F) 4 9.65** 1.77** 1017.96** 18.46* 697.42** 203.14** 32.35** 624.14** 387287.68** 
Male (M) 3 280.42** 2.87** 431.60** 418.99** 22766.16** 1484.08** 1008.08** 7870.89** 246641.87** 
(M x F) 12 12.42** 1.31** 189.89** 23.87** 529.02** 49.39** 13.88 304.78** 157868.38** 
Error 38 2.51 0.26 11.5 5.7 108.02 6.69 7.2 37.13 54856.06 
 
h2 0.84 0.56 0.68 0.81 0.90 0.87 0.95 0.85 0.59 
*Significant difference observed among the means (P < 0.05); **highly significant difference observed among means (P < 0.01); h2 = Narrow Sense heritability 
 
Table 6. 5: Mean square for combining ability for fruit quality traits studied among parents 
Source of variation Df Pericarp thickness (mm) Fruit hardness (N/cm2) pH Shelf life (days) 
Rep 2 0.48 1.22 0.00 14.55 
Genotypes 19 3.05** 67.62** 0.04* 40.09** 
Female (F) 4 0.38 112.84** 0.07* 10.23 
Male (M) 3 13.67** 143.70** 0.11 134.42** 
M x F 12 1.29** 33.53** 0.02** 26.46** 
Error 38 1.29** 33.53** 0.02** 26.46** 
h2  0.76 0.67 0.81 0.65 
*Significant difference observed among the mean (P < 0.05); **highly significant difference observed among mean (P < 0.01); h2 = Narrow Sense heritability
114 
 
University of Ghana http://ugspace.ug.edu.gh
6.3.4.1 Estimation of General Combining Ability (GCA) effects 
 
Male parent Pimplifolium exhibited significant negative GCA for days to first flowering, days 
to fruit set, fruit length, fruit diameter, fruit weight, pericarp thickness and fruit hardness. The 
three other males exhibited significant positive GCA for days to first flowering.  Peto Mech 
had the highest significant negative GCA for plant height but positive GCA for fruit.  
AVTO1311 and Peto Mech had the highest significant positive GCA for fruit length. Again, 
AVTO1219 and AVTO1311 had the highest significant positive GCA for fruit diameter. On 
the other hand, AVTO1219 and AVTO1311 and AVTO1429 had the highest significant 
negative GCA for number of fruits per plant while Pimplifolium had the highest significant 
positive GCA for fruit per plant. AVTO1311 and AVTO1219 had the highest significant 
positive GCA for weight per fruit. Power Rano had the highest significant negative GCA for 
fruit weight. Lorry Tyre had the highest significant positive GCA for yield.  
AVTO1219 and AVTO1429 had the highest significant positive GCA effect for pericarp 
thickness. Peto Mech had the highest positive significant GCA effect for fruit hardness. While 
Pimplifolium had the highest significant positive GCA effect for shelf life, AVTO1219 had the 
highest negatively GCA effect for shelf life (Table 6.6). 
 
 
 
 
 
 
 
115 
 
University of Ghana http://ugspace.ug.edu.gh
Table 6. 6: GCA effects for male and female parents for vegetative, reproductive, yield component and fruit quality traits in tomato 
Parent Days to Number Height Days to Fruit Fruit Fruit/ Weight Yield Pericarp Fruit pH Shelf 
first of at first length diameter plant / fruit (g) /plant thickness hardness life 
flowering Branches maturity fruit set (mm) (mm) (g) (mm) (N/cm2) (days) 
   (cm)           
 
Female 
 
Lorry Tyre 0 0.05 5.15 0 -2.39 -0.34 2.31 -0.08 177.17* 0 -0.88 -0.08 0 
Peto Mech 0 -0.17 -11.05* 0 5.38* 0.54 -2.38 4.55 -43.29 0 3.82* 0.05 0 
Power Rano 0 0.09 -4.07 0 -0.64 -1.48 -0.92 -5.72* -107.34 0’ -0.48 0.01 0 
Power 0 0.03 2.78 0 -0.48 0.86 1.27 0.33 -22.33 0 -1.23 0.04 0 
Wosowoso 0 0 7.19* 0 -1.87 0.41 -0.28 0.92 -4.21 0 -1.23 -0.01 0 
 
SE 0.17 3.88 0 2.19 0.91 3.36 3.94 90.64 0 1.56 0.04 0 
              
             
Male 
AVTO1219 2.03* -0.02 -1.9 2.32 3.88 5.02** -16.04* 10.83* 28.67 0.57* -0.47 0.01 -2.65* 
AVTO1311 1.96* -0.27 -3.21 3.20* 6.71* 4.84** -22.10** 14.04* -49.97 0.14 1.7 0.02 -0.65 
AVTO1429 2.22* -0.02 2.39 1.94 3.69 2.1 -18.82** 7.94 -27.06 0.57* 1.93 0.07 -0.04 
Pimplifolium -6.21** 0.31 2.73 -7.46** -14.27** -11.96** 56.96** -32.82** 48.36 -1.29** -3.17* -0.1 3.35* 
              
SE 0.10 0.22 2.93 1.19 2.31 1.10 6.09 4.93 63.60 0.26 1.49 0.04 1.12 
*Significant difference observed among the mean (P < 0.05); **highly significant difference observed among mean (P < 0.01). GCA = General combining ability 
 
 
 
 
 
116 
 
University of Ghana http://ugspace.ug.edu.gh
6.3.4.2 Estimation of Specific Combining Ability Effects 
 
AVTO1429 x Peto Mech and Pimplifolium x Peto Mech exhibited significant positive SCA 
effect for days to first flowering (Table 6.7). Although AVTO1219 x Power Rano and 
AVTO1311 x Wosowoso displayed negative SCA effect for plant height, AVTO1219 x 
Wosowoso and AVTO1429 x Wosowoso showed significant positive SCA effect for plant 
height.  AVTO1219 x Power Rano showed significant positive SCA effect for fruit length but 
AVTO1311 x Power Rano expressed negative SCA effect for fruit length. While Pimplifolium 
x Peto Mech showed negative SCA effect for number of fruits per plant, Pimplifolium x Power 
had the highest significant positive SCA effect for fruits per plant. AVTO1429 x Lorry Tyre 
exhibited positive SCA effect for weight per fruit, however, AVTO1219 x Lorry Tyre and 
AVTO1311 x Power Rano exhibited negative SCA effect for fruit weight per fruit. AVTO1311 
x Lorry Tyre had the highest significant positive SCA for yield per plant. AVTO1219 x Power 
Rano, AVTO1311 x Power and AVTO1429 x Peto Mech had positive SCA effect for pericarp 
thickness. AVTO1311 x Peto Mech and AVTO1429 x Lorry Tyre also showed positive 
significant SCA effect for fruit hardness. However, only Pimplifolium x Peto Mech showed 
significant negative SCA to fruit hardness.  AVTO1219 x Wosowoso and AVTO1429 x Peto 
Mech exhibited negative significant SCA effect for shelf life, AVTO1311 x Power Rano 
expressed positive SCA for shelf life.   
 
 
 
 
 
117 
 
University of Ghana http://ugspace.ug.edu.gh
Table 6. 7: Specific combining ability effects for vegetative and reproductive traits studied in tomato 
Crosses Days to Number Height Days to Fruit Fruit Fruit/ Weight Yield/ Pericarp Fruit Shelf 
first of  at first length diameter plant /fruit (g) plant (g) thickness hardness life 
flowering Branches maturity fruit (mm) (mm) (mm) (N/cm2) 
(cm) set 
AVTO1219 x Lorry Tyre   -0.72 -0.48 -2.42 0.53 -4.66 -1.63 11.49 -15.74* 173.79 -0.61 -0.06 1.02 
AVTO1219 x Peto Mech -0.98 -0.3 -3.8 -0.68 2.64 0.48 -2.86 10.51 33.28 0.37 2.51 1.02 
AVTO1219 x Power Rano 0.86 0.29 -10.99* 0.54 5.61* 0.81 -2.34 4.68 23.91 0.81* -0.59 -2.04 
AVTO1219 x Power 1.12 -0.19 0.74 -0.02 1.52 0.31 -5.66 -1.7 -111.78 -0.3 -1.36 1.53 
AVTO1219 x Wosowoso 0.07 0.62 9.44* -0.2 -4.54 0.21 -2.15 4.16 47.12 -0.09 -1.18 -3.57* 
AVTO1311 x Lorry Tyre 0.91 -0.27 -1.2 0.4 1.22 1.04 5.47 4.01 252.75* 0.06 -4.14 -0.25 
AVTO1311 x Peto Mech -1.19 -0.37 -7.9 0.3 1.9 1.18 -1.54 10.44 -106.18 -0.42 6.75** -1.53 
AVTO1311 x Power Rano 0.12 0.49 5.58 0.5 -6.02* -1.92 -1.29 -16.66* -217.65 -0.5 2.47 3.32* 
AVTO1311 x Power 1.17 -0.52 0.41 -0.34 0.95 -0.86 -4.25 1.01 -180.02 0.75* -1.65 -2.3 
AVTO1311 x Wosowoso -0.67 -0.24 -8.74* -0.61 2.94 0.73 -0.48 3.68 -38.85 0.16 -0.96 0.26 
AVTO1429 x Lorry Tyre -0.61 1.12 6.07 0.36 -0.84 0.33 -5.31 12.29* -165.081 0.1 4.43* 1.58 
AVTO1429 x Peto Mech 3.85** -0.57 -3.14 1.94 2.97 -0.33 1.63 -1.88 41.84 0.70* 1.37 -3.79* 
AVTO1429 x Power Rano -1.13 -0.51 -2.18 -1.4 1.54 -0.66 6.73 -9.08 95.5 -0.13 -1.64 -0.21 
AVTO1429 x Power -1.13 0.34 -4.86 0.28 -2.24 0.45 -2.6 3.52 -0.72 -0.3 -1.55 0.04 
AVTO1429 x Wosowoso -0.61 -0.44 12.92* -1.02 -0.87 0.28 -2.24 -3.45 -128.53 -0.2 0.18 2.34 
Pimplifolium x Lorry Tyre -1.84 0.06 1.99 -0.46 1.62 -0.23 11.5 -0.84 56.74 -0.21 -1.64 0.77 
Pimplifolium x Peto Mech 2.88* -0.3 5.31 0.38 -1.53 -0.54 -21.03* -3.8 -46.69 0.11 -4.51* 1.53 
Pimplifolium x Power Rano -0.53 0.56 4.08 0.11 -1.85 -0.37 -12.32 1.87 -94.54 -0.33 -1.01 1.28 
Pimplifolium x Power -0.53 0.61 6.1 -0.27 -0.77 1.36 25.17** -1.72 252.41* 0.01 2.59 1.02 
Pimplifolium x Wosowoso -1.05 0.1 -7.43 -0.35 0.4 -0.62 2.07 -1.31 112.69 0.03 -0.01 -2.04 
SE 1.06 0.34 4.44 1.29 2.48 1.22 7.47 5.83 128.63 0.32 1.88 1.44 
*Significant difference observed among the mean (P < 0.05); **highly significant difference observed among SCA of crosses (P < 0.01). 
 
 
118 
 
University of Ghana http://ugspace.ug.edu.gh
6.3.4.3 Relative contribution of Additive and Non-Additive Gene action to 
various traits in tomato 
 
The GCA values for males ranged from 6.14% for yield to 91.08 % for fruit diameter. Again, 
the GCA values for females ranged from 3.75% for days to first flowering to 53.26% for plant 
height. Fruit diameter had the highest GCA (94.98%), followed by number of fruits per plant 
(91.80) and then fruit length (89.88). The least GCA was recorded for yield per plant (18.99%), 
followed by number of primary branches (49.89%) and shelf life (58.31%). SCA values ranged 
from ranged 5.02% for fruit diameter to 81.01% for yield per plant (Figure 6.8). 
100%
90%
80%
70%
60%
50%
40%
30%
20%
10%
0%
Male Female SCA
 
Figure 6. 1: Relative contribution of Additive and Non-Additive Genes to various traits in 
tomato 
 
 
 
119 
 
University of Ghana http://ugspace.ug.edu.gh
6.3.5 Mean performance of parents and 20 F1 hybrids evaluated for various traits 
in tomato 
 
The mean performance of parents for days to first flowering ranged from 10 days 
(Pimplifolium) to 23 days (AVTO1219) compared to 7 (Pimplifolium x Lorry Tyre) to 22 days 
(AVTO1429 x Peto Mech) in specific crosses. Mean yield of parents ranged from 301.70 g in 
AVTO1219 to 1283.30 g in AVTO1429, however, the mean yield of the 20 F1 hybrids ranged 
from 301.10 g in Power Rano x AVTO1311 to 1306.50 g in AVTO1311 x Lorry Tyre. For fruit 
quality traits, the mean shelf life for parents ranged from 14 days (Wosowoso) to 28 days 
(Pimplifolium) while the mean shelf life of the 20 F1 hybrids ranged from 16 days (Wosowoso 
x AVTO1219) to 29 days (Peto Mech x Pimplifolium) –Table 6.8.   
6.3.6 Heterosis 
 
 The mid-parent heterosis ranged from -54.52% (Lorry Tyre x Pimplifolium) for days to 
flowering to 571.16% (Lorry Tyre x AVTO1219) for fruits per plant (Table 6.9). 
Heterobeltiosis ranged from -99% in fruit weight (Wososowo x AVTO142) to 383.52% for 
fruits per plant (Lorry Tyre x AVTO1219).  Power Rano x AVTO1219 had the highest 
heterobeltiosis (56.03%) for pericarp thickness. For fruit hardness, Wosowoso x Pimplifolium 
cross exhibited the highest fruit hardness (27.21%) followed by Peto Mech x AVTO1311 
(20.12%) – Table 6.10. 
 
 
 
 
 
120 
 
University of Ghana http://ugspace.ug.edu.gh
T able 6. 8:  Mean performances of parents and the F1s evaluated for vegetative reproductive, yield and fruit quality traits 
Number of 1st Height at 1st fruit Fruit Fruit Fruits/ Weight Yield / Pericarp Fruit pH Shelf 
 branches f lowering  maturity  set  length d iameter  plant   plant  thickness h ardness   life 
Parents 
AVTO1219 5 23 72.67 34 49.32 39.60 7.10 42.94 301.70 3.67 27.07 3.99 24 
AVTO1311 6 14 47.67 24 55.45 38.16 8.30 41.28 342.60 3.55 25.20 4.20 22 
AVTO1429 5 19 70.67 25 51.34 56.70 14.43 89.03 1283.80 5.20 30.90 4.43 26 
Pimplifolium 6 10 75.33 20 21.42 24.47 73.77 10.28 765.20 2.16 10.40 4.00 28 
Lorry Tyre 5 19 55.33 35 36.86 65.85 3.13 109.02 354.30 5.20 29.83 4.02 15 
Peto Mech 4 16 55.00 24 55.29 43.76 12.17 60.25 735.40 5.44 24.73 4.15 24 
Power Rano 6 12 72.00 22 32.38 51.56 23.20 54.49 1265.40 3.69 15.50 4.16 21 
Power 9 14 74.00 27 35.55 54.09 16.50 75.26 1233.80 4.40 17.50 3.96 21 
Wosowoso 6 11 67.00 23 36.32 60.35 7.00 88.72 623.20 3.07 9.50 4.11 14 
                           
Crosses 
Lorry Tyre x AVTO1219 6 16 73.33 29 34.53 43.68 34.33 37.04 1264.10 3.82 16.23 4.36 22 
Lorry Tyre x AVTO1311 6 18 73.33 20 44.16 49.05 20.70 62.74 1306.50 4.31 14.10 4.26 23 
Lorry Tyre x AVTO1429 8 17 86.67 27 38.75 44.84 10.43 66.08 689.10 4.80 23.37 4.28 26 
Lorry Tyre x Pimplifolium 7 7 82.67 16 23.64 29.61 107.33 10.36 1104.50 2.51 11.87 4.13 28 
Peto Mech x AVTO1219 6 16 55.67 25 50.74 48.95 11.60 71.58 828.30 5.16 23.63 4.30 22 
Peto Mech x AVTO1311 5 16 50.00 28 52.71 50.23 7.20 74.70 536.00 3.66 30.27 3.89 21 
Peto Mech x AVTO1429 5 22 60.67 34 50.93 44.35 14.47 54.57 785.70 5.61 24.83 4.31 19 
Peto Mech x Pimplifolium 6 13 70.00 19 27.76 29.85 61.77 11.62 725.50 2.95 13.53 4.15 29 
Power Rano x AVTO1219 7 18 55.00 29 48.15 47.62 13.70 54.65 749.90 5.75 16.07 4.26 18 
Power Rano X AVTO1311 7 17 71.33 30 37.52 41.77 8.97 33.57 301.10 3.54 21.47 4.09 27 
Power Rano x AVTO1429 6 16 68.67 22 43.25 41.65 22.33 36.09 803.90 4.48 17.37 4.05 23 
Power Rano x Pimplifolium 7 8 75.67 18 21.37 28.19 74.17 7.81 588.10 2.35 12.93 4.18 29 
Power x AVTO1219 6 19 74.33 27 43.59 48.91 11.73 53.45 627.00 4.24 14.50 4.28 23 
Power x AVTO1311 5 19 72.67 27 45.76 46.31 7.43 59.75 443.80 5.25 16.37 4.32 20 
Power x AVTO1429 7 16 72.67 28 39.04 46.29 12.80 56.50 741.50 4.25 16.70 4.20 24 
Power x Pimplifolium 7 8 84.67 16 22.79 34.12 123.47 9.77 1204.80 2.81 15.97 4.25 28 
Wosowoso x AVTO1219 7 17 88.00 26 35.19 48.26 14.60 60.71 888.60 4.54 14.70 4.14 16 
Wosowoso x AVTO1311 6 16 67.33 26 46.67 49.17 10.63 63.37 678.20 4.45 17.10 4.27 23 
Wosowoso x AVTO1429 6 17 96.00 23 39.24 45.48 11.70 49.15 563.70 4.38 18.53 4.33 27 
Wosowoso x Pimplifolium 7 8 74.67 16 22.75 29.57 92.90 10.83 1008.80 2.83 13.23 3.96 24 
              
SED 1 2 3.03 2 2.08 2.06 7.28 5.06 196.10 0.40 1.16 0.12 2 
121 
 
University of Ghana http://ugspace.ug.edu.gh
 
T able 6. 9: Mid parent and better heterosis of 20 F1 hybrids evaluated for vegetative, reproductive, yield and yield component traits in tomato 
1st flowering Height at maturity 1st fruit set Fruits/plant Fruit length Fruit diameter 
Genotypes MPH BPH MPH BPH MPH BPH MPH BPH MPH BPH MPH BPH 
Lorry Tyre x AVTO1219 -21.62 -14.05 14.58 32.53 -15.13 -13.87 571.16 383.52 -19.87 -29.99 17.00 -33.67 
Lorry Tyre x AVTO1311 9.99 27.91 42.39 53.83 1.71 25.35 262.20 149.40 -4.32 -20.36 -5.68 -25.51 
Lorry Tyre x AVTO1429 -11.49 -10.71 37.57 56.64 -11.10 5.29 18.79 -27.72 -12.13 -24.52 -26.82 -31.91 
Lorry Tyre x Pimpinellifolium -54.52 -35.43 26.54 49.41 -42.67 -21.65 179.14 45.49 -18.87 -35.87 -34.43 -55.03 
Peto Mech x AVTO1219 -16.54 -29.42 -12.79 1.22 -14.93 1.40 20.39 -4.68 -2.99 -8.23 17.44 11.86 
Peto Mech x AVTO1311 4.47 0.00 -2.60 4.89 16.67 15.08 -29.65 -40.84 -4.80 -4.94 22.63 14.79 
Peto Mech x AVTO1429 30.05 42.50 -3.45 10.31 36.93 39.75 8.80 0.28 -4.47 -7.89 -11.71 -21.78 
Peto Mech x Pimpinellifolium -2.54 22.65 7.42 27.27 -15.77 -6.65 43.75 -16.27 -27.62 -49.79 -12.50 -31.79 
Power Rano x AVTO1219 5.74 52.75 -23.96 -23.61 4.81 38.44 -9.57 -40.95 17.87 -2.37 4.48 -7.64 
Power Rano X AVTO1311 31.64 44.42 19.21 49.63 32.33 1.52 -43.05 -61.34 -14.56 -32.34 -6.89 -18.99 
Power Rano x AVTO1429 4.34 33.33 -3.74 -2.83 -6.38 -11.65 18.68 -3.75 3.32 -15.76 -23.06 -26.54 
Power Rano x Pimpinellifolium -25.39 -19.36 2.72 5.10 -15.19 0.00 52.98 0.54 -20.56 -34.00 -25.85 -45.33 
Power x AVTO1219 1.83 33.36 1.36 2.28 -10.51 14.07 -0.59 -28.91 2.72 -11.62 4.41 -9.58 
Power x AVTO1311 31.80 33.36 19.45 52.44 7.27 10.54 -40.08 -54.97 0.57 -17.48 0.40 -14.38 
Power x AVTO1429 -2.05 -14.30 0.46 2.83 7.69 -18.35 -17.23 -22.42 -10.14 -23.96 -16.44 -18.36 
Power x Pimpinellifolium -31.52 -19.36 13.40 14.42 -30.02 0.00 173.56 67.37 -19.99 -35.89 -13.14 -36.92 
Wosowoso x AVTO1219 1.94 52.96 26.01 31.34 -7.08 13.04 107.09 105.63 -17.82 -28.65 -3.43 -20.03 
Wosowoso x AVTO1311 27.28 44.13 17.43 41.24 11.42 1.43 38.95 28.07 1.71 -15.83 -0.17 -18.53 
Wosowoso x AVTO1429 11.13 47.13 39.46 43.28 -3.46 -20.00 9.19 -18.92 -10.47 -23.57 -22.29 -24.64 
Wosowoso x Pimpinellifolium -29.18 -25.75 4.93 11.45 -25.58 -30.43 130.04 25.93 -21.20 -37.36 -30.28 -51.00 
MPH - Mid-parent heterosis; BPH - Heterobeltiosis  
 
 
 
122 
 
University of Ghana http://ugspace.ug.edu.gh
T able 6. 10: Mid parent and better heterosis of 20 F1 hybrid s evaluated for yield and fruit quality traits in tomato  
Weight/fruit Yield Pericarp thickness Fruit hardness pH Shelf life 
Genotypes MPH BPH MPH BPH MPH BPH MPH BPH MPH BPH MPH BPH 
Lorry Tyre x AVTO1219 -51.25 -66.02 285.40 256.79 -13.80 -26.44 -42.95 -45.59 0.55 0.42 12.61 -8.22 
Lorry Tyre x AVTO1311 -16.51 -42.45 274.95 268.76 -1.42 -17.01 -48.76 -52.73 1.26 -1.12 20.39 1.52 
Lorry Tyre x AVTO1429 -33.27 -39.39 -15.87 -46.32 -7.72 -7.75 -23.04 -24.37 -1.30 -6.03 24.22 -1.27 
Lorry Tyre x Pimplifolium -82.63 -90.50 97.32 44.34 -31.85 -51.76 -40.99 -60.21 -4.72 -8.04 29.24 0.00 
Peto Mech x AVTO1219 38.73 18.80 59.73 12.63 13.24 -5.15 -8.76 -12.71 7.54 6.01 -6.96 -8.22 
Peto Mech x AVTO1311 47.15 23.98 -0.56 -27.11 -18.67 -32.78 21.25 20.12 2.53 1.43 -8.70 -11.28 
Peto Mech x AVTO1429 -26.89 -38.71 -22.18 -38.80 5.51 3.18 -10.73 -19.64 0.27 -3.32 -24.82 -28.19 
Peto Mech x Pimplifolium -67.05 -80.71 -3.31 -5.19 -22.29 -45.72 -22.97 -45.29 -1.75 -3.95 12.25 3.57 
Power Rano x AVTO1219 12.18 0.29 -4.29 -40.74 56.33 56.03 -24.50 -40.64 9.31 7.94 -19.13 -24.66 
Power Rano X AVTO1311 -29.89 -38.39 -62.55 -76.21 -2.13 -3.91 5.50 -14.80 2.48 -1.26 26.15 22.39 
Power Rano x AVTO1429 -49.71 -59.46 -36.93 -37.38 0.75 -13.90 -25.13 -43.79 2.40 -3.77 -0.72 -10.27 
Power Rano x Pimplifolium -75.88 -85.67 -42.08 -53.52 -19.62 -36.26 -0.15 -16.58 -0.12 -4.88 17.02 2.39 
Power x AVTO1219 -9.56 -28.98 -18.33 -49.18 5.00 -3.70 -34.93 -46.44 4.02 3.28 0.74 -5.47 
Power x AVTO1311 2.54 -20.61 -43.69 -64.03 31.90 19.17 -23.33 -35.04 3.68 1.83 -8.38 -10.43 
Power x AVTO1429 -31.22 -36.54 -41.09 -42.24 -11.49 -18.27 -30.99 -45.95 1.92 -2.42 0.02 -8.96 
Power x Pimplifolium -77.16 -87.02 20.54 -2.35 -14.37 -36.18 14.48 -8.74 0.63 -2.32 14.86 1.18 
Wosowoso x AVTO1219 -7.78 -31.57 92.15 42.59 34.63 23.52 -19.61 -45.70 0.52 -2.52 -15.52 -32.88 
Wosowoso x AVTO1311 -2.51 -28.57 40.44 8.83 34.35 25.16 -1.44 -32.14 0.99 0.40 27.28 4.48 
Wosowoso x AVTO1429 -44.70 -99.65 -40.88 -56.09 6.04 -15.71 -8.27 -40.03 -0.20 -2.19 32.26 2.58 
Wosowoso x Pimplifolium -78.12 -87.79 45.32 31.83 8.40 -7.63 32.96 27.21 -7.33 -7.90 14.95 -13.11 
MPH - Mid-parent heterosis; BPH - Heterobeltiosis  
 
 
 
 
123 
 
University of Ghana http://ugspace.ug.edu.gh
6.4 Discussion 
6.4.1 Confirmation of TYLCD resistance gene in 20 F1 hybrids 
 
The Primers used for the amplification of the TYLCD resistance genes confirmed that most of 
the plants were hybrid since they amplified double bands in the F1. This led to the avoidance 
of the selection of false hybrids that were going to be used in the F2 population study.  
A higher GCA indicates higher heritability and less environmental effects (Fasahat et al., 
2016). Days to first flowering and first fruit is an important determinant of early yield and 
therefore Pimplifolium that contributed negative GCA effects for these traits is desirable for 
developing early maturing hybrids. This is consistent with the results obtained by Chishti et al. 
(2008) and Zengin et al. (2015). Height of tomato is a very important trait since tall tomato 
plants require staking. Staking tomato prevents tomato fruits from getting direct contact with 
the soil and soil microorganisms. Staking also improves aeration thereby reducing the 
prevalence of fungi diseases but it is labour and capital intensive. Genotypes such as Peto Mech 
and Wosowoso that contributed significant negative GCA for plant height at maturity can be 
exploited in developing short and firm stem hybrids. Zengin et al. (2015), however, reported 
positive significant GCA for height and inferred that it is a desirable trait for tomato growth. 
Peto Mech and AVTO1311 were good general combiners for fruit length. AVTO1219 and 
AVTO1311 were also good general combiners for fruit diameter. Lorry Tyre was a good 
combiner for yield. Pimplifolium was a good general combiner for number of fruits per plant 
but very poor combiner for weight per fruit. All the other males were good combiners for 
weight per fruit. Parents with significant positive GCA for yield components traits will be very 
desirable in breeding for high yielding varieties. These findings agree with (Zengin et al., 2015) 
who reported positive GCA for yield component traits. 
124 
 
University of Ghana http://ugspace.ug.edu.gh
AVTO1219 and AVTO1429 were good general combiners for pericarp thickness. Peto Mech 
was a good combiner for fruit hardness and Pimplifolium was a good combiner for shelf life. 
These genotypes will be useful in improving fruit quality.  
6.4.2 Specific Combining Ability Effects 
 
SCA effects are due to non-additive gene action which includes dominant or epistatic (Falconer 
1989) and isolate best specific crosses with most desirable traits combination (Ercan and 
Mehmet 2005).   
Cruz et al. (2004) indicated that to achieve a good estimate for SCA, at least one of the parents 
of the cross combination should show a good effect of GCA. The report of Kadams et al. (1999) 
also emphasizes that hybrid with high SCA involves one or two of both parents of good general 
combiners. These two reports agree with the observation that Pimplifolium was a good 
combiner for fruits per plant and this was evident in the specific cross whereby Pimplifolium 
x Power also had a positive significant SCA for fruit per plant.  AVTO1311 x Lorry Tyre 
showed a desirable significant SCA for yield since Lorry Tyre was a good combiner for yield.  
On the contrary, the study of Umar et al. (2017) showed that the absence of negative SCA 
effects for shattering score, days to 50% flowering and days to maturity indicated that the 
hybrids did not follow the trend where a high estimate of SCA should involve one or both 
parents exhibiting high GCA effect. In the present study for height at maturity, Wosowoso 
exhibited positive (undesirable) significant GCA for plant height at maturity, however, 
AVTO1311 x Wosowoso exhibited a negative significant SCA.  
Traits like days to first flowering, days to first fruit set, fruits per plant are highly under 
additive gene control but yield was influenced by non-additive genes. 
125 
 
University of Ghana http://ugspace.ug.edu.gh
 
Positive heterosis for traits like yield is desired, however, negative heterosis is desired for traits 
like early maturity (Acquaah, 2012). A good cross for days to first flowering was Lorry Tyre 
x Pimplifolium. Selection of hybrids showing better heterosis over better parents for days to 
flowering will be useful for developing early commercial hybrids. Again, good cross Lorry 
Tyre x AVTO1219 for weight can be utilized in developing high yielding hybrids. This is 
consistent with Shende et al. (2012) who reported that heterobeltiosis for fruit weight breeding 
is the best for improving the trait in tomato.  
6.5 Conclusion 
The primers confirmed the introgressed Ty-2, Ty-3 and ty-5 genes. Pimplifolium can be used 
for improving earliness. Even though Pimplifolium had a positive significant GCA for number 
of fruits per plant, it had negative significant GCA for weight per fruit and therefore cannot be 
recommended for yield improvement. Peto Mech can be used to develop shorter plants. Lorry 
Tyre can be used to improve yield. Specific crosses such as AVTO1429 x Lorry Tyre had the 
highest significant weight and AVTO1311 x Lorry Tyre had the highest significant yield. 
AVTO1219, AVTO1429 and Peto Mech can be recommended for improving fruit quality. 
AVTO1311 x Peto Mech showed the highest positive significant SCA effect for fruit hardness. 
AVTO1219 x Power Rano had positive SCA for fruit thickness 
This study gives an indication that both additive and non-additive gene effects were important 
in the inheritance of yield and fruit quality in tomato. The heterosis can be utilized in breeding 
for tomato fruits that combine high yielding, fruit quality and TYLCD resistance. 
 
 
  
126 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER SEVEN 
7.0 Segregation pattern for fruit quality and TYLCD resistance loci in tomato (Solanum 
lycopersicum L.) F2 population 
7.1 Introduction 
In Ghana, tomato is the most important vegetable, however, cultivars grown have low yield, 
poor fruit quality and are susceptible to diseases and pests (Robinson and Kolavalli, 2010). 
Tomato Yellow Leaf Curl Disease (TYLCD) is the most important diseases affecting tomato 
and causes significant yield and quality losses in Ghana (Horna et al., 2006)  
In order to improve on disease resistance, resistance genes from the wild tomato species have 
introgressed into tomato lines (Ji et al., 2007; Hanson et al., 2016).  Plant molecular genetics 
and genomics present useful information to breeders to make decisions on the incorporation of 
desirable genes into various elite cultivars (Varshney at al., 2014). Resistance genes have been 
mapped and molecular markers linked to traits have also been developed to carry out marker-
assisted selection. Utilization of tightly linked molecular markers allows the selection of 
resistance gene(s) in segregating population even in the absence of disease infection 
(Mandoulakani et al., 2015).  For traits controlled by single or few genes, molecular marker 
selection at F2 generation reduces labour and cost that will be involved in screening a large 
number of genotypes in a subsequent generation (Barone et al. 2005). For self-pollinated crops 
like tomato, pedigree breeding is considered an effective method to develop pure lines. 
Selection can be based on best performing single plants (Acquaah, 2012). 
Selection of tomato of individual plants with disease homozygous resistant alleles will be 
valuable in breeding for resilient commercial tomato variety. The objective of this work was to 
identify and select F2 plants with homozygous TYLCD resistance gene loci. 
 
127 
 
University of Ghana http://ugspace.ug.edu.gh
7.2 Materials and Methods 
7.2.1 Plant materials and Experimental Site 
The F2 population from Power Rano and AVTO1429 was used for this study. The parents were 
included in the trial. AVTO1429 had Ty-2 and Ty-3 genes while Power Rano lacks Ty-2 and 
Ty-3 genes. 
7.2.3 Nursery and Agronomic practices 
 
Two seeds of the F2 population and parents were planted in each cell of a nursery tray and later 
thinned to one seedling per cell.  Seedlings were watered twice daily and Ridomil was applied 
to prevent damping off disease.  
7.2.4 Identification of plants with TYLCD resistance genes 
Leaf samples were harvested from the 38 F2 plants and one plant of each of the parents. Samples 
were sent to Ag Biotech in the USA for the amplification of the TYLCD resistance genes using 
SNP markers. 
7.2.4 Statistical analysis 
 Chi-Square goodness of fit test was used to check whether the Ty-2 and Ty-3 will segregate 
in the 1:2:1 Mendelian ratio.  
7.3 Results 
For Ty-2 gene, the number of plants observed for the genotypes was 7 resistance alleles, 17 
heterozygous and 14 susceptible alleles (Table 7.1). 
 
 
 
 
128 
 
University of Ghana http://ugspace.ug.edu.gh
Table 7. 1: Segregation pattern of 38 F2 plants for obtained from Power Rano x AVTO1429 
segregating for Ty-2 genes 
Allele df Observed (O) Expected (E) O-E (O-E)2 (O-E)2/E P value (0.05) 
         
R  7 9.5 -2.5 6.25 0.66 
 
HT  17 19 -2 4 0.21 
 
S  14 9.5 4.5 20.25 2.13 
χ2 2     3 0.22 
R=Resistance; HT=Heterozygous; S=Susceptible 
 
For the Ty-3 gene, number of plants observed for resistance (3) and heterozygous (18) alleles 
was fewer than expected while the number of plants for susceptible was greater than expected 
(Table 7.2).  
 
Table 7. 2: Segregation pattern of 38 F2 plants for obtained from Power Rano x AVTO1429 
segregating for Ty-3 
Allele df Observed (O) Expected (E) O-E (O-E)2 (O-E)2/E P value (0.05) 
 
R  3 9.5 -6.5 42.25 4.45 
 
HT  18 19 -1 1 0.05 
 
S  17 9.5 7.5 56.25 5.92 
χ2 2     10.42 0.005 
R=Resistance; HT=Heterozygous; S=Susceptible 
 
 
 
 
 
 
  
129 
 
University of Ghana http://ugspace.ug.edu.gh
7.4 Discussion 
The Ty-2 introgression segregation was an acceptable fit to the expected 1:2:1 ratio. Ty-2 is a 
dominant resistance gene (Hanson et al., 2010) and therefore followed the inheritance of a 
single dominant gene. 
 The Ty-3 introgression segregation deviated from the 1:2:1 ratio. This work collaborates with 
a similar work done by Gracia et al. (2008) who reported that among 77 F2 plants segregating 
for Ty-4 gene, the number of plants with resistant alleles were reduced (10) and the numbers 
of plants with the susceptible alleles were increased (43). This was attributed to the Ty-4 
introgression decreasing the number of viable seedlings and thus carried deleterious alleles for 
gamete viability, seed set or germination.  
7.5 Conclusion 
Seven (7) and three (3) homozygous resistant plants for Ty-2 and Ty-3 genes were identified. 
This will enable the screening of F3 families in Tomato Yellow Leaf Curl Disease hotspot. 
 
 
 
 
 
 
 
 
 
 
 
130 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPETR EIGHT 
8.1 General Conclusion and Recommendation 
TYLCD was the most important biotic stress in all the three regions. Most respondents were 
familiar with the symptoms of TYLCD but did not know the cause of the disease. Farmers 
applied different chemicals in an attempt to control TYLCD. The disease can cause more than 
50% of yield loss. Farmers indicated high yielding, TYLCD resistant and have longer shelf 
life.  
There was high level of diversity within the tomato germplasm assembled. The cluster analysis 
grouped the accessions into two distinct classes. The cluster I is largely made of improved 
varieties. The two cultivated accessions (Power Rano and Peto Mech) in Ghana were also found 
in cluster I. The cluster II was made largely of local cultivars. The 348 SNPs markers used 
were very informative in the assembled germplasm. With the exception of the lines from 
PGRRI and UC Davis, all the accessions had high level of heterozygosity. The UC DAVIS and 
BNARI accessions were good addition to the cultivars from PGGRI.   
This study confirmed the presence of Ty-2 and Ty-3 TYLCD resistance genes in the lines from 
AVRDC.  ty-5 gene (larger band size than expected) and Ty-6 gene were discovered in the 
Ghanaian line Pimplifolium from PGRRI and ty-6 in G121 (Wosowoso x Pimpinellifolium) 
from BNARI. Pimplifolium expressed high level of resistance to TYLCD at both Akumadan 
and Vea. 
Pimplifolium was a good general combiner for number of fruits per plant and shelf life. Peto 
Mech was a good combiner for fruit quality such as fruit length and fruit hardness. AVTO1219, 
AVTO1311 and AVTO1429 were good general combiners for fruit weight and AVTO1311 
was also a good combiner for fruit diameter. Lorry Tyre can be used to improve yield. For 
specific crosses, Lorry Tyre x AVTO1311 expressed positive SCA for yield. Lorry x 
131 
 
University of Ghana http://ugspace.ug.edu.gh
AVTO1429 had the highest SCA for weight.  AVTO1311 x Peto Mech had positive SCA for 
fruit hardness. AVTO1219 x Power Rano had positive SCA for fruit thickness. 
Seven (7) and three (3) homozygous resistant plants for Ty-2 and Ty-3 genes were identified.  
Recommendations 
1. The discovered ty-5 and Ty-6 in Pimplifolium should be sequenced and compared to 
known ty-5 and Ty-6 genes. 
2. The F1 should be evaluated at different locations to establish their performance across 
environments. 
3. The F2 derived F3 families should be evaluated in a disease hotspot to ascertain their 
level of resistance. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
  
132 
 
University of Ghana http://ugspace.ug.edu.gh
REFERENCES 
Abhary, M., Patil, B., and Fauquet, C. (2007). Molecular biodiversity, taxonomy, and 
nomenclature of tomato yellow leaf curl-like viruses, In: H. Czosnek, (ed.) Tomato 
yellow leaf curl virus disease: management, molecular biology, breeding for resistance. 
Springer, 85-118, Dordrecht 
 
Acquaah, G. (2012). Principles of plant genetics and breeding, Second Edition.  John Wiley 
and Sons, Ltd. Published by John Wiley & Sons, Ltd 
 
Adebisi, M. A., Okelola F. S, Ajala, M. O., Kehinde, T. O., Daniel, I. O., and Ajani, O. O. 
(2012). Evaluation of variations in seed vigour characters of West African rice (Oryza 
sativa L.) genotypes using multivariate technique. American Journal of Plant Science, 
4, 356–363  
 
Agble, F. (1978). Crop Research Institute Horticulture division annual report. Horticulture 
Division/12/SF2/1 8-13 
 
Agrama, H.A., and Scott, J. W. (2006). Quantitative trait loci for tomato yellow leaf curl virus 
and tomato mottle virus resistance in tomato. Journal of the American Society for 
Horticultural Science 131, 267-272 
 
Aguirre, N. C., López, W., Orozco-Cárdenas, M., Coronado, Y. M., and Vallejo-Cabrera 
(2016). Use of microsatellites for evaluation of genetic diversity in cherry tomato. DOI: 
http://dx.doi.org/10.1590/1678 4499.116 
 
Ahmad, F., Hanafi, M. M., Hakim, M. A., Rafii, M.Y., Arolu, I. W., and Abdullah, S. N. (2015). 
Genetic divergence and heritability of 42 coloured upland rice genotypes (Oryza sativa) 
as revealed by microsatellites marker and agro-morphological traits. PLoS One 
10(9):e0138246. Doi: 10.1371/journal.pone.0138246 
 
Akhtar, S., and Pandit M. K. (2009). F2 segregation pattern for fruit shape and pedicel character 
in tomato. Journal of Crop and Weed, 5(1), 148-151  
 
Anbinder, I., Reuveni, M., Azari, R., Paran, I., Nahon, S., Shlomo, H., Chen, L., Lapidot, M., 
and Levin, I. (2009). Molecular dissection of Tomato leaf curl virus resistance in tomato 
line TY172 derived from Solanum peruvianum. Theoretical and Applied Genetics, 119, 
519–530 
 
Anguillara, L. (1561). Semplici dell’ eccellente M. L. A, Liquali in piu Pareri diversi nobili 
huomini scritti appiano, et Nouvamente da M. Giovanni Martinello mandate in luce.  
 
Appiah, A., Amoatey, H., Glu, G. Y. P., Affful, N., Azu, E., and Owusu, G. (2012). Spread of 
African cassava mosaic virus from cassava (Manihot esculenta Crantz) to physic nut 
(Jatropha curcas L.) in Ghana. Journal of Phytology, 4(1), 31-37 
 
Asare-Bediako, E., Mensah-Wonkyi, D., Van der Puije, G. C., and Abole, E. (2017). Farmers’ 
agronomic practice in management of the tomato (Solanum lycopersicon L.) Yellow 
leaf curl virus in Central Region of Ghana. Journal of Agricultural Extension, 21 (2)  
133 
 
University of Ghana http://ugspace.ug.edu.gh
Asare-Bediako, E., Wonkyi, D.  M., Van der Puije, G., Amenorpe, G., and Osei, M. K. (2017). 
Variation in the susceptibility of tomato (Lycopersicon Solanum L.) genotypes to 
tomato yellow leaf curl virus (TYLCVD) infections at coastal savannah and forest 
zones of Ghana. Australian Journal of Crop Science, 11 (04), 373-381, Doi: 
10.21475/ajcs.17.11.04. pne124 
 
Bang, B., Lee, J., Kim, S., Park, J., Nguyen, T. T., and Seo, Y. S. (2014). A rapid and efficient 
method for construction of an infectious clone of tomato yellow leaf curl virus. The plant 
pathology journal, 30(3), 310-315 
 
Bhattarai, K., Sharma, S., and Panthee, D. R. (2018). Diversity among modern tomato 
genotypes at different levels in fresh-market breeding. Hindawi International Journal of 
Agronomy. Article ID 4170432 
 
Barbieri, M., Acciarri, N., Sabatini, E., Sardo, L., Accotto, G. P., and Pecchioni, N. (2010). 
Introgression of resistance to two mediterranean virus species causing tomato yellow 
leaf curl into a valuable traditional tomato variety. Journal of Plant Pathology, 92 (2), 
485-493 
 
Barone, A., Ercolano, M. R., Langella, R., Monti, L., and Frusciante, L. (2005). Molecular 
marker-assisted selection for pyramiding resistance genes in tomato. Advances in 
Horticultural Science, 19(3), 147-152 
 
Barrett B. A., Kidwell, K.K. (1998). AFLP-based genetic diversity assessment among wheat 
cultivars from the Pacific Northwest. Journal of Crop Science, 38, 1261-1271 
 
Bekov R. K (1968). Initial material and breeding tomato varieties for mechanical harvesting. 
Autoreferate Dess Moscow, 21 
  
Berry, S., and Rafique-Ud-Din, M. (1988). Effect of high temperature on fruit set in tomato 
cultivars and selected germplasm. Journal of Horticultural Science, 23, 606-608 
 
 Bhattarai, K., Sharma, S., and Panthee, D. R. (2018). Diversity among modern tomato 
genotypes at different levels in fresh-market breeding. International Journal of 
Agronomy. https://doi.org/10.1155/2018/4170432 Article ID 4170432, 15 
 
Bhattarai, U., Sharma, A., Das R., and Talukdar, P. (2016). Genetic analysis of yield and yield 
attributing traits for high temperature resistance in tomato. International Journal of 
Vegetable Science, 22(6), 585-597, DOI: 10.1080/19315260.2015.1118421  
 
 Blay, E. T., Danquah, E. Y., Offei, S. K., and Kudadjie, C. (1999). Morphological and 
agronomic characterization of some tomato (Lycopersicon esculentum) germplasm in 
Ghana. Ghana Journal of Agricultural Science, 32(2), 169-175 
Brewer, M. T, Lang, L., Fujimura, K., Dujmovic, N., Gray, S., and Van Der Knaap, E. (2006). 
Development of a controlled vocabulary and software application to analyze fruit shape 
variation in tomato and other plant species. Journal of Plant Physiology, 141, 15-25 
 
 
 
134 
 
University of Ghana http://ugspace.ug.edu.gh
Brewer, M. T., Moyseenko, J. B., Monforte, A. J., and van der Knaap, E. (2007). 
Morphological variation in tomato fruit: a comprehensive analysis and identification of 
loci controlling fruit shape and development. Journal of Experimental Botany, 58, 
1339-1349 
 
Brown, J. K, Frohlich, D. R and Rosell, R. C. (1995). The sweetpotato/silverleaf whiteflies: 
biotypes of Bemisia tabaci (Genn.), or a species complex. Annual Review of 
Entomology, 40,511-534 
 
Chen, L. F., Rojas, M. R., Kon, T., Gamby, K., Xoconostle-Cazares, B., and Gilbertson R. L.  
(2009). A severe symptom phenotype in tomato in Mali is caused by a reassortant 
between a novel recombinant begomovirus (Tomato yellow leaf curl Mali virus) and a 
betasatellite. Molecular Plant Pathology, 10, 415-430 
 
Chen, H., Chen, L. Yoshida, M., Hanson, P., Schafleitner, R., (2015). Multiplex PCR for 
detection of tomato yellow leaf curl diseases and root-knot nematode resistance genes 
in tomato (Solanum lycopersicum L.). International Journal of Plant Breeding and 
Genetics, 9. 44-56 
 
Chernet, S., Belew, D. And Abay, F. (2013). Genetic variability and association in tomato 
(Solanum lycopersicon L.) genotypes in northern Ethiopia. International. Journal of 
Agricultural Research, 8(2), 67-76 
 
Chishti S. A. S., Khan A. A., Sadia B., and Khan I. A. (2008). Analysis of combining ability 
for yield components and quality characters in tomato (Lycopersicon esculentum Mill.). 
Journal of Agricultural. Research, 46(4), 325-332 
 
Cohen, S., and Harpaz, I. (1964): Periodic, rather than continual acquisition of a new tomato 
virus by its vector, the tobacco whitefly (Bemisia tabaci Gennadius). Entomologia 
experimentalis et Applicata, 7, 155-166 
 
Cohen, S., and Lapidot, M. (2007). Appearance and expansion of TYLCV: a historical point 
of view, In: H. Czosnek, (ed.) tomato yellow leaf curl virus disease: management, 
molecular biology, breeding for resistance. Springer, Dordrecht, 3-12 
 
Cohen, S., Nitzany, F. E., and Vilde, T. (1961). The tomato yellow top virus in Israel. Hassadeh 
Tel Aviv (in Hebrew) 42, 139-140 
 
Corrado, G., Piffanelli, P., Caramante, M., Coppola, M., and Rosa, R.  (2013). SNP genotyping 
reveals genetic diversity between cultivated landraces and contemporary varieties of 
tomato. BMC Genomics, 2 -14, http://www.biomedcentral.com/1471-2164/14/835  
 
 Corte´s, A. J., Chavarro, M. C., and Blair, M. W. (2011). SNP marker diversity in common 
bean (Phaseolus vulgaris L.). Theoretical and Applied Genetics, 123,827-845. DOI 
10.1007/s00122-011-1630-8 
 
Cruz, C. D., Regazzi, A. D., and Carnero, P. C. S. (2004). Modelos biometricos aplicados ao 
melhoramento genetico. Vicosa: Universidade Federal de Vicosa, 480 
 
135 
 
University of Ghana http://ugspace.ug.edu.gh
Czosnek, H., and Laterrot, H. A. (1997). A Worldwide survey of tomato yellow leaf curl 
viruses. Archives of Virology, 142(7), 1391-406 
 
Dagnoko, S., Dinssa, F., Hanson, P. and Kollo, I. A. (2011). Preliminary performance of tomato 
breeding lines for yield, fruit quality, and resistance to tomato yellow leaf curl disease. 
Actahorticulturae, 911(911), 455468. DOI: 10.17660/ActaHortic.2011.911.53 
 
Daniel, O. I, Oloyede, H.T, Adeniji, O. T, Ojo, D. K, and Adegbite, A. E. (2006). Genetic 
analysis of earliness and yield in elite parental lines and hybrids of tropical maize (Zea 
mays L.) Journal of Genetics and Breeding, 60:289-296 
 
Dembele, D., and Noussourou, M. (1991). Tomato yellow leaf curl virus in Mali (in French). 
In: Laterrot H, Trousse C (eds) Proceedings of the seminar of EEC: resistance of the 
tomato to TYLCV, Avignon, France, 17-20 
 
D'Hondt, M. D., and Russo, M. (1985). Tomato yellow leaf curl in Senegal. Journal of 
Phytopathology, 112(2), 153-160 
 
Dharminder, K., Rajeev, K., Sandeep, K., Bhardwaj, M. L., Thakur, M. C., Ramesh, K., 
Kuldeep, S. T., Dogra, B. S., Vikram, A., Thakur, A., and Kumar, P. (2013). Genetic 
variability, correlation and path coefficient analysis in tomato, International Journal of 
Vegetable Science, 19: (4), 313-323. doi: 10.1080/10408690390826437 
 
Dry I. B., Ridgen, J. E., Krake, L. R., Mullineau, P. M., and Rezaian, M. A. (1993). Nucleotide 
sequence and genome organization of tomato leaf curl Gemini Virus. The Journal of 
General Virology, 74(1), 147-151 
 
Duodo, F. (2014). Tomato disease attacks farms in Agotime-Ziope (2014). The Daily Guide 
 
El-Dougdoug, N.  K., Mahfouze, S.  A., Ahmed, S. A., Othman, B. A., and Hazaa, M, A. 
(2013).  Identification of biochemical and molecular markers in tomato yellow leaf curl 
virus resistant tomato species. Scientia Agriculture E-ISSN: 2310-953X/P-ISSN: 2311-
0228 
 
Ercan, C. and Mehmet A. A (2005). Combining ability and hetetrosis for grain yield and some 
yield components in Pea (Pisum sativum L.). Pakistan Journal of Biological Sciences, 
8(10):1447-1452 
 
Falconer, D. S. (1989). Introduction to Quantitative Genetics. Longman, London, 433 
 
Fasahat, P., Rajabi, A., Rad, J. M., and Derera, J. (2016). Principles and utilization of 
combining ability in plant breeding. Biometric & Biostatistics International Journal, 4 
(1), 1-24 https://doi.org/10.1155/2018/4170432 
 
FAOSTAT (2016). http://www.fao.org/faostat/en/#data/QC. Accessed on 23-10-2018 
 
Fauquet, C. M., and Stanley, J. (2005). Revising the way, we conceive and name viruses below 
the species level: A Review of Geminivirus taxonomy calls for new standardized isolate 
descriptors. Archives of Virology, 150, 2151-2179 
 
136 
 
University of Ghana http://ugspace.ug.edu.gh
Fischer R. A., and Rebetzke G. J. (2018). Indirect selection for potential yield in early-
generation, spaced plantings of wheat and other small-grain cereals: A Review. Crop 
and Pasture Science, 69, 439-459 https://doi.org/10.1071/CP17409 
 
Friedmann, M., Lapidot, M., Cohen, S. and Pilowsky, M. (1998). Novel source of resistance to 
tomato yellow leaf curl virus exhibiting a symptomless reaction to viral infection. 
Journal of the American Society for Horticultural Science, 123, 1004-1007 
 
Fufa, H., Baenziger, P. S., Beecher, B. S., Dweikat, I., Graybosch, R. A., and Eskridge, K. M. 
(2005). Comparison of phenotypic and 1103 molecular marker-based classifications of 
hard red Winter wheat cultivars. Euphytica, 145,133-146 
 
Gajanandana, O., Warin, N., Seepiban, C., Hongprayoon, R., and Attathom, S. (2002). 
Production of monoclonal antibodies to the coat protein of tomato yellow leaf curl virus 
and the development of immunoassays for detection of tomato yellow leaf curl virus 
and whitefly transmitted Geminivirus. Workshop on detection of tomato yellow leaf 
curl virus and whitefly-transmitted Geminivirus Using immunological methods. 
Kasetsart Univerisy, Kamphaeng Saen Campus, Nakhon Pathom, 1-4  
 
Gakpo, J. H. (2017). Farming communities turn down ‘alien seeds for ‘Planting for Food and 
Jobs’. wwwmyjoyfm.com  
 
Garcia-Andres, S., Monci, F., Navas-Castillo, J., and Moriones, E. (2006). Begomovirus 
Genetic Diversity in the Native Plant Reservoir Solanum Nigrum: Evidence for the 
presence of a new virus species of Recombinant Nature. Virology, 350, 433-442 
 
Ghana Statistical Service (GSS). (2013). 2010 Population and housing census: Regional 
analytical report Upper East Region 
 
Ghanim, M., Morin, S., Zeidan, M., and Czosnek, H. (1998). Evidence for transovarial 
transmission of tomato yellow leaf curl virus by its vector the Whitefly Bemisia tabaci. 
Virology, 240, 295-303 
 
GolaniI, J., Mehta, D. R., Purohit, V. L., Pandya, H. M., Kanzariya, M. V. (2007). Genetic 
variability, correlation and path coefficient studies in Tomato. Indian Journal of 
Agricultural Research, 41, 146-149 
 
Gongolee, G. A. K. (2014). Evaluation of some introduced fresh market Tomato (Solanum 
Lycopersicum L) for genetic variability and adaptability in Ghana using morphological 
and molecular Markers. Thesis Unpublished 
 
Gongolee, G. A. K., Osei, M. K., Akromah, R. Nyadanu D. and Aboagye, L. M. (2015). 
Evaluation of some Introduced Tomato Cultivars. Horizon Journal of Agriculture and 
Food Science, 1(1), 001-006 
 
Gonzalo, M. J., and van der Knaap, E. (2008). A comparative analysis into the genetic bases 
of morphology in tomato varieties exhibiting elongated fruit shape. Theoretical and 
Applied Genetics, 116, 647-656 
 
137 
 
University of Ghana http://ugspace.ug.edu.gh
Goodman, A. M. C. (2017). Ghana’s tomato processing industry: An attractive investment 
option in 2016.  
https://www.wathi.org/debat_id/developpement-de-lagriculture/wathinote-developpement-de-
lagriculture/ghanas-tomato-processing-industry-an-attractive-investment-option-in-
2016 
 
Gordon, J. S. (2009). Reseeding tomato production in West Africa-identification and 
deployment of high yielding cultivars resistant to tomato yellow leaf curl disease 
(Doctoral dissertation). Cornel University, Ithaca, New York 1-270  
 
Govindaraj, M., Vetriventhan, M., and Srinivasan, M. (2015). Importance of genetic diversity 
assessment in crop plants and its recent advances: An overview of its Analytical 
perspectives. Genetics Research International, 4 Doi.org/10.1155/2015/431487 
 
Grandillo, S., Ku, H. M., and Tanksley. S. D. (1996). Characterization of fs8.1, a major QTL 
influencing fruit shape in tomato. Molecular Breeding, 2, 251-260 
Hanson, P. M., Bernacchi, D., Green, S., Tanksley, S.D., Muniyappa, V., Padmaja, S., Chen, 
H.M., Kuo, G Fang, D., and Chen, J. T. (2000). Mapping a wild tomato introgression 
associated with tomato yellow leaf curl virus resistance in a cultivated tomato line. 
Journal of the American Society for Horticultural Science, 125, 15-20 
 
Hanson, P., Lu, S., Wang, J., Chen, W., Kenyon, L., Tan, C., Tee, K. L., Wang, Y., Hsu, Y.,  
Schafleitner, R., Ledesma, D., and Yang, R. (2016). Conventional and Molecular 
marker assisted selection and pyramiding of genes for multiple disease resistance in 
tomato. Scientia Horticulturae, 201, 346-354 
 
Harlan, J. R. (1971). "Agricultural Origins: Centers and Noncenters." Science, 174(4008), 468- 
474 
 
Harrison, B. D., Muniyappa, V., Swanson, M. M., Roberts I. M., and Robinson D. J. (1991).  
Recognition and differentiation of seven whitefly-transmitted geminiviruses from 
India, and their relationships to African cassava mosaic and Thailand mung bean yellow 
mosaic viruses. Annals of Applied Biology, 118, 299-308 
 
Hayes, H. K., Immer, I. R, and Smith, D. C. (1955). Methods of plant breeding, McGraw Hill 
Company, Inc., New York 
 
Henareh, M. Dursun, A. and. Mandoulakani, B. A. (2015). Genetic diversity in tomato 
landraces collected from Turkey and Iran revealed by morphological characters,” Acta 
Scientiarum Polonorum, Hortorum Cultus, 14(2), 87-96 
 
Henson, J. M. and French, R. (1993). The polymerase chain reaction and plant disease 
diagnosis. Annual Review of Phytopathology, 31, 81-109 
 
Horna, D., Smale, M. and Falck-Zepeda, J. (2006). Assessing the potential economic impact 
of genetically modified crops in Ghana: Tomato, Garden Egg, Cabbage and Cassava. 
PBS report. Available upon request (dhorna@cgiar.org). International Food Policy 
Research Institute.  
 
138 
 
University of Ghana http://ugspace.ug.edu.gh
Horna, D., Smale, M., Al-Hassan, R., Falck-Zepeda, J., and Timpo, S. E. (2008). Insecticide 
use on vegetables in Ghana. Would GM seed benefit farmers? IFPRI Discussion Paper, 
00785 
 
Huang, L., Milne, D., Frank, E., Written, I. H. (2012). Learning a concept‐based document 
similarity measure. Journal of American Society for Information Science and 
Technology, 63, 8 https://doi.org/10.1002/asi.22689 
 
Hutton, S. F., Scott, J. W., (2015). Ty-6, a major begomovirus resistance gene located on 
chromosome 10. Report of the Tomato Genetics Cooperation, 64, 14–18 
 
Illa‑Berenguer, E., Houten, J. V., Huang, Z., and van der Knaap, E. (2015). Rapid and reliable 
identification of tomato fruit weight and locule number loci by QTL‑seq. Theoretical 
and Applied Genetics, Doi: 10.1007/s00122-015-2509-x 
 
Imran, M., Shakeel, A., Azhar, F. M., Farooq, J., Saleem, M.  F., Saeed, A., Nazeer, W., Riaz, 
M., Naeem, M., and Javaid, A. (2012). Combining ability analysis for within-boll yield 
components in upland cotton (Gossypium hirsutum L.). Genetics and Molecular 
Research, 11(3), 2790-2800 
 
IPGRI. (1996). Descriptors for Tomato (Lycopersicon spp.). International Plant Genetic 
Resources Institute, Rome. 
 
Islam, F. M. A., Beebe, S., Munoz, M., Tohme, J., Redden, R. J., and Basford, K.E. (2004). 
Using molecular markers to assess the effect of introgression on quantitative attributes 
of common bean in the Andean gene pool. Theoretical and Applied Genetics, 108,243- 
252 
 
Jessieu, A. L. de. (1789). Genera Platarum Viduam Herssant et Theophilium Barrios, Paris, 
498   
 
Ji, Y., Salus, M., van Betteray, B., Smeets, J., Jensen, K.S., Martin, C. T., Mejia, L., Scott, J. 
W., Havey, M. J. and Maxwell, D. P. (2007b). Co-dominant SCAR markers for 
detection of the Ty-3 and Ty-3a loci from Solanum chilense at 25 cM of chromosome 
6 of tomato. Report of Tomato Genetics Cooperation, 57, 25-28 
 
Ji, Y., Schuster, D. J., and Scott, J. W. (2007a). Ty-3, a begomovirus resistance locus near the 
Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. 
Molecular Breeding, 20, 271-284 
 
Ji, Y., Scott, J. W., Hanson, P., Graham, E., and Maxwell, D. P., (2007c.) Sources of resistance, 
inheritance, and location of genetic loci conferring resistance to members of the tomato-
infecting begomoviruses. In: Czosnek, H. (Ed.), Tomato Yellow Leaf Curl Virus 
Disease: Management, Molecular Biology, Breeding for Resistance. Kluwer, 
Dordrecht, 343–362 
 
Ji, Y., Scott, J. W., and Schuster, D. J., (2009). Towards fine mapping of the Tomato yellow 
leaf curl virus resistance gene Ty-2 on chromosome 11 of tomato. American Society for 
Horticultural Science, 44, 614–618 
139 
 
University of Ghana http://ugspace.ug.edu.gh
Joye, K. W., Catignani, G. L., and Lazarus, S. (2003). Tomatoes and cardiovascular 
health, critical. Reviews in Food Science and Nutrition, 43:1, 1-18 
 
Kadams, A. M., Ugherughe, P. O., and Abakura, J. B. (1999). Genetic correlation and path 
coefficient analysis of yield and its components in wheat. Nigeria. Journal of Tropical 
Agriculture, 1, 107-114 
 
Kasrawi, M. A., (1989). Inheritance of resistance to tomato yellow leaf curl virus (TYLCV) in 
Lycopersicon pimpinellifolium. Plant Diseases, 73, 435-437 
 
Kheyr-Pour, A., Bendahmane, M., Matzeit, V., Accotto, G. P, Crespi, S., Gronenborn B. 
(1991). Tomato yellow leaf curl virus from Sardinia is a whitefly-transmitted 
monopartite geminivirus. Nucleic Acids Research, 19, 6763–6769 
 
Kil, E., Kim, S., Lee, Y., Bynn, H., Park, J., Seo, H., Kim, C. Shim, J., Lee, J., Kim, J., Lee, H. 
C., and Lee, S. (2016). Tomato yellow leaf curl virus (TYLCV-IL): a seed transmissible 
geminivirus in tomato. Scientific Report 8 (6), 19013, Doi: 1038/srep19013 
 
Kugblenu, Y. O, Oppong-Danso E., Ofori, K., Andersen, M. N., Abenney-Mickson, S., and 
Sabi, E. B. (2013). Screening tomato genotypes for adaptation to high temperature in 
West Africa. Acta Agriculturae Scandinavica, Section B - Soil and Plant Science.  
63(6), 516–22. DOI: 10.1080/09064710.2013.813062 
 
Kunik T., Salomon, R., Navot, N., Zeidan, M., Michelson, I., Zamir, D., Gafni, Y., and Czosnek 
H. (1994). Transgenic tomato plants expressing the tomato yellow leaf curl virus capsid 
protein are resistant to the virus. BioTechnology, 12: 500–504 
 
Lana, A. F., and Wilson, G. F. (1976). New virus like disease of tomato in Nigeria. Plant 
Disease Reporter 60; 296-298 
 
Lapidot, M. (2003). Host resistance to whitefly-transmitted geminiviruses. 3rd International 
Bemisia Workshop, Barcelona, 95 
 
Lapidot, M. and Friedmann, M. (2002) Breeding for resistance to whitefly-transmitted 
geminiviruses. Annals of Applied Biology, 140, 109–127 
 
Lapidot, M., Goldray, O., Ben, J. R., Cohen, S., Friedmann, M., Shlomo, A., Nahon, S., Chen, 
L., and Pilowsky, M. (2000). Breeding tomatoes for resistance to tomato yellow leaf 
curl begomovirus. Bulletin. OEPP/EPPO 30, 317–321 
 
Larry, R., Joanne, L., Razdan M. K., and Mattoo A. K. (2007) Genetic resources of tomato 
Miller Genetic improvement of solanaceous crops.  Enfield, NH Science Publishers, 
Volume 2 CRC Book Press 
 
Lefebvre, V., and Chevre, A. M., (1995). Tools for marking plant disease and pest resistance 
genes: a review. - Agronomie, EDP Sciences 15 (1), 3-19 
 
Levy, D., and Lapidot, M. (2008). Effect of plant age at inoculation on expression of genetic 
resistance to tomato yellow leaf curl virus. Archives of Virology, 7(1) 153-171. 
DOI: 10.3390/insects7040057 
140 
 
University of Ghana http://ugspace.ug.edu.gh
 
Liu, X., You, J., Guo, L., Liu, X., He, Y., Yuan, J., and Liu, G. (2011). Genetic Analysis of 
Segregation Distortion of SSR Markers in F2 Population of Barley. Journal of 
Agricultural Science, 3(2). Doi:10.5539/jas. v3n2p172 
 
Lodhi, M. A., Ye, G., Norman F., Weeden, N. F., and Reisch, B. I.  (19940). A Simple and 
efficient method for DNA Extraction from Grapevine cultivars and vitis Species. Plant 
Molecular Biology Reporter, 12 (1) 6-13  
 
Luckwill, L. C. (1943). The genus Lycopersicon: an historical, biological, and taxonomical 
survey of the wild and cultivated tomatoes. Aberdeen University Studies; (120):1–44 
 
Makkouk, K. M., and Laterrot, H. (1983). Epidemiology and control of tomato yellow leaf curl 
virus, In: R. T. Plumb and J. M. Thresh, (eds.) Plant Virus Epidemiology, 315–321. 
Blackwell, Oxford  
 
Mandoulakani, B. A., Yaniv, E., Kalendar, R., Raats, D., Bariana, H.S., Bihamta, M. R., and 
Schulman A. H. (2015). Development of IRAP-and REMAP-derived SCAR markers 
for marker-assisted selection of the stripe rust resistance gene Yr15 derived from wild 
emmer wheat. Theoretical and Applied Genetics. 128: 211–219 
 
Manna, M. And Paul, A., (2012). Studies on genetic variability and characters association of 
fruit quality parameters in tomato. Horticultural Flora Research. Spectrum, 1(2): 110-
116 
 
Mateescum, R. G.,  Zhang, Z., Tsai, K., Phavaphutanon, J., Burton-Wurster, N. I.,  Lust,  G.,  
Quaas, R.,   Murphy,  K., Acland,  G. M., Todhunter, R. J.,  and Hered, R. J. (2005). 
Analysis of allele fidelity, polymorphic information content, and density of 
microsatellites in a genome-wide screening for hip dysplasia in a crossbreed pedigree. 
96 (7): 847-853.  doi: https://doi.org/10.1093/jhered/esi109 
 
 Mc Ewen, J. (1961). Review of work on tomatoes. Ghana Farmer. Volume IV. Number 3 
 
Mensah-Wonkyi, D. (2014). Studies of tomato yellow leaf curl viral disease in some districts 
in the Central Region of Ghana. University of Cape Coast. Dissertation (Unpublished), 
85-89 
 
Michelson, I., Zamir, D., and Czosnek, H.  (1994). Accumulation and translocation of Tomato 
yellow leaf curl virus (TYLCV) in a Lycopersicon esculentum breeding line containing 
the L. chilense TYLCV tolerance gene Ty-1. Phytopathology, 34, 928–933 
 
Miller, J. C., and Tanksley S. D. (1990). RFLP analysis of phylogenetic relationships and 
genetic variation in the genus Lycopersicon. Theoretical and Applied Genetics, 80(4): 
437-448 
 
Miller, P. (1754). The gardeners’ dictionary, Abridged 4th edition. John and James Rivington, 
London 
 
Mohammadi, S.  A., Prasanna, B. M. (2003). Analysis of genetic diversity in crop plants - 
salient statistical tools and considerations. Crop Science, 43 (4), 1235-1248 
141 
 
University of Ghana http://ugspace.ug.edu.gh
 
Monci, F., Sanchez-Campos, S., Navas-Castillo, J., and Moriones, E. (2002). A natural 
recombinant between the geminiviruses Tomato yellow leaf curl Sardinia virus and 
Tomato yellow leaf curl virus exhibits a novel pathogenic phenotype and is becoming 
prevalent in Spanish populations. Virology 303; 317-326 
 
Moriones, E., and Navas-Castillo, J. (2000). Tomato yellow leaf curl virus, an emerging virus 
complex causing epidemics worldwide. Virus Research, 71, 123-134 
 
Mound, L. A, and Halsey, S. H. (1978). Whitefly of the World: A Systematic Catalogue of the 
Aleyrodidae (Homoptera) with Host Plant and Natural Enemy Data. British Museum, 
340 
 
Mound, L. A., and Halsey, S. H. (1978). Whitefly of the world. A systematic catalogue of 
Aleyrodidae (Homoptera) with host plant and natural enemy data: New York: 340 
 
MunoLinnaeus, C. (1753). Species Platarum, 1st edition. Holmaie, Stockholm, 2 volumes, 1200  
 
Nakhla, M. K. Mazyad H. M. and Maxwell D. P. (1993). Molecular characterization of four 
tomato yellow leaf curl virus isolates from Egypt and development of diagnostic 
methods Phytopathology. Mědit, 32, 163-173 
 
Navot, N., Zeidan, M., Pichersky, E., Zamir, D., and Czosnek, H. (1992). Use of the 
polymerase reaction to amplify tomato yellow leaf curl virus DNA from infected plants 
and viruliferous whiteflies. Phytopathology 82: 1199–1202 
 
Navot, N., Ber, R., and Czosnek, H. (1989). Rapid detection of tomato yellow leaf curl virus 
in squashes of plants and insect vectors. Phytopathology 79; 562-568 
 
Nei M. (1973). Analysis of gene diversity in subdivided populations. Proceedings of the 
National Academy of Sciences of the United States of America, 70(12), 3321–3323. 
doi:10.1073/pnas.70.12.3321 
 
Nesbitt, T. C., and Tanksley, S. D. (2002). Comparative sequencing in the genus Lycopersicon:   
implications for the evolution of fruit size in the domestication of cultivated tomatoes. 
Genetics, 162(1): 365-379 
 
Norman, J. C. (1992). Tropical Vegetable Crops. Pub.Arthur Stock Well Ltd. p15-53 
 
Orchard, J. E., and Suglo, E. K. (1999). Integrated food crops systems projects: enhancing 
smallholder livelihood through reducing costs and adding value to agricultural 
production. Final Technical Report. City 
 
Osei, M. K, Bonsu, K. O. Adu-Gyamfi, K, and Frimpong, M. (2015). Development of high 
yielding and uniform Tomato fruits using pure line selection. Direct Research Journal 
of Agriculture and Food Science 3(1) 10-16 
 
 
 
142 
 
University of Ghana http://ugspace.ug.edu.gh
Osei, M. K., Akromah R., Lamptey R. J. N. L., and Quain, M.D. (2012). Phenotypic and 
molecular screening of   some tomato germplasm for resistance to tomato yellow leaf 
curl virus disease in Ghana. African Journal of Agricultural Research.  Volume 7(33), 
4675-4684, DOI: 10.5897/AJAR12.672 
 
Osei, M. K., Akromah, R., Shih, S. L., Lee, L. M., and Green, S. K. (2008). First report and 
molecular characterization of DNA of three distinct begomoviruses associated with 
tomato leaf curl disease in Ghana. Plant Disease 92; 1585-1585 
 
Osei, M. K., Akromah, R., Shih, S. L., and Green, S. K. (2010). Evaluation of some tomato 
germplasm to Tomato yellow leaf Curl Virus (tylcv) disease in Ghana. Aspects of 
Applied Biology, 96, 315-323 
 
Osei, M., K.., Offei Bonsu, K., Asare, C., Agyeman, A., Gyau, J., Choi, H.S. (2013). Germplasm 
collections: a prerequisite for tomato breeding programme in Ghana. Advanced Crop 
Science, 3(9): 568 – 578 
 
Ossom M. (2012). Etiology and management of leaf curl disease in Volta region in Ghana 
(Unpublished master’s thesis).  University of Ghana. Legon, 21-49  
 
Paran, I., and van der Knaap, E. (2007). Genetic and molecular regulation of fruit and plant 
domestication traits in tomato and pepper. Journal of Experimental Botany 58:3841–
3852 
 
Patil, B. M. P. (2015). Molecular diversity analysis in elite tomato genotypes selected for fruit 
quality traits (Unpublished master’s thesis). University of Agricultural Sciences, 
Dharwad 580 005, 1-77  
 
Peralta, I. E., Spooner, D. M. (2007). History, origin and early cultivation of tomato 
(Solanaceae). In:  Razdan, M. K.; Mattoo, A. K. (EDS.). Genetic improvement of 
solanaceous crops. Vol. 2. Enfield, Nueva Hampshire: Science Publishers, Volume 2, 
1-27 
 
Peralta, I., and Spooner, D. M. (2001). GBSSI gene phylogeny of wild tomato (Solanum L- 
section Lycopersicon [Mill] Westst. Subsection Lycopersicon). American Journal of 
Botany 88:1888-1902 
 
Picó, B., Diez, M. J., and Nuez, F. (1996). Viral diseases causing the greatest economic losses 
to the tomato crop. II. The tomato yellow leaf curl virus—A review. Scientia 
Horticulturae, 67; 151-196 
 
Picó, B., Ferriol, M., Díez, M., and Nuez, F. (1999). Developing tomato breeding lines resistant 
to Tomato yellow leaf curl virus. Plant Breeding, 118: 537-542 
 
Pilowsky, M., and Cohen, S. (1990). Tolerance to tomato yellow leaf curl virus derived from 
Lycopersicum peruvianum. Plant Disease, 74: 248–250 
 
Poehlman, J. M. (1979). Breeding field crops. Avi Publishing Company, Inc. Westport, 
Connecticut, 277-320 
 
143 
 
University of Ghana http://ugspace.ug.edu.gh
Polston, J., and Lapidot, M. (2007). Management of Tomato yellow leaf curl virus: US and 
Israel Perspectives, In: H. Czosnek, (ed.) Tomato Yellow Leaf Curl Virus Disease: 
management, molecular biology, breeding for resistance, 251-262. Springer, Dordrecht 
 
Polston, J. E., and Anderson, P. K. (1997). The emergence of whitefly-transmitted 
geminiviruses in tomato in the western hemisphere. Plant Disease 81, 1358-1369 
 
Poole, P., and College, W. (1999). Overcoming informational constraints: improving 
horticultural marketing and technical information flows to smallholders. First technical 
report, 2-6 
 
Potter, J.  L., Nakhla, M. K., Mejía, L., and Maxwell, D. P. (2003). PCR and DNA hybridization 
methods for specific detection of bean-infecting begomoviruses in the Americas and 
Caribbean. Plant Diseases, 87(10):1205-12 
 
Prasanna, H. C., Sinha D. P., Raia, G. K., Krishnaa, R., S. P., Kashyapa, N. K., Singha, M., 
and Malathi, V. G. (2015).  Pyramiding Ty-2 and Ty-3 genes for resistance to 
monopartite and bipartite tomato leaf curl viruses of India. Plant Pathology 64, 256–
264 Doi: 10.1111/ppa.12267 
 
Puozaa, F. Z. (2015). Allocative efficiency of irrigated tomato production in the Upper East 
Region, Ghana. University of Ghana. Dissertation (Unpublished), 87-93 
 
Reddy, B. R., Reddy, M. P., Begum, H. and Sunil, N., (2013). Cause and effect relationship 
for yield and shelf life attributes in exotic lines of tomato (Solanum lycopersicum L.). 
IOSR Journal of Agriculture and Veterinary Science, 3(4): 54-56 
 
Research D.F.I.D. (2012). Improved tomato varieties to plant diseases. The World Vegetable 
Center have developed tropical tomatoes with resistance to several whitefly-transmitted 
begomoviruses through “gene pyramiding”. https://www.gov.uk/government/case-
studies/dfid-research-the-great-pyramid-ty-tomatoes-resist-pests-and-diseases 
 
Rick, C. M., and Holle M. (1990). Andean Lycopersicon esculentum var. cerasiforme: genetic 
variation and its evolutionary significance. Economic Botany 44: 69-78 
 
Rick, C. M., and Chetelat, R. T. (1995). Utilization of related wild species for tomato 
improvement. Acta Hort. 412:21-38. SAS Institute Inc (2011) The SAS System, version 
9.3 for windows. 9th ed. SAS Institute, Cary, NC 
 
Rick, C. M., Laterrot, H., and Philouze, J. (1990). A revised key for the lycopersicon species, 
Tomato Genetics Cooperative Rep 40:31 
 
Rick, C. M. (1976). Tomato (family Solanaceae), in: N. W. Simmonds (Ed.), Evolution of crop 
plants, Longman Publications, 268-273 
 
Robertson, N. L., French, R., and Gray, S. M. (1991). Use of group specific primers and the 
polymerase chain reaction for the detection and identification of luteoviruses. Journal 
of General Virology, 72: 1473–1477 
 
144 
 
University of Ghana http://ugspace.ug.edu.gh
Robinson, E. J., and Kolavalli, S. L. (2010). The case of tomato in Ghana: Institutional support. 
International Food Policy Research Institute (IFPRI), 1-7 
 
Rochester, D. E., de Paulo, J.J., Fauquet, C. M., and Beachy, R. N. (1994). Complete 
NucleotideSequence of the Geminivirus Tomato Yellow Leaf Curl Virus, Thailand 
isolate. The Journal of General Virology, 75, 477-485 
 
Rodriguez, G. R., Munos, S., Anderson, C., Sim, S.C., Michel, A., Causse, Gardener, B.B.M., 
Francis, D., and van der Knaap, E. (2011). Distribution of SUN, OVATE, LC, and FAS 
in the tomato germplasm and the relationship to fruit shape diversity. Plant Physiology, 
156: 275-285 
 
Rojas M. R, Gilbertson R. L, Russell D. R., and Maxwell D. P. (1993). Use of degenerate 
primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. 
Plant Disease. 77:340 347 
 
Rom, M., Antignus, Y., Gidni, D. Pilowsky, M. and Cohen. S. (1993). Accumulation of tomato 
yellow leaf curl virus DNA in tolerant and susceptible tomato lines. Plant Disease. 77: 
253-257 
 
Rotbi, M., De Castro, A. P, Díez, M. J., and Elmtili, E. (2015). Identification and distribution 
of Tomato yellow leaf curl virus TYLCV and tomato yellow leaf curl sardinia virus 
TYLCSV infecting vegetable crops in Morocco. African Journal of Biotechnology, 1 
(13) 1476-1483 
 
Sahagún, B. D. (1988). Historia General de las Cosas de Nueva España. Madrid 
 
Salati, R., Nahkla, M. K., Rojas, M.R., Guzman, P., Jaquez, J., Maxwell, D.  P., and Gilbertson, 
R. L. (2002). Tomato yellow leaf curl virus in the Dominican Republic: 
Characterization of an infectious clone, virus monitoring in whiteflies, and 
identification of reservoir hosts. Phytopathology 92, 487-496 
 
Saleem, M.Y., Asghar M., and Iqbal, Q. (2015). Analysis of genetic proximity in tomato 
(Solanum lycopersicum L.) genotypes. Journal of. Environmental and Agricultural 
Sciences, 3, 8-13  
 
Schippers, R. R. (2000). African indigenous vegetables. An overview of the cultivated species.  
Natural Resources Institute, London.UK, 222. ISBN 0 85954 51 
 
Scott, J. W., Hutton, S. F. and Freeman, J. H. (2015). Fla. 8638B and Fla. 8624 tomato breeding 
lines with Begomovirus resistance genes with Ty-5 plus Ty-6 respectively. Institute of 
Food and Agricultural Sciences (IFAS), University of Florida 
 
Seal, S. E., vanden Bosch, F., and Jeger, M. J. (2006). Factors influencing begomovirus 
evolution and their increasing global significance: Implications for sustainable control. 
Critical Reviews in Plant Sciences 25; 23-46 
 
Segbefia, M. M., Amoatey, H. M., Ahiakpa J. K., Quartey, E. K., Appiah, A. S., Nunoo, J. and 
Kusi-Adjei R. (2018). Field evaluation of tomato varieties/breeding lines against tomato 
145 
 
University of Ghana http://ugspace.ug.edu.gh
yellow leaf curl virus disease (TYLCV). Tropical Agricultural Science, 41 (1): 423 - 
440  
 
Segbefia, M. M., Amoatey, H. M., Quartey, E. K., Ahiakpa J. K., Appiah, A. S., Nunoo, J. and 
Kusi-Adjei R. (2015). Detection of TYLCV in Ten Genotypes of Tomato (Solanum spp 
L.) using Serological and Molecular Techniques in a Coastal Savanna Zone of Ghana. 
Journal of Natural Sciences Research, 5(2), 17-25 
 
Shankar, A., Reddy, R. V. S. K., Sujatha, M., and Pratap, M. (2013). Combining ability analysis 
to identify superior F1 hybrids for yield and quality improvement in tomato (Solanum 
lycopersicum L.). Agrotechnology, 2: 114. doi:10.4172/2168-9881.1000114 
 
Shende, V. D., Seth, T., Mukherjee, S., and Chattopadhyay, A. (2012). Breeding tomato 
(Solanum lycopersicum l.) for higher productivity and better processing qualities. 
Journal of Breeding and Genetics, 44 (2) 302-321 
 
Shih, J., Kakuda, Y., and Yeung, D. (2004). Antioxidative properties of lycopene and other 
carotenoids from tomatoes: Synergistic effects. BioFactors 21: 203–210 
 
Shih, S. L., Green, S.K., Tsai, W.S., Lee, L.M., Wang, J.T., and Tesfaye, A. (2006): First report 
of a begomovirus associated with tomato yellow leaf curl disease in Ethiopia. Plant 
Diseases 90; 974-974 
 
Sim, S. C., Robbins, M. D., Van Deynze, A., Michel A. P., and Francis, D. M. (2011). 
Population structure and genetic differentiation associated with breeding history and 
selection in tomato (Solanum lycopersicum L.). Heredity 106, 927–935 
 
Sim, S. C., Deynze, A. V., Stoffel, K. Douches, D. S., Zarka, D., Ganal, M. W., Chetelat, R. 
T., Hutton, S. F., Scott, J. W., Gardner, R. G., Panthee, Dilip R. D., Mutschler, M. 
Myers, J. R., and Francis, D. M. (2012). High-Density SNP genotyping of tomato 
(Solanum lycopersicum L.) reveals patterns of genetic variation due to breeding. PLOS 
ONE 7(9): e45520. https://doi.org/10.1371/journal.pone.0045520 
 
Sim, S. C., Merk, H. L., and McQueen, J. (2013). Downstream analysis of SNPs from SolCAP 
tomato Infinium Array. Breeding and Genomics 
 
Sim, S. C., Robbins, M. D., Van Deynze, A., Michel, A. P., and Francis, D. M. (2011). 
Population structure and genetic differentiation associated with breeding history and 
selection in tomato (Solanum lycopersicum L.). Heredity, 106(6):927–935 
 
Sim, S., Robbins, M. D., Chilcott, C., Zhu, T., and Francis, D. M. (2009). Oligonucleotide array 
discovery of polymorphisms in cultivated tomato (Solanum lycopersicum L.) reveals 
patterns of SNP variation associated with breeding. BMC Genomics, Doi: 
10.1186/1471-2164, 10-466 
 
Smith, J.S.C. (1988). Diversity of United-States hybrid maize germplasm - Isozymic and 
chromatographic evidence. Crop Science. 28:63-69 
 
 
 
146 
 
University of Ghana http://ugspace.ug.edu.gh
 
Soyk, S., Lemmon, Z. H., Oved, M., Fisher, J., Liberatore, L. K., Park, S. J., Goren A., Ramos, 
A., van der Knaaap, E., Van Eck J., Zamir D., Eshed, Y., and Lippman, Z. B. (2017). 
Bypassing Negative Epistasis on Yield in Tomato Imposed by a Domestication Gene. 
Cell 169(6,) 1142–1155.e12. doi: 10.1016/j.cell.2017.04.032 
 
Sperling, L., Ashby, J. A., Tew, M. E., Weltzein, E., and McGuire, S. (2001). A framework for 
analyzing participatory plant breeding approaches and results. Euphytica, 122: 439-450 
 
Spooner, D. M., Anderson, G. J., and Jansen, R. K. (1993). Chloroplast DNA evidence for 
interrelationships of tomatoes, potatoes and pepinos (Solanaceae). American Journal of 
Botany 80: 678-66 
 
Tam, S. M., Mhiri, C., Vogelaar, A., Kerkveld, M., Pearce, S. R., and Grandbastien, M. A., 
(2005). Comparative analyses of genetic diversities within tomato and pepper 
collections detected by retrotransposon-based SSAP, AFLP and SSR. Theoretical and 
Applied Genetics. 110, 819–831 
 
Tambo, J. A., and Gbemu, T. (2010). Resource-use efficiency in tomato production in the 
Dangme West District, Ghana. In Conference on International Research on Food 
Security, Natural Resource Management and Rural Development. Tropentag, ETH 
Zurich, Switzerland 
 
Tembe, K. O., Chemining’wa, G., Ambuko, J., and Owino, W. (2018). Evaluation of African 
tomato landraces (Solanum lycopersicum) based on morphological and horticultural 
traits. Agriculture and Natural Resources 
 
Tew, M., (1920) Cooking in West Africa made easier. Printed by C. Tinling and Co., Liverpool, 
United Kingdom 
 
Thompson, J. A., and Nelson, R. L. (1998). Core set of primers to evaluate genetic diversity in 
soybean. Crop Science. 38:1356- 1362 
 
Tournefort, J. P. de. (1694). Elemens de Botanique. I’Imprimerie royale, Paris, 3  
 
Tran, D. V. (2005). Overview on tomato production and tomato varieties in Vietnam Centre 
for Agricultural Research and Ecological Studies (CARES), Hanoi Agricultural 
University, Hanoi. 1-10  
 
Ucko, O., Cohen, S., and Ben-Joseph, R. (1998). Prevention of virus epidemics by a crop-free 
period in the Arava region of Israel. Phytoparasitica 26; 313-321 
 
Umar, F. A. M., Mohammed, S., Oyekunle, M., Usman, I. S., Ishaq, M. N., and Dachi S. N. 
(2017). Estimates of combining ability for resistance to pod shattering in soybean 
(Glycine max (L.)  Merrill) genotypes. Journal of Plant Breeding and Crop Science, 
Volume 9(12), 217-223, DOI:10.5897/JPBCS2017.0684 
 
UPOV (2011). International Union for the Protection of New Varieties of Plants. Geneva, 
Switzerland, 1-72 
 
147 
 
University of Ghana http://ugspace.ug.edu.gh
Urbino, C., Thébaud, G., Granier, M., Blanc, S., and Peterschmitt, M. A. (2008). Novel cloning 
strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses. 
Virology Journal, 5:135 
 
van der Knaap, E., and Tanksley, S. D. (2003). The making of a bell pepper shaped tomato 
fruit: identification of loci controlling fruit morphology in Yellow Stuffer tomato. 
Theoretical and Applied Genetics, 107: 139-147 
 
Varshney, R. K., Terauchi, R., and McCouch, S. R. (2014). Harvesting the promising fruits of 
genomics: applying genome sequencing technologies to crop breeding. PLOS Biology, 
Volume 12.  
doi: 10.1371/journal.pbio. 1001883.g001 
 
Verlaan, M. G., Hutton, S. F., Ibrahem, R. M., Kormelink, R., Visser, R. G. F., Scott, J. W., 
Edwards, J. D. and Bai, Y., (2013). The tomato yellow leaf curl virus resistance 
genesTy-1 and Ty-3 are allelic and code for DFDGD-Class RNA-dependent 
RNApolymerases. PLoS Genetics. 9, 1–11 
 
Vidavsky, F., and Czosnek, H. (1998). Tomato breeding lines resistant and tolerant to tomato 
yellow leaf curl virus issued from Lycopersicon hirsutum. Phytopathology 88; 910-914 
 
Visa, S., Cao, C., Gardener, B. M., and van der Knaap. E. (2014). Modelling of tomato fruits 
into nine shape categories using elliptic fourier shape modeling and Bayesian 
classification of contour morphometric data. Euphytica, 200: 429-439 
 
Wyatt, S. D., and Brown, J. K (1996). Detection of subgroup III Gemini-virus isolates in leaf 
extracts by degenerate primers and polymerase chain reaction. Phytopathology 
86:1288-1293 
 
Yang, X., Caro, M., Hutton, S. F., Scott, J. W., Guo, Y., Wan, X., Rashi, M. H., Szina, D., 
deJong, H., Visser, R.G.F., Bai, Y., and Du, Y. (2014). Fine mapping of the tomato 
yellowleaf curl virus resistance gene Ty-2 on chromosome 11 of tomato. Molecular 
Breeding.34, 749–760 
 
Yongping, Z., Weimin, Z., Huimei, C., Yang, Q., Kun, S., Yanhui, W., Longying, Z., Li, Y., 
and Zhang, H. (2008). Molecular identification and the complete nucleotide sequence 
of TYLCV isolate from Shanghai of China. Virus Genes, 36: 547–551 
 
Zamir, D., Ekstein-Michelson, I., Zakay, Y., Navot, N., Zeidan, M. Sarfatti, M., Eshed, Y., 
Harel, E., Pleban, T., Vanoss, H. Kedar, N., Rabinowitch, H.D., and Czosnek, H. 
(1994). Mapping and introgression of a tomato yellow leaf curl virus tolerance gene, 
Ty-1. Theoretical and Applied Genetics 88, 141-146 
 
Zengin, S., Kabaş, A., Oğuz, A., and Ersin Polat, A.  (2015). Determining of general combining 
ability for yield, quality and some other traits of tomato (Solanum lycopersicum L.) 
inbred lines. Research Article, 28 (1):1-4  
 
Zhao, W. G., Chung, J. W., Cho, Y. I., Rha, W. H., Lee, G. A., Ma, K. H., and Park, Y. J. 
(2010). Molecular genetic diversity and population structure in Lycium accessions 
using SSR markers. Comptes Rendus Biologies, 333(11-12), 793-800 
148 
 
University of Ghana http://ugspace.ug.edu.gh
 
Zhou, Y. C., Noussourou, M., Kon, T., Rojas, M. R, Jiang, H., Chen L. F, Gamby, K., Foster, 
R., and Gilbertson R. L. (2008). Evidence of local evolution of tomato-infecting 
begomovirus species in West Africa: characterization of tomato leaf curl Mali virus and 
tomato yellow leaf crumple virus from Mali. Archives of Virology, 153(4):693-70 
 
Ziaf, K., Amjad, M., Shakeel, A., Azhar, M., and Saeed, A. (2016). Assessment of genetic 
diversity in tomato for fruit morphology, composition and Yield. Pakistan Journal of 
Botany 48(6): 2477-2483 
 
Zilberstein, A., Navot, N., Ovadia S., Reinhartz A., Herzberg M., and Czosnek, H. (1989). 
Field-usable assay for the diagnosis of the tomato yellow leaf curl virus in squashes of 
plants and insects by hybridization with a chromogenic DNA probe. Technique 1: 118-
124 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
149 
 
University of Ghana http://ugspace.ug.edu.gh
APPENDIX 
 
Questionnaire on Development of Tomato Yellow Leaf Curl Virus (TYLCV) Resistant 
Tomato (Solanum lycopersicum L.) varieties 
Documentation of Farmers’ perception on the importance and control of TYLCV disease in 
Upper East, Brong Ahafo and Greater Accra Regions of Ghana. Please tick [✔] where 
applicable. 
A. BACKGROUND INFORMATION 
1. Name of Region/Community ………………………………………………….. 
2. Sex              1. Male [   ]     2. Female [   ] 
3. Age of farmer             1. Below 18 years [  ]     2. 18 – 30 years [   ]   3. 31 – 40 [  ]   4. 
41 – 50 years [   ] 5.  Above 50 years 
4. What is your level of education? 1. None [  ]   2. Primary [   ]   3. JHS/JSS [   ] 4. 
Secondary [   ]    5. Technical/Vocational [   ]   6. Tertiary [   ] 7. Others 
(Specify)……………………………………………………………………….   
5. Do you grow tomato?   1. Yes [   ]    2.  No [   ] 
6. If yes, how long have you been growing tomato? 1. Less than a year [  ]    2. 1-5 years [  ]   
3. 6 – 10 years [  ]  
7. What is the size of your land for tomato cultivation? ………………………………… 
8. Where do you obtain your tomato seeds?  1. Agro-seed shops [   ]      2. Saved seeds [   ]   
3. Market [   ]    4. MOFA [   ]     5. Research Institutions [   ]     6. NGO [  ]   7. Others 
(specify)………………………………………………… 
9. How often do you buy new seeds?    1. Every season [  ]     2. Yearly [  ]        3. Every two 
(2) years [  ]   4. Others (Specify)…………………………… 
150 
 
University of Ghana http://ugspace.ug.edu.gh
10. Which month(s) of the year do you grow tomato?…………………………….. 
.................................................................................................................................................. 
11. What tomato variety/varieties do you cultivate and what is/are their yield (s)? 
 Variety Yield (t/ha) 
 
  
B.  
  
 
  
 
  
 
  
 
Farmers’ knowledge, perception and experiences concerning TYLCV prevalence 
12. What are some of the tomato production challenges you encounter in your farm?       
Challenges encountered in tomato production Tick ( ) 
1 Inadequate Finance   
2 Low quality seeds  
3 High cost of fertilizers and insecticides  
4  Pests and Diseases   
5 Lack of Technical Support from Agricultural Extension  
Agents (AEAs) 
6 Drought  
7  Others (Specify)   
 
 
 
151 
 
University of Ghana http://ugspace.ug.edu.gh
13. What are the major tomato pests you encounter on your farm, their importance and 
control measures? 
Pests Level of importance Control Measures 
1 2 3 4 5 6 7 
         
         
         
         
         
         
         
1-Most important; 2-Very important; 3-important; 4-Less important; 5-Least 
important; 6-Not important 
 
14. What are the major tomato diseases you encounter on your farm, their importance and 
control measures?  
Diseases Level of importance Control Measures 
1 2 3 4 5 6 7 
         
         
         
         
         
152 
 
University of Ghana http://ugspace.ug.edu.gh
         
         
 
1-Most important; 2-Very important; 3-important; 4-Less important; 5-Least 
important; 6-Not important 
15. Are you aware of the existence of TYLCD? 1. Yes [   ]     2. No   [   ] 
16. If yes, how did you get to know about it?  Through: 1. Personal observation in my 
farm [   ]    2. Report by other farmers [   ]    3.Report by AEAs [   ]         4. Scientific 
publication [   ]   5.Others 
(Specify)………………………………………………………….. 
………………………………………………………………………………………………... 
17. Do you know the cause of TYLCD? 1. Yes [   ]    2.  No [   ] 
18. If yes, what cause(s) TYLCV disease? 1. Aphid [    ]   2. Red mite [     ]       3. Mealy bug 
[   ]    4. Whitefly [    ]   5. Caterpillar [    ] 6. Grasshopper [   ] 
7. Others (Specify)…………………………………………………………….................... 
19. What other crop(s) does the pest that causes TYLCD attack? 1. Pepper [    ]   2. Eggplant 
[     ]       3. Cassava [   ]    4. Yam [    ]   5. Plantain [    ]    6. Others 
(Specify)…………………………………………………………………………………... 
20. What are the symptoms of TYLCV on leaves, stems and fruits of tomato? 
Leaves...........................................................................Stems...............................................
fruits........................................................................................... 
21. At what stage of the plant growth do the plants suffer from the disease?  1. At the nursery 
[   ]   2. 1-2 weeks after transplanting [   ] 3. 3 – 4 weeks after transplanting [   ]   4. 5-6 
weeks after transplanting [   ] 5. 7 weeks and above [   ] 
 
153 
 
University of Ghana http://ugspace.ug.edu.gh
22. Which of the tomato varieties you cultivate does the disease commonly affect? 
..................................................................................................................................................... 
23.  Which month(s) of the year do you observe TYLCV disease in your farm? 
...............................………………………............................................................................ 
24. How often does the disease affect your farm? 1. Every season [   ]    2. Yearly [  ]    3. 
Every two (2) years [  ]   4.  Others(Specify)………………………………………..……. 
25. What percentage loss does TYLCV disease have on your yield? 1. 25% yield loss [   ]    
2. Between 25% and 50% yield loss [   ]   3. Between 50% and 75% yield loss [   ] 4. 
Between 75% and 100% yield loss [   ]    5. 100% yield loss [   ] 
26. How do you control TYLCV disease? 1. Early planting [   ] 2. Distant old field from new 
field [   ] 3.Use of mesh screens [   ] 4. Use of resistant cultivars [   ] 5. Practicing crop 
rotation [   ] 6. Proper farm sanitation [   ] 7.regular weeding [   ] 8. Chemical spraying [   
] 8. Others (Specify)….....................................…………………………………………. 
27. Can the disease be reduced by the use of resistant varieties? 1. Yes [   ]   2. No [   ] 3. No 
idea [   ]  
28.  Rank in order of importance the following factors that should be considered in 
developing a tomato variety for your locality. 
Traits Level of importance Control Measures 
1 2 3 4 5 6 7 
High yielding         
Longer shelf life         
Big fruit size         
Drought resistant         
154 
 
University of Ghana http://ugspace.ug.edu.gh
Heat Resistant         
TYLCV resistant         
varieties 
Others (Specify)         
1-Most important; 2-Very important; 3-important; 4-Less important; 5-Least 
important; 6-Not important 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
155 
 
University of Ghana http://ugspace.ug.edu.gh
Table S1: Codes, names and sources of 123 tomato  accessio ns evaluated  
Code Accessions Local Name Source Code Accessions Source 
  
G1 GH9116  Tomatose Eastern Region G42 14TAT101383 Syngenta 
  
G2 GH9246  Petomec Eastern Region G43 14TAT101385 Syngenta 
  
G3 GH9251  RASTER Eastern Region G44 14TAT101394 Syngenta 
  
G4 GH9305 Ntose Eastern Region G45 14TAT101353 Syngenta 
  
G5 GH9233  Pimplifolium Eastern Region G46 14TAT101371 Syngenta 
  
G6 GH9111 REX Eastern Region G47 Tomato TO 687 Syngenta 
  F1 Hybrid 
G7 GH 9239  Burkina Greater Accra G48 Tapiche Syngenta 
  
G8 GH 9137  Tomatose Greater Accra G49 14TAT101382 Syngenta 
  
G9 GH 9114 Lorry Tyre Greater Accra G50 14TAT101342 Syngenta 
  
G10 GH 9281  Tomatose Volta Region G51 LA0643 UC DAVIS 
  
G11 GH9152  One Man Volta Region G52 08TEP070545 Syngenta 
thousand   
G12 GH 9163  Asante tomato Western Region G53 08TEP070546 Syngenta 
  
G13 GH9208  Asante tomato Western Region G54 08TEP070547 Syngenta 
  
G14 GH9243  Adwoba Western Region G55 08TEP070729 Syngenta 
  
G15 GH9121  Local 1 Western Region G56 08TEP080187 Syngenta 
  
G16 GH9224  Local 2 Western Region G57 15TEP070136 Syngenta 
  
G17 GH9098  Fadebegye Central Region G58 10TEP080188 Syngenta 
  
G18 GH9190  Ataamba Central Region G59 08TEP070549 Syngenta 
  
G19 GH9184  Pimplifolium Central Region G60 08TEP070550 Syngenta 
  
G20 GH9073  1R Northern Region G61 08TEP070728 Syngenta 
  
G21 GH9185  Local1 Upper East G62 Tom DIABOU Wienco 
  
G22 GH9238  Local 4 Upper East G63 Tom TAMP Wienco 
  
G23 GH9109  Local 3 Upper East G64 Tom INDIO Wienco 
  
G24 GH9285  LOCAL 5 Upper East G65 Tom 1999 Wienco 
  
G25 GH9128  Local 6 Upper East G66 Tom 2000 Wienco 
  
G26 GH9158 Local 2 Upper East G67 Tom3308 Wienco 
  
G27 GH9200  Ashanti 2 Ashanti Region G68 Tom 4223 Wienco 
  
G28 GH9311  Local 1 Ashanti Region G69 Tom EMER Wienco 
  
G29 GH9104  Local 3 Brong Ahafo G70 Tom MARIA Wienco 
  
G30 GH9166 IIVT-13 Korea G71 Tom Sonia Wienco 
  
G31 GH9131  IIVT-15 Korea G72 14A112 FOHCREC 
  
G32 GH9107  IIVT-19 Korea G73 14A113 FOHCREC 
  
G33 GH9160  Bakkeoseu Korea G74 Dyvine RZ Wienco 
  
G34 GH9207 Superdotaerang Korea G75 NL Crop 
  Science 
G35 GH9078 Madiso Korea G76 Money maker FOHCREC 
  
G36 GH9150  AVTO 0101 AVRDC G77 Shaktiman FOHCREC 
  
G37 GH9247  AVTO 1006 AVRDC G78 NO7 FOHCREC 
  
G38 GH9235 AVTO 1020 AVRDC G79 Tropic FOHCREC 
  
G39 GH9310  AVTO 9802 AVRDC G80 Strain B FOHCREC 
  
G40 GH9237  AVTO 9804 AVRDC G81 Zumorned FOHCREC 
     
G41 12TAT001641 - Syngenta 
 
 
 
156 
 
University of Ghana http://ugspace.ug.edu.gh
Table S1: Continuation   
Code Accessions Source Code Accessions Source 
  
G82 Heinz 1370 FOHCREC G104 LA0348 UC DAVIS 
  
G83 #15063 FOHCREC G105 LA3472 UC DAVIS 
  
G84 NS 504 FOHCREC G106 LA2821 UC DAVIS 
  
G85 NS577 FOHCREC G107 LA2-225 UC DAVIS 
  
G86 Nirvana FOHCREC G108 LA2644 UC DAVIS 
G87 Tomaland FOHCREC   G109 2-175 UC DAVIS 
  
G88 Larisa FOHCREC G110 LA4442 UC DAVIS 
  
G89 Nkansah HT FOHCREC G111 LA1802 UC DAVIS 
  
G90 Tropimec FOHCREC G112 LA4285 UC DAVIS 
  
G91 Boma VF FOHCREC G113 LA3044 UC DAVIS 
  
G92 F1 Jaguar + Technisem G114 LA2369 UC DAVIS 
  
G93 F1 Thorgal Technisem G115 LA3152 UC DAVIS 
  
G94 F1 Nadira Technisem G116 2 - 031 UC DAVIS 
  
G95 F1 Cobra 26 Technisem G117 LA3012 UC DAVIS 
  
G96 Prado F1 Technisem G118 EMSD 2010 F1 Agrimat 
  
G97 UC 82 Wienco G119 Pimpinellifolium x  Roma  BNARI 
  
G98 Roma Tomato Wienco G120 BA-4 Pimpinellifolium x Wosowoso BNARI 
  
G99 Tomato Oxheart Crop Science G121 BA-5 Pimpinellifolium x Wosowoso BNARI 
  
G100 UN1621E Crop Science C-1  GH 9193 (Power Rano) Bunso 
  
G101 LA3251 UC DAVIS C-2 Peto Mech Agrimat 
  
G102 LA2127 UC DAVIS    
     
G103 LA1793 UC DAVIS 
 
 
 
 
 
 
157 
 
University of Ghana http://ugspace.ug.edu.gh
Table S2: Means of reproductive, yield component and fruit quality traits of 26 of 119 
tomato germplasm. 
Genotypes Blocks NDFFS TM RD Fr/Pl Weight Yield Brix 
(days) (days) (days) (g) (t/ha) 
G1 1 32.23 62.27 29.99 32.39 32.93 39.43 3.80 
G102 1 33.23 61.27 27.99 17.7 16.67 20.22 3.70 
G21 1 11.23 60.27 48.99 49.5 8.12 20.36 4.50 
G23 1 30.23 57.27 26.99 53.29 17.47 36.12 4.10 
G37 1 32.23 59.27 26.99 31.94 26.64 38.65 4.60 
G52 1 35.23 65.27 29.99 15.06 34.29 31.97 3.90 
G67 1 30.23 61.27 30.99 3.54 56.8 33.14 5.00 
G68 1 27.23 67.27 39.99 3.12 52.2 29.31 3.80 
G70 1 32.23 62.27 29.99 5.97 45.14 30.65 5.40 
G72 1 31.23 62.27 30.99 2.45 50.8 28.17 4.60 
G74 1 34.23 62.27 27.99 2 56.68 22.07 4.90 
G100 2 28.73 57.77 28.99 33.99 25.72 30.67 3.55 
G104 2 40.73 65.77 24.99 9.43 41.34 18.8 3.85 
G112 2 40.73 100.77 59.99 7.56 39.47 16.3 4.55 
G117 2 30.73 100.77 69.99 5.89 20.71 15.78 4.15 
G20 2 34.73 61.77 26.99 32.23 34.18 37.99 2.95 
G27 2 33.73 57.77 23.99 24.68 32.11 30.72 3.45 
G66 2 34.73 65.77 30.99 18.86 61.87 35.37 4.65 
G78 2 26.73 58.77 31.99 11.75 49.33 23.13 4.95 
G9 2 34.73 61.77 26.99 44.39 30.24 41.33 3.25 
G91 2 33.73 61.77 27.99 28.65 50.37 43.12 4.05 
G96 2 31.73 61.77 29.99 34.49 43.58 45.23 4.05 
G115 3 33.73 55.77 21.99 6.86 51.03 24.53 4.50 
G121 3 32.73 52.77 19.99 55.36 9.99 33 5.10 
G13 3 27.73 50.77 22.99 140.81 5.6 44.67 5.50 
G5 3 24.73 51.77 26.99 215.34 3.25 36.23 5.90 
G51 3 28.73 64.77 31.99 2.91 20.93 16.24 4.10 
G57 3 51.73 89.77 37.99 4.11 54.32 19.71 3.60 
G6 3 31.73 50.77 18.99 58.5 8.18 29.75 5.90 
G64 3 35.73 64.77 28.99 14.56 68.25 41.19 4.70 
G65 3 33.73 51.77 17.99 16.51 44.38 25.12 4.90 
G76 3 30.73 64.77 33.99 15.26 36.77 30.44 4.10 
G95 3 29.73 48.77 18.99 18.56 49.66 39.7 2.90 
G109 4 24.23 91.77 67.49 5.74 47.42 19.77 5.21 
G113 4 27.23 52.77 25.49 7.21 40.26 20.43 4.51 
G114 4 29.23 63.77 34.49 10.5 36.64 22.23 3.71 
G12 4 22.23 54.77 32.49 24.76 20.07 25.34 5.01 
G29 4 22.23 52.77 30.49 75.56 14.99 34.94 5.41 
G39 4 28.23 52.77 24.49 175.59 14.22 55.46 5.71 
G43 4 21.23 52.77 31.49 15.21 50.25 30.59 3.21 
G59 4 27.23 52.77 25.49 24.86 40.37 37.02 4.71 
G60 4 27.23 53.77 26.49 14.13 45.54 24.83 5.01 
 
158 
 
University of Ghana http://ugspace.ug.edu.gh
Table S2: Means of reproductive, yield component and fruit quality traits of 26 of 119 
tomato germplasm. 
NDFFS TM RD Weight Yield 
Genotypes Blocks Fr/Pl Brix 
(days) (days) (days) (g) (t/ha) 
G73 4 24.23 52.77 28.49 25 47.87 40.21 4.21 
G87 4 28.23 52.77 24.49 12.06 50.3 26.49 3.41 
G103 5 32.73 93.27 60.49 27.21 17.86 19.63 4.05 
G107 5 40.73 68.27 27.49 4.96 50.14 16.09 4.15 
G11 5 26.73 54.27 27.49 106.5 15.12 31.67 5.45 
G14 5 26.73 54.27 27.49 125.75 16.18 38.12 4.55 
G2 5 29.73 54.27 24.49 104.7 18.61 40.41 4.15 
G3 5 27.73 55.27 27.49 73.27 22.63 38.5 3.65 
G34 5 28.73 55.27 26.49 115.17 19.36 43.65 4.85 
G35 5 29.73 54.27 24.49 273.25 13.24 46 5.45 
G69 5 28.73 54.27 25.49 26.91 61.15 46.07 2.95 
G90 5 34.73 67.27 32.49 12.42 54.3 18.88 4.85 
G98 5 31.73 54.27 30 16.59 44.17 24.5 4.15 
G120 6 29.23 60.77 31.49 150.64 9.41 46.86 5.1 
G22 6 31.23 59.77 28.49 37.84 24.31 37.88 4.9 
G31 6 32.23 58.77 26.49 93.74 13.37 34.34 6.2 
G41 6 29.23 57.77 28.49 14.86 51.36 34.02 4.6 
G49 6 28.23 62.77 34.49 13.07 59.65 34.58 4.2 
G71 6 49.23 100.77 51.49 2.91 78.85 21.97 4.4 
G8 6 31.23 57.77 26.49 121.64 12.21 49.46 4.9 
G80 6 35.23 65.77 30.49 5.02 56.79 22.94 4.2 
G81 6 33.23 61.77 28.49 7.16 45.62 23.3 4.7 
G82 6 51.23 100.77 49.49 5.84 45.24 17.3 4.8 
G83 6 29.23 60.77 31.49 7.69 47.67 25.17 4.3 
G105 7 33.73 62.27 28.49 12.61 21.97 21.13 3.95 
G118 7 28.73 58.27 29.49 24.77 45.6 37.39 4.15 
G16 7 29.73 58.27 28.49 77.27 15.32 35.4 5.65 
G24 7 26.73 62.27 35.49 13.93 20.34 21.4 5.75 
G25 7 31.73 62.27 30.49 38.66 30.2 36.27 5.25 
G32 7 31.73 60.27 28.49 82.83 17.91 39.52 4.95 
G45 7 28.73 59.27 30.49 18.19 70.54 38.93 3.75 
G54 7 49.73 69.27 19.49 11.58 52.51 25.32 3.95 
G61 7 36.73 69.27 32.49 44.14 13.91 25.55 5.85 
G75 7 32.73 62.27 29.49 14.57 54.7 32.09 5.05 
G85 7 29.73 57.27 27.49 117.72 12.94 35.13 6.45 
G28 8 31.23 59.77 28.49 159.82 2.21 45.76 4.91 
G44 8 31.23 60.77 29.49 22.98 55.44 32.81 4.61 
G46 8 33.23 61.77 28.49 24.53 42.93 31.57 2.91 
G47 8 28.23 60.77 32.49 28.16 29.21 28.77 3.81 
 
 
 
159 
 
University of Ghana http://ugspace.ug.edu.gh
Table S2: Continuation 
NDFFS TM RD Weight Yield 
Genotypes Blocks Fr/Pl Brix 
(days) (days) (days) (g) (t/ha) 
G56 8 67.23 100.77 33.49 16.56 9.04 18.66 4.41 
G58 8 32.23 100.77 68.49 55.87 4.14 27.65 5.61 
G7 8 17.23 60.77 43.49 71.81 4.61 31.36 6.31 
G84 8 29.23 59.77 30.49 30.45 46.23 36.85 3.91 
G89 8 29.23 56.77 27.49 29.65 13.61 24.74 4.81 
G93 8 28.23 59.77 31.49 52.09 16.16 37.99 4.91 
G99 8 33.23 72.77 39.49 20.1 240.43 52.71 4.41 
G101 9 32.73 66.77 33.99 1.97 42.93 19.84 2.7 
G106 9 28.73 58.77 29.99 21.03 33.28 27.08 4.2 
G17 9 27.73 51.77 23.99 66.08 26.03 43.73 4.3 
G18 9 24.73 50.77 25.99 65.36 18.53 28.01 5.3 
G19 9 27.73 58.77 30.99 88.98 19.67 37.61 2.4 
G33 9 29.73 54.77 24.99 66.53 22.57 37.15 4 
G36 9 24.73 50.77 25.99 52.08 27.1 39.36 2.4 
G53 9 35.73 65.77 29.99 8.51 50.71 28.96 4.6 
G62 9 28.73 59.77 30.99 1.63 64.65 28.33 2.5 
G94 9 28.73 54.77 25.99 19.13 53.78 44.61 2.3 
G97 9 30.73 61.77 30.99 8.36 40.55 22.72 3.4 
G108 10 30.73 63.77 32.99 113.21 1.96 25.39 6.45 
G110 10 30.73 62.77 31.99 63.89 17.95 42.9 4.85 
G116 10 42.73 98.77 55.99 31.43 44.06 21.75 3.65 
G26 10 31.73 62.77 30.99 80.21 12.07 39.71 4.95 
G30 10 27.73 62.77 34.99 118.26 8.54 47.96 5.15 
G38 10 30.73 59.77 28.99 209.13 3.63 53.61 5.05 
G40 10 30.73 59.77 28.99 43.1 20.87 34.06 4.75 
G42 10 30.73 57.77 26.99 31.48 43.66 36.78 4.35 
G48 10 38.73 62.77 23.99 25.42 34.65 26.89 3.85 
G55 10 42.73 98.77 55.99 19.01 112.77 19.43 4.55 
G63 10 31.73 59.77 27.99 24.57 52.14 29.83 5.15 
G10 11 29.73 58.77 28.99 37.77 26.2 36.88 5.1 
G111 11 37.73 98.77 60.99 6 23.18 15.15 4.5 
G119 11 26.73 59.77 32.99 150.97 13.58 33.44 4.9 
G15 11 26.73 59.77 32.99 77.17 19.52 38.34 5.5 
G4 11 28.73 59.77 30.99 118.59 14.4 30.13 5.1 
G50 11 29.73 58.77 28.99 1.12 52.02 33.11 4 
G77 11 25.73 56.77 30.99 1.08 59.07 35.25 4 
G79 11 30.73 59.77 28.99 2.37 48.68 30.69 4.9 
 
 
 
160 
 
University of Ghana http://ugspace.ug.edu.gh
Table S2: Continuation 
NDFFS TM RD Weight Yield 
Genotypes Blocks Fr/Pl Brix 
(days) (days) (days) (g) (t/ha) 
G86 11 30.73 59.77 28.99 8.28 26.9 22.42 3.9 
G88 11 19.73 57.77 37.99 4 73.26 24.03 3.5 
G92 11 25.73 58.77 32.99 6 71.77 31.62 3.9 
C-1   28.37 56.18 27.76 30.86 30.51 36.79 4.49 
C-2   34.1 63.36 29.22 21.58 38.22 32.2 4.01 
SED df=10 (checks) 1.24 2.05 1.66 4.18 3.61 5.23 0.24 
SED df=10 (within 
3.05 5.03 4.06 10.23 8.84 12.8 0.59 
block) 
SED df=10 (different 
4.13 6.81 5.5 13.85 11.97 17.34 0.8 
blocks) 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
161 
 
University of Ghana http://ugspace.ug.edu.gh
Table S3: List of tomato accessions grouped based on morphological traits 
Cluster I Cluster II Outlier 
Power Rano 08TEP080187 LA2644 Tomato 
Oxheart 
Peto Mech 15TEP070136 GH9152   
GH9116  08TEP070549 LA4442  
GH 9281  08TEP070550 BA-1 Wild * Roma   
UN1621E 08TEP070728 BA-4 Wild * Wosowoso  
LA3251 Tom DIABOU BA-5 Wild * Wosowoso  
LA2127 Tom TAMP GH9208   
LA1793 Tom INDIO GH9243   
LA0348 Tom 1999 GH9121   
LA3472 Tom 2000 GH9224  
LA2821 Tom3308 GH9098   
LA2-225 Tom 4223 GH9190  
2-175 Tom EMER GH9184   
LA1802 Tom MARIA GH9246   
LA4285 Tom Sonia GH9185   
LA3044 14A112 GH9109   
LA2369 14A113 GH 9158   
LA3152 Dyvine RZ GH9311   
2 – 031 NL GH9104   
EMSD 2010 F1 Money maker GH9251   
GH 9163  Shalctiman GH9166  
GH9073  NO7 GH9131   
GH9238  Tropic GH9107   
GH9285  Strain B GH9160   
GH9128  Zumorned GH9207  
GH9200  Heinz 1370 GH9078  
GH9247  NS 504 GH9150   
GH9237  Nirvana GH9235  
12TAT001641 Tomaland GH9310   
14TAT101383 Larisa GH9305  
14TAT101385 Nkansah HT GH9233   
14TAT101394 GH 9114 10TEP080188  
14TAT101353 Tropimec GH9111  
14TAT101371 Boma VF GH 9239   
Tomato TO 687 F1 Hybrid F1 Jaguar + GH 9137   
Tapiche F1 Nadira NS577  
14TAT101382 F1 Cobra 26 F1 Thorgal  
14TAT101342 Prado F1   
08TEP070545 UC 82   
08TEP070546 Roma Tomato   
08TEP070547    
 
 
162 
 
University of Ghana http://ugspace.ug.edu.gh
Table S4: Key descriptive statistics for measuring informativeness of 48 of the 338 SNPs 
markers based on 96 tomato acce ssions of Ghanaian and Exotic origin 
Locus N Hobs HExp PIC Locus N Hobs HExp PIC 
 
S100022 94 0.117 0.502 0.375 S12638 96 0.167 0.481 0.364 
 
S100037 94 0.181 0.502 0.375 S12647 96 0.229 0.489 0.368 
 
S100154 96 0.104 0.492 0.37 S12656 94 0.117 0.291 0.248 
 
S100197 94 0.16 0.277 0.237 S12664 95 0.021 0.081 0.077 
 
S100205 96 0.104 0.492 0.37 S12718 96 0.167 0.44 0.342 
 
S100240 96 0.083 0.355 0.291 S12749 95 0.284 0.438 0.341 
 
S100246 93 0.075 0.093 0.088 S12757 96 0.281 0.436 0.34 
 
S100269 96 0.156 0.349 0.287 S12799 96 0.156 0.392 0.314 
 
S100516 96 0.156 0.496 0.372 S12826 96 0.073 0.162 0.148 
 
S100561 96 0.219 0.479 0.363 S13202 96 0.229 0.447 0.346 
 
S100691 96 0.073 0.436 0.34 S13398 95 0.116 0.43 0.337 
 
S100743 96 0.156 0.5 0.374 S13399 96 0.167 0.44 0.342 
 
S100810 94 0.043 0.174 0.158 S13404 92 0.196 0.499 0.373 
 
S100981 96 0.031 0.179 0.162 S13458 95 0 0.061 0.059 
 
S100987 96 0.115 0.286 0.244 S13481 95 0.263 0.485 0.366 
 
S100995 95 0.168 0.456 0.351 S13625 96 0.042 0.099 0.094 
 
S101009 96 0.052 0.179 0.162 S13762 94 0.16 0.5 0.374 
 
S101067 96 0.083 0.397 0.317 S13842 96 0.219 0.228 0.201 
 
S101068 95 0.084 0.267 0.231 S13868 95 0.074 0.071 0.068 
 
S101085 96 0.115 0.228 0.201 S13899 95 0.105 0.155 0.142 
 
S10372 96 0.135 0.338 0.279 S14323 96 0.104 0.366 0.298 
 
S10686 96 0.125 0.293 0.249 S14354 93 0.14 0.218 0.193 
 
S10796 96 0.073 0.196 0.176 S14355 96 0.135 0.258 0.224 
 
S10958 96 0.125 0.332 0.275 S14415 94 0.255 0.421 0.331 
 
S11092 90 0.133 0.461 0.353 S14458 96 0.188 0.481 0.364 
 
S11205 96 0.146 0.387 0.311 S14530 96 0.198 0.487 0.367 
 
S11231 95 0.2 0.501 0.374 S14653 95 0.2 0.302 0.255 
 
S11281 95 0.063 0.189 0.171 S14758 93 0.172 0.385 0.31 
 
S11543 95 0.211 0.462 0.354 S14868 84 0.774 0.491 0.369 
 
S11588 96 0.063 0.099 0.094 S14890 96 0.125 0.319 0.267 
 
S12200 93 0.161 0.499 0.373 S1490 94 0.191 0.298 0.252 
 
S12201 96 0.198 0.436 0.34 S1498 94 0.16 0.262 0.227 
 
S12212 94 0.117 0.49 0.369 S15013 96 0.052 0.127 0.118 
 
S12213 96 0.115 0.493 0.37 S15039 96 0.156 0.498 0.373 
 
S12372 96 0.156 0.42 0.33 S1504 96 0.167 0.279 0.239 
 
S12414 94 0.138 0.433 0.338 S15046 95 0.105 0.502 0.375 
 
S12421 91 0.11 0.246 0.215 S15058 95 0.137 0.495 0.371 
 
S12501 95 0.053 0.091 0.086 S1525 96 0.198 0.3 0.254 
 
S12535 96 0.063 0.118 0.11 S15432 96 0.24 0.474 0.36 
 
S12536 96 0.063 0.118 0.11 S15515 95 0.179 0.465 0.356 
N (Number of individuals typed at the locus), Hobs (Observed heterozygosity), Hexp (Expected 
heterozygosity), PIC (Polymorphic Information Content)
163 
 
University of Ghana http://ugspace.ug.edu.gh
Table S4: Continuation  
Locus N Hobs HExp PIC Locus N Hobs HExp PIC 
 
S1568 96 0.115 0.286 0.244 S18763 96 0.115 0.502 0.375 
 
S15688 95 0.179 0.488 0.368 S18996 91 0.121 0.312 0.262 
 
S15693 92 0.152 0.417 0.329 S19102 96 0.135 0.469 0.357 
 
S1572 95 0.168 0.4 0.319 S19345 96 0.24 0.338 0.279 
 
S15765 95 0.158 0.302 0.255 S19514 92 0.174 0.491 0.369 
 
S15780 96 0.229 0.432 0.337 S19569 96 0.125 0.306 0.258 
 
S15785 92 0.141 0.493 0.37 S19570 96 0.125 0.306 0.258 
 
S15789 94 0.138 0.433 0.338 S19574 96 0.167 0.495 0.371 
 
S15889 96 0.063 0.118 0.11 S19630 93 0.258 0.5 0.374 
 
S16177 95 0.084 0.503 0.375 S19643 96 0.177 0.443 0.344 
 
S16424 96 0.146 0.415 0.328 S19982 95 0.105 0.4 0.319 
 
S16648 96 0.042 0.497 0.372 S19983 96 0.104 0.406 0.323 
 
S16654 95 0.063 0.49 0.369 S20216 96 0.146 0.344 0.283 
 
S16794 96 0.125 0.306 0.258 S20344 92 0.174 0.434 0.339 
 
S16795 96 0.125 0.306 0.258 S20409 96 0.125 0.306 0.258 
 
S16803 96 0.135 0.272 0.234 S20440 89 0.124 0.155 0.142 
 
S16978 96 0.021 0.366 0.298 S21035 94 0 0.27 0.232 
 
S1698 96 0.146 0.495 0.371 S21215 92 0.076 0.382 0.308 
 
S16982 95 0.042 0.487 0.367 S21317 95 0.179 0.395 0.316 
 
S17019 95 0.168 0.503 0.375 S21335 95 0.095 0.328 0.273 
 
S17481 96 0.167 0.501 0.374 S21372 96 0.083 0.293 0.249 
 
S17502 94 0.16 0.5 0.374 S21385 94 0.202 0.49 0.369 
 
S17525 94 0.17 0.488 0.368 S21461 94 0.032 0.355 0.291 
 
S17547 95 0.116 0.476 0.361 S21829 96 0.156 0.498 0.373 
 
S17641 96 0.125 0.502 0.375 S21862 94 0.117 0.502 0.375 
 
S17645 96 0.938 0.503 0.375 S2191 96 0.156 0.5 0.374 
 
S17649 96 0.125 0.502 0.375 S22065 96 0.208 0.502 0.375 
 
S17655 95 0 0.061 0.059 S22109 92 0.293 0.489 0.368 
 
S1772 96 0.208 0.495 0.371 S2234 96 0.146 0.355 0.291 
 
S17756 95 0 0.1 0.095 S22565 95 0.126 0.418 0.329 
 
S17765 96 0.094 0.501 0.374 S22567 95 0.126 0.418 0.329 
 
S17771 96 0.094 0.501 0.374 S22572 93 0.129 0.395 0.316 
 
S1779 95 0.137 0.315 0.264 S22603 95 0.189 0.426 0.334 
 
S18272 91 0.132 0.214 0.19 S22620 96 0.177 0.349 0.287 
 
S18397 96 0.177 0.503 0.375 S22649 95 0.137 0.476 0.361 
 
S18443 96 0.135 0.338 0.279 S22830 95 0.168 0.449 0.347 
 
S18519 96 0.052 0.127 0.118 S231 92 0.022 0.177 0.161 
 
S18619 95 0.189 0.503 0.375 S23192 91 0.132 0.471 0.359 
 
S18641 96 0.156 0.503 0.375 S23480 96 0.188 0.499 0.373 
 
S18739 96 0.115 0.502 0.375 S23589 95 0.168 0.493 0.37 
N (Number of individuals typed at the locus), Hobs (Observed heterozygosity), Hexp (Expected 
heterozygosity), PIC (Polymorphic Information Content)
164 
 
University of Ghana http://ugspace.ug.edu.gh
Table S4: Continuation  
Locus N Hobs HExp PIC Locus N Hobs HExp PIC 
 
S23724 92 0.283 0.469 0.357 S34365 95 0.147 0.473 0.36 
 
S23850 95 0.095 0.315 0.264 S34373 96 0.167 0.44 0.342 
 
S24148 96 0.125 0.332 0.275 S34761 96 0.052 0.428 0.335 
 
S24428 90 0.067 0.264 0.228 S3480 93 0.14 0.307 0.259 
 
S24437 94 0.074 0.49 0.369 S36192 91 0.011 0.396 0.316 
 
S24440 95 0.074 0.404 0.321 S36224 93 0.054 0.497 0.372 
 
S24454 96 0.083 0.432 0.337 S36504 96 0.146 0.476 0.362 
 
S24575 96 0.177 0.493 0.37 S36809 95 0.158 0.497 0.372 
 
S24577 94 0.181 0.461 0.354 S37097 94 0.191 0.501 0.374 
 
S25111 93 0.129 0.486 0.367 S37209 93 0.086 0.242 0.212 
 
S2622 95 0.126 0.468 0.357 S37265 93 0.118 0.484 0.365 
 
S2629 96 0.177 0.428 0.335 S39457 92 0.196 0.366 0.298 
 
S26683 95 0.168 0.473 0.36 S39506 88 0.102 0.261 0.226 
 
S2671 90 0 0.393 0.315 S3977 95 0.189 0.468 0.357 
 
S26884 95 0.116 0.302 0.255 S39804 96 0.125 0.489 0.368 
 
S27167 96 0.094 0.228 0.201 S4000 95 0.126 0.295 0.251 
 
S27197 91 0.22 0.428 0.335 S4005 96 0.125 0.293 0.249 
 
S28824 96 0.052 0.313 0.263 S4021 96 0.188 0.492 0.37 
 
S29188 96 0.052 0.212 0.189 S4038 93 0.129 0.3 0.254 
 
S29222 95 0.116 0.414 0.327 S4042 95 0.168 0.462 0.354 
 
S29473 93 0.086 0.454 0.35 S41220 94 0.191 0.298 0.252 
 
S29477 95 0.232 0.502 0.375 S4139 96 0.115 0.463 0.354 
 
S29720 91 0.022 0.471 0.359 S41458 96 0.167 0.344 0.283 
 
S2983 93 0.172 0.477 0.362 S4283 93 0.118 0.499 0.373 
 
S3017 95 0.137 0.352 0.289 S43632 92 0.12 0.477 0.362 
 
S30379 91 0.198 0.503 0.375 S4374 95 0.179 0.495 0.371 
 
S30380 96 0.188 0.503 0.375 S4431 96 0.156 0.502 0.375 
 
S30515 95 0.105 0.334 0.277 S45076 95 0.189 0.295 0.251 
 
S3066 95 0.105 0.449 0.347 S45412 96 0.125 0.489 0.368 
 
S3067 96 0.073 0.402 0.32 S45432 94 0.128 0.488 0.368 
 
S3096 96 0.156 0.498 0.373 S45448 93 0.118 0.488 0.367 
 
S3112 96 0.146 0.415 0.328 S45469 96 0.094 0.286 0.244 
 
S3159 95 0.126 0.4 0.319 S45495 96 0.115 0.493 0.37 
 
S3163 96 0.146 0.454 0.349 S46386 96 0.031 0.313 0.263 
 
S31973 95 0.137 0.315 0.264 S47762 95 0.189 0.478 0.362 
 
S32342 96 0.063 0.355 0.291 S47843 93 0.118 0.333 0.277 
 
S33168 95 0.147 0.334 0.277 S48097 82 0 0.251 0.219 
 
S33701 86 0.151 0.438 0.34 S48121 95 0.084 0.358 0.293 
 
S33745 74 0.095 0.446 0.345 S48426 95 0.021 0.189 0.171 
 
S3430 95 0.147 0.503 0.375 S4926 96 0.156 0.392 0.314 
N (Number of individuals typed at the locus), Hobs (Observed heterozygosity), Hexp (Expected 
heterozygosity), PIC (Polymorphic Information Content)
165 
 
University of Ghana http://ugspace.ug.edu.gh
 Table S4: Continuation  
Locus N Hobs HExp PIC Locus N Hobs HExp PIC 
 
S4963 93 0.075 0.218 0.193 S62409 96 0.167 0.25 0.218 
 
S5050 91 0.099 0.503 0.375 S62495 96 0.208 0.406 0.323 
 
S50895 96 0.156 0.338 0.279 S6255 96 0.219 0.3 0.254 
 
S50902 96 0.156 0.313 0.263 S62702 95 0.116 0.374 0.303 
 
S50925 96 0.146 0.344 0.283 S6291 96 0.135 0.5 0.374 
 
S50932 95 0.105 0.334 0.277 S63588 96 0.021 0.061 0.059 
 
S5094 96 0.177 0.338 0.279 S63641 96 0.021 0.061 0.059 
 
S5110 94 0.213 0.458 0.352 S63704 96 0.021 0.061 0.059 
 
S51325 95 0.084 0.295 0.251 S63869 94 0.181 0.448 0.346 
 
S51332 93 0.075 0.265 0.229 S65677 94 0.117 0.366 0.298 
 
S51338 96 0.104 0.492 0.37 S6568 96 0.135 0.49 0.369 
 
S51382 96 0.083 0.293 0.249 S65964 96 0.115 0.372 0.301 
 
S51601 96 0.156 0.382 0.308 S6905 93 0.075 0.419 0.33 
 
S5191 96 0.146 0.492 0.37 S69787 96 0.052 0.228 0.201 
 
S5211 95 0.105 0.282 0.241 S69874 94 0.096 0.2 0.179 
 
S53055 93 0.075 0.32 0.268 S69978 96 0.021 0.061 0.059 
 
S53136 95 0.095 0.181 0.164 S7025 94 0.213 0.502 0.375 
 
S55037 93 0.032 0.479 0.363 S7042 93 0.215 0.49 0.368 
 
S5547 96 0.156 0.392 0.314 S7045 95 0.2 0.495 0.371 
 
S5656 96 0.073 0.258 0.224 S706 96 0.146 0.366 0.298 
 
S56956 96 0.083 0.293 0.249 S719 96 0.135 0.361 0.294 
 
S56978 95 0.105 0.493 0.37 S7232 96 0.198 0.5 0.374 
 
S5761 96 0.104 0.25 0.218 S7386 93 0.172 0.482 0.364 
 
S58180 95 0.105 0.418 0.329 S7388 94 0.17 0.429 0.336 
 
S5861 95 0.168 0.462 0.354 S74 94 0.191 0.475 0.361 
 
S5863 91 0.154 0.465 0.355 S7410 94 0.213 0.324 0.271 
 
S58869 96 0.115 0.3 0.254 S75 96 0.177 0.496 0.372 
 
S58916 92 0.098 0.466 0.356 S7775 94 0.128 0.494 0.371 
 
S58945 96 0.188 0.454 0.349 S7829 96 0.146 0.501 0.374 
 
S59159 91 0.088 0.391 0.313 S7919 92 0.098 0.493 0.37 
 
S59771 95 0.147 0.498 0.373 S7939 96 0.094 0.463 0.354 
 
S60078 96 0.094 0.196 0.176 S7942 94 0.085 0.255 0.221 
 
S60360 87 0.057 0.337 0.279 S8064 95 0.105 0.346 0.285 
 
S60417 96 0.063 0.406 0.323 S8223 96 0.063 0.355 0.291 
 
S60557 96 0 0.061 0.059 S8464 96 0.188 0.485 0.366 
 
S60559 96 0 0.061 0.059 S8505 96 0.208 0.502 0.375 
 
S61108 92 0.065 0.442 0.343 S8510 96 0.188 0.387 0.311 
 
S61131 96 0.042 0.415 0.328 S8524 95 0.137 0.289 0.246 
 
S61192 93 0.161 0.475 0.361 S8547 95 0.126 0.267 0.231 
 
S6196 96 0.219 0.228 0.201 S8549 96 0.177 0.361 0.294 
N (Number of individuals typed at the locus), Hobs (Observed heterozygosity), Hexp (Expected 
heterozygosity), PIC (Polymorphic Information Content)
166 
 
University of Ghana http://ugspace.ug.edu.gh
 Table S4: Continuation 
Locus N Hobs HExp PIC  Locus N Hobs HExp PIC 
S8669 96 0.125 0.344 0.283  S9379 94 0.043 0.139 0.128 
S8697 92 0.13 0.228 0.201  S9444 96 0.156 0.5 0.374 
S8774 96 0.156 0.272 0.234  S9510 91 0.473 0.406 0.322 
S8787 95 0.084 0.434 0.339  S9663 95 0.116 0.503 0.375 
S8807 93 0.075 0.475 0.361  S9681 94 0.138 0.502 0.375 
S8835 96 0.198 0.503 0.375  S9689 96 0.031 0.496 0.372 
S8855 96 0.094 0.457 0.351  S9703 96 0.104 0.44 0.342 
S8858 73 0.055 0.128 0.119  S9707 95 0.158 0.492 0.37 
S8859 96 0.052 0.09 0.085  S9856 96 0.25 0.476 0.362 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
167 
 
 
University of Ghana http://ugspace.ug.edu.gh
Table S4: Level of heterozygosity of 96 to ma to accessions genotyped with 338 SNP markers 
Sample #  #  Het Het Sample #  #  Het Het 
Loci loci   Loci loci 
GH 9131 337 1 0.003 GH_9243 333 17 0.051 
  
Nkansah HT 335 1 0.003 BA-5xWoso 333 18 0.054 
  
Peto Mech 297 1 0.003 GH 9237 336 19 0.057 
  
Money maker 338 2 0.006 GH 9235 335 19 0.057 
  
LA3472 338 2 0.006 GH 9107 330 21 0.064 
  
GH 9128 337 2 0.006 GH 9160 336 22 0.065 
  
GH_9200 337 2 0.006 GH 9121 333 22 0.066 
  
LA2-225 337 2 0.006 UC_82 333 26 0.078 
  
Tomaland 337 2 0.006 GH 9305 334 27 0.081 
  
LA1793 336 2 0.006 GH 9104 330 27 0.082 
  
LA3012 335 2 0.006 Tropimec 334 28 0.084 
  
Power Rano 335 2 0.006 LA3473 338 30 0.089 
  
Boma VF 334 2 0.006 GH 9238 335 31 0.093 
  
GH 9073 334 2 0.006 GH 9078 336 32 0.095 
  
LA4440B 333 2 0.006 GH 9163 334 32 0.096 
  
UN1621E 332 2 0.006 LA1018 337 34 0.101 
  
Heinz 1370 337 3 0.009 GH_9247 333 34 0.102 
  
LA2821 337 3 0.009 Roma tomato 310 32 0.103 
  
GH 9114 336 3 0.009 BA-1xRoma 324 38 0.117 
  
LA4442 336 3 0.009 GH 9109 333 40 0.12 
  
LA3044 336 3 0.009 GH 9116 313 44 0.141 
  
LA3152 336 3 0.009 GH 9207 331 50 0.151 
  
LA2644 336 3 0.009 #15063 335 63 0.188 
  
LA4440 335 3 0.009 GH 9285 331 65 0.196 
  
GH 9184 335 3 0.009 NS577 330 65 0.197 
  
LA2369 335 3 0.009 GH 9285 331 65 0.196 
  
LA3151 334 3 0.009 NS577 330 65 0.197 
  
LA2127 338 4 0.012 GH 9224 334 71 0.213 
LA0348 338 4 0.012   GH_9152 332 71 0.214 
GH 9281 334 4 0.012   GH_9098 331 71 0.215 
 
 
 
 
 
 
 
168 
 
 
University of Ghana http://ugspace.ug.edu.gh
Table S4 Continuation   
Sample #  #  Het Het Sample #  #  Het Het 
Loci loci Loci loci 
GH 9233 331 4 0.012   Shaktiman 334 76 0.228 
GH 9310 334 5 0.015   Nirvana 334 80 0.24 
GH 9190 333 5 0.015   Dyvine_RZ 335 81 0.242 
GH 9137 333 7 0.021   F1_Nadira 328 89 0.271 
Tomato Oxheart 333 9 0.027   Tom_Sonia 333 100 0.3 
GH 9239 332 10 0.03   NO7 332 104 0.313 
LA1802 336 11 0.033   Zumorned 335 108 0.322 
GH 9158 333 14 0.042   F1_Jaguar+ 332 108 0.325 
GH 9246 334 15 0.045   GH_9150 333 109 0.327 
GH 9185 324 16 0.049   Tropic 336 111 0.33 
BA-4xWoso 337 17 0.05   Tom_4223 337 112 0.332 
GH 9251 308 105 0.341   Tom 2000 337 125 0.371 
  
NS 504 336 116 0.345 NL 336 126 0.375 
  
Tom EMER 337 117 0.347 Tom DIABOU 334 126 0.377 
  
EMSD 2010 F1 334 118 0.353 Tom INDIO 335 130 0.388 
  
GH 9166 333 119 0.357 Tom MARIA 337 131 0.389 
  
14A113 335 123 0.367 Tom 1999 336 132 0.393 
  
Tom 3308 337 124 0.368 Tom TAMP 329 133 0.404 
  
GH 9311 335 124 0.37 F1 Thorgal 332 137 0.413 
# Loci=Number of loci; #=Number of Heterozygous loci; Het= Heterozygosity 
 
169