RESEARCH ARTICLE
Molecular detection of dengue virus in
patients suspected of Ebola virus disease in
Ghana
Joseph Humphrey Kofi Bonney 1ID *, Takaya Hayashi1,2☯, Samuel Dadzie1‡,
Esinam Agbosu1☯, Deborah Pratt1☯, Stephen Nyarko1☯, Franklin Asiedu-Bekoe 3☯ID ,
Eiji Ido2‡, Badu Sarkodie4☯, Nobuo Ohta2‡, Shoji Yamaoka2‡
1 Virology Department, Noguchi Memorial Institute of Medical Research, University of Ghana, Legon, Ghana,
2 Tokyo Medical and Dental University, Tokyo, Japan, 3 Disease Surveillance Department, Ghana Health
a1111111111
Service, Accra, Ghana, 4 Public Health Division, Ghana Health Service, Accra, Ghana
a1111111111
a1111111111 ☯ These authors contributed equally to this work.
a1111111111 ‡ These authors also contributed equally to this work.
a1111111111 * Kbonney@noguchi.ug.edu.gh
Abstract
OPEN ACCESS Dengue fever is known to be one of the most common arthropod-borne viral infectious dis-
Citation: Bonney JHK, Hayashi T, Dadzie S, eases of public health importance. The disease is now endemic in more than 100 countries
Agbosu E, Pratt D, Nyarko S, et al. (2018) in Africa, the Americas, the Eastern Mediterranean, Southeast Asia and the Western Pacific
Molecular detection of dengue virus in patients
with an estimated two fifths of the world’s population being at risk. The notable endemic viral
suspected of Ebola virus disease in Ghana. PLoS
ONE 13(12): e0208907. https://doi.org/10.1371/ hemorrhagic fevers (VHFs) found in West Africa, including yellow fever, Lassa fever, Rift
journal.pone.0208907 Valley fever, dengue fever and until recently Ebola have been responsible for most out-
Editor: Pierre Roques, CEA, FRANCE breaks with fatal consequences. These VHFs usually produce unclear acute febrile illness,
especially in the acute phase of infection. In this study we detected the presence of 2 differ-
Received: May 25, 2018
ent serotypes (DENV-2 and DENV-3) of Dengue virus in 4 sera of 150 patients clinically sus-
Accepted: November 26, 2018
pected of Ebola virus disease during the Ebola Virus Disease (EVD) outbreak in West Africa
Published: December 19, 2018 with the use of serological and molecular test assays. Sequence data was successfully gen-
Copyright: © 2018 Bonney et al. This is an open erated for DENV-3 and phylogenetic analysis of the envelope gene showed that the DENV-
access article distributed under the terms of the 3 sequences had close homology with DENV-3 sequences from Senegal and India. This
Creative Commons Attribution License, which
study documents molecular evidence of an indigenous Dengue fever viral infection in
permits unrestricted use, distribution, and
reproduction in any medium, provided the original Ghana and therefore necessitates the need to have an efficient surveillance system to rap-
author and source are credited. idly detect and control the dissemination of the different serotypes in the population which
Data Availability Statement: All relevant data are has the potential to cause outbreaks of dengue hemorrhagic fevers.
within the manuscript. However, sequence data
files for the three positive samples (EV-042, EV-
050 and EV-073 for the gene target, capsid pre-
membrane region) and two of the same samples
(EV-042 and EV-073 for the gene target, non-
structural 5 region) are available on the DNA Data Introduction
Bank of Japan (DDBJ) and assigned the accession
numbers LC379220 - LC379224. Viral hemorrhagic fevers (VHFs), which refer to a group of illnesses that are caused by viruses
within a distinct group of families, are well known for their characteristic overall vascular sys-
Funding: This research work was supported by
funds from the Japan Initiative for Global Research tem damage and the impairment of the body’s ability to regulate itself [1]. Symptoms pre-
Network on Infectious Diseases (J-GRID) of the sented by VHF-related illnesses are often accompanied by hemorrhage which in itself is rarely
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 1 / 14
Dengue fever virus in suspected Ebola patients in Ghana
Japan Agency for Medical Research and life-threatening [1]. While some types of hemorrhagic fever viruses cause relatively mild ill-
Development (AMED) to NO and by the ness, many of these viruses cause severe fatal disease. The occurrence of outbreaks caused by
Government of Ghana through the financial
these viruses cannot be certainly projected However, in recent times, the world has come to
support from the University of Ghana Research
terms with the devastating impact of mortality and morbidity unleashed by two viral agents
Fund to JH and KB. The funders had no role in
study design, data collection and analysis, decision within these distinct viral groups–Dengue virus and Ebola virus. While the mortality rate of
to publish, or preparation of the manuscript. the latter is known to be a little over 90% [2] in some instances, it is rather the morbidity rate
in the former that causes extensive concern as the World Health Organization (WHO) indi-
Competing interests: The authors have declared
that no competing interest exists. cated a 30-fold increase in cases since 1960 [3].
DF which is considered the most important Aedes mosquito-borne viral disease to infect
humans is caused by one of four closely related serotypes of Dengue virus (DENV) [4]. The
four serotypes, DENV serotypes 1–4, have caused large urban outbreaks, particularly once the
co-circulation of different serotypes is observed or when a new serotype is presented [5–7].
The virus belongs to the genus Flavivirus within the Flaviviridae family [8]. It is endemic and
known as a common illness throughout Southeast Asia and much of the Americas [8]. A study
that used a cartographic approach provided an annual global estimate of 390 million DENV
infections of which 67 to 136 million showed at any level of disease severity [9]. In this same
study 70% of the global estimated infections were predicted to have occurred in Asia and 16%
in Africa [9,10]. It was however noted with interest the large estimated burden of Dengue in
Africa from this study as it was not until recently that the often-recognized disease outside
Africa has assumed higher levels of risk in Africa [9,10].
The widespread epidemic of Ebola virus disease (EVD) in three West African countries,
Guinea, Sierra Leone and Liberia, between 2013 and 2015 caused significant mortality, with
reported case fatality rates of up to 72% [11] and specifically 57–59% among hospitalized
patients [11]. Many West African countries including Ghana that are near to these three most
affected countries were deemed at high risk of EVD importation. As a response to the outbreak
in these neighboring countries, a national surveillance system was set up in Ghana as part of
an EVD preparedness and response plan to detect and rapidly respond to cases and rumors of
cases. Clinical specimens of serum/plasma from patients suspected of EVD from health facili-
ties across the country were submitted to the Noguchi Memorial Institute for Medical
Research (NMIMR), which was designated for laboratory investigation of these suspected
cases.
To establish a definitive diagnosis for these suspected cases of EVD, a testing algorithm that
involved investigating for the other known endemic VHFs in the sub-region was adopted.
Thus, laboratory investigations were not only performed for Ebola and Marburg but the other
endemic hemorrhagic fever viruses including Yellow fever, Lassa fever West Nile and DF.
While a definitive viral diagnosis could not be established for the majority of the suspected
cases, four were found to be positive for dengue virus with our testing algorithm. The import
of this approach was reinforced when analysis of the case investigation forms that accompa-
nied these suspected specimens suggested only 10% met the WHO standard case definition for
an EVD [12]. From the foregoing, we sought to detect viral agents of hemorrhagic fevers likely
to be endemic in the country from the suspected clinical specimens submitted for laboratory
investigation of EVD. We intend to present the molecular indication of a native Dengue viral
infection in Ghana.
Materials and methods
Clinical specimens
The clinical specimens of sera and plasma used in this study were archived specimens stored at
Noguchi Memorial Institute for Medical Research (NMIMR). These samples had been
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 2 / 14
Dengue fever virus in suspected Ebola patients in Ghana
collected between 2014 and 2016, during the West African EVD outbreak. Eligible patients
were examined by trained health staff and diagnosed on suspicion of EVD illness based on the
routine surveillance case definition of the standard WHO case definitions for Ebola and Mar-
burg virus diseases [12]. During that period, they were tested for EVD and other VHFs includ-
ing Marburg, Lassa fever, yellow fever and West Nile by reverse transcription polymerase
chain reaction (RT-PCR). Residual specimens were stored at -80˚C. Thus, the batch of speci-
mens used in this work had previously been tested for EVD, Marburg, Lassa fever and yellow
fever but were yet to be tested for other flaviviruses.
Ethical approval was obtained from the Noguchi Memorial Institute for Medical Research
Institutional Review Board (NMIMR-IRB) and the Ghana Health Service for this research
work (study number: #033/15-16). All analyzed patients’ clinical specimens used in this study
were anonymized prior to access by the authors.
Serological assays
The 150 residual clinical specimens were individually tested with serological assays for the
presence of antibodies to DENV. Test assays were performed in a 96-well ELISA format using
commercially available kit and test procedure followed in accordance with manufacturer’s
instructions: Human Anti-DENV IgG/IgM ELISA kit (Abcam, Cambridge, UK). Anti-DENV
IgM positives were tested with a lateral flow immunochromatographic strip (Dengue NS1 Ag
STRIP; Bio-Rad, Marnes-la-Coquette, France).
Nucleic acid extraction and purification
Viral RNA was extracted from 140 μL of clinical specimens that were anti-DENV IgM positive
with the QIAmp viral RNA kit (Qiagen, Hilden, Germany) according to the manufacturer’s
instructions. The extracted and purified nucleic acid was eluted from the spin columns with
60 μL of RNase/DNase-free elution buffer provided with the kit.
Nucleic acid amplification assays
To amplify the nucleic acid and detect the genomic sequence of interest, several amplification
assays were deployed. An initial test run was carried out with a TaqMan-based real time
reverse transcription-polymerase chain reaction (rRT-PCR) assay developed by Johnson et al.
[13] to detect and type the four DENV serotypes. In a 25μl reaction mixtures with the Applied
Biosystems 7300 RT-PCR system (Life Technologies, Grand Island, NY, USA), volumes each
of 5μl of extracted and purified RNA from the clinical sera or plasma were combined with 10
pmol each of Dengue serotype specific primer and probe sets and targets. Each reaction mix-
ture contained a single Dengue serotype primer pair and probe–making four separate reac-
tions for the isolated and purified RNAs for each clinical specimen. The reagent master mix
was prepared according to the number of reactions required for each test run using the
AgPath-ID One-Step RT-PCR kit (#AM1005, Thermo Fisher Scientific, NY, USA). Then a
final addition of 5μl of individual RNA to each appropriately labeled well. Included in each test
run were ‘no RNA’ or nuclease-free water reagent and Dengue positive RNA control. A pre-
sumptive positive for Dengue serotype specific virus was considered for a clinical specimen
when the controls met stated requirements and the growth curves crossed the threshold line
within 40 cycles with the inverse true for negatively considered clinical specimens for Dengue
serotype specific virus.
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 3 / 14
Dengue fever virus in suspected Ebola patients in Ghana
Conventional RT-PCR
In all, four conventional RT-PCR assays were performed and, in each test, run a volume of 25 μl
with 5 μl nucleic acid extract was used as a template. The reagents, cycle numbers, primer
sequences, target regions and amplicon lengths are shown in Table 1. The four conventional
RT-PCR assays were performed using the Aeris G-96 well PCR system (Esco Micro Pte Ltd, Sin-
gapore). The amplification products were electrophoresed on a 2% Agarose gel (peqlab Biotech-
nologie, Erlangen, Germany), stained with Ethidium bromide, and viewed under UV light.
Sequencing and phylogenetic analysis
The conventional RT-PCR products were sequenced and were assembled using the DNAS-
TAR’s Lasergene sequence analysis software with base calling proofread by graphic examina-
tion of the electropherograms. Phylogenetic trees were constructed based on 511 nucleotides
of the capsid (pre-membrane) and the 266 nucleotides of the non-structural protein target
genomic regions target genes and the analysis included the amplified samples from the con-
ventional RT-PCR as well as GenBank reference sequences of 34 and 37 respectively (Table 2).
The reference sequences were selected from representatives of the four DENV serotypes as
Table 1. Dengue virus primers and RT-PCR assays used.
Primer Name Reagents Cycles Sequences (5’-3’) Target gene Genome position/ Amplicon Reference
Length
Real-time PCR
DENV-1
DEN-1 AgPath-ID One-Step RT-PCR 45 CAAAAGGAAGTCGTGCAATA Envelope 8973 [13]
Forward Reagents
DEN-1 Reverse CTGAGTGAATTCTCTCTACTGAACC 9084
DEN-1 Probe CATGTGGTTGGGAGCACGC 8998
DENV-2
DEN-2 AgPath-ID One-Step RT-PCR 45 CAGGTTATGGCACTGTCACGAT Envelope 1605 [13]
Forward Reagents
DEN-2 Reverse CCATCTGCAGCAACACCATCTC 1583
DEN-2 Probe CTCTCCGAGAACAGGCCTCGACTTCAA 1008
DENV-3
DEN-3 AgPath-ID One-Step RT-PCR 45 GGACTGGACACACGCACTCA Envelope 740 [13]
Forward Reagents
DEN-3 Reverse CATGTCTCTACCTTCTCGACTTGTCT 813
DEN-3 Probe ACCTGGATGTCGGCTGAAGGAGCTTG 762
DENV-4
DEN-4 AgPath-IDOne-Step RT-PCR 45 TTGTCCTAATGATGCTGGTCG Envelope 904 [13]
Forward Reagents
DEN-4 Reverse TCCACCTGAGACTCCTTCCA 992
DEN-4 Probe TTCCTACTCCTACGCATCGCATTCCG 960
Conventional PCR
DUC QIAGEN OneStep RT-PCR Kit 45 TCAATATGCTGAAACGCGCGAGAAACCG Envelope 511 [6]
DUS TTGCACCAACAGTCAATGTCTTCAGGTTC Envelope
NS5F1 QIAGEN OneStep RT-PCR Kit 45 AGYGGAGTRGAAGGRGAAGG Non-structural 5 917 [46]
NS5F2 AGCATGTCTTCXGTXTCATCCA
FU1 QIAGEN OneStep RT-PCR Kit 45 TACAACATGATGGGAAAGAGAGAGAA Non-structural 5 266 [47]
cFD2 GTGTCCCAGCCGGCGGTGTCATCAGC
FU2 QIAGEN OneStep RT-PCR Kit 45 GCTGATGACACCGCCGGCTGGGACAC Non-structural 5 845 [47]
cFD3 AGCATGTCTTCCGTGGTCATCCA
https://doi.org/10.1371/journal.pone.0208907.t001
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 4 / 14
Dengue fever virus in suspected Ebola patients in Ghana
Table 2. A list of reference strains of DENV from the GenBank with their accession numbers, year isolated/detected and the location.
Strain Serotype Location Year GenBank accession no.
TB55i 3 Indonesia 2004 AY858048
TB16 3 Indonesia 2004 AY858047
MKS-WS79b 3 Indonesia 2010 KC762693
98902890 DF DV-3 3 Indonesia 1998 AB189128
Singapore 8120/95 3 Singapore 2004 AY766104
D3/SG/05K4648DK1/2005 3 Singapore 2005 EU081225
DENV3-632 3 Philippines 2008 KU509279
VIROAF7 3 Philippines 1964 KM190937
PhMH-J1-97 3 Philippines 1997 AY496879
KDH0010A 3 Thailand 2010 HG316483
ThD3 0007 87 3 Thailand 1987 AY676353
Pythium 3 Thailand 2014 KT424097
DENV-3/WS/BID-V2973/1995 3 Samoa 1995 FJ898456
DENV-3/IND/663381/1966 3 India 1966 JQ922555
Rajasthan.India/DMRC/Balotra87/2013 3 India 2013 KU216208
ND143 3 India 2007 FJ644564
UNC3001 3 Sri Lanka 1989 JQ411814
DENV-3/LK/BID-V2414/1985 3 Sri Lanka 1985 FJ882574
D3/H/IMTSSA-SR/2000/1266 3 Sri Lanka 2000 NC_001475
DENV-3/PR/BID-V2116/2001 3 Puerto Rico 2001 KF955468
DENV-3/PR/BID-V2102/2000 3 Puerto Rico 2000 KF955466
DENV-3/PR/BID-V1728/2006 3 Puerto Rico 2006 KF955456
BR74886/02 3 Brazil 2004 AY679147
DNV-3/BR/BID-V3609/2007 3 Brazil 2007 GU131877
DENV3/BR/D3LIMHO/2006 3 Brazil 2006 JN697379
DENV3-3140 3 Senegal 2009 KU509282
MKS-0077 1 Indonesia 2007 KC762654.1
DENV-1/PH/BID-V2940/2004 1 Philippines 2004 GQ868602
16681 2 Thailand 1964 NC_001474
7869191/BF/2016 2 Burkina Faso 2016 KY627762
UOH_23916 4 India 2015 KX845005
BR005AM_2011 4 Brazil 2011 KT794007
https://doi.org/10.1371/journal.pone.0208907.t002
well as closely related sequences to the query. Phylogenies were inferred by the maximum like-
lihood method and conducted in MEGA 7 [14]. It was drawn to scale, with branch lengths in
the same units as those of the evolutionary distances used.
Statistical analysis
Analysis of quantitative variables were done with non-parametric statistics and statistical tests
after data entered in Excel was cleaned. Appropriate measures of central tendency for mean,
median, frequency distributions, percentages, and standard deviation were calculated.
Accession numbers
The sequences of the amplified samples by conventional RT-PCR with two target regions of
the capsid and the non-structural 5 gene segments yielded five sequences which were
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 5 / 14
Dengue fever virus in suspected Ebola patients in Ghana
Fig 1. Map of Ghana showing place of origin of samples. Map shows the different parts of the country where samples
were collected. The symbol star shows where the four DENV positive samples were taken.
https://doi.org/10.1371/journal.pone.0208907.g001
submitted to the DNA Data Bank of Japan (DDBJ) and assigned the accession numbers
LC379220—LC379224.
Results
ELISA and NS1 serological detection
The number of archived clinical specimens tested was from 150 patients and collected between
the years 2014–2016 from all over the country (Fig 1). Anti-DENV IgM was detected in 32
samples while ant-DENV IgG was detected in 85 samples. Of the 32 anti-DENV IgM positives
tested for NS1 Ag, 4 were detected as positive (IDs 29, 42, 50, 73), Table 3, Fig 2.
PCR assays detection
All 32 patients’ clinical specimens that were found positive by ELISA for anti-DENV IgM anti-
bodies were analyzed by several PCR assays. Using the TaqMan-based rRT-PCR assay, viral
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 6 / 14
Dengue fever virus in suspected Ebola patients in Ghana
Table 3. Summary of results of testing.
Test Performed Number tested Number of Positives (%)
DENV IgG 150 85 (57)
DENV IgM 150 32 (21)
Both DENV IgM and IgG 150 22 (15)
DENV NS1 Antigen 150 4
DENV rRT-PCR 32 4
https://doi.org/10.1371/journal.pone.0208907.t003
RNA was detected in 4 out of the 32 DENV IgM positive samples. They were characterized as
1 DENV-2 (sample ID 29) and 3 DENV-3 (sample IDs 42, 50 and 73) serotypes. Clear DNA
fragments of expected sizes were observed for all but sample 29 when the conventional
RT-PCR assays were performed on the 4 positive samples (Fig 3).
Sequence and phylogenetic analysis
To determine the genotypes and evolution of the viruses present in the positive patients’ sam-
ples, the amplicons from the conventional RT-PCR run were sequenced and subjected to phy-
logenetic analysis. The parsimony analysis by maximum likelihood method [15] and MEGA 7
[1] included the three amplified patient’s samples (42, 50 and 73), as well as GenBank reference
sequences. In both phylogenetic trees, the patient’s samples were closely related to each other
and clustered within DENV serotype 3 and in close homology with sequences from Senegal
(KU509282) and India (FJ544564 and KU216208) (Fig 4A and 4B).
Fig 2. NS1 antigen strips. Immunochromatographic assay for DENV NS1Ag test for real time RT-PCR positive samples (29, 42, 50 and 73). Two samples (22 and 127)
that were negative by real time RT-PCR were included for validation. a. Arrowhead: positive band; b. � indicates the four patient samples found to be positive.
https://doi.org/10.1371/journal.pone.0208907.g002
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 7 / 14
Dengue fever virus in suspected Ebola patients in Ghana
Fig 3. Gel electrophoresis pictures of four positive patient samples by conventional-type RT-PCR using primers
indicated. Gel images after amplification using the following primer set: a) FU1 and cFD2- expected size 266bp b) FU2
and cFD3 –expected size 845bp c) DUC and DUS–expected size 511bp d) NS5F1 and NS5R –expected size 917bp NC–
Negative control PC–Positive control M–molecular ladder.
https://doi.org/10.1371/journal.pone.0208907.g003
Demographics and clinical details
Of the 4 patients in whom DENV RNA was detected, 2 were males and 2 were females with
the age range of 30 to 56years old. Three (IDs 29, 50 and 73) are Ghanaian indigenes residing
in the southern part of Ghana (Accra and Kasoa) and one (ID 42) being a Burkinabe who
sought medical attention across the border between the two countries in Bawku, a town in the
North Eastern part of Ghana. From the clinical characteristics, fever (temperature above 38˚C)
and muscle/joint pains were the most commonly seen in all patients on presentation. Other
observed clinical features included headache, confused or disoriented seizures and unex-
plained bleeding from the gums and nose (Table 4).
Discussion
A decade ago, the global distribution of the risk of DENV infection and its public health bur-
den were poorly known with little information from Africa [5]. However, recent studies and
outbreaks in Burkina Faso and Senegal [16–19] as well as the forces of urbanization and global-
ization have facilitated the emergence of Dengue and other Arboviruses [5] and increased
their surveillance and diagnostic activities in sub-Saharan Africa. This study has therefore
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 8 / 14
Dengue fever virus in suspected Ebola patients in Ghana
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 9 / 14
Dengue fever virus in suspected Ebola patients in Ghana
Fig 4. Phylogenetic trees generated based on the non-structural protein and capsid. Phylogenetic trees were drawn using the maximum
likelihood method a. Using DUC/DUS sequences b. Using FU1/cFD2 sequences.
https://doi.org/10.1371/journal.pone.0208907.g004
added to the body of knowledge and scientific data, the molecular evidence of the presence of
the West African commonly found DENV-2 and DENV-3 serotypes in Ghana. This finding
supports the co-circulation and concurrent infections by multiple DENV serotypes which has
become a frequent occurrence in endemic countries [20,21].
Dengue serotype 2 has been dominant in West Africa [22] and this was given credence with
the recent outbreaks in Burkina Faso and Senegal [17]. In an earlier hospital-based study con-
ducted in a peri-urban area in Ghana, we sought to identify pathogens that cause febrile ill-
nesses among children. Of the 700 enrolled, 2 were found to be acutely infected with DENV-2
when viral RNA was detected using molecular tools [23]. The dominance of Dengue 2 may be
attributed to the prevalence of the strain of the transmissible vector in the sub-region. DENV
serotypes and strains within the serotypes are known to vary in their ability to infect and dis-
seminate in mosquitoes [24,25]. Dengue serotype 2 strains have been demonstrated to be bet-
ter adapted and tend to infect the highly domesticated Ae. aegypti more efficiently [26]. It is
thus considered the principal vector for DENV in urban areas whereas the species Ae. albopic-
tus is recognized as an important vector in some rural areas [27].
The additional detection of DENV-3 and its relative proportion against DENV-2 in our
study makes it a dual or multiple circulation of serotypes. This suggests possibility of concur-
rent serotype infections within the population. With the documented evidence that concurrent
circulation by multiple Dengue serotypes influences clinical expression and accounts for the
emergence of Dengue Hemorrhagic fevers (DHFs) [24], our finding presents a cause for public
health concern in a country where hitherto hospital-based clinical and laboratory-based viro-
logic surveillance system for DENV infection is inadequate. Since 1982 when the first case of
concurrent infections with 2 DENV serotypes was reported in Puerto Rico [28], there have
been documented reports of several concurrent infections in other countries [29, 30] and usu-
ally, though not in all cases, concurrent infections occur during epidemics or outbreaks. Our
study finding of the co-circulating serotypes which also suggests hyperendemicity but without
any apparent clinical or sub-clinical manifestation of DF or DHF may be partly due to the lack
of hospital and laboratory-based surveillance at the time. It could also in part be attributed to
the events at the time (during the peak of the EVD epidemic in West Africa) when the patients
presented to the health facility were paid more attention because of the heightened alert for
EVD suspected cases. Nevertheless, an absence of DHF notwithstanding hyperendemic co-cir-
culating DENV transmission was also observed in a study in Haiti [31].
Table 4. Demographic and clinical characteristics of dengue positive patients.
Patient Gender Age Occupation Nationality Known Dengue Symptoms Rare Dengue Symptoms Outcome
ID (yrs)
29 Male 56 Trader Ghanaian Fever, vomit, nausea and muscle/joint pains None stated Alive
42 Male 30 Farmer Burkinabe Fever, headache, intense fatigue, general weakness, Coma, Unconsciousness Alive
muscle/joint pains, anorexia/loss of appetite, nose and
gum bleeding
50 Female 33 Trader Ghanaian Fever, headache, blood in vomit, muscle/joint pains, None stated Alive
abdominal pains, nose and gum bleeding
73 Female 35 Housewife Ghanaian Fever, vomiting, general weakness, conjunctivitis, Difficulty in breathing, confused Dead
headache, muscle/joint pains, nose and gum bleeding, and disoriented, seizures, collapse
injection site bleeding
https://doi.org/10.1371/journal.pone.0208907.t004
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 10 / 14
Dengue fever virus in suspected Ebola patients in Ghana
The rare clinical features observed with two of the four patients who tested positive for DF
were in confused or disoriented state and unconsciousness. Although these features are usually
not described to define a case of DF/DHF however, our observations are consistent with stud-
ies that have described unusual neurological manifestations of Dengue infection, including
non-specific symptoms to encephalitis and, rarely, Guillain-Barré syndrome [32, 33]. Addi-
tionally, DENV-2 and DENV-3 are recurrently described as the cause of neurological sequelae
[32]. It was worth noting that all the 4 positive patients had high grade fever and muscle/joint
pains as main symptomatology in conformity with the WHO case definition [34] for DF. Fur-
ther to that, 2 of the patients (IDs 50 and 73) had evidence of hemorrhagic manifestations, sug-
gesting cases of DHF [33].
In our study analysis, we performed sequence phylogeny to confirm and establish the sero-
types of the positive patient’s samples as documented reports in the sub-region on the circula-
tion of different DENV serotypes are poor. Few publications however provide information on
outbreaks and serological surveillance studies and reports that documented DENV infection
in travellers. The results confirmed our serotypes as closely related to each other and clustered
within DENV serotype 3 and in close homology with sequences from Senegal (KU509282) and
India (FJ544564 and KU216208). Nonetheless, DENV-2 has been the main serotype reported
to be circulating in West Africa [35] since the case of DENV was detected in Nigeria in 1964
[36]. In the West African countries of Côte d’Ivoire, Burkina Faso and Guinea, DENV-2 was
detected from sylvatic cycles [37–39] and more closely in 2005, DENV-2 was identified in a
traveller who returned from Ghana [40]. Despite this, DENV-3 has been detected severally in
Africa [41, 42] with an instance where analysis suggested the importation of the virus from the
Indian sub-continent [43]. Again, in our neighbouring country Côte d’Ivoire, DENV-3 was
documented to have been co-circulating with Yellow fever [44]. These reports corroborate our
finding of DENV-3 circulation in Ghana which has been noted to be consistent with evidence
that this serotype is spreading in the sub-region [45].
In conclusion, we report the detection of 2 different serotypes of DENV circulating among
patients suspected of EVD in Ghana. This makes for a public health interest on local DF bur-
den and epidemiology and offers the platform to improve surveillance, laboratory testing
capacity and clinical alertness in the health delivery system within the country and the sub-
region.
Acknowledgments
Our gratitude goes to the Ghana Health Service for the permission granted for the use of the
clinical specimens, the health staff and facilities across the country who and where these speci-
mens were collected and submitted for testing and the VHF team at the Virology Department
at Noguchi Memorial Institute for Medical Research.
Author Contributions
Conceptualization: Joseph Humphrey Kofi Bonney.
Data curation: Esinam Agbosu, Deborah Pratt, Stephen Nyarko, Eiji Ido, Badu Sarkodie.
Formal analysis: Esinam Agbosu, Deborah Pratt, Stephen Nyarko, Eiji Ido, Shoji Yamaoka.
Funding acquisition: Nobuo Ohta, Shoji Yamaoka.
Investigation: Joseph Humphrey Kofi Bonney, Samuel Dadzie, Esinam Agbosu, Deborah
Pratt, Franklin Asiedu-Bekoe, Badu Sarkodie.
Methodology: Franklin Asiedu-Bekoe, Badu Sarkodie.
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 11 / 14
Dengue fever virus in suspected Ebola patients in Ghana
Project administration: Shoji Yamaoka.
Resources: Eiji Ido, Nobuo Ohta, Shoji Yamaoka.
Supervision: Joseph Humphrey Kofi Bonney, Takaya Hayashi, Samuel Dadzie, Eiji Ido.
Validation: Franklin Asiedu-Bekoe, Badu Sarkodie, Shoji Yamaoka.
Writing – original draft: Joseph Humphrey Kofi Bonney.
Writing – review & editing: Takaya Hayashi, Samuel Dadzie, Esinam Agbosu, Deborah Pratt,
Stephen Nyarko, Franklin Asiedu-Bekoe, Eiji Ido, Badu Sarkodie, Nobuo Ohta, Shoji
Yamaoka.
References
1. Centers for Disease Control and Prevention, National Center for Emerging and Zoonotic Infectious Dis-
eases (NCEZID), Division of High-Consequence Pathogens and Pathology (DHCPP), Viral Special
Pathogens Branch (VSPB). January 29, 2015. Available from: https://www.cdc.gov/vhf/index.html
2. World Health Organization. Ebola and Marburg virus disease epidemics: preparedness, alert, control,
and evaluation. Geneva (CH): World Health Organization; 2014. p. 12. Report no.: INTERIM version
1.2.
3. Global alert and response–impact of dengue. Accessed July 27, 20115. Available from: http://www.
who.int/csr/disease/dengue/impact/en/
4. Simmons CP, Farrar JJ, van Vinh Chau N, Wills B. Dengue. N. Engl. J. Med. 366, 1423–1432 (2012).
https://doi.org/10.1056/NEJMra1110265 PMID: 22494122
5. Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and
burden of dengue. Nature. 2013 Apr 25; 496(7446): 504–507. https://doi.org/10.1038/nature12060
PMID: 23563266
6. Lanciotti RS, Calisher CH, Gubler DJ, Chang GJ, Vorndam AV. Rapid detection and typing of dengue
viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. Journal of Clini-
cal Microbiology. 1992; vol. 30, no. 3, pp. 545–551. PMID: 1372617
7. Gubler DJ. Epidemic dengue: dengue hemorrhagic fever as a public health, social and economic prob-
lem in the 21st century. Trends Microbiol 2002; 10:100–103. PMID: 11827812
8. Alan L, Schmal J, McClain D. Alphaviruses (Togaviridae) and Flaviviruses (Flaviviridae). Book chap.,
54, Medical Microbiology. 4th edition. Baron S, editor. Galveston (TX): University of Texas Medical
Branch at Galveston; 1996.
9. Natasha E, Murray A, Quam MB. Epidemiology of dengue: past, present and future prospects. Clin Epi-
demiol. 2013; 5: 299–309. https://doi.org/10.2147/CLEP.S34440 PMID: 23990732
10. Terzian ACB, Mondini A, Vieira R. Detection of Saint Louis Encephalitis Virus in Dengue-Suspected
cases during a Dengue 3 outbreak. Vector Borne and Zoonotic Diseases, 2011; Vol. 11, Number 3.
11. Roca A, Afolabi MO, Saidu Y, Kampmann B. Ebola: A holistic approach is required to achieve effective
management and control. J Allergy Clin Immunol. 2015 Apr; 135(4): 856–867. https://doi.org/10.1016/j.
jaci.2015.02.015 PMID: 25843598
12. World health Organization: Accessed May 2016. Available from: http://www.who.int/csr/resources/
publications/ebola/case-definition/en/
13. Johnson BW, Russell BJ, Lanciotti RS. Serotype-Specific Detection of Dengue Viruses in a Fourplex
Real-Time Reverse Transcriptase PCR Assay. Journal of Clinical Microbiology. 2005; 43(10):4977–
4983. https://doi.org/10.1128/JCM.43.10.4977-4983.2005 PMID: 16207951
14. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0. 2015.
Molecular Biology and Evolution
15. Saitou N, Nei M. The Neighbor-Joining Method-a New Method for Reconstructing Phylogenetic Trees.
Mol Biol Evol 4: 406–425. https://doi.org/10.1093/oxfordjournals.molbev.a040454 PMID: 3447015
16. Stoler J, Delimini RK, Bonney JHK, Oduro AR, Owusu-Agyei S, Fobil JN, et al. Evidence of Recent Den-
gue Exposure among Malaria Parasite-Positive Children in Three Urban Centers in Ghana; Am. J.
Trop. Med. Hyg., 92(3), 2015, pp. 497–500 https://doi.org/10.4269/ajtmh.14-0678 PMID: 25582693
17. Weekly Bulletin on Outbreak and other Emergencies: Week 44: 28 October–03 November, World
Health Organization (WHO) Regional office for Africa, WHO Health Emergencies Program
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 12 / 14
Dengue fever virus in suspected Ebola patients in Ghana
18. Stoler J, al Dashtib R, Anto F. Deconstructing “malaria”: West Africa as the next front for dengue fever
surveillance and control, Acta Tropica. 2014; 134, 58–65. https://doi.org/10.1016/j.actatropica.2014.02.
017 PMID: 24613157
19. WHO: Dengue/dengue hemorrhagic fever. Weekly Epidemiol Rec 2000, 75:193–196.
20. Wilder-Smith A, Yoksan S, Earnest A. Serological evidence for the co-circulation of multiple dengue
virus serotypes in Singapore; Epidemiol. Infect. 2005; 133, 667–671. f 2005 Cambridge University
Press https://doi.org/10.1017/S0950268805003821 PMID: 16050512
21. Loron˜ O-Pino MA, Cropp CB, Farfa JA, Vorndam V. Common Occurrence of Concurrent Infections by
Multiple Dengue Virus Serotypes; Am. J. Trop. Med. Hyg., 61(5), 1999, pp. 725–730 Copyright q 1999
by The American Society of Tropical Medicine and Hygiene PMID: 10586902
22. Cordellier R, Bouchite B, Roche JC, Monteny N, Diaco B, Akoliba P. Circulation silvatique du virus den-
gue 2 en 1980, dans les savannes sub-soudaniennes du Cote d’Ivoire. Cah ORSTOM Ser Entomol
Med Parasitol 1983; 21:165–179
23. Amoako N, Duodu S, Dennis FE, Bonney JHK, Asante KP, Ameh J, et al. Dengue virus serotype 2
detected in febrile children in a peri-urban area of Accra, Ghana using a multiple-pathogen assay.
Emerg Infect Dis. 2018; 24(8):1544–1547. https://doi.org/10.3201/eid2408.180341 PMID: 30015610
24. Gubler DJ, Nalim S, Tan R, Saipan H, Sulianti Saroso J. Variation in susceptibility to oral infection with
dengue viruses among geographic strains of Aedes aegypti. Am J Trop Med Hyg 1979; 28:1045–1052.
[PubMed: PMID: 507282]
25. Rosen L, Roseboom LE, Gubler DJ, Lien JC, Chaniotis BN. Comparative susceptibility of mosquito spe-
cies and strains to oral and parenteral infection with dengue and Japanese encephalitis viruses. Am J
Trop Med Hyg 1985; 34:603–615. [PubMed: PMID: 2860816]
26. Armstrong PM, Rico-Hesse R. Differential susceptibility of Aedes aegypti to infection by the American
and Southeast Asian genotypes of dengue type 2 virus. Vector Borne Zoonotic Dis 2001; 1:159–168.
[PubMed: https://doi.org/10.1089/153036601316977769 PMID: 12680353
27. Higa Y. Dengue Vectors and their Spatial Distribution. Tropical Medicine and Health. 2011; 39(4
Suppl):17–27. https://doi.org/10.2149/tmh.2011-S04 PMID: 22500133
28. De Carvalho Araujo FM, Nogueira RMR, De Araujo JMV, Ramalho ILC, De Sa Roriz MLF, De Melo
MEL, Coelho ICB. Concurrent infection with dengue virus type-2 and DENV-3 in a patient from Ceara,
Brazil. Memorias do Instituto Oswaldo Cruz 2006; 101:925–8. PMID: 17293990
29. Laille M, Deubel V, Sinte-Marie FF. Demonstration of concurrent dengue 1 and dengue 3 infection in six
patients by the polymerase chain reaction. Journal of Medical Virology 1991; 34:51–4. PMID: 1885943
30. Maneekarn N, Morita K, Tanaka M, Igarashi A, Usawattanakul W, Sirisanthana V, Innis BL, Sittisombut
N, Nisalak A, Nimmanitya S. Applications of polymerase chain reaction for identification of dengue
viruses isolated from patient sera. Microbiology and Immunology 1993; 37:41–7. PMID: 8474356
31. Halstead SB, Streit TG, Lafontant JG, Putvatana R, Russell K, Sun W, et al. Haiti: absence of dengue
hemorrhagic fever despite hyperendemic dengue virus transmission. Am J Trop Med Hyg 2001; 65:
180–183. PMID: 11561700
32. Soares CN, Faria LC, Peralta JM, de Freitas MR, Puccioni Sohler M. Dengue infection: neurological
manifestations and cerebrospinal fluid (CSF) analysis. Journal of the Neurological Sciences. 2006;
249, 19–24. https://doi.org/10.1016/j.jns.2006.05.068 PMID: 16870213
33. Lum LC, Lam SK, Choy YS, George R, Harun F. Dengue encephalitis: a true entity? Am Trop Med Hyg
1996; 54(3):256–9.
34. Centers for Disease Control and Prevention (US CDC), National Center for Emerging and Zoonotic
Infectious Diseases (NCEZID), Division of Vector-Borne Diseases (DVBD). Accessed March 2, 2018.
Available from: https://www.cdc.gov/dengue/clinicallab/casedef.html
35. Sang RC. Dengue in Africa. Nairobi, Kenya, Arbovirology/Viral Haemorrhagic Fever Laboratory, Centre
for Virus Research, Kenya Medical Research Institute, 2007. Accessed October 21, 2009. Available
from: http://www.tropika.net/review/061001-Dengue_in_Africa/article.pdf.
36. Carey DE, Causey OR, Reddy S, Cooke AR. Dengue viruses from febrile patients in Nigeria,1964–68.
Lancet. 1971; 1(7690):105–6. PMID: 4099602
37. Vasilakis N, Holmes EC, Fokan EB, Faye O, Diallo M, Sall AA, et al. Evolutionary process among syl-
vatic dengue type 2 viruses. J. Virol. 2007; 81(17):9591–5 https://doi.org/10.1128/JVI.02776-06 PMID:
17553878
38. Zeller HG, Traoré-Lamizana M, Monlun E, Hervy JP, Mondo M, Digoutte JP. Dengue-2 virus isolation
from humans during an epizootic in southeastern Senegal in November 1990. Res Virol. 1992; 143
(2):101–2. PMID: 1594790
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 13 / 14
Dengue fever virus in suspected Ebola patients in Ghana
39. Diallo M, Ba Y, Sall AA, Diop OM, Ndione JA, Mondo M, et al. Amplification of the sylvatic cycle of den-
gue virus type 2, Senegal, 1999–2000: Entomologic findings and epidemiologic considerations. Emerg
Infect Dis. 2003; 9(3):362–7. https://doi.org/10.3201/eid0903.020219 PMID: 12643833
40. Huhtamo E, Uzcátegui N, Siikamäki H, Saarinen A, Piiparinen H, Vaheri A, et al. Molecular epidemiol-
ogy of dengue virus strains from Finnish Travelers. Emerg Infect Dis. 2008; 14(1):80–3. https://doi.org/
10.3201/eid1401.070865 PMID: 18258084
41. Gubler DJ, Sather GE, Kuno G, Cabral JR. Dengue 3 virus transmission in Africa. Am J Trop Med Hyg.
1986; 35:1280–4. PMID: 3789276
42. Sharp TW, Wallace MR, Hayes CG, Sanchez JL, DeFraites RF, Arthur RR, et al. Dengue fever in US
troops during Operation Restore Hope, Somalia, 1992–1993. Am J Trop Med Hyg. 1995; 53:89–94.
PMID: 7625541
43. Messer WB, Gubler DJ, Harris E, Sivananthan K, De Silva AM. Emergence and global spread of den-
gue serotype 3, Subtype III virus. Emerg Infec Dis. 2003; 9(7):800–9.
44. Dengue in Africa: emergence of DENV-3 Cote d’Ivoire, 2008. [No authors listed]. WHO Wkly Epidemiol
Rec.2009; 84(11–12):85–8. Article in English, French.
45. Franco L, Di Caro A, Carletti F, Vapalahti O, Renaudat C, Zeller H, Tenorio A. Recent expansion of den-
gue virus serotype 3 in West Africa. Eurosurveillance. 2010; Volume 15, Issue 7
46. Kekenhi project. Available from: https://kaken.nii.ac.jp/en/file/KAKENHI-PROJECT-25670267/
25670267seika.pdf
47. Kuno G, Chang G-JJ, Tsuchiya KR, Karabatsos N, Cropp CB. Phylogeny of the Genus Flavivirus. J
Virol 1998; 72(1);73–83 PMID: 9420202
PLOS ONE | https://doi.org/10.1371/journal.pone.0208907 December 19, 2018 14 / 14