U N t V C R S i r v O f 0 « A « * UflAAIIV U N IV ER SITY O F GHANA T H E B A L M E L IB R A R Y B A L M E L IB R A R Y TH E SE S 1. Balm e Library theses are available for consultation in the Library They are not norm ally available for loan, and they are never lent to individuals. 2. All w ho consult a thesis must not copy or quote from it without the consent o f the author and o f this University. 3. A ny copying or quotation perm itted should be duly acknowledged. QR414.Ag9 bite C.l G364680 THE BALME LIBRARY 3 0 6 9 2 1 0 0 2 8 0 7 2 4 University of Ghana http://ugspace.ug.edu.gh U N t V C R S i r v O f 0 « A « * UflAAIIV U N IV ER SITY O F GHANA T H E B A L M E L IB R A R Y B A L M E L IB R A R Y TH E SE S 1. Balm e Library theses are available for consultation in the Library They are not norm ally available for loan, and they are never lent to individuals. 2. All w ho consult a thesis must not copy or quote from it without the consent o f the author and o f this University. 3. A ny copying or quotation perm itted should be duly acknowledged. QR414.Ag9 bite C.l G364680 THE BALME LIBRARY 3 0 6 9 2 1 0 0 2 8 0 7 2 4 University of Ghana http://ugspace.ug.edu.gh INCIDENCE AND MOLECULAR CHARACTERIZATION OF NEONATAL HUMAN ROTAVIRUS STRAINS IN ACCRA. A THESIS SUBMITTED BY AKWASI AGYEMAN TO THE DEPARTMENT OF BIOCHEMISTRY, UNIVERSITY OF GHANA IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE AWARD OF MASTER OF PHILOSOPHY (MPHIL) DEGREE. SEPTEMBER, 2000. University of Ghana http://ugspace.ug.edu.gh INCIDENCE AND MOLECULAR CHARACTERIZATION OF NEONATAL HUMAN ROTAVIRUS STRAINS IN ACCRA. A THESIS SUBMITTED BY AKWASI AGYEMAN TO THE DEPARTMENT OF BIOCHEMISTRY, UNIVERSITY OF GHANA IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE AWARD OF MASTER OF PHILOSOPHY (MPHIL) DEGREE. SEPTEMBER, 2000. University of Ghana http://ugspace.ug.edu.gh I certify that the work described in this research report was carried out by me at the Electron Microscopy Unit, Noguchi Memorial Institute for Medical Research and the Biochemistry Department o f the University of Ghana, Legon under the supervision of Dr. G. E. Armah and Dr. J. P. Adjimani. DECLARATION Akwasi Agyeman Date • Student Dr. G. E. Armah Dr. J. P. Adjimani jtyti—yc-k — Date— -— ----- i/ Supervisor rV f^ O C P k C ir* ate---- Supervisor University of Ghana http://ugspace.ug.edu.gh I certify that the work described in this research report was carried out by me at the Electron Microscopy Unit, Noguchi Memorial Institute for Medical Research and the Biochemistry Department o f the University of Ghana, Legon under the supervision of Dr. G. E. Armah and Dr. J. P. Adjimani. DECLARATION Akwasi Agyeman Date • Student Dr. G. E. Armah Dr. J. P. Adjimani jtyti—yc-k — Date— -— ----- i/ Supervisor rV f^ O C P k C ir* ate---- Supervisor University of Ghana http://ugspace.ug.edu.gh / U Z M M & \ ^ \ V f y 6 ! L i t e c . | University of Ghana http://ugspace.ug.edu.gh / U Z M M & \ ^ \ V f y 6 ! L i t e c . | University of Ghana http://ugspace.ug.edu.gh To the memory of my late father Nana Akwasi Agyeman and to my mother Akua Benewaah. To my siblings, Konadu, Bonsu, Dwomoh, Badu, Tutu, Oheneafrewo and Saah DEDICATION 11 University of Ghana http://ugspace.ug.edu.gh To the memory of my late father Nana Akwasi Agyeman and to my mother Akua Benewaah. To my siblings, Konadu, Bonsu, Dwomoh, Badu, Tutu, Oheneafrewo and Saah DEDICATION 11 University of Ghana http://ugspace.ug.edu.gh My sincere thanks and gratitude go to God Almighty for his protection and guidance for me throughout my graduate program. I wish to acknowledge my indebtedness to my supervisors, Dr. J. P. Adjimani of the Department o f Biochemistry and Dr. G. E. Armah of the Noguchi Memorial Institute for Medical Research (N. M. I. M. R), whose keen interest, immense and valuable contributions, selfless devotion, very useful suggestions and criticisms in no small way helped me in the completion of this thesis. I would also like to thank all the lecturers at the Biochemistry Department especially Mr. Christian Clement for their tremendous assistance. To my colleagues, Ernest, Castro, Sefah, Kenneth, Bridgette, Manager, Wedzi and Kwabena, I say a big thank you for your encouragement and moral support especially during the hard times. My heartfelt appreciation goes to Messrs Dodoo, Ayim, Asmah, Odoi and Sister Suzie, all of the electron microscopy unit of the Noguchi Memorial Institute for Medical Research for the co-operation, love and contributions they offered during the period My appreciation also goes to the management of the Noguchi Memorial Institute for Medical Research for allowing me to use their laboratory and facilities. Sincere appreciation is also expressed to all the technical staff of the Biochemistry ACKNOWLEDGEMENTS University of Ghana http://ugspace.ug.edu.gh My sincere thanks and gratitude go to God Almighty for his protection and guidance for me throughout my graduate program. I wish to acknowledge my indebtedness to my supervisors, Dr. J. P. Adjimani of the Department o f Biochemistry and Dr. G. E. Armah of the Noguchi Memorial Institute for Medical Research (N. M. I. M. R), whose keen interest, immense and valuable contributions, selfless devotion, very useful suggestions and criticisms in no small way helped me in the completion of this thesis. I would also like to thank all the lecturers at the Biochemistry Department especially Mr. Christian Clement for their tremendous assistance. To my colleagues, Ernest, Castro, Sefah, Kenneth, Bridgette, Manager, Wedzi and Kwabena, I say a big thank you for your encouragement and moral support especially during the hard times. My heartfelt appreciation goes to Messrs Dodoo, Ayim, Asmah, Odoi and Sister Suzie, all of the electron microscopy unit of the Noguchi Memorial Institute for Medical Research for the co-operation, love and contributions they offered during the period My appreciation also goes to the management of the Noguchi Memorial Institute for Medical Research for allowing me to use their laboratory and facilities. Sincere appreciation is also expressed to all the technical staff of the Biochemistry ACKNOWLEDGEMENTS University of Ghana http://ugspace.ug.edu.gh Department headed by Mr. Bosompem for the support given me. Also deserving special thanks are the members o f staff especially, Sister Nyame of the Babies unit of the Korle-Bu teaching hospital for their support during the collection of the samples. To all my friends and all those whose names were not mentioned but who helped in diverse ways towards the completion of this work, I say thank you and God bless you all. Finally, to members of my wonderful family, from whom my attention and services were withdrawn in order to have a complete concentration on this work, I would like to say that I appreciate your love, understanding and care. University of Ghana http://ugspace.ug.edu.gh Department headed by Mr. Bosompem for the support given me. Also deserving special thanks are the members o f staff especially, Sister Nyame of the Babies unit of the Korle-Bu teaching hospital for their support during the collection of the samples. To all my friends and all those whose names were not mentioned but who helped in diverse ways towards the completion of this work, I say thank you and God bless you all. Finally, to members of my wonderful family, from whom my attention and services were withdrawn in order to have a complete concentration on this work, I would like to say that I appreciate your love, understanding and care. University of Ghana http://ugspace.ug.edu.gh DECLARATION............................................................................................................................................. 1 DEDICATION................................................................................................................................................ 11 ACKNOWLEDGEMENTS.......................................................................................................................m TABLE OF CONTENTS............................................................................................................................. v LIST OF FIGURES...................................................................................................................................VII LIST OF TABLES................................................................................................................................... VIII LIST OF ABBREVIATIONS...................................................................................................................IX ABSTRACT.............................................................. X CHAPTER ONE .............................................................................................................................................1 GENERAL INTRODUCTION AND LITERATURE REVIEW........................................................ 1 Replication o fHRV ..................................................................................................................................9 Pathogenesis o f HR V............................................................................................................................. 10 Epidemiology o f Rotavirus Infection...................................................................................................12 Factors Implicated in Attenuation o f Rotavirus Infections in the New-borns.............................14 Host Factors....................................................................................................................................... 14 Role ofBreast-Feeding in Prevention o f Rotavirus Infection........................................................ 16 Classification o f Human Rotavirus.....................................................................................................17 Non Group A Human Rotaviruses.......................................................................................................21 Prevalence o f HRV P and G Types (o f Rotaviruses) in Infected Infants.....................................25 Genetic Variation in Rotavirus........................................................................................................... 28 Neonatal Rotavirus Infection...............................................................................................................30 Genotype Associated with Neonatal Rotavirus Infection................................................................30 Justification fo r the work ..................................................................................................................... 34 CHAPTER TWO ......................................................................................................................................... 35 MATERIALS AND METHODS.............................................................................................................35 Materials/Reagents................................................................................................................................35 M ethods ................................................................................................................................................. 36 Study Area:..............................................................................................................................................36 Detection o f Rotavirus in stools.......................................................................................................... 36 Characterisation by Polyacrylamide Gel Electrophoresis.............................................................37 RNA Extraction fo r PAGE: ..............................................................................................................37 Silver staining o f page gels:............................................................................................................ 38 Genotyping o f Rotavirus.......................................................................................................................39 (i) RNA Extraction fo r PCR:........................................................................................................ 39 TABLE OF CONTENTS University of Ghana http://ugspace.ug.edu.gh DECLARATION............................................................................................................................................. 1 DEDICATION................................................................................................................................................ 11 ACKNOWLEDGEMENTS.......................................................................................................................m TABLE OF CONTENTS............................................................................................................................. v LIST OF FIGURES...................................................................................................................................VII LIST OF TABLES................................................................................................................................... VIII LIST OF ABBREVIATIONS...................................................................................................................IX ABSTRACT.............................................................. X CHAPTER ONE .............................................................................................................................................1 GENERAL INTRODUCTION AND LITERATURE REVIEW........................................................ 1 Replication o fHRV ..................................................................................................................................9 Pathogenesis o f HR V............................................................................................................................. 10 Epidemiology o f Rotavirus Infection...................................................................................................12 Factors Implicated in Attenuation o f Rotavirus Infections in the New-borns.............................14 Host Factors....................................................................................................................................... 14 Role ofBreast-Feeding in Prevention o f Rotavirus Infection........................................................ 16 Classification o f Human Rotavirus.....................................................................................................17 Non Group A Human Rotaviruses.......................................................................................................21 Prevalence o f HRV P and G Types (o f Rotaviruses) in Infected Infants.....................................25 Genetic Variation in Rotavirus........................................................................................................... 28 Neonatal Rotavirus Infection...............................................................................................................30 Genotype Associated with Neonatal Rotavirus Infection................................................................30 Justification fo r the work ..................................................................................................................... 34 CHAPTER TWO ......................................................................................................................................... 35 MATERIALS AND METHODS.............................................................................................................35 Materials/Reagents................................................................................................................................35 M ethods ................................................................................................................................................. 36 Study Area:..............................................................................................................................................36 Detection o f Rotavirus in stools.......................................................................................................... 36 Characterisation by Polyacrylamide Gel Electrophoresis.............................................................37 RNA Extraction fo r PAGE: ..............................................................................................................37 Silver staining o f page gels:............................................................................................................ 38 Genotyping o f Rotavirus.......................................................................................................................39 (i) RNA Extraction fo r PCR:........................................................................................................ 39 TABLE OF CONTENTS University of Ghana http://ugspace.ug.edu.gh (ii) Reverse Transcription to Generate cDNA:............................................................................ 39 (iii) Genotyping:.................................................................................................................................40 (b) P-typing ....................................................................................................................................... 42 CHAPTER THREE..................................................................................................................................... 44 R esu lts ....................................................................................................................................................44 PAGE........................................................................................................................................................44 G and P characterization......................................................................................................................46 CHAPTER FOUR........................................................................................................................................ 52 DISCUSSION AND CONCLUSION.....................................................................................................52 Discussion...............................................................................................................................................52 Summary o f conclusion.........................................................................................................................56 REFERENCES:............................................................................................................................................58 APPENDICES...............................................................................................................................................77 APPENDIX 1...............................................................................................................................................77 Reagents fo r PAGE ................................................................................................................................77 (x) Reagents fo r loading o f samples: .............................................................................................79 Autoclaved......................................................................................................................................... 79 (xi) Reagents fo r casting o f g e ls .................................................................................................... 79 1000ml o f distilled water.................................................................................................................80 Reagents fo r silver staining:........................................................................................................... 80 APPENDIX II .............................................................................................................................................82 Reagents fo r ELISA............................................................................................................................... 82 APPENDIX III........................................................................................................................................... 83 Reagents fo r RT-PCR............................................................................................................................83 Reagents fo r the Extraction process..............................................................................................83 APPENDIX IV .......................................................................................................................................... 84 Questionaire:......................................................................................................................................... 84 VI University of Ghana http://ugspace.ug.edu.gh (ii) Reverse Transcription to Generate cDNA:............................................................................ 39 (iii) Genotyping:.................................................................................................................................40 (b) P-typing ....................................................................................................................................... 42 CHAPTER THREE..................................................................................................................................... 44 R esu lts ....................................................................................................................................................44 PAGE........................................................................................................................................................44 G and P characterization......................................................................................................................46 CHAPTER FOUR........................................................................................................................................ 52 DISCUSSION AND CONCLUSION.....................................................................................................52 Discussion...............................................................................................................................................52 Summary o f conclusion.........................................................................................................................56 REFERENCES:............................................................................................................................................58 APPENDICES...............................................................................................................................................77 APPENDIX 1...............................................................................................................................................77 Reagents fo r PAGE ................................................................................................................................77 (x) Reagents fo r loading o f samples: .............................................................................................79 Autoclaved......................................................................................................................................... 79 (xi) Reagents fo r casting o f g e ls .................................................................................................... 79 1000ml o f distilled water.................................................................................................................80 Reagents fo r silver staining:........................................................................................................... 80 APPENDIX II .............................................................................................................................................82 Reagents fo r ELISA............................................................................................................................... 82 APPENDIX III........................................................................................................................................... 83 Reagents fo r RT-PCR............................................................................................................................83 Reagents fo r the Extraction process..............................................................................................83 APPENDIX IV .......................................................................................................................................... 84 Questionaire:......................................................................................................................................... 84 VI University of Ghana http://ugspace.ug.edu.gh LIST OF FIGURES Fig. 1: The human rotavirus as seen under the electron microscope............................................ 6 Fig. 2 : Gene coding assignments and the structure o f human roiavirus.......................................8 Fig. 3: Replication cycle o f human rotavirus.................................................................................. 11 Fig. 4: Diagram o f RNA profiles o f human group A rotavirus.................................................. 20 Fig. 5: Rotavirus gene 9 showing locations o f variable regions, PCR primers and expected length o f amplified segments...............................................................................24 Fig. 6: Rotavirus gene 4 showing locations o f variable regions, PCR primers and expected lenghts o f amplified segments............................................................................ 27 Fig. 7: Polyacrylamide gel electrophoretic pattern o f human rotavirus from neonates in Accra................................................................................................................... 48 Fig. 8: Neonatal HRV genotype distribution in Accra from October, 1999-March, 2000....49 Fig. 9: P-typing o f neonatal rotavirus with dsRNA consensus primers, Con3, IT-1, 2T-2, 3T-1, 4T-1 and 5T-1...................................................................................................50 Fig. 10: G-typing o f neonatal rotavirus dsRNA with consensus primers, End9, ABT1, aCT2, aDT4, aDT8 and aFT9.................................................................................51 University of Ghana http://ugspace.ug.edu.gh Table 1: Neonatal Rotavirus infections in Accra according to age....................................... 45 Table 2: Relative frequency o f human rotavirus types identified..........................................46 LIST OF TABLES viii University of Ghana http://ugspace.ug.edu.gh LIST OF ABBREVIATIONS APS - ammonium persulphate TEMED - N, N, N ’ - N - tetramethylethylene diamine Mabs - monoclonal antibodies ELISA - enzyme linked immunosorbent assay SDS-PAGE - sodium dodecyl sulphate polyacrylamide gel electrophoresis RT-PCR - reverse transcription polymerase chain reaction RNA - ribonucleic acid ^M - micromolar ml - millilitre Hi - micromolar Hg - microgram U.V - ultraviolet EDTA - ethylenediamine tetra acetic acid University of Ghana http://ugspace.ug.edu.gh ABSTRACT Specific and sensitive tests for the detection and typing of rotavirus strains are essential for a more assessment of the epidemiology of rotaviral infection in a community. In this study, 200 stool specimens obtained from October, 1999 to March, 2000 from neonates at the Babies Unit of the Korle-Bu teaching and Legon Hospitals were examined. Group A rotavirus was detected in 30% and Non-group A in 2.5% of the samples tested by either enzyme-linked immunosorbent assay (ELISA) for the detection of VP6 antigen and/ or polyacrylamide gel electrophoresis (PAGE) of double-stranded RNA respectively. Reverse transcription-PCR (RT-PCR) was used for the amplification of the VP7:G (1,062 bp) and VP4:P (876 bp) genes. Five positive specimens were positive by PAGE but negative by ELISA. G and P typing was carried out by nested amplification of variable sequences of the VP7 and the VP4 genes with six G- and five P-type-specific primers (multiplex PCR). The observed P and G types were as follows: G2, 57.1%; G3, 7.1%; G9, 10.7%; G2G3, 3.6%; P6, 67.9%; P8, 3.6%; P6P10, 14.3%. 21.4% of G type and 14.3% of P type were nontypeable. The G-P type combination most frequently found was G2P6 (42.9%), which is the most commonly found in neonates worldwide. Unusual strains of the type G3P6, G9P6 accounted for 7.1% and 3.6% respectively while mixed infections with more than one type were found in 17.9% of the samples typed. Samples whose either P and/ or G could be typed accounted for 28.6%. \ University of Ghana http://ugspace.ug.edu.gh CHAPTER ONE GENERAL INTRODUCTION AND LITERATURE REVIEW Diarrhea is the second most common cause of death and morbidity in children in developing countries. It is o f great economic importance, causing millions o f lost working days each year, as well as much discomfort (Bern et al., 1992). Diarrhea is defined as an abnormally frequent discharge o f semisolid or fluid faecal matter from the bowel. It is recognised in humans as one of major disease o f public health concern world wide (WHO., 1990). In poorly developed countries where conditions such as inadequate means of disposal o f human faecal waste, poor personal hygiene and lack o f education exist, the various pathogens that cause diarrheal disease are readily transmitted to young children often resulting in high rates o f morbidity and mortality (Bern et al., 1992). Diarrhea continues to cause a great number o f deaths, with a disproportionately high mortality in infants and young children in developing countries. In many developing countries, a child suffers six to eight episodes of diarrhea per year before the age of 2 (Bern et al., 1994). Most o f the life experience o f these young children are spent suffering from diarrhea (Gurwith et al., 1981). In a majority o f cases, these episodes of diarrhea are mild and do not require a visit to a health care facility. However about 10% o f these diarrheas results in clinical dehydration and 0.5 to 1% culminate in severe life threatening dehydration (Mata el al., 1983). l University of Ghana http://ugspace.ug.edu.gh Studies carried out by Walsh and Warren (1979) estimated that 3 to 5 billion cases of diarrhea occurred in 1978 in Asia, Africa and Latin America resulting in 5 to 10 million deaths. Another estimate which reviewed data from several longitudinal studies in children revealed that 4.6 million diarrheal deaths and 744 million to 1 billion episodes of diarrhea occurred in children less than 5 years o f age in the same regions excluding China (Synder and Merson, 1982). It has been reported further that 3-3.2 million children still die each year from diarrhea (23 deaths per 1000 live births), making diarrhea a major contributor to infant mortality in developing world (Flores et al., 1986). Although there has been a decrease in incidence globally, it is still a major cause o f death in children in Africa. In the impoverished rural communities of Africa, up to 25% of infants aged 6-11 months may suffer from diarrhea in any two week period (Bern el al 1994). Worldwide, it is estimated that each child under five may suffer an average o f 2.6 episodes o f diarrhea per year (Oelsofen et al., 1990). Bacteriological and parasitological advances made during the past century have led to the discovery o f the etiology o f some o f the diarrhea illnesses, but a lot still remains unsolved (Ramachandran et al., 1996). Diarrhea can be caused by a variety of different germs, including bacteria, viruses and parasites. It can also be caused without an infection by food allergies or as a result o f taking medicines such as antibiotics. The vast majority of diarrheal cases are due to acute self-limiting intestinal infection by bacteria and other parasites and are successfully managed at home without recourse to medical care. 2 University of Ghana http://ugspace.ug.edu.gh The symptoms o f bacterial diarrhea are mostly o f the milder forms and in most o f these cases, administration o f a large volume o f water and electrolytes can prevent dehydration and cure the diarrhea. On the other hand, the life threatening forms o f diarrhea requiring hospital visits or stay are caused mostly by viruses. Rotavirus is the single most important viral etiologic agent o f severe and dehydrating diarrhea o f infants and young children world-wide and have been isolated in more than 50% o f cases (Kapikian and Chanock, 1996). They were first observed in the duodenal epithelium o f children with diarrhea by electron microscopy in 1973 by Bishop et al., (1973) and subsequently designated rotavirus (Latin, rota = wheel) because o f its appearance. In various studies conducted in Africa, rotavirus has been shown to be the most common cause o f diarrhea in young children under the age o f five years. Rotavirus infection often occurs at an early age with virus shedding observed in infants under 12 months o f age. Studies in Ghana have also shown the rotavirus to be a very important pathogen of diarrhea in children and to be responsible for over 20% o f diarrhea in children aged 18 months or less peaking after the first year and then declining during the third year o f life (Armah et al., 1994). Infection is highest during the dry and hot seasons with peaks in September and February. 3 University of Ghana http://ugspace.ug.edu.gh Infections with rotavirus are widespread in both developed and developing countries as evidenced by the prevalence o f serum antibodies in approximately 90% o f infants and young children by three years o f age (Kapikian et al., 1996). Although rotavirus infections are known to be transmitted by the faecal-oral route, the extremely high rate of infection in both developed and developing countries, regardless o f sanitary conditions, has led to speculation that respiratory transmission might also occur (Kapikian et al., 1996). For example, it is estimated that: (i) three million infants and young children develop rotavirus diarrhea yearly in the United States o f America; (ii) 82,000 are admitted to the hospital with rotavirus diarrhea and (iii) rotavirus diarrhea causes about 150 deaths (Institute o f Medicine. Prospects o f immunizing against rotavirus infections, 1990). In contrast, the toll o f the rotavirus infection and death is staggering in developing countries. Estimates indicate that each year 18 million cases o f moderately severe or severe rotavirus diarrhea occur in children under five years o f age and that more than 870,000 children in this age group die because o f rotavirus disease (Unicomb et al., 1989). Rotaviruses are members o f the family Reoviridae and are 70nm in diameter, spherical in shape, non-enveloped, and possess a distinctive double-shelled icosahedral outer shell (Fig.l). The virion consists of three shells: the outer shell, the inner capsid and the core (Fig. 2c), which encloses 11 discrete double stranded RNA genes (Fig.2a and 2b). Each o f these genes encodes specific viral proteins, which are either structural or nonstructural. University of Ghana http://ugspace.ug.edu.gh Viral protein (VP) 1, VP2, and VP3 are encoded by gene segments 1, 2, and 3 respectively and are located in the core. Viral protein 6 (encoded by gene segment 6) forms the inner capsid. VP4 (encoded by gene 4) and VP7 (encoded by gene segment 7, 8 or 9 depending on the strain) make up the outer capsid o f the rotavirus particles and are known to induce neutralizing antibodies (Kapikian et al., 1996). 5 University of Ghana http://ugspace.ug.edu.gh University of Ghana http://ugspace.ug.edu.gh VP7 is a glycoprotein (G for glycoprotein and thus G-type) with a molecular weight of 34, 000 which is one of the two major neutralization antigens located on the outer shell. The other outer shell protein VP4 with a molecular weight o f 84, 000 is protease-cleaved, and is hence called a P-protein and thus P-type. It protrudes from the outer surface as 60 spikes, each 10-12nm in length. The product of gene segment 4 (VP4) is a nonglycosylated protein (Arias et al., 1982). Knowledege of the diverse properties of the VP4 has resulted in an increased awareness of the importance of this protein in the biology of rotaviruses. VP4 is the hemagglutinin in many rotavirus strains (Kalica et al., 1983) and probably the cell attachment protein (Ruggeri et al., 1992). Proteolytic cleavage of VP4 to VP5 [molecular weight (Mr) approximately 60 000 (60K)] and VP8 (Mr aproximately 28K) results in enhancement of viral infectivity (Espejo et al., 1981; Estes et al., 1981). Cleavage ofV P4 enhances penetration (but not binding) of virus into cells (Fukuhara et al., 1988). VP4 is also associated with restriction of growth o f certain rotavirus strains in tissue culture cells (Crawford et al., 1994) and with protease-enhanced plaque formation (Kalica et al., 1983). Features of VP4 with potential biologic relevance have been found by analyzing nucleotide and predicted amino acid sequence data (Lopez et al., 1985). Both VP4 and VP7 have blocked NH2-termini, and VP5 is composed of two polypeptide species with slightly different amino acid sequences at their NH2- termini. Comparison of these data with the nucleotide sequence of VP4 identified two trypsin cleavage sites (arginine 241 and arginine 247), with position 247 being the preferred cleavage site (Lopez et al., 1985). 7 University of Ghana http://ugspace.ug.edu.gh 9/% VP7 10 f c S NSP4 VP4 Neutralization antigen V P 6 P antigen NSP1 . Protaln V P 7 Neutralization antigen Subcore Fig. 2: Gene coding assignm ents an d the structu re o f hum an ro tavirus, ‘a ’ represen ts the eleven dsRNA segm ents o f H RV , ‘b ’ sh ow s the trip le layer o f the virus and 1 c ’ show s the pro teins that make up the viral particle and th e ir locations University of Ghana http://ugspace.ug.edu.gh Replication of HRV Rotaviruses infect the small intestine after oral ingestion and spread through the faecal route. Multiplication occurs in the mature epithelial cells at the tip of the villi of the small intestine (Estes, 1996). The initial stages of replication have been examined by biochemical and morphologic (EM) procedures. Only triple-layered particles containing VP4 attach to cells when monitored by EM (Petrie et al., 1981) or by cell binding (Crawford et al., 1994) or infectivity assays (Bridger et al., 1976). Increasing direct evidence indicates that virus attachment occurs through VP4, although early studies reported that VP7 and nonstructural protein (NSP) 2 had cell binding activity (Fukuhara et al., 1988). Initial binding is sodium-dependent, pH insensitive and is dependent on sialic acid residues in the membranes. Virus entry can be receptor-mediated endocytosis or direct penetration. The virus-associated transcriptase is latent in triple-layered particles (full particle) and can be activated in vitro by treatment with a chelating agent or by heat shock treatment (Spencer et al., 1983). Such treatment results in the removal of the outer capsid protein with conversion of the triple-layered particle to double-layered particle (Cohen et al., 1979). Early EM studies suggested that virus entry occurs by endocytosis (Petrie et al., 1981) and that incoming particles are rapidly transported to lysosomes and that uncoating might occur by the effect of lysosomal enzymes (Ludert et al., 1987). The synthesis o f rotaviral transcripts is mediated by an endogenous viral RNA-dependent RNA polymerase (transcriptase) that has a number of enzymatic activities. After removal of the outer capsid, the viral RNA-dependent RNA polymerase is activated, and 9 University of Ghana http://ugspace.ug.edu.gh large numbers of single stranded mRNAs are produced which leave the single-shelled particle via its pores. Transcripts function both to produce proteins and also templates for the production of virus strands. Once the complementary minus strand is synthesized, it remains associated with the plus strand. The dsRNA segments are formed within nascent subviral particles, and free dsRNA or free minus strand ssRNA segments are never found in infected cells. Subviral particles VP1, VP2, VP3 and VP6 form in association with viroplasms, and these particles mature by budding through the membrane of the endoplasmic reticulum. In this process, particles acquire their outer capsid proteins, VP7 and VP4. Cell lysis releases particles from infected cells as shown in Fig. 3. Pathogenesis of HRV The infected duodenal villi cells lyse with increasing necrosis at the villous tips which eventually leads to atrophy and reduction of absorption This is followed by a reactive crypt cell hyperplasia accompanied by an increased secretion, which also contributes to the severity of diarrhea. Viral factors determining pathogenicity of rotaviruses have been investigated in several animal models. The protein product of RNA segment 4, VP4, has been found to be a major pathogenicity determinant in several systems. In addition, the products of other structural genes (VP3, VP7) and also of nonstructural genes (NSP1, NSP2, NSP4) have been implicated (Hoshino et al., 1995). NSP4 has also recently been described as a viral enterotoxin (Ball et al., 1996). Ki University of Ghana http://ugspace.ug.edu.gh Single Shelled f „Particle Lyso som e Viroplasm 4VP1,2,3,6 < NSP2,5 mRNA NSP3 Translation VP1,2,3,4,6,7 NSP1,2,3,5 Envelope Removal Double Shelled Virus Transient Enveloped Particle. Assembly o f S lngle-Shollod Particles NSP Infecting Virus Fig. 3 : R ep lica tion cycle o f hum an ro tav irus (D avid et al., 1995) University of Ghana http://ugspace.ug.edu.gh Clinical Manifestations and Treatment The typical clinical picture o f a child with rotavirus gastro-enteritis is for all practical purposes indistinguishable from diarrhea of other etiology. In general, rotavirus gastroenteritis is commonly associated with fever, vomiting and dehydration than in children with diarrhea due to other etiological agents. In most severe cases the illness has an abrupt start and the child is usually taken to the hospital within the first 36 hours after onset o f symptoms. In most cases the resolution of the illness is rather benign since the patient can be rehydrated within the first hours after admission. The average hospital stay is 4 days, however, up to 20% of the patients require 7 days or more of hospitalisation. In immunodeficient children and children or adults receiving immunosuppressive therapy, the infection with rotavirus imposes additional threats ranging from the establishment of a chronic or prolonged diarrhea to severe cases associated with fatality (Yolken et a l., 1982). Thus the spectrum of rotavirus infection is rather broad, from subclinical infections to serious cases of dehydration leading to death. Although a series of syndromes have been associated with rotavirus diarrhea including intussusception, Reyes syndrome, sudden death, necrotizing enterocolitis, etc., a direct cause-effect relationship has not been established (Flores et al., 1986). Epidemiology of Rotavirus Infection The importance of rotaviruses as the major etiologic agent of gastro-enteritis in children under 2 years of age has been well documented in more than 30 countries (Rodriquez et 12 University of Ghana http://ugspace.ug.edu.gh a /., 1980). In most of these studies, rotaviruses have been associated with between 20% and 60% of diarrhea cases requiring hospital admission. Not many prospective studies have been carried out to assess the actual incidence of rotavirus illnesses at the community level. One study in Washington, DC, estimated that 1 in 272 infants under 1 year of age and 1 in 451 children 1 to 2 years of age would be hospitalised with rotavirus diarrhea during a one year period (Rodriguez et a l , 1980). Another study in Michigan (Koopmans et al., 1984) estimated that children experienced 0.15 episode of rotavirus diarrhea during the first year o f life and 0.05 episode during the second year; 11% of those children required hospitalisation. These figures contrast with longitudinal studies carried out in Bangladesh and Guatemala in which estimates o f 0.5 and 0.8 episodes, respectively, o f rotavirus diarrhea per child per year were observed during the first 2 years of life (Mata et a l, 1983). In areas with temperate climates, rotavirus diarrhea is seasonal and peaks during the cooler months of the year whilst in the tropical areas, rotavirus diarrhea occurs throughout the year, with peaks in the cool dry months. This seasonal distribution may be responsible in part for some differences (observed in some epidemiological studies) such as the modes of transmission, the rate of reinfection and the age of occurrence of the disease. The age distribution of rotavirus diarrhea in developing countries differs somewhat from that observed in developed regions. In the developed countries, rotavirus infection is 13 University of Ghana http://ugspace.ug.edu.gh usually seen after the age o f 12 months peaking usually at 18 months. However, in the developing countries, a rotavirus infection usually occurs before the age of 12 months. This early infection in developing countries may be attributed to an early exposure to rotavirus especially in prevailing unsanitary conditions in most developing countries. It could also be related to the seasonal variations observed in developing countries where the cyclic character o f the disease would spare many young susceptible children for at least one season (Flores et al., 1986). Symptomatic rotavirus illness in neonates has however been observed to be low generally (Perez-Schael et al., 1984). What makes the new-boms refractory to rotavirus illness is however not clear. The phenomenon may be related to the stage o f intestinal maturation, passive protection afforded by breast-feeding or transplacentally acquired antibody or the preferential infection of the new-born by naturally existing attenuated rotavirus strains (Flores et al., 1986). Factors Implicated in Attenuation of Rotavirus Infections in the New-borns Host Factors Numerous authors have documented the presence of antibodies to rotavirus in human milk worldwide (Haffejee and Moosa, 1990). Antibodies to rotavirus, which are secretory IgA (s-IgA) antibodies produced in the mammary tissue (Rahman et al., 1987), have been detected in 60%-100% of lactating mothers tested, except in South Africa, where the prevalence was only 3% and 13% among Asian and black mothers, respectively (Haffejee et al., 1990, Cook et a!., 1978), The high early concentrations University of Ghana http://ugspace.ug.edu.gh probably serve to protect the new-born at a stage when the total intake of milk is small (Yolken et a l., 1978; Cukor et al., 1979). Differences in sensitivities of the tests used may account for these discrepancies. Prolonged antibody production was found in studies that employed ELISA or solid-phase radioimmunoassay (Cukor et al., 1979), whereas in those that used neutralisation assays or immunoelectrophoresis, antibodies were detected only during the first week of life (Cook et al., 1978). None of the fluorescent-antibody or complement-fixation tests are sufficiently sensitive to detect antibodies to rotavirus in breast milk (Haffejee et al., 1990). The antibodies certainly protect the neonates from becoming infected with rotavirus if present at a sufficiently high titer (Jayashree et al., 1988). A British study, however, found no correlation between the presence of IgA in human milk and protection from rotavirus infection (Totterdell et al., 1980). Hence, both the prevalence of lacteal antibodies to rotavirus and their protective effects have not yet been ascertained. Breast-fed infants develop a bacterial flora that is transient and consist of approximately 99% bifidobacteria by the third week of life. These organisms are absent from the gut of formula-fed infants. In a prospective study Duffy et al., (1986), showed that in breast-fed infants, those with moderate-to-large numbers of intestinal bifidobacteria were at lower risk of developing rotavirus-related illness than were those with low numbers The latter infants, in turn, though at risk for rotavirus-associated illness, developed symptoms that were very mild in comparison to those in infants who were fed formula, none of whom were colonised by bifidobacteria. University of Ghana http://ugspace.ug.edu.gh Although breast-feeding is associated with mild nature of neonatal rotavirus infections, the various factors discussed above do not explain the frequently asymptomatic character of the infection that occurs in new-boms who do not receive breast milk (Chrystie et al., 1978). Role of Breast-Feeding in Prevention of Rotavirus Infection The effects of breast-feeding in the prevention of rotavirus infection are not clear. Banatvala et al., (1978) have demonstrated that the rate of neonatal rotavirus infections was significantly lower in babies who were breast-fed. Similarly the number of rotavirus particles in the stools was lower in breast-fed babies. Prospective studies by Gurwith et al., (1981) have not demonstrated a significant protective role of breast­ feeding against rotavirus illness. British and Australian studies have found a significantly lower rate of rotavirus infection, as well as a lower number of rotavirus particles in the stools of neonates who were breast-fed than in formula-fed new-boms (Duffy et al., 1986). In Japan a fivefold-lower prevalence of rotavirus infection in breast-fed infants less than 6 months old was observed compared to a control group of formula-fed infants (Konno et al., 1978). Rotavirus infections were uncommon among breast-fed infants in a longitudinal Costa Rican study (Simhon et al., 1985). These findings are in support of studies in Australia, Britain, and the United States, where breast-feeding was associated with reduction in rotavirus-associated morbidity (Weinberg et al., 1984). In Gabon, Africa, where infants are usually breast-fed until they are 1 year old, the highest prevalence (23.5%) of rotavirus diarrhea, as determined by EM of stool specimen, is seen in infants less than 6 months of age (Sitbon et al., 1985). Duffy et al., (1986) also University of Ghana http://ugspace.ug.edu.gh found no difference between the rates o f rotavirus-associated gastro-enteritis in breast-fed and formula-fed babies and emphasized that the clinical disease was much milder in the breast-fed group. This, they attributed to colonisation of the gut by bifidobacteria in the breast-fed infants. Thus, although there is some controversy regarding the role of human milk in the prevention of rotavirus infection, there is ample proof that human milk does protect the infant from rotavirus diarrhea, and diarrhea if it does occur, is mild and resolves rapidly. Various factors in breast milk have been found to afford this protection. Neonates who receive breast milk with low concentration of two of these factors, i.e antirotaviral secretory IgA and ai.antitrypsin, are likely to become infected with rotavirus as are formula-fed babies (McLean eta]., 1981) Classification of Human Rotavirus Early investigation into antigenic relationships suggested that all rotaviruses shared a common group antigen. This was believed to be situated within the inner capsid layer of rotavirus particles. Thus, it was thought that any one of the viruses from any species could be used for the preparation of antigen or antibody for diagnostic tests, and that this would aid in the diagnosis of rotavirus infection in humans and animals (Woode et al., 1976). As investigations proceeded, viruses with rotavirus morphology, but without the common group antigen were found in humans and animals (Nagesha et al., 1988). Serological studies have also confirmed that there are viruses which carry group antigens (group epitopes) which are different from the original rotavirus group antigen and rotaviruses to date, have been divided into seven groups A through G based on this. University of Ghana http://ugspace.ug.edu.gh Group A, B, and C are those currently found in both humans and animals, whereas viruses in Groups D, E, F and G have been found only in animals to date. Viruses within each group are capable of genetic reassortment, but reassortment does not occur among viruses in different groups (Yolken et al., 1988). The group A rotavirus have been most extensively studied. The group specific epitopes of rotaviruses are located in VP6 (Ramig, 1994). Rotaviruses have been classified into groups, subgroups and serotype/genotype based on antigenic specificity and genetic structure. They are classified serologically by a scheme that allows for the presence of multiple groups (subgroups) and the existence of serotypes within each group. A rotavirus group (or subgroup) includes viruses that share cross­ reacting antigens detectable by a number of serologic tests such as immunofluorescence, enzyme linked immunosorbent assay (ELISA), and immune electron microscopy (IEM) (Estes et al., 1985). The group antigenic determinants, or common antigens, are found on most if not all o f the structural proteins as well (David et al., 1995). However, cross­ reactive epitopes on the inner capsid protein (VP6) are those usually detected in diagnostic enzyme linked immunosorbent assays. Subgroup specificity is also determined by VP6, the most abundant viral protein, which is the target of group diagnostic assays, and contains the antigen used to further classify rotaviruses into subgroups I and H Two different rotavirus subgroups have been recognised in humans and animals. Subgroup specificity of human rotavirus (HRV) is intimately related to the migration pattern of viral RNA in polyacrylamide gel University of Ghana http://ugspace.ug.edu.gh electrophoresis (PAGE). HRVs with subgroup I specificity mostly have ‘short’ RNA patterns characterised by slow-migrating gene 11, while those with subgroup II specificity have ‘long’ RNA patterns characterised by rapidly-migrating gene 11 (Fig. 4). In humans, rotavirus subgroup II strains are more common than subgroup I strains (Nakagomi et al., 1985). Most of the animal rotavirus studied to date belong to subgroup Within each group, rotaviruses can be further classified into serotypes defined by reactivity o f viruses in plaque reduction (or fluorescent foci reduction) neutralization assays using hyperimmune serum prepared in antibody-negative animals (Hoshino et al., 1984). Using such assays, 14 VP7 serotypes have been identified and strains o f human and animal origin may fall within the same serotype. Neutralization assays can measure reactivity of antibody with the two outer capsid-neutralizing antigens (VP4 and VP7). However, in most cases, the predominant reactivity measured is with the glycoprotein VP7. This may be because VP7 comprises a greater percentage of the virion outer capsid, or alternatively with hyperimmunization, VP7 selectively induces highly specific antibodies. Identical classification of the same virus isolates using MAbs to VP7 uneqivocally demonstrate that plaque reduction neutralization assays with hyperimmune serum primarily measure reactivities with VP7 (Coulson et al., 1987). 19 University of Ghana http://ugspace.ug.edu.gh University of Ghana http://ugspace.ug.edu.gh Classification o f rotaviruses by a binary system, in which distinct serotypes VP4 and VP7 are named, has been proposed and accepted (Graham and Estes, 1980). However, a lack of readily specific typing serum or MAbs to different VP4 types have hampered classification of VP4 (P) by serology. Properties of VP4 types have however been studied by sequence analysis and current evidence suggests the existence o f at least 19 different genotypes of VP4. Genotypes of VP4 and VP7 are determined by sequence analysis, whereas serotypes are determined by reactivity with polyclonal or monoclonal antisera. For VP7, a correlation between genotype and serotype has been established. Such correlation is less clear for VP4, although sequence variation between amino acids 84 and 180 have been suggested to be useful in defining P type-specific epitopes (Larralde et al., 1991). Serotype designation thus reflects the expression of neutralizing epitopes on both VP4 and VP7. Increasingly, epitope expression on these outer capsid proteins has been found to be dependent on the specific combinations of VP4 and VP7 in this complex (Chen et al., 1994). Although the molecular basis of these interactions is not yet well understood, new structural information clearly documents the presence of specific interactions between VP4, VP6 and VP7 within this complex capsid. The serology of the epitopes in proteins that interact in this complex is clearly complicated and likely will not be understood fully until high-resolution structural data on the capsid are available (David et al., 1996). Non Group A Human Rotaviruses Several "rotavirus-like’ organisms also known as 'pararotavirus’ or 'non-Group A rotavirus’ were identified initially in piglets, calves and later in chicken, human and rats (Vonderfecht et a l , 1984). They are morphologically indistinguishable from University of Ghana http://ugspace.ug.edu.gh rotavirus but do not share any o f the rotavirus antigens, including the common epitopes of the VP6. They also have a segmented genome with 11 double stranded PINA genes, but their electrophoretic RNA patterns are different from those of conventional rotaviruses. The prevalence of these rotavirus-like viruses has not yet been determined and the extent o f their association with human diarrheal illness remains to be established although there was an outbreak of acute diarrhea associated with group C rotavirus in China (Tao et al., 1984). Comparative studies on the amino acid sequences of the VP7 proteins of the various serotypes have identified six discrete regions (A through F) with significant amino acid divergence (Glass et al., 1985). These regions, although very distinct among different serotypes, are highly conserved within each serotype (Green et al., 1987). Furthermore, the serotype of a given rotavirus isolate could be predicted from the sequence of two of these divergent regions (Green et al., 1988). Each of the 11 rotavirus genomic segments has been shown to possess unique sequence at both the 3 ’- and 5’- ends, and are highly conserved among strains (Glass et al., 1985). Six variable regions have been detected within the gene 9 segment of rotavirus and have been exploited for the genetic classification of rotavirus VP7 (Fig. 5). Within the variable regions, unique sequences common to group A viruses and specific to the viral genotype and which correspond to serotype, exists. These short sequences (primers) have been used for the genotyping of the rotavirus VP7 in PCR. University of Ghana http://ugspace.ug.edu.gh Similarly, five genetically distinct human rotavirus gene 4 groups have been described on the basis of comparative nucleotide sequencing and the predicted amino acid sequences, and at least four of them represent distinct VP4 antigenic types. Within the gene 4 of the human rotavirus are 5 hypervanable regions which have unique sequences corresponding to the group A rotavirus. These sequences have been found to be specific to the viral genotype and correspond to the serotype. Thus, these regions have been used for the construction of primers which are used for the genotyping of VP4 using PCR. Figure 6 shows the VP4 gene illustrating the variable regions, primer sequence and PCR products. University of Ghana http://ugspace.ug.edu.gh A 39 ' 50 B C D 87 101 120 I X 143 152 mRNA 309 351 406 438 477 504 Beg 9 E F 207 220 233 242 672 711 747 774 306 bp End 9 RVG9 1062 tip aATS 885 t>D a B T i 749 bP a C T2 J Variable regions 652 bp aDT4 583 bp aET3 374 bpBBI Primers a FT9 Fig. 5 . R otav irus gen e 9 show ing locations o f variab le regions, P C R prim ers fo r ty p in g and expected length o f am plified segm ents. 24 University of Ghana http://ugspace.ug.edu.gh Prevalence of HRV P and G Types (of Rotaviruses) in Infected Infants Surv eys o f rotavirus P genotypes in more than 500 fecal specimens from seven countries revealed 2 major types, P[8] and P[4], Ten other worldwide studies involving more than 2700 specimen identified four major neutralisation antigen gene combinations. Eighty three percent of the specimens were genotypes P[8] with G l, G3, or G4 specificity and P[4] with G2 specificity (Steele et al., 1995). When specimens that could not be typed for one or both genes and specimens with mixed infections were excluded, this figure rose to 95.9%. The single most common strain reported was P[8], Gl (53%), followed by P[8], G4 (14.3%); P[4], G2 (10.7%); and P[8], G3 (5.4%). Other genotypes with unusual P and G types included P[6] with G l, G2, G3, or G4 specificity (0.8% of the total); P[9], Gl or G3 (1.1%); P[4], Gl or G4 (0.4% ); P[8], G9 (0.3%); and P[3], G l or G3 (0 3%). Of note, although uncommon in specimens analysed so far, P[6] and P[9] strains and the natural reassortants P[4], Gl have been detected in faecal specimens from many countries, suggesting that they may have a global distribution. Studies in Bangladesh and Brazil have also revealed a significant prevalence of unexpected strains. In Bangladesh, although a small number of strains were typed, 10% of them were either natural reassortants (P[4], Gl and P[4], G4) or uncommon P[6], G l) rotaviruses (Bern et al 1992). Studies in Brazil showed 5 uncommon serotypes (P[6], G l, P[6], G3; P[6], G4, P[3], G l, and P[3], G3) representing one third of the single infections (Timenesky et al., 1994). Strains with the P[6] serotype had the highest prevalence isolates among all the studies surveyed, while the P[3] genotype, the University of Ghana http://ugspace.ug.edu.gh prototype o f which is rhesus rotavirus, had previously been reported only among infants from Israel and the United States (Silberstein et ah, 1995). Genotype P[8], G5 was found in specimens from several different years and from all five regions studied in Brazil and it represented 12.6% of the single infections. This made it the most common strain identified. The prevalence of mixed infections (21%) was unusually high, suggesting a complex rotavirus infection pattern in Brazil. This result coupled with other observations from another report in which G5 strains were detected but the P genotype could not be specified reported (Timenetsky et al., 1994), suggesting that Brazilian P[8], G5 strains may represent reassortants between human and animal rotaviruses. Although both the Brazilian and Bangladeshi studies were limited because of small number of completely typed strains, they represent one of the first reports of rotaviruses with P genotypes other than P[8]or P[4] that could be of major public health importance. University of Ghana http://ugspace.ug.edu.gh CJQ aq M l 278 356 402 <94 387 230 S'Hh t------- ( - i------- 1------------------------------- - - - 3 CON 3 * • * • H i - 3T-1 1 T-1 4 T -t 2 T-l CON 2 875 bo •I- 345 60 391 bo 463 &o . 6 : R otavirus gene 4 show ing locations o f variab le regions, PCR prim ers for typing and expected ths o f am plified segm ents. 27 University of Ghana http://ugspace.ug.edu.gh Genetic Variation in Rotavirus The RNA segments o f the rotavirus when run on polyacrylamide gel electrophoresis (PAGE) appear as 11 distinct bands on the gel. Based on the migration patterns o f the 11th- gene segment on PAGE, rotaviruses are classified into ‘long’, ‘short’ and ‘super­ short’ electrophoretypes as previously described. There is however considerable variation of electrophoretypes within any given community at any given time, although usually one strain predominates and the virus population in a given area changes with time (Rodger et a l , 1981). Before human rotaviruses could be propagated in cell cultures, the analysis o f the electrophoretic migration pattern of the virus genomic RNA segments was an important tool for the epidemiologic studies. A common observation made was the existence of numerous strains with differing RNA migration patterns even among strains obtained on the same day in a given geographic location (Flores et al., 1982). This suggested that a high degree of genetic variability exists that may allow the generation of new serotype specificity and/or altered virulence. Genetic variation among rotavirus can be explained by two major mechanisms; accumulation of successive mutation (genetic drift) and reassortment of genes (genetic shift). Point mutations in the genes of the rotavirus could certainly occur as the virus is amplified and propagated from one individual to another. Changes in the base pair sequence of genes may result in altered migration without any size changes. On the other hand the segmented nature of the rotavirus genome allows for the occurrence of University of Ghana http://ugspace.ug.edu.gh reassortment when two strains coinfect simultaneously a given host. Silent mutations among equivalent genes from different strains have been observed in rotaviruses (Flores et al., 1985). The number of such mutations is however relatively small. The existence of two distinct genetic ‘families’ of human rotavirus based on genomic cross-hybridisation studies o f over 100 human rotavirus isolates obtained in Venezuela has been proposed (Flores et al., 1985). The two families are represented by the well- characterised laboratory strains Wa and DS-1. Most o f the Venezuelan isolates hybridise at high stringency with the genes of the prototype strain Wa; a few of the isolates however hybridised strongly to the DS-1 prototype strain. Some isolates exhibited a high degree of homology to Wa in most of their genes while simultaneously presenting one or two genes homologous to DS-1. This observation would suggest that reassortment may have take place under natural conditions during coinfection by strains belonging to different rotavirus ‘families’ Furthermore, the reported finding of two mixed rotavirus with different RNA electrophoretic patterns in the same stool of ill children provides further support to this hypothesis. The consequences that may derive from natural development o f rotavirus reassortants are unclear. Similarly the consequences of successive accumulation of mutations in one or more of the rotavirus genes are impossible to predict. Under experimental conditions selective pressures can induce reassortants with certain gene constellation, however, it is not known whether such selective pressures act under natural conditions and to what extent they may force the generation of reassortants or the induction of new serotypes. University of Ghana http://ugspace.ug.edu.gh Neonatal Rotavirus Infection Rotavirus infections in neonates are generally mild or asymptomatic as stated earlier. Generally, fewer than one-third of rotavirus-infected neonates have diarrhea, although higher rates have been reported in some hospital nursery populations (Haffejee et al., 1991). Infections usually occur during the first week of life and generally invokes a mucosal antibody response without a concomitant serologic antibody response. Neonatal rotavirus-infections appear to incite an immune response that affords significant protection against future severe rotavirus associated diarrhea, although not necessarily against a symptomatic rotavirus infection (Haffejee et al., 1991). The outer capsid protein VP4 of neonatal strains are highly conserved, a property that probably plays a key role in their attenuated virulence. Immaturity of proteolytic enzymes in the neonatal gut and presence of secretory anti-rotavirus IgA and trypsin inhibitors in breast milk are other factors that could account for the asymptomatic nature of rotavirus infections in new­ borns. Genotype Associated with Neonatal Rotavirus Infection New-born infants bom in hospital nurseries sometimes become infected with rotavirus, usually in the absence of symptoms of diarrhea (Bishop et al., 1983). Thus, infection of neonates with these strains may have important implications for the success of vaccination against rotavirus. A number of studies have shown differences between strains of rotavirus that infect neonates and strains that infect older infants and children. Studies done in Venezuela and South Africa have identified strains related to P[6] with G l , G3, or G4 specificity (Genstch et al., 1996). Isolates from New Delhi and Bangalore were first characterised molecularly and serologically and shown to belong to University of Ghana http://ugspace.ug.edu.gh serotypes G9 and G10 respectively, serotypes not previously identified in neonates (Dunn et al., 1993). These strains had related but distinct VP4 genes, both of which were closely related to the prototype bovine rotavirus B223 which has a P8[11] and G10 specificity. RNA-RNA hybridisation experiments supported the hypothesis that both strains had arisen by reassortment between human and bovine rotaviruses (Das et al., 1993). Subsequent genotype analysis identified neonatal strains circulating in the New Delhi area as P[ 11], G9 (70.2% of total). About one-third of these were isolates obtained during the same period from the same hospital as the prototype strain of this group, 116E (Cicirello et al., 1994). A second novel neonatal rotavirus (P[6], G9, 13.5% oftotal) was identified at this hospital and also at another hospital in 1993 during an epidemiologic study of neonatal rotavirus prevalence. A low prevalence of 2 other strains, P8[1 1], G3 (2.7% of total) and P[4], G2 (1.4 of total) was identified among culture-adapted strains but not in faecal specimens, therefore, their importance as causes of neonatal infections is unknown. The implications from these findings is that these differences may be responsible for mild or asymptomatic infections, Australian investigators, who analysed RNA patterns of rotavirus by electrophoresis, isolated two strains of rotavirus that were almost identical from new-boms in nurseries. The two strains were distinct from other rotavirus strains isolated from older ill children in the community (Rodger et al., 1981). This electrophoretic dissimilarity of strains again was demonstrated also by Albert et al., (1984). Perez-Schael and colleagues (1997) also observed a similar constancy of RJMA patterns in rotavirus strains isolated from neonates. Hoshino et al., (1985) showed that three English strains recovered from asymptomatic new-boms had identical RNA profiles; the same conclusion applied to five strains from Sweden. On the other hand, University of Ghana http://ugspace.ug.edu.gh during two outbreaks of neonatal rotavirus infection in a tertiary care nursery, 11 different electrophoretic strains were identified (Rodriguez et al., 1983). The similarities found in neonatal electrophoretypes do not, however, hold for serotypes. All four human serotypes (Totterdell et al., 1976) that cause symptomatic infection in infants and young children also cause asymptomatic or mild infections in neonates. Similarly, both serotype subgroups I and II have been implicated in neonatal infections (Hoshino et al., 1985). It appears, therefore, that there is no correlation between a specific serotype or subgroup and the occurrence of asymptomatic or mild infections in neonates. It is of interest that although four serotypes were implicated in neonatal infections in the study of Hoshino etal., (1985) each individual serotype was endemic in the neonatal nurseries of only one of the four different countries at any given time. The mutation rate among nursery strains o f rotavirus with regard to VP7 gene is very low, i.e., these strains appearto be genetically stable (Flores eta l., 1988). The VP4 gene is highly conserved in neonatal rotavirus strains and differs from that o f strains found in older children with diarrhea (Flores etal., 1986). Since enzymatic cleavage of VIM is required for infectivity, it is conceivable that the relatively immature proteolytic enzymes that occur in new-born babies may 'process’ the VP4 in a manner that would allow replication of the virus without causing clinical illness. Thus, although both breast milk and the natural attenuation of the nursery rotavirus strains probably account for the general asymptomatic nature of neonatal rotavirus infection, it appears that the second factor, the inherent attenuation of nursery strains, is University of Ghana http://ugspace.ug.edu.gh most important. This property has led to the consideration of these strains as vaccine candidates (Edelman et al., 1987). If efficacious, such a vaccine would be an important advance in the reduction of the morbidity and mortality from infantile diarrhea, since it is estimated that about 870,000 children less than 5 years of age die annually from rotavirus diarrhea worldwide, the majority in developing countries (Ho et al., 1988). Other promising vaccines are the bovine WC3 vaccine and the combined rhesus-human quadrivalent reassortment vaccine (Flores et al., 1990). The WC3 vaccine gave a high protection rate in small field trials in the United States (Clark et al., 1988), although larger trials in different settings are clearly indicated. The quadrivalent or multiserotype vaccine produced a high rate of febrile reactions in a small Venezuelan trial, but no long­ term follow-up results are yet available to assess protection if any against rotavirus diarrhea (Flores et al., 1990). Development of a vaccine against rotavirus might reduce the high infant mortality rates due to diarrheal illness in developing countries as well as the high endemicity observed in both developed and developing countries. Before such a vaccine can be developed, the different strains in circulation must be characterised and documented especially the neonatal strains since they make good candidates for rotavirus vaccines. W hilst there exist some data on neonatal strains in the developed countries, such data is almost non existent in the developing countries. The aim of of this study therefore is to characterise by molecular methods rotavirus strains in neonates in Accra. This is the first study of its kind in Ghana and will provide valuable data that would be very essential in the development and formulation of vaccines against rotavirus strains. University of Ghana http://ugspace.ug.edu.gh The specific objectives are as follows: (i) To isolate rotavirus from stools of neonates in Accra. (11) To determine the incidence of rotavirus infection in neonates. (iii) To characterise by molecular methods rotavirus isolates in neonates. Justification for the work The determination o f the incidence of rotavirus infection in neonates and the characterisation of the various strains would provide valuable local information on rotaviruses in neonates. This would contribute to the global development and formulation o f vaccine against the different rotavirus strains, by providing epidemiological data on rotavirus strains in neonates. 34 University of Ghana http://ugspace.ug.edu.gh CHAPTER TWO MATERIALS AND METHODS Materials/Reagents Acetone, sodium chloride, hydrochloric acid, sodium dodecyl sulphate, sucrose, bromophenol blue, glacial acetic acid, sodium hydroxide were obtained from Fluka Chemical Company (Buchs) and were of analytical grade. Sodium dihydrogen phosphate, dipotassium hydrogen phosphate, N N N ’ N ’ tetramethelene diamine, ammonium persulphate and glycine were obtained from Wako Chemical Company (Japan). N ’ N ’ methelene bisacrylamide was from Serva Fienbiochemica Company Ltd. (N.Y). Ethanol and disodium hydrogen phosphate were obtained from Riedel-deHaen (ph. Eur) and extraction buffers L2 and L6 were from Severn Biotech Ltd. Rnase-free sterile distilled water was obtained from RNAsin, Promega, Madison, WI. Primers were from Pharmacia Biotech and Tris-HCl, KC1, MgCb, Reverse transcriptase and dNTPs were obtained from Life technologies, Gaitherburg, MD. The DDEIA Rotavirus kit was from Dako Diagnostics Ltd, Cambridgeshire, UK and agarose was obtained from Seakem, Flowen, USA. University of Ghana http://ugspace.ug.edu.gh Methods Study Area: This study was conducted in the Greater Accra region, the capital of Ghana Accra lies in the coastal belt of West Africa and has two main seasons-a rainy season from April to June and a dry season from December to March. In between these major seasons, there are minor rainy and dry seasons from September to November and July to August, respectively. The Korle-Bu Teaching hospital, where the study was conducted, is the main referral facility in the city of Accra. It serves as the medical center for all zonal classes and has a daily out patient population of approximately 1500 people. Two hundred neonates at the selected hospitals (Korle-Bu Teaching Hospital and the Legon Hospital) were recruited into the study and the basic data collected by questionnaire (Appendix IV). Stool samples were collected from neonates who were on admission at the babies unit o f the hospital. The stool samples were collected in plastic cups and transported to the laboratory at 4°C where they were stored under glycerol at -20°C for processing within 10 days. Detection o f Rotavirus in stools Approximately 10% suspension of stool samples were prepared by homogenization in phosphate buffered saline (PBS) pH 7.4 for 3 mins. and used for analysis. Rotavirus detection was carried out using Enzyme Linked Immunosorbent Assay (ELISA). The 10% suspension of stool samples were tested for rotaviruses with the DDEIA Rotavirus kit following the manufacturer’s instructions. Briefly, two drops (100jn 1) of test samples University of Ghana http://ugspace.ug.edu.gh (supernatant from 10% suspension) were added to each well of the 96 well plate followed by two drops of conjugate. The plate was then incubated at 30°C for 60 minutes, after which time the wells were washed five times using working strength buffer (Appendix II). A drop (50^1) of substrate Part A (Appendix II) was added to each well followed by one drop of substrate Part B (Appendix II), and incubated at 30°C for 10 minutes The reaction was stopped by the addition o f one drop of stopping solution (Appendix II) to each of the wells. Each plate included two negative controls and a positive control. The absorbance was read at 450nm and any samples which had a value equal to or greater than the sum of 0.1 and the absorbance value of the negative control were considered positive. All assays were in duplicate. Characterisation by Polyacrylamide Gel Electrophoresis RNA Extraction fo r PAGE: The 10% suspension of the faecal samples were spun down and RNA was extracted from the supernatant o f the faecal samples using the method of Flook et al., (1992). Two hundred microliters of purified virus solution was mixed with 200ul of Bender buffer (Appendix I) and incubated at 65°C in a water bath for 30 mins Sixty microliters of 8M potassium acetate was added, mixed by inverting the tube a couple of times, and allowed to stand on ice for 45 mins. The mixture was clarified by spinning at 10 000 rpm and twice the volume of cold absolute alcohol was added to the supernatant in another tube and allowed to stand for a few minutes. The RNA precipitate was pelleted by centrifugation and re-suspended gently in 200|il of Tris-EDTA buffer (TE) pH 8.0 and left for 30 mins at room temperature. The viral genomic RNA was finally precipitated University of Ghana http://ugspace.ug.edu.gh with alcohol (420|il) and 10^1 o f NaCl, dried under vacuum and re-suspended in 15(j.1 of loading buffer or TE. The extracted RNA was then analysed by polyacrylamide gel electrophoresis using the SDS-tris-glycine discontinuous buffer system (Laemmli., 1970) on 10% acrvlamide gels and run overnight at a constant voltage of 100V for 1 8 hours. Samples were applied to separate lanes of polyacrylamide slab gels and electrophoresed in an Atto (Japan) mini-gel system and the gels stained by the method of Herring et al., (1982). Silver staining o f page gels: After removal of the gel from the glass plates, it was fixed in solution 1 (Appendix I) for 30 minutes. The gel was then transfered into solution 2 (Appendix I) for another 30 minutes, and then placed in 200ml of silver nitrate stain and swirled slowly for 30 minutes. The stain was decanted after 30 minutes and the gel washed twice with water to remove any trace of excess silver nitrate that may darken the gel. The gel was then washed with 50ml of developer (Appendix I) for 1 Osecs. and developed by adding 250ml of developer (Appendix I). The gel was allowed to stand for approximately 5 minutes, until the nucleic acid bands were visible. The developer was afterwards poured off and replaced with 200ml of solution 3 (Appendix I) to fix the gel. The gel was stored in solution 2 and later photographed. 38 University of Ghana http://ugspace.ug.edu.gh Genotyping of Rotavirus All the PAGE positive rotavirus samples were characterized by molecular methods using the polymerase chain reaction (PCR) techniques. (i) RNA Extraction fo r PCR: Five hundred microlitres of lysis buffer L6 (Appendix HI) was added to lOOul of 10% faecal extract in a 1,5ml eppendorf tube and 10|il of size fractionated silica was added to the mixture. The mixture was then vortexed for 10 seconds, left to stand at room temperature for 15min, before pelleting by centrifugation at 13, 000 rpm for 15 seconds. The supernatant was discarded and 0.5ml of lysis buffer L2 (Appendix ID) was added. The pellet was washed by gently resuspending with pipette and then pelleted again by centrifugation at 13,000 rpm for 60 seconds. The supernatant was discarded and the washing process was repeated as above. The pellet was further washed twice with 0.5ml of 70% ethanol, followed by 0.5ml of acetone and then the tubes were placed with caps open in a dry heating block at 56°C for 5 minutes. The nucleic acid was eluted from the silica by adding 25^1 o f distilled water, vortexed, incubated at 56°C for 15 minutes in the heating block and centrifuged at 13,000 rpm for 2 min to recover the supernatant. (ii) Reverse Transcription to Generate cDNA: The extracted RNA was used for RT-PCR after random priming with hexamers or specific priming with VP7 and VP4 consensus primer pairs (Beg9/End9 and Con3/Con2 respectively) by the method of Gentsch et al., (1996). Briefly, l |i l of random primer Pd(N)6 or 1 ^1 of either specific primer pair (Beg9/End9 for VP7 or Con3/Con2 for VP4), was added to 20^1 of the extracted RNA, heated at 97°C for 5 min. to denature the 39 University of Ghana http://ugspace.ug.edu.gh dsRNA followed by annealing o f the primers for 5 min at 70°C for random priming, 42°C for VP7 or 50°C for VP4 and chilled on ice for 2 min. Fourteen microliters of the RT reaction mix was added, to yield a total volume of 30ul consisting of20m M Tris-HCl pH 8.4, 50mM KC1, 5mM MgCh, 50uM of each dNTP and 200U of MuLV reverse transcriptase. The RT reaction was carried out by incubation at 37°C for 1 hr, and the reaction terminated at 95°C for 5 min followed by chilling on ice for 2 min. The RT-PCR for determining the G-type used Beg9 and End9 primers (Gouvea et al., 1990). The sequence of primers (5' to 3') and the nucleotide positons are as follows: Beg 9 with sequence (nt 1 to 28) GGCTTTAAAAGAGAGAATTTCCGTCTGG; and End 9 with sequence (nt 1062 to 1036) GGTCACATCATACAATTCTAATCTAAG. The RT-PCR for determining the P-type used Con2 and Con3 primers (Gentsch et al., 1992). The nucleotide (nt) positions and sequences of these (5’ to 3’) are as follows: con 3 (nt 11 to 32), TGGCTTCGCCATTTTATAGACA, con2 (nt 868 to 887), ATTTC GGAC C ATTT AT AAC C . (iii) Genotyping: (a) G-typing G-typing was performed using a semi-nested PCR and adapted from the method of Gouvea et al (1990). The first round PCR amplified the whole length ofV P7 gene using primers Beg 9 and End 9. The second round typing PCR was a multiplex PCR and incorporated the primer End 9 and the G-type specific primers, aBTl (Gl -specific), aCT2 40 University of Ghana http://ugspace.ug.edu.gh (G2- specific), aET3 (G3-specific), aDT4 (G4-specific), aAT8 (G8-specific) and aFT9 (G9-specific). The aAT8 maps to variable region A with nucleotide position (nt) 178 to 198 and sequence, GTCACACCATTTGTAAATTCG, with product size, 885bp, the primer aBTl maps to the region B of nucleotide position and sequence (nt 314 to 335, CAAGTACTCAAATCAATGATGG), with product size 749bp, the primer aCT2 maps to region C of nt and sequence (nt 411 to 435, CAATGATATTAACACATTTTCTGTG), with product size 652bp, the primer aDT4 maps to region D of nt and sequence (nt 480 to 498, CGTTTCTGGTGAGGAGTTG), with product size 583bp, the primer aET3 maps to region E of nt and sequence (nt 689 to 709, CGTTTGAAGAAGTTGCAACAG) with product size 374bp and the primer aFT9 maps to region F of nt and sequence (nt 757 to 776, CTAGATGTAACTACAACTAC) with product size 306bp. These primers were selected to be pooled as a primer mix and used in combination with the common primer RVG9 (ntl062 to 1044, GGTCACATCATACAATTCT), 19 nucleotide at the 5’ end of the primer End 9. The PCR reaction mix for the first consisted of 18mM Tris-HCl pH 8.4, 45mM KC1, 2mM MgCl2, 50uM of each dNTP, 1 (il o f Taq polymerase and 2\iM of each primer. The first round PCR was performed by using 5^1 of the random primed cDNA to 45^1 of the PCR mix. After denaturation at 94°C for 5 min, 30 PCR cycles each consisting of 94°C for 1mm, 42°C for 2 min and 72°C for 1 mm were performed, followed by an extension at 72°C for 7 min. The second round PCR was performed using the same protocol but with 1 ul of the first round reaction product as the template in a final reaction volume of University of Ghana http://ugspace.ug.edu.gh 50|il, and reducing the number of cycles to 15. All amplified products were examined by gel electrophoresis in 2% agarose gels containing 0.5|.ig/ml ethidium bromide under standard conditions (b) P-typmg : P-typing was performed using a semi-nested PCR adapted from the method of Gentsch et al., (1992). The first round PCR amplified an 876bp fragment of the gene of group A rotaviruses using the consensus primers Con2 and Con3, The second round typing PCR incorporated Con3 and the P-type specific primers IT-1 (P[4]-specific), 3T-1 (P[6]- specific), 4T-1 (P[9]-specific and 5T-1 (P[10]-specific). IT-1 (nt 339 to 356), TCTACTTGGATAACGTCG and product size, 345bp; 2T-1 (nt 474 to 494), CTATTGTTAGAGGTTAGAGTC and product size 483bp; 3T-1 (nt 259 to 278), TGTTGATTAGTTGGATTCAA, with product size 267bp; 4T-1 (nt 358 to 402), TGAGACATGCAATTGGAC with product size 391bp and 5T-1 (nt 575 to 594), ATCATAGTTAGTAGTCGG with product size 583bp. A second set of genetic group- specific primer pairs was employed to confirm the results obtained with typing primers. Their nucleotide positions on gene 4 and sequences (5' to 3’) areas follows: 1C-1 (nt 314 to 331), GGACTGCAGTAGTTGCTA; 1C-2 (nt 474 to 494), TTAGTATCAGAAGTTAGTGTA; 2C-1 (nt 1324 to 1344), ATACGAACACGTACAATAAAC; 2C-2 (nt 1809 to 1828), CATCATTTACTGAGTCAGTT, 3C-1 (nt 261 to 278), GAATCCAACTAATCAACA; 3C-2 (nt 446 to 467), TGTTGAAATTCGGCACTAACA; 3C-3 (nt 288 to 312), AGAGGGTACCAATAAAACTGATAT, 3C-4 (nt 589 to 606), TGCAGTTTCTACTTCAGA; 4C-1 (nt 223 to 242), ACCTCACTCAACTTAGT; University of Ghana http://ugspace.ug.edu.gh and 4C-2 (nt 464 to 484), ATAATGTTGAATATTGAGTGT. The reaction mix for the first and second round amplification was the same as that of the G-typing except for the primer concentrations (l(.iM Con2 and Con3 for the first round PCR and 2^M of each typing primer for the second round) Forty PCR cycles were performed with annealing performed at 50°C for a minute. The second round PCR cycle was reduced to 25 cycles. PCR products were examined as described above. The products were analysed by 2% agarose gel electrophoresis and stained with ethidium bromide (0.5|ig/ml). The products were run along side with a lkbp marker at 80 volts for 30 minutes before observation under U.V light. 43 University of Ghana http://ugspace.ug.edu.gh CHAPTER THREE Results During the period of the study (October, 1999 to March, 2000), a total of 200 neonatal faecal specimens were collected from the Legon and Korle-Bu teaching Hospitals. These were tested by Enzyme-linked Immunosorbent Assay (ELISA) for the detection of group A rotavirus as described in materials and methods. Out of the 200 neonatal samples tested, 60 samples (30%) were found to be positive for rotavirus antigen. Rotavirus was detected in all age groups, with the exception of the age groups 16-19 and 24-27 days. The age distribution of neonatal rotavirus infection during the rotavirus season is shown in Table 1. The infection was highest in the 0-3 days age group which recorded 37.9% HRV positives out of the total o f 29 samples. A 33.3% HRV positivity was observed for the age group 20-23 days. There was a 32.2% infection among children in the age group 4-7 days and 30.8% among children in the age group 12-15 days. Children in the age group 8-11 days and neonates who were more than 27 days old had 29.4% and 17.4% HRV infection respectively. PAGE The neonatal stools were tested by PAGE for rotavirus as well as determining the electrophoretic pattern. This method also afforded us the opportunity of detecting the various electrophoretypes as well as selecting samples with adequate intact virus (enough dsRNA) for genotyping by PCR. In addition, it also allowed for the detection of non group A human rotaviruses. Out of the 60 (30%) stool samples that were positive by ELISA, 23 were positive by PAGE. In all 28 (14%) of the 200 samples turned out to University of Ghana http://ugspace.ug.edu.gh be positive by PAGE. O f the ELISA positive samples, only 24 (40%) had diarrhea (Table 2). Eleven (45.8%) o f the 24 neonates who had diarrhea were rotavirus positive whiles 13 (54.2%) had diarrhea but were rotavirus negative. All the neonates who had diarrhea and were rotavirus positive were observed to be infected with group A rotavirus. All the group A rotaviruses were detected by ELISA and the non-group A by PAGE Table 1: Neonatal Rotavirus infections in Accra according to age Age (days) Total number o f children Diarrhea cases +ve HRV(%) Non Diarrhea cases +ve HRV (%) 0-3 29 2 (0.0) 27 (40.7) 4-7 66 7(14.3) 59 (32.2) 8-11 17 4 (50.0) 13(23.1) 2-15 39 7(57.1) 32 (25.0) 16-19 0 0 (0.0) 0 (0.0) 20-23 24 2(100.0) 22 (27.2) 24-27 0 0 (0.0) 0 (0.0) >27 25 2 (50.0) 23 (13.0) 0-27 200 24 176 45 University of Ghana http://ugspace.ug.edu.gh Table 2: Relative frequency of human rotavirus types identified Number tested Virus Total number o f positive samples Diarrhea (%) Non Diarrhea (%) Type A rotavirus 60 24 (40) 36 (60) Non type A rotavirus 5 0(0) 5(0) Two distinct rotavirus RNA electrophoretypes were observed to occur. Seven (25%) were o f the long electrophoretic pattern and 22 (75%) o f short type. No unusual patterns such as mixed infections were observed as depicted in Figure 7. G and P characterization The 28 isolates detected by the PAGE were the ones which had enough RNA for the RT- PCR. These 28 isolates were genotyped but a total o f 8 samples (28.6%) could not be genotyped; there were four samples (14.3%) whose G-types could not be determined, but their P-genotypes could be determined and two samples (7.1%) could not be P-typed but their G-types could be identified. Two (7.1%) o f the samples were completely untypable, although gene products could be obtained after reverse transcription and amplification, indicating the possibility o f unusual strains. The predominant genotype was VP4 P6 accounting for 19 (79.2%) o f the P-typed (24) specimens. Four samples with mixed P- type specificities (P6P10) accountcd for 16.7% o f the P-typcd specimens. These samples were P[6]P[10] types, while only one (4.2%) was found to be the P[8] type. The University of Ghana http://ugspace.ug.edu.gh predominant VP7 G-type was G[2] (72.7%) followed by G[9] (12.5%), and G[3] (8.3%). The mixed G-type was (G[2]G[3]) (4.2%). No VP7 G[4] and G [l] strains o f human rotavirus were isolated in this study. Three distinct single rotavirus strains with a combination of VP7 genotype and VP4 genotype, were found among neonates in Accra as shown in Figure 8. Strains of the type P[6]G[2] were the most predominant (42%). There was 7.1% o f type P[6]G[3] strains and 3.6% o f P[6]G[9] strains. There was one mixed G-type (3.6%)and four mixed P-type strains (10.7%). The P and G-typing o f the strains after the PCR amplification are as shown in figures 9 and 10 respectively. 47 University of Ghana http://ugspace.ug.edu.gh Fig. 7. The electrophore tic pattern o f hum an ro tav irus stra ins from neonates in Accra. All samples (lanes A -M ) exh ib ited the typical 4-1-3-2 pattern o f g roup A ro tavirus. Lanes I, K and M show the long pattern w h ilst lanes A -H and L show the short pattern . N um bers denote positions o f dsRNA segm ents. University of Ghana http://ugspace.ug.edu.gh Fig. 8: Neonatal HRV Genotype Distribution in Accra from Oct., 1999 - March, 2000 DP[6]G[?]-10.7% □ P[6]G[2]-42.9% □ P[6]G[3]-7.1% □ P[6]G[9]-3.6% ■ P[6]G[2]G[3]-3.6% □ P[8]G[?]-3.6% HP[6]P[10]G[2]-10.7% □ P[6]P[10]G[9]-3.6% ■ P[?]G[?]-7.1% □ P[?]G[2]-3.6% □ P[?]G[9]-3.6% University of Ghana http://ugspace.ug.edu.gh - P 8 -P6 Fig. 9: P-typing o f neonatal ro tavirus dsR N A with consensus prim ers, C on3, IT-1, 2T-2. 3T -1 . 4T- land 5T -1 . P roducts w ere analysed by 2% agarose gel e lectrophoresis and stained w ith ethidium brom ide. Lanes 1-12 show som e o f the positive neonatal strains analysed for VP4 genotype. Lanes 1 - 4, 7, 8, 11 and 12 correspond to the product size 267bp, w hich is genotype P6. Lanes 5, 6 and 10 corespond to the P8genotype w ith p roduct size 345bp. Lane 9 was untypeable. The m igration o f the gel is from up to dow n. 50 University of Ghana http://ugspace.ug.edu.gh Fig. 10: G -typ ing o f neonatal ro tavirus dsR N A with consensus prim ers, End9, a B T l, aC T2, aET3, aDT4, aATS and aFT9. Lanes i - 10 show som e o f the positive neonatal strains analysed fo r V P7 genotype. Lanes 2, 5 and 9 correspond to the product size 652bp, w hich is G2. Lane 7 correspond to the dual infection G 2G 3. The G3 has a product size o f 374bp. Lanes 1, 3, 4, 6, 8 and 10 w ere untypeable. T he m igra tion o f the gel is from up to dow n. 51 University of Ghana http://ugspace.ug.edu.gh CHAPTER FOUR DISCUSSION AND CONCLUSION Discussion Rotavirus infection in neonates is common and has been reported to be generally asymptomatic, although diarrheal illness has also been recorded. In this study, about 50% of neonates who were infected with rotavirus exhibited one or more of the following symptoms, fever, bloody stool, watery stool, diarrhea and vomitting. Out of a total of 24 babies who had diarrhea only, 11 (45.8%) were positive for human rotaviruses. The presence of rheumatoid-like factor in some neonatal faecal specimens has been suggested to give false-positve results with ELISA (Yolken et al., 1979). This may probably explain why 36 (60%) of the neonates positive by rotavirus ELISA were asymptomatic but tested negative by PAGE. Another explanation could also be that the amount ofRNA was so small to be detected by the PAGE. In this study, a high incidence of 30% was recorded with the use of ELISA for the detection of the rotaviral antigen. The methods of choice for detection of rotavirus in stool samples should be very sensitive, specific and reproducible, ensuring consistency in the laboratory assays. ELISA for the detection of viral antigens is the method commonly employed in many laboratories in combination with either electrophoretype determination by PAGE or detection of viral particles by EM, The overall sensitivities of these methods are in the range of 108 to 109 viral particles/ml for PAGE. The most sensitive ELISA described detects as few as 10s to 106 viral particles/ml, whereas for a University of Ghana http://ugspace.ug.edu.gh positive EM reaction 108 viral particles/ml are required (Brandt et al., 1981). Data obtained from the comparison of diagnostic sensitivities and specificities of commercial ELISA kit, and PAGE for direct detection o f group A rotavirus in stool samples, with RT-PCR as the standard method by Arguelles et al (1999), indicate that for the rapid screening of a large number of samples, the ELISA is able to detect rotavirus in stool samples with sensitivity (98%) and specificity (100%) similar to those of RT-PCR at a considerably lower cost and without previous treatment of the samples (Coulson et al., 1991). To select samples with enough dsRNA for the RT-PCR and to detect other rotavirus groups as well as determine the electrophoretic patterns, polyacrylamide gel electrophoresis was performed on all the rotavirus positive stools. The detection of some rotavirus strains by PAGE which could not be detected by ELISA is an indication of the presence of rotaviruses of other groups other than group A. The overall detection of rotavirus in 30% of neonatal samples was in agreement with findings of a similar study in South Africa where rotavirus incidence of 30% was observed. Possible reasons for the high incidence of rotavirus infection in this study could be the poor feeding practices of the babies by the mothers and poor hygiene. At present, faecal-oral route and air-borne mechanisms are the suspected modes of transmission of rotaviruses (Henry et al., 1990), and both are favoured by overcrowding, low socio-economic status and poor sanitation. These might explain the high incidence of rotavirus infection observed in this study as most inhabitants in Accra find themselves in such living conditions. 53 University of Ghana http://ugspace.ug.edu.gh All rotavirus strains regardless of the group to which they belong have 11 distinct RNA gene segments which appear as 11 discrete bands when run on a polyacrylamide electrophoretic gel. Based on the electrophoretic migration pattern, rotaviruses have been classified as subgroup I or subgroup II depending on migration pattern of the 11th gene. Subgroup I rotavirus have a short pattern and subgroup II, a long pattern (Nakagomi et al., 1985). These two rotavirus RNA patterns (long and short) were detected in our study. The short pattern was observed to occur in 21 of the samples whiles the long pattern was observed to occur in 7 of the samples. There was no unusual pattern observed. Rotaviruses were found in stools o f neonates who were less than a day old. Neonatal rotavirus infection typically occurs very shortly after birth. This early infection may be attributed to an earlier exposure to rotavirus especially in conditions such as contaminated sources and overcrowding as was observed for the Babies Unit of the Korle-Bu teaching hospital. Most infected neonates excrete rotavirus during the first week of life and some newborns shed rotavirus less than 24 hours after birth (Haffejee et al., 1990). Using RT-PCR techniques to assess the distribution of VP7 and VP4 genotypes of neonatal rotavirus field specimens from Accra, the VP4 P[6] genotype was found to be most prevalent. This observation supports previous findings in a study in Nigeria where P[6] was observed to be the most prevalent genotype in neonates (Adah et al., 1997). Rotavirus strain P[6] genotype have been associated with asymptomatically-infected University of Ghana http://ugspace.ug.edu.gh neonates in newborns nurseries (Silberstein et al., 1995), but recent reports from India, South Africa and Brazil have indicated that this genotype could be constantly detected in symptomatically-infected neonates and children (Timnesky et al., 1994). Four of the samples (14.3%) had mixed infections and all had P[6]P[10] specificities. Cases of mixed infection specificity have been reported also by several workers across the globe (Ramachandran eta l., 1996). However, in South Africa, the most common dual infection was found to occur between strains bearing a P[8] and a P[4] genotype (Steele et al., 1995). This was not the case in this study as none of the 4 specimens with mix infection specificities had this combination. A possible explanation for the high preponderance of the unusual dual infection strain P[6]P[10] genotype could be attributed to the emergence of a new strain P[10] in the study area However, it should be noted that no strain bearing the single P[10] genotype was isolated, and only one strain with a P[8] specificity was detected during the study. This study has shown clearly that strains with G[2] genotype specificity are the only circulating neonatal strain in Ghana. The detection of G[9] strain as a mixed infection could be a recent emerging strain. Previous hybridization and sequencing studies of unusual human rotavirus isolates revealed that naturally occurring reassortants between human and animal rotaviruses can occasionally emerge under natural conditions (Urasawa et al., 1993). Bovine rotaviruses are particularly known to be conspicuously involved in the generation of such reassortants. In India, two strains of rotaviruses, 1321 and 116E (Das et al., 1993) were shown to contain either a VP4 gene (116E) or both VP4 and VP7 genes (1321) of probable bovine rotavirus origin. In these instances, however, no direct evidence for dual University of Ghana http://ugspace.ug.edu.gh infection of an individual subject with bovine and human rotaviruses were demonstrated. A recent study using RNA-RNA hybridization and sequencing techniques has demonstrated the occurrence in infants of an apparent dual infection with human and bovine rotaviruses (Nakagomi et al., 1994), Most of the big towns in the Greater Accra region have very poor sanitation due to the lack of toilet facilities and proper waste management, and animals and humans live in close contact. Under these conditions, it is tempting to speculate that the possibility exists that naturally occurring reassortment events may be taking place in this region of the country. Summary of conclusion This study has thus clearly demonstrated that: (i) the P[6]G[2] strain predominates in neonates in Accra at this time. Other^arrasual strains such as P[6]P[10]G[2], P[6]G[3], P[6]G[9], P[6]G[2]G[3] and P[6]P[10]G[9] were also detected. (ii) The high prevalence of mixed infection among different human rotavirus genogroups suggests the potential for reassortment between viruses from these genogroups. The presence of some untypeable rotavirus strains in this study may be an indication of the existence in Ghana o f strains with unusual genotypes. The study provides the first characterization of G and P type of neonatal strains in Ghana and also the first reported presence of novel P[6]P[10]G[2] and P[6]P[10]G[9] genotype combinations. It also indicates the presence of unusual human rotaviruses in circulation in Ghana The emergence of these strains strengthens the need to continue University of Ghana http://ugspace.ug.edu.gh surveillance of circulating strains especially in Africa for inclusion in a future rotavirus vaccine formulation. The results of this study has important implications for vaccine application in the country. Many studies have shown that rotavirus is less common in the first 6 months of life and that maternally-acquired antibodies in breastmilk contribute to the relative infrequency of rotavirus in this age group (McLean et al., 1981). This hypothesis no longer seems to hold as recent work including this study has shown that neonates are highly susceptible to rotavirus infections. Thus, the target age group for any such vaccination should be looked at more critically. 57 University of Ghana http://ugspace.ug.edu.gh REFERENCES: Adah MI, Rohwedder A, Olaleye DD, Werchau H. (1997). Serotype of Nigerian strains. Trop M ed hit Hlth, 43:267-273. Albert MJ, Unicomb LE, Bishop RE. (1987). Cultivation and characterization o f human rotaviruses derived from asymptomatic human with ‘super short’ RNA patterns. J Clin Microbiol', 25:183-5. Ando T, Montroe SS, Gentsch JR. (1995). Detection and differentiation o f antigemcally distinct small round-structured virses (Norwalk-like virses) by reverse transcription-PCR and Southern hybridization. J Clin Microbiol, 33:64-71. Arguelles MH, Villegas GA, Castello A, Abrami A, Ghiringhelli PD, Semorile L, Glikmann G. (1999). VP7 and VP4 genotyping of human group A rotavirus in Buenos Aires, Argentina. J. Clin. M icrobiol, 38:252-259. Arias CF, Lopez S, Espejo RT.(1982). Gene protein products of S A ll simian rotavirus genome. J Virol, 41:42-50. Armah GE, Mingle JAA, Dodoo AK, Anyanful A, Antwi R, Coomey J, Nkrumah F.(l 994).Seasonality of rotavirus infection in Ghana. Annals o f Tropical Paediatrics’, 14:223-230. 58 University of Ghana http://ugspace.ug.edu.gh Ball JM, Tian P, Zeng CQ, Morris AP, Estes M K (1996). Age dependent diarrhea induced by a rotaviral nonstructural glycoprotein. Science ; 272:101-4. Banatvala JE, Chrystie EL, Totterdell BM. (1978). Rotaviral infections in human neonates. J Am Vet M ed Assoc, 173:527-30. Bern C, Glass RI. (1994). Impact of diarrheal diseases worldwide. Marcel Dekker I n c 1- 26. Bern C, Martines J, de Zoysa I, Glass RI. (1992). The global problem of diarrhea: a ten year update. Bull World Health Organ, 70:705-14. Bhan MK, Lew JF, Sazawal S. (1993). Protection conferred by neonatal rotavirus infection against subsequent diarrhea. J In fect Dis; 168:282-7. Bishop RF, Davidson GP, Holmes IH. (1973). Virus particles in epithelial cells of duodenal mucosa from children with viral gastroenteritis. Lancet', 2:1281-1283. Bishop RF, Barnes GL, Cipraini E. (1983). Clinincal immunity after neonatal rotavirus, a prospective longitudinal study in young children. TV Engl'Med; 309:72-76. Brandt CD, Kim HW, Rodriguez WJ, Thomas L, Yolken RH, Arrobio AZ, Kapikian AZ, 59 University of Ghana http://ugspace.ug.edu.gh Parrot RH, Chanock RM. (1981). Comparison of direct electron microscopy, immune electron microscopy, and rotavirus enzyme-linked immunosorbent assay for detection of gastroenteritis viruses in children. J Clin M icrobiol; 13:976-981. Bridger JC, Woode GN. (1976). Characterization of two particle types of calf rotavirus../ Gen Virol; 31:245-250. Chen RT, Rastogi SC, Mullen JR. (1994). The vaccine adverse event reporting system (VAERS). Vaccine; 542-550. Chrystie IL, Totterdell BM, Banatvala JE. (1978). Asymptomatic endemic rotavirus infection in the newborn. Lancet; 1:1176-8. Cicirello HG, Das BK, Gupta A. (1994). High prevalence of rotavirus infection among neonates born at hospitals in Delhi, India: Predisposition of newborns to infection with unusual rotavirus. Pediatr Infect Dis J; 13:720-4. Clark HF, Borian FE, Bell LM, Modesto K, Gouvea V, Plotkin SA. (1988). Protective effect of WC3 vaccine against rotavirus diarrhea in infants during a predominantly serotype 1 rotavirus season. J Infect Dis; 158:87. Cohen J, Laporte J, Charpilienne A, Scherrer R. (1979). Activation of rotavirus polymerase by calcium chelation. Arch Virol.; 60:177-186. University of Ghana http://ugspace.ug.edu.gh Cook DA, Zbitnew A, Dempster G, Gerard JW. (1978). Detection of antibodies to rotavirus by counterimmunelectrophoresis in human serum, colostrum and milk. J Pediatr; 93:916-70. Cook SM, Glass RI. LeBaron CW, Ho M-S. (1990). Global seasonality of rotavirus I infections. Bull World Health Organization; 68:171-7. Coulson BS, Unicomb LE, Pitson GA, Bishop RF. (1987). Simple and specific enzyme immunoassay using monoclonal antibodies for serotyping human rotaviruses. J Clin M icro/; 25:509-515. Coulson BS, Kirkwood C. (1991). Relationship of VP7 amino acid sequence to monoclonal antibody neutralization of rotavirus and rotavirus monotype. J Virol; 65:5968-5974. Crawford SE, Labbe M, Cohen J, Burroughs MH, Zhan Y, Estes MK. (1994). Characterization of virus-like particles in insect cells. J Virol, 68:5945-5952. Cukor G, Blacklow NR, Capozza FE, Panjvani ZFK, Bednarek F. (1979). Persistence of antibodies to rotavirus in human milk. J Clin M icrobiol; 9:93-96. 61 University of Ghana http://ugspace.ug.edu.gh Das BK, Gentsch JR, Hoshino Y. (1993). Characterization of the G serotype and genogroup of New Delhi newbome rotavirus strain 116E. Virology; 197:99-107. David M, Bernard NF, Peter MH. (1995). Rotaviruses and their replication. Fields virology, 3rd edition; 2:1641. Duffy LC, Riepenhoff-Talty M, Byers TE, La Scolea LJ, Zielezny MA, Dryja DM, Ogra PL. (1986). Modulation of rotavirus enteritis during breastfeeding: implication on alterations in the intestinal bacterialflora. Am J Dis Child ; 140:1164-8. Dunn SJ, Greenberg HB, Ward RL. (1993). Serotype and genotypic characterization of human serotype 10 rotavirus from asymptomatic neonates. J Clin] 31:165-9. Edelman R. (1987). Perspective on the development and deployment o f rotavirus vaccines. Pediatr Infect Dis J\ 6:704-10. Espejo RT, Lopez S, Arias C. (1981). Structural polypeptide of simian rotavirus SA11 and the effect of trypsin. J Virol, 37:156-160. Estes MK, Graham DY, Mason BB.(1981). Proteolytic enhancement o f rotavirus infectivity: Molecular mechanisms. J Virol, 39:879-888. Estes MK, Graham DY, Petrie BL. (1985). Antigenic structure of rotaviruses. Van 62 University of Ghana http://ugspace.ug.edu.gh Regemortel MHV, Neurath (eds) immunochemistry of viruses. Elsevier, Amsterdam , pp 389-405. Estes MK. (1996). Rotaviruses and their replication. Fields Virology. 3rd edition, Lippincott Raven, Philadelphia, pp. 1625-1655. Flook PK, Wilson MD, Post RJ. (1992) The use of respective DNA probes in the analysis o f natural population of insects and parasites. In: Berry RJ, Crawford TJ, Hewitt GM. (eds) British Ecological Society / Blackwell Scietific publication, Oxford, pp 484-486. Flores J, Myslinski J, Kalica AR. (1982). In vitro transcription of two human rotaviruses. J Virol, 43:1032-1037. Flores J, Pere-Schael I, Boeggeman E. (1985). Genetic relatedness among human rotaviruses. J M ed Virol, 37:648-655. Flores J, Nakagomi 0 , Nakagomi T, Glass RI, Gorziglia M, Askaa J, Hoshino Y, Perez- Schael I, Kapikian AZ. (1986). The role of rotaviruses in paediatric diarrhea. Paediatr Infect Dis; Suppl, 5:S53-S60. Flores J, Taninuchi K, Green K, Perez-Schael 1, Garcia D, Sears J, Urasawa S, Kapikian 63 University of Ghana http://ugspace.ug.edu.gh AZ. (1988). Relative frequencies of rotavirus serotypes 1, 2, 3 and 4 in Venezuelan infants with gastroenteritis. J Clin Microbiol', 26:2092-5. Flores J, Perez-Schael I, Blanco M, White L, Garcia D, Vilar M, Cunto W, Gonzalez R, Urbina C, Boher J, Mendez M, Kapikian AZ. (1990). Comparison of reactogenicity and antigenicity of M37 rotavirus vaccine and rhesus-rotavirus based quadrivalent vaccine. Lancer, 336:330-3. Fukuhara N, Yoshie O, Kitaoka S, Konno T. (1988). Role of VP3 in human rotavirus internalization after target cell attachment via VP7. J Virol, 62:2209-2218. Gentsch JR, Glass RI, Woods P, Gouvea V, Gorziglia M, Flores J, Das BK, Bhan MK. (1992). Identification of group A rotavirus gene 4 types by polymerase chain reaction. J Clin Microbiol, 30:1365-1373. Gentsch JR, Woods PA, Ramanchandran M, Das BK, Alfieri A, Kumar R, Bhan MK, Glass RI. (1996). Review of G and P typing results from a global collection of rotavirus strains: implication for vaccine develpoment. J. Infect. Dis .174 (suppl. 1) S30-36. Glass RI, Keith J, Nakagomi O, Nakagomi T, Askaa J, Kapikian AZ, Chanock RM, Flores J. (1985). Nucleotide sequence of the structural glycoprotein VP7 gene of Nebraska calf diarrhea virus, comparison with homologous genes from four of University of Ghana http://ugspace.ug.edu.gh human and animal rotaviruses. Virology, 141:292-298. Gouvea V, Glass RI, Woods P, Taniguchi K, Clark HF, Forrester B, Fang ZY. (1990). Polymerase chain reaction amplification for typing of rotavirus nucleic acid from stool specimen. J. Clin. Microbiol, 28:276-282. Gouvea V, Santos N, Timemetsky MdoC. (1994). Identifiation of bovine and porcine G types by VCR. J Clin Microbiol, 32:1338-40. Graham DY, Estes MK. (1980). Proteolytic enhancement of rotavirus infectivity: Biologic mechanisms. Virol, 101:432-439. Green KY, Hoshino Y, Ikegami N. (1989). Sequence analysis of the gene encoding the serotype-specific glycoprotein VP7 o f two new human rotavirus serotypes. Virology, 168:429-433. Green KY, Midthun K, Gorziglia M, Hoshino Y, Kapikian AZ, Chanock RM, Flores J. (1987). Comparison of the amino acid sequences of the major neutralization protein of four human rotavirus serotypes. Virology, 161:153-159. Green KY, Sears JF, Taniguchi K, Midthun K, Hoshino Y, Gorziglia M, Nishikawa K, Urasawa S, Kapikian AZ, Chanock RM, Flores J. (1988). Paediatrisc human rotavirus serotypeby nucleotide sequence analysis of the VP7 protein gene. J. 65 University of Ghana http://ugspace.ug.edu.gh Virol; 62:1819-1823. Gurwith M, Wenman W, Hinde D. (1981). A prospective o f study of rotavirus infection in infants and young children. J. Infect Diseases', 144:218-224. Haffejee BE. Moosa A. (1990). Rotavirus studies in India (Asia) and South African infants with acute gastroenteritis. II. Clinical aspects and outcome. Ann Trop Paediatr, 10:245-54. Haffejee E. (1991). Review of infectious diseases. Ann Trop Paediatr, 13:957-962. Ho M-S, Glass RI, Pinsky PF, Anderson LJ. (1988). Rotavirus as a cause of diarrheal morbidity and mortality in the United States. J Infect Dis, 158:1112-6. Hoshino Y, Wyatt RG, Grenberg HB, Flores J, Kapikian AZ. (1984). Serotypic dimilarity and diversity o f rotaviruses of mammalian and avian origin as studied by plaque reduction neutralization. J Infect Dis', 149:694-702. Hoshino Y, Sereno MM, Midthun K. (1985). Independent segregation of two antigenic specificities (VP3 and VP7) involved in neutralization of rotavirus infectivity. Proc Natl Acad Sci USA', 82:8701-4. 66 University of Ghana http://ugspace.ug.edu.gh Hoshino Y, Saif LJ, Kang SY, Sereno MM, Chen WK, Kapikian AZ. (1995). Identification of group A rotavirus genes associated with virulence of a porcine rotavirus and host range restriction of a human rotavirus in the gnotobiotic piglet model. Virol, 209:274-280. Henry FJ, Bartholomew RK. (1990). Epidemiology and transmission of rotavirus infections and diarrhea in St. Lucia, W est Indies . M ed J ; 39:205-12. Herring AJ, Inglis NF, Oieh CK, Snodgrass DR, Menzies JD. (1982). Rapid diagnosis of rotavirus infection by direct detection of viral nucleic acid in silver stained polyacrylamide gels. J. Clin. M icrobiol, 16: 473-7. Institute of medicine. Prospects of immunizing against rotavirus. In :new vaccine development, establishing priorities. Disease of importance in the united states. (1990). Vol I. National academy press, Washington D.C, pp 410-423,1985. Bull world Health Organ', 68:171 -7. Jayashree S, Bhan MK, Kumar R, Bhandari N, Sazawal S. (1988). Protection against neonatal rotavirus infection by breast milk antibodies and trypsin inhibitors. J Med Virol, 26:333-8. Kalica AR, Flores J, Greenberg HB. (1983). Identification of the rotaviral gene that codes for hemagglutination and protease-enhanced plaque formation. Virology; University of Ghana http://ugspace.ug.edu.gh 125:194-205. Kapikian AZ, Chanock RM. (1996). Rotaviruses. In : Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B, Strans SE (eds) virology, vol 2. Lippincott-Raven publishers, philadelphia, pp 1657-1708. Kawasaki ES, Clark SS, Coyne MY, Smith SD, Champlin R, Witte ON, McCormick FP. (1988). Diagnosis o f chronic myeloid and acute lymphocytic leukemias by detection of leukemia-specific mRNA sequences amplified in vitro. Proc. Natl. Acad. Sci. USA; 85:5698-5702. Konno T, Suzuki H, Imai A, Kutsuzawa T, Ishida N, Katsushima N, Sakamoto M Kitaoka S, Tsuboi R, Adachi M. (1978). A long term survey of rotavirus infection in Japanese children with acute gastroenteritis. J Infect Dis; 138:569-76. Koopmans JS, Turkish VJ, Monto AS. (1984). Patterns and etiology o f diarrhea in three clinical settings. Am Epidemiol; 119:114-123. Laemmli, U.K. (1970). Cleavage of structural proteins during assembly of the head of bacteriophage T4, Nature; 227:680-685. Larralde G, Li B, Kapikian AZ, Gorziglia M. (1991). Serotype-specific epitope(s) present on the VP8 subunit of rotavirus VP4 protein, J Virol; 65:321 3-3218. 68 University of Ghana http://ugspace.ug.edu.gh Lopez S, Arias CF, Bell JR, Strauss JH, Espejo RT. (1985). Primary structure o f the cleavage site associated with trypsin enhancement of rotavirus SA11 infectivity. Virology; 144:11-19. Ludert JE, Michelangeli F, Liprandi F, Esparza J. (1987). Penetration and uncoating of rotaviruses in cultured cells. Intervirology; 27:95-101. Mata L, Simhon A, Urrutia JJ, Kronmal RA, Fernandez R, Garcia B. (1983). Epidemiology of rotaviruses in a cohort o f 45 Guatemalan Mayan Indian children observed from birth to the age of three years. J Infect Dis; 148:452-61. McLean M, Holmes IH. (1981). Effects of antibodies, trypsin and trypsin inhibitors on susceptibility of neonates to infection. J Clin M icrobiol; 13:22-9. Mullis KB, Faloona FA. (1987). Specific synthesis o f DNA in vitro via a polymerase- catalyzed chain reaction. Methods Enzymol; 155:335-350. Nagesha HS, Hum CP, Bridger JC, Holmes IT. (1988). Atypical rotaviruses in Australian pigs .Arch Virol, 102:91-98. Nakagomi 0 , Nakagomi T, Oyamada H. (1985). Relative frequency of human rotavirus subgroups I and II in Japanese children with acute gastroenteritis. J Med Virol; 109:381-3. University of Ghana http://ugspace.ug.edu.gh Nakagomi O, Ohshima A, Aboudy Y (1990) Molecular identification by RNA-RNA hybndizationof human rotavirus that is closely related to rotaviruses of feline and canine origin. J Clin M icrobiol; 28:1198-203. Nakagomi 0 , Isegawa Y, Ward RL. (1994). Naturally occurring dual infection with human and bovine rotaviruses as suggested by the recovery of G1P8 and G1P5 rotaviruses from a single patient .Arch Virol; 137:381-388. Nakata S, Adacgi S, Ukae S, Kagawa K, Numata K, Urasawa S, Chiba S. (1996). Outbreaks of nosocomial rotavirus gastroenteritis in a paediatric ward. Eur J Pediatr; 155:954-958. Perez-Schael I, Daoud G, White L. (1984). Rotavirus shedding by newborn children. J Med Virol, 14:127-136. Perez-Schael I, Guntinas MJ, Perez M, Pagone V, Rojas AM, Gonzelez BS. (1997) Efficacy of the rhesus-based quadrivalent vaccine in infants and young children in Venezuela. New Engl J Med; 337:1181-209. Petrie BL, Graham DY, Estes MK. (1981). Identification of rotavirus particle types. Intervirology; 16:20-28. 70 University of Ghana http://ugspace.ug.edu.gh Pittard WB m. (1979). Breast milk immunology. Am J Dis Child; 133:83-7. Rahman MM, Yamauchi M, Hanada N, Nishikawa K, Morishima T. (1987). Local production of rotavirus specific IgAin breast tissue and transfer to neoantes. Arch Dis Child, 62:401-5. Ramachandran M, Das BK, Vij A, Kumar R, Bhambal SS, Kesari N, Rawat H, Bhal L, Thakur S, Woods PA, Glass RI, Bhan MK, Gentsch JR. (1996). Unusual diversity of human rotavirus G and P types in India. J. Clin Microbiol, 34:386-439. Ramachandran M, Gentsch JR., Parashar VD, Jin S, Woods P A Holmes JL, Kirkwood CD, Bishop RF, Greenberg HB, Urasawa S, Gerna G, Coulson BS, Taniguchi K, Bresee JS, Glass RI, The National Rotavirus Strain Surveillance System Collaborating Laboratories. (1998). Detection and characterization of novel rotavirus strains in the United States. J Clin Microbiol; 36:3223-3229. RamigRF. (1994). Rotaviruses. Ram igRF eds. Springer-Verlag, Berlin, Heidelberg pp 183-186. Rodger SM, Bishop RF, Birch C, McLean B, Holmes IH. (1981). Molecular epidemiology of human rotaviruses in Melbourne, Australia, from 1973 to 1979, as determined by electrophoresis of genome ribonucleic acid ■/ Clin Microbiol; 13:272-8. University of Ghana http://ugspace.ug.edu.gh Rodriguez WJ, Kim HW, Brandt CD. (1980). Rotavirus gastroenteritis in the Washington area: Incidence of cases resulting in admission to hospital. Am J child ; 134:777- 779. Rodriguez WJ, Kim HW, Brandt CD, Gardner MK, Parrot RH. (1983). Use of electrophoresis o f RNA from human rotavirus to establish the identity of strains involved in outbreaks in a tertiary care nursery. J Infect Dis; 148:34-40. Ruggeri F M Marziano ML, Salvatori E, Bisicchia R, Scardellato U, Scagnelli M. (1992). Laboratory diagnosis of rotavirus infection in diarrheal patients by immunoenzymatic and latex agglutination assays. Microbiologica; 15:301-6. Silberstein L, Shulman LM, M endelsen E, Shif I. (1995). Distribution of both rotavirus VP4 genotypes and VP7 serotypes among hospitalized and non-hospitalized Israeli children. J Clin Microbiol.; 33:1421-2. Simhon A, Mata L, Vives M, Rivera L, Vargas S, Ramirez G, Lizano L, Catarmella G, Azofeifa J. (1985). Low endemicity and low pathogenicity of rotaviruses among rural children in Costa Rica. J Infect Dis; 152.1134-42. Sitbon M, Lecerf A, Garin Y, Ivanoff B. (1985). Rotavirus prevalence and relationships with climatological factors in Gabon, Africa. J Med Virol; 16:177-82. 72 University of Ghana http://ugspace.ug.edu.gh Synder ID, Merson MH. (1982). The magnitude of the global problem of acute diarrheal disease. Bull WHO; 60:605-613. Spencer EG, Avendano LF, Garcia BJ. (1983). Analysis o f human rotavirus mixed electrophoretypes. Infect Immun; 39:569-574. Steele AD, Garcia D, Sears J, Gerna G, Nakagomi O, Flores J. (1993). Distribution of VP4 gene alleles in human rotaviruses by using probes to the hyperdivergent region of the VP4 gene. J Clin Microbiol; 31:1735-1740. Steele AD, van Niekerk MC, Mphahlele MJ. (1995). Geographical distribution of human rotavirus VP4 genotypes and VP7 serotypes in five South African regions. J Clin Microbiol; 33:1516-19. Tamguchi K, Urasawa S, Urasawa T. (1985). Preparation and characterization of neutralizing monoclonal antibodies with diferent reactivity patterns to human rotaviruses. J. Gen. Virol; 66:1045-1053. Tao H, Changan W, Zhaoying F. (1984). Waterborne outbreak of rotavirus diarrhea in adults in China caused by a novel rotavirus. Lancet; 1:1139-1142. Timenesky MDST, Santos N, Gouvea V. (1994). Survey of rotavirus G and P types 73 University of Ghana http://ugspace.ug.edu.gh associated with human gastroenteritis in Sao Paulo, Brazil, from 1986-1992. J Clin Microbiol; 32:2622-4. Totterdell BM, Chrystie IL, Banatvala JE. (1976). Rotavirus infection in a maternity unit. Arch Dis Child; 51:46-49. Totterdell BM, Chrystie IL, Banatvala JE. (1980). Cord blood and breast-milk antibodies in neonatal rotavirus infection. BMJ; 280:828-30. Unicomb LE, Coulson BS, Bishop R. (1989). Experience with an enzyme immunoassay for serotyping human group A rotaviruses. J. Clin. Microbiol; 27:586-588. Urasawa S, Urasawa T, Taniguchi K, Wakasugi F, Kobayashi N, Chiba S, Sakurada N, Morita M, Morita O, Tokieda M. (1989). Survey of human rotavirus serotypes in different locales in Japan by enzyme-linked immunosorbent assay with monoclonal antibodies. J Infect Dis; 160:44-51. Urasawa T, Taniguchi K, Kobayashi N. (1993). Nucleotide sequence of VP4 and VP7 genes of a unique human rotavirus strain Mc35 with subgroup I and serotype 10 specificity. Virology; 195:766-71. Vonderfecht S, Hubber AC, Eiden J. (1984). Infectious disease of infant rats produced by a rotavirus-like agent. J Virol; 52:94-98. 74 University of Ghana http://ugspace.ug.edu.gh Walsh JA, Warren KS. (1979). Selective primary health care, an interim strategy for disease control in developing countries. N Engl J Med\ 302:967-974. Weinberg RJ, Tipton G, Klish W, Brown MR. (1984). Effects o f breast-feeding on morbidity in rotavirus gastroenteritis. Pediatrics', 74:250-3. Wilde J, Eiden J, Yolken R. (1990). Removal o f inhibitory substances from human faecal specimens for detection of group A rotaviruses by reverse transcriptase and polymerase chain reactions. J Clin Microbiol, 28:1300-1307. Woode GN, Bridger JC, Jone MJ, Flewett TH, Bryden AS, Davis HA, White GBB. (1976). Morphological and antigenic relationships between rotaviruses from acute gastroenteritis o f children, calves, piglets, mice and foals. Infect Immun, 14:804- 810. Woods PA, Gentsch J, Gouvea V, Mata L, Simhon A, Santosham M, Bai Z-S. Urasawa S, Glass RI. (1992). Distribution of serotypes of human rotavirus in different populations. J Clin Microbiol, 30:781-785. World Health Organization. (1990). Amanual for the treatment of diarrhea. Geneva:WHO. 75 University of Ghana http://ugspace.ug.edu.gh Yolken RH, Wyatt RG, Mata L, Urrutia JJ, Garcia B, Chanock RM, Kapikian AZ (1978) Secretory antibody directed against rotavirus in human milk-measurement by means of enzyme-linked immunosorbent assay. J Pediatr, 93:916-21 Yolken RH. Stopa PJ. (1979). Analysis o f nonspecific reactions in enzyme-linked immunosorbent assay testing for rotaviruses. J Clin M icrobiol; 10:703-7. Yolken RH, Bishop CA, Townsend TR. (1982). Infectious gastroenteritis in bone marrow transplant patients. N Engl J M ed ; 306:1009-1012. University of Ghana http://ugspace.ug.edu.gh APPENDIX I Reagents for PAGE Reagents for extraction process: (i) 0.1M NaCl (5.844g dissolved in 1000ml o f water) (ii) 0.2M Sucrose (68.4g o f sucrose dissolved in 1000ml o f water) (iii) 0.1M Tris-HCl, pH 8.0 (12.lg of Tns-HCl dissolved in 1000ml of water and pH adjusted to 8.0 with NaOH) (iv) 0.05M EDTA, pH 8.0 (18.612g of EDTA dissolved in 1000ml distilled water and pH adjusted to 8.0 with NaOH) (v) 0.5% SDS (0.5g of SDS in 100ml of distilled water) (vi) Bender Buffer; 100ml of 0.5M EDTA, pH 8.0 100ml of Tns-HCl, pH 8.0 5.844g of NaCl 68,46g of Sucrose 5g of SDS 1000ml of distilled water. APPENDICES J- University of Ghana http://ugspace.ug.edu.gh (vii) POTASSIUM ACETATE (KAc) solutions: 5M KAc (490.75g in 1000ml of distilled water) 8M KAc composed of; 600ml of 5M KAc 115ml of glacial acetic acid 285ml of distilled water. (vm) TE BUFFER pH 8.0: Stock Solutions: (i) 0.5MEDTA: 1 (ii) 1M Tris-HCl: 0.2ml of0 .5M E D T A pH 8.0 lm l of 1M Tris-HCl 98.8ml of distilled water Autoclaved. 86.12g ofNaOH 1000ml o f water 121.1 lg of Tris-HCl 1000ml of water ( ix ) PHOSPHATE BUFFERED SALINE (PBS) pH 7.4: 0.2M monobasic sodium phosphate 0.2M dibasic sodium phosphate 0.14M sodium hydroxide 78 University of Ghana http://ugspace.ug.edu.gh (x) Reagents for loading o f samples: 1. SAMPLE BUFFER: 1 Oml of stacking gel buffer 4ml of glycerol 20mg of Bromophenol blue 6ml of distilled water Autoclaved (xi) Reagents for casting o f gels Stock Solutions; (a) Separating Gel Buffer (3M Tris-HCl pH 8.8) 36.33g Tris-HCl dissolved in 100ml of distilled water and pH adjusted to 8.8 with NaOH (b) Stacking Gel Buffer (0.5M Tris-HCl) 6.05g Tris-HCl dissolved in 100ml of distilled water and pH adjusted to 6.8 with NaOH. 79 University of Ghana http://ugspace.ug.edu.gh (xii) 30% Acrylamide solution: 30g of acrylamide 0.8g of Bisacrylamide 100ml of distilled water filter through a 0.45uM filter Store in dark bottle at 4°C (xiii) Ammonium Persulphate: lm g of ammonium persulphate lm l of double distilled water (xiv) 5X SDS Electrophoresis Running Buffer: 151.1 g of Tris Base 5g of SDS 72g of Glycine 1000ml of distilled water Reagents for silver staining: Solution 1: Absolute ethanol 40ml Glacial acetic acid 5ml Double distiled water 55ml Solution 2: Absolute ethanol 10ml Glacial acetic acid 0.5ml 80 University of Ghana http://ugspace.ug.edu.gh Double distilled water Solution 3: Glacial acetic acid double distilled water Silver Nitrate solution: Developing solution: 89.5ml 5ml 95ml 0.4g of silver nitrate and 200ml of distilled water 7.5g ofNaOH pellets, 2ml of 36% formalin and 250ml of distilled water University of Ghana http://ugspace.ug.edu.gh Reagents for ELISA Diluent: Tris buffered saline containing antimicrobial agent and red dye Positive control: Inactivated bovine rotavirus (calf rotavirus strain 3209176)in buffer containing antimicrobial agent and red dye. Conjugate: Rotavirus specific rabbit polyclonal antibody conjugated to horseradish peroxidase in a buffered protein solution containing antimicrobial agent and blue dye. Washing buffer concentrate (x25): Tris buffered solution containing antimicrobial agent and detergent. Substrate part A: 25% N N Dimethylformamide, TMB and antimicrobial agent. Substrate part B' Hydrogen peroxide and antimicrobial agent. Stopping solution: 0.46mol/L sulphuric acid. APPENDIX II 82 University of Ghana http://ugspace.ug.edu.gh (i) Lysis Buffer L 2 180g o f Guanidmnium isothiocyanate 0.1M Tris-Hcl pH 6.4 (ii) Lysis Buffer L 6 60g o f Guanidinnium isothiocyanate 50ml o f 0.1M Tris-Hcl pH 6.4 11ml o f 0.2M ED TA pH 8.0 1.3g o f Triton X-100 (iii) Fractionated silica (iv) Absolute ethanol (v) Acetone (vi) Random primer Pd(N)6 (vii) 10X buffer II (viii) 50mM MgCL (ix) lOmM dNTPs (x) 200/ul M-MLV (xi) Taq poplymerase APPENDEX III Reagents for the Extraction process University of Ghana http://ugspace.ug.edu.gh a p p e n d ix IV Questionaire: 1. Name of Child ......... 2 Registration number / / / / / / / NEMCHD REGNUM 3 Age (days) / _ / _ / AGE 4. Is child breastfeeding Yes/__/ No/__/ BRESFED 5. Is child formula feeding Yes/__/ No/__/ FORFED 6 Has child diarrhea Yes/__/ No/__/ DIAHEA 7. Has child fever (>37.5) Yes/__/ No/__/ FEVER 8. Admin Temp / _ / _ / • / _ / ADTEMP 9. Temp, at collection / _ / _ / ■ / _ / COLTEM 10.Other comments. 84 University of Ghana http://ugspace.ug.edu.gh