Journal of Pharmaceutical and Biomedical Analysis 205 (2021) 114355 Contents lists available at ScienceDirect Journal of Pharmaceutical and Biomedical Analysis journal homepage: www.elsevier.com/locate/jpba Ultra Performance Liquid Chromatography-Quadrupole Time-of-Flight Mass Spectrometry (UPLC-Q-TOF-MS)-based metabolomic analysis of ]]]]]]]] ]] mycelial biomass of three Ganoderma isolates from the Lower Volta River Basin of Ghana Gideon Adoteya,⁎, Raphael N. Alolgab,⁎, Abraham Quarcooa, Mohammed Ahmed Gedela, Abraham K. Anangc, John C. Hollidayd a Science Laboratory Department, Accra Technical University, P.O. Box GP 561, Barnes Road, Accra, Ghana b State Key Laboratory of Natural Medicines, Department of Pharmacognosy, China Pharmaceutical University, Nanjing, China c Noguchi Memorial Institute for Medical Research (NMIMR), University of Ghana, Ghana d Mushroom Consulting LLC, Carson City, NV, USA a r t i c l e i n f o a b s t r a c t Article history: In this work, we sought to determine the differences and/or similarities in the metabolite composition of Received 1 April 2021 the mycelial biomass of three ganoderma isolates (Ganoderma LVRB-1, Ganoderma LVRB-9 and Ganoderma Received in revised form 17 August 2021 LVRB-17) from the Lower Volta River Basin of Ghana. The cultured mycelial mass of the three isolates were Accepted 28 August 2021 subjected to DNA sequencing. BLASTn searches of the internal transcribed spacer. (ITS) sequences of the Available online 1 September 2021 isolates were conducted in the GenBank and the data obtained subjected to ITS phylogenetic analysis. Thereafter, extracts of the cultured mycelial biomass of the three isolates were subjected to untargeted ultra Keywords: Metabolomics performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF-MS)- UPLC-Q-TOF-MS based metabolomic analysis. A cursory examination of the total ion chromatograms of the isolates gave Ganoderma isolates evidence of the differential levels of the metabolites present. Further analysis of the metabolomic data using Triterpenoids multivariate analysis better captured these marked differences in terms of the presence and/or levels of the Lower Volta River Basin of Ghana metabolites. Finally, four lanostane triterpenoids, namely ganoderic acid C6, ganoderenic acid A, Ganoderenic acid D and ganoderic acid G, together with two annotated compounds (ganoderic acids K and AM1) were detected in the mycelia biomass of the three ganoderma isolates from the Lower Volta River Basin of Ghana. The results provide the first ever metabolomic data on the chemical constituents of the mycelial biomass of ganoderma isolates from the Lower Volta River Basin of Ghana. © 2021 Published by Elsevier B.V. 1. Introduction healing of cold and flu symptoms when its smoke is inhaled and applied to infected skin to treat the wounds on children’s heads [2]. Mushrooms have been consumed by humans because of their In most Asian countries, Ganoderma popularly called “herb of spiri- nutritional and pharmaceutical properties since time immemorial. tual potency,” is regarded as a symbol of success, well-being, divine The genus Ganoderma under the division of Basidiomycota, for ex- power and longevity. Taoist priests in China reportedly were adding ample, holds an important place in food and traditional medical ganoderma mushrooms to a special magic potion to attain a state of systems of China, Japan, Korea [1] and some African countries. In higher consciousness [3]. The State Pharmacopoeia of the People’s Namibia, for example, ganoderma mushrooms are reported to have Republic of China [4] stated ganoderma mushrooms can be used to been used in relieving stress when sniffed as ash mixed with to- ease the mind and this may partly explain why this biomedical bacco, calming of nerves when put in water, used as a drink and fungus have been used in some ritual and cultural practices. Several bioactive compounds have been isolated from the my- celia, fruiting body and spores of ganoderma mushrooms. These bioactive compounds of ganoderma mushrooms include triterpe- ⁎ Corresponding authors. noids, steroids, polysaccharides, proteins, amino acids, alkaloids, E-mail addresses: Gadotey@atu.edu.gh (G. Adotey), nucleosides, and nucleotides [1,5]. Extracts and preparations from alolgara@cpu.edu.cn (R.N. Alolga). https://doi.org/10.1016/j.jpba.2021.114355 0731-7085/© 2021 Published by Elsevier B.V. G. Adotey, R.N. Alolga, A. Quarcoo et al. Journal of Pharmaceutical and Biomedical Analysis 205 (2021) 114355 this ancient biomedical fungus have been reported to have phar- 2.1.2. Production of mycelia biomass macological activities such as anticancer, immunomodulation, anti- A semi-solid medium of MEA was prepared in a petri plate and a inflammation, antioxidation and hepatoprotection [6]. Ganoderma small piece of a 10-day cultured pure mycelium of the isolate was polysaccharides, for example, are known to exert their pharmaco- placed in agar medium of the petri plate. This inoculated plate was logical activities primarily through enhanced mitogenicity and ac- incubated in the dark at 28 °C, 90% of relative humidity of air until tivation of some immune cells; leading to increase in the production primordial heads started forming. The mycelia biomass, a combi- of interferon (IFN)-γ and tumor necrosis factor (TNF-α) [7,8], en- nation of mycelium, primordia and extracellular compounds, was hanced cytotoxicity of cytotoxic T lymphocytes (CTLs) and natural harvested by gently scrapping from the surface of the agar plate for killer (NK) cells activity [8]. Ganoderma triterpenes (GTs), on the UPLC-Q-TOF-MS analysis. other hand, have been shown to suppress the inflammatory re- sponse in lipopolysaccharide (LPS) activated murine macrophages. 2.1.3. Molecular identification and phylogeny of ganoderma isolates GTs have been reported to suppress the secretion of inflammatory Three fruiting bodies resembling the genus Ganoderma from the cytokines (TNF-α and IL-6), inflammatory mediator, nitric oxide (NO) Lower Volta River Basin were subjected to DNA sequencing to fa- and prostaglandin E2 (PGE2) from LPS-stimulated murine RAW264.7 cilitate their identification. BLASTn searches of the ITS sequences of cells. Mechanistically, GTs mediate their anti-inflammatory activity the three isolates in comparison with the reference sequences at the through inhibition of the transcription factor, NF-κB [9,10]. Gano- GenBank of National Centre of Biotechnology Information (NCBI) derma has been identified as one of the herbal anti-inflammatory were initially made to confirm that the fungal isolates were species agents that can suppress the secretion of inflammatory cytokines of Ganoderma and the data matrices generated subjected to ITS and prevent the development of diseases associated with chronic phylogenetic analysis by Bayesian Inference (BI) approach [13] to inflammation [11]. Owing to the wide range of biological activities, establish their phylogenetic positions. the commercialization of ganoderma products is increasing world- wide and are in high demands in many health shops in Asian, 2.1.4. Preparation of mycelial biomass for UPLC-Q-TOF-MS analysis Western and European [12] and now in most West African countries A 0.02 g quantity of fresh mycelial biomass was weighed and cold including Ghana. macerated with 500 µL methanol (containing 0.1% v/v formic acid) at Through a mycological survey and molecular phylogenetic study, 4 °C for 48 h and ultrasonicated (100 Hz) for at 25 °C for 3 min. Each three novel ganoderma isolates have been identified from the Lower sample was then centrifuged using Eppendorf 5430 R at 9838 x g for Volta River Basin of Ghana, West Africa. These isolates, however, 5 min at 4 °C and the supernatant filtered through 0.22 µm pore size have not been characterized for their metabolite composition and sintered glass filter. The quality control sample consisted of a mix- possible identification of their major bioactive secondary metabo- ture of equal volumes of all samples (100 µL of each). A 5 µL aliquot lites. There is, therefore, a need to study the metabolome of gano- of each mycelium biomass was injected for UPLC-Q-TOF-MS analysis. derma isolates from the Lower Volta River Basin of Ghana to provide insight into their biopharmaceutical potentials and possible clinical 2.1.5. UPLC-Q-TOF-MS analysis applications. The goal of this study was to study the metabolome of Chromatographic separations were performed with an Agilent mycelial biomass, (a combination of myceliaa, primordia and ex- 1290 series (Agilent Corp., Santa Clara, CA, USA) HPLC system tracellular compounds) of three novel ganoderma isolates from the equipped with a binary pump, micro degasser, an autosampler and a Lower Volta River Basin of Ghana to unlock their nutraceutical and temperature-controlled column compartment. Chromatographic biopharmaceutical potentials. separations were done on an ACQUITY UPLC HSST3 ODS column (1.8 µm, 2.1 mm × 100 mm; Waters, Ireland). The mobile phase consisted of two solvents, A and B. Mobile phase A was 0.1% formic 2. Materials and methods acid water and B was acetonitrile. This mobile phase system was run in a gradient elution as follows: 25% B at 0–2 min; 25–42% of B at 2.1. Chemicals and reagents 2–20 min; 42–75% of B at 20–35 min; 75–95% of B at 35–40 min; 95–25% of B at 40–42 min. The oven temperature was set to 40 °C Former acid (HPLC grade), methanol (HPLC grade) and acetoni- and the injection volume was 5 µL. Flow rate was 0.4 mL/min. Before trile (LC-MS grade) were purchased from Sigma–Aldrich, St. Louis, each injection, the column was equilibrated for 5 min with 25% of MO (USA). Ganoderenic acid A (CAS No. 100665-40-5), ganoderic phase B. The samples were injected randomly. The QC sample was acid G (CAS No. 98665-22-6), ganoderenic acid D (CAS No. 100665- initially injected three times to equilibrate the column prior to the 43-8), ganoderic acid C6 (CAS No. 105742-76-5) were bought from injections of the samples and injected after every injection of the Yuanye biotechnological Ltd (China). Purified water was obtained samples. Solutions of all reference compounds were subjected to from Milli-Q water system (Millipore, USA). Aantibiotics malt extract same analytical conditions. agar (AMEA) was bought from Fungi Perfecti, LLC (USA). Separated components were detected with Agilent 6545 A Q-TOF mass spectrometer (Agilent Corp., Santa Clara, CA, USA) equipped 2.1.1. Ganoderma tissue isolation with an ESI interface. For MS/MS analysis, the following operating Freshly collected fruiting bodies of Ganoderma LVRB-1, parameters were used: drying N2 gas flow rate, 11 L/min; tempera- Ganoderma LVRB-9 and Ganoderma LVRB-17 collected from the ture, 350 °C; nebulizer, 35 psig; capillary, 3000 V; skimmer, 65 V; Lower Volta River Basin of Ghana were surface sterilized with 70% OCT RFV, 750 V, fragmentor 175 V. An auto MS/MS was achieved in alcohol, cut with sterilized scalpel longitudinally and a small piece of the negative ion mode in m/z range of 60–1000. At the scan rate of tissue fragments was taken aseptically from the inner core of the 2.0 spectra/sec using fixed collision energies (10.00, 20.00, 40 eV) fruiting body. The isolated tissue fragment was placed on antibiotic MS/MS data were acquired with isolation width MS/MS malt extract agar (AMEA) prepared following the manufacturer’s medium (~4 amu). instructions (Fungi Perfecti, LLC (USA) in a petri plate and incubated in the dark at 28 °C for 10 days. The resulting mycelium of each 2.1.6. Data processing ganoderma isolate was transferred to malt extract agar (MEA), The raw LC-MS spectral data were initially transformed to the consisting of 2% w/v malt extract, 1.5.0% w/v agar without antibiotic “.mzdata” format using the Agilent DA-reprocessor software (version and cultured for another 10 days to obtain pure mycelium of the B.06.00, Agilent Technologies). Therein, the threshold of 5000 counts fungal culture. was set for the peak heights. The data obtained were the run by 2 G. Adotey, R.N. Alolga, A. Quarcoo et al. Journal of Pharmaceutical and Biomedical Analysis 205 (2021) 114355 XCMS package (http://metlin.scripps.edu/download/) on the R plat- the premise that identical ganoderma isolates would produce si- form to pretreat the data which included peak discrimination, fil- milar mass spectral features in terms of the presence and abundance tering and alignment. The 80% rule was applied in the treatment of of the components, whereas those of different isolates would gen- missing values. Finally, prior to multivariate analysis, the pretreated erate different mass spectra features. The representative total ion data were normalized by the relative peak abundance. The resultant chromatograms (TIC) of the mycelial biomass of the three gano- data were then analyzed using R software (R 3.6.1) to construct the derma isolates are shown in Fig. 2. partial least squares-discriminate analysis (PLS-DA) and heatmap A cursory examination of the chromatograms reveals that the using the R packages ‘vegan’ and ‘pheatmap’ respectively. The hier- mycelial biomass of the three ganoderma isolates are un- archical clustering dendrogram was constructed using the distance ambiguously different from each other. The subtle differences be- measure option “euclidean” and clustering algorithm, “ward” using tween them were more significantly captured in the metabolomics same R software (R 3.6.1). The differences between the samples in analyses. Partial least squares discriminate analysis (PLS-DA), a terms of metabolite levels were captured by these three multivariate commonly used classification method for modeling the discrimina- algorithms. tion between species based on the levels of their metabolites, was employed to analyze the LC-MS data and the score plot is given in 2.1.7. Identification of metabolites Fig. 3A. As shown, the clusters of the mycelial biomass of the ga- Chemical composition of the mycelial biomass was determined noderma isolates are well separated in the PLS-DA plot. The clusters on the basis of the mass spectral data (fragmentation patterns) of of Ganoderma LVRB-17 and Ganoderma LVRB-9 are located in the each metabolite with reference to relevant published literature upper left and lower left quadrants of the PLS-DA plot, respectively, [14–16] and reference compounds (ganoderic acid C6, ganoderenic while clusters of Ganoderma LVRB-1 are located in middle of the acid A, ganoderenic acid D, and ganoderic acid G). right upper and lower quadrants of the PLS-DA plot, indicating ex- plicit difference among the three ganoderma isolates. Also, the 3. Results metabolome differences between the cultured biomass of the ga- noderma isolates were captured in a heatmap (Fig. 3B). As illu- 3.1. Molecular identification and phylogeny of ganoderma isolates strated, the ganoderma samples G1 = LVRB-1, G1.1 = LVRB-1.1, G9 = LVRB-9, G9.9 = LVRB-9.9 and G17 = LVRB-17, G17.1 = LVRB-17.1, The results of the ITS BLASTn search (Table 1) revealed that first exhibited marked variations in their secondary metabolite compo- isolate designated Ganoderma LVRB-1 had a high level of DNA se- sition. Finally, the similarities and differences in the metabolomes of quence similarity (99.47%) with G. enigmaticum whereas the second the various ganoderma isolates were captured in the hierarchical the isolate labelled Ganoderma LVRB-9 had a high level of sequence clustering dendrogram (Fig. 3C). similarity (98.72%) with G. weberianum. The third isolate designated Ganoderma LVRB-17 similarly had a high level of sequence similarity 3.3. Identification triterpenoids (99.48%) with G. resinaceum. Bayesian analysis of the ITS sequences revealed that Ganoderma LVRB-1 belongs to the species G. en- We sought to identify as much as possible the presence of tri- igmaticum whereas Ganoderma LVRB-17 belongs to G. resinaceum. terpenoids in the cultured mycelial biomass of the three ganoderma The third isolate designated, Ganoderma LVRB-9, however, matched isolates. In order to confirm or otherwise the identities of the tri- with G. weberianum (99.24%) and G. sichuanese (98.73%) (Fig. 1) in terpenoids, 4 compounds were identified based on the retention times the ITS BLASTn search. and fragmentation patterns of their reference compounds but two other two triterpenoids were detected in the present study annotated 3.2. Mycelial biomass metabolomic differences with reference to relevant published literature. The structures of these compounds are illustrated in Fig. 4. Similar to previous studies, ex- To systematically compare the similarities and differences in tracts of the ganoderma isolates were analyzed in the negative ion terms of the chemical components of Ganoderma LVRB-1, mode using electrospray ionization. This mode was found to be more Ganoderma LVRB-9 and Ganoderma LVRB-17, UPLC-Q-TOF-MS-based sensitive and appropriate for the triterpenoids. A common pattern of metabolomics approach was employed. This approach is based on the fragmentation pertained to losses of H2O and CO2 and Table 1 ITS sequence of isolate (A) Ganoderma LVRB-1, (B) Ganoderma LVRB-9 and (C) Ganoderma LVRB-17 from the Lower Volta River Basin of Ghana. Species ID DNA sequence Sequence similarity (%) showing species of top matching candidate Ganoderma GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTAT- Ganoderma LVRB-1 TCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTGCAACCTCTTTGCGGAGTTTGTAGGCTTGGACTTGGAGGGCTTGTCGGCCTTTA- enigmaticum ACGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCRGATCGGCTGTCGGTGTGATAAAATGTCTACGCCGTGACCGTGAAGCGTTTGGATGA- voucher GCTTCCAACCGTCTTGSTTCAAAGACAACTTTTTATGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Ghana1a/ 93839899.49% Ganoderma CATTATCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTGCTGTGGGTTTCAAA- Ganoderma LVRB-9 CGTCGTAAAGCGAGTCTCTTTACCGAGCTTGTAGAGCGGCGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGT- weberianum AACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCACCGATGAAGAACGCAGCGAAATGCGATAAAATGTGAATTGCAGAATTCAG- strain CBS TGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACAGACCTTTGCA 12858199.24% and Ganoderma sichuanese 98.73% Ganoderma GTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACAC- Ganoderma LVRB-17 CCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTCCAGACGTTGTGAAGCGGGCTCTTTACGGAGCTTGTAAAGCGGCGTGCCTGTGCCTG- resinaceum CGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGCTCTTGGCTCTCGCATCGATG- isolate F- AAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAG 299.48% 3 G. Adotey, R.N. Alolga, A. Quarcoo et al. Journal of Pharmaceutical and Biomedical Analysis 205 (2021) 114355 Fig. 1. Bayesian posterior probability (BPP) tree showing the phylogenetic position of Ganoderma collections from the Lower Volta River Basin of Ghana in comparison with reference ITS rDNA sequences at the GenBank of National Centre of Biotechnology Institute (NCBI). Trametes hirsuta CLF6 and Trametes hirsuta P8 were used as outgroups. Numbers at the branch nodes represent BPP values. Fig. 2. Representative total ion chromagrams (TIC) of cultured mycelial biomass of three species of Ganoderma. A = Ganoderma enigmaticum (LVRB-1); B = Ganoderma LVRB-9; C = Ganoderma resinaceum (LVRB-17). 4 G. Adotey, R.N. Alolga, A. Quarcoo et al. Journal of Pharmaceutical and Biomedical Analysis 205 (2021) 114355 Fig. 3. Presentation of the metabolomic differences between the species of Ganoderma analyzed. (A) PLS-DA score plot showing the discrimination the metabolome of the various Ganoderma species [R2Y(cum) = 0.962; Q2(cum) = 0.710]. (B). Heatmap representation of the metabolite differences between three Ganoderma species analyzed. (C). Hierarchical clustering dendrogram of all samples analyzed. G1 = LVRB-1, G1.1 = LVRB-1.1 mean two different samples of Ganoderma LVRB-1 strains; G9 = LVRB-9, G9.1 = LVRB-9.1 represent two samples of strain of Ganoderma LVRB-9 strain; G17 = LVRB-17, G17.1 = LVRB-17.1 are two samples of Ganoderma LVRB-17 strains. rearrangement of fragments. The maximum mass error recorded for molecules of H2O and CO2. For instance, m/z value 496.2180 corre- the molecular ions of all the compounds was ± 3.3258 ppm which sponds to losses of 2 H2O and loss of 3H atoms ([M－H－2 H2O－ meets the requirement for qualitative analysis. Details of the identi- 3 H]－); m/z 467.2801 represents [M－H－CO －H － 2 2O] etc. fication are described here and summarized in Table 2. (Supplementary Fig. S1). This pattern of fragmentation was con- Compound 1 which was detected at 30.752 min, was identified as firmed using reference compound. ganoderic acid C6 based on the product ion, [M－H]－ 529.2810 and The product ion, [M－H]－ 571.2932 of compound 2 yielded the corresponding fragment ions of m/z values 511.2707, 496.2180, fragment ions of m/z values 553.3533, 529.3535, 511.3429. m/z value 467.2801, 437.2318, 303.1602, 273.1458, 209.3146. The fragment ion of 553.3533 is the result of the loss of a H2O molecule by the product of m/z value 511.2707 is the product of a loss of water molecule by ion, thus, [M－H－H2O]－. Sequential losses of a HCOOH molecule the product ion, [M－H－H O]－2 . The rest correspond to losses of and a H2O molecule from the product ion respectively account for m/ Fig. 4. Chemical structures of triterpenoids identified in all three Ganoderma species. 5 G. Adotey, R.N. Alolga, A. Quarcoo et al. Journal of Pharmaceutical and Biomedical Analysis 205 (2021) 114355 z values 529.3535, 511.3429. Specifically, m/z 529.3535 represents [M －H－HCOOH]－, while m/z 511.3429 is [M－H－HCOOH－H －2O] . Based on the observed pattern of fragmentation with reference to the work of Hennicke et al. [11], compound 2 was annotated as ganoderenic acid K (Supplementary Fig. S2). Compound 3 which was annotated as ganoderic acid AM1 (Supplementary Fig. S3) at a retention time of 33.592 min presented with the product ion, [M－H]－ 513.2856 and fragment ions, 495.2752, 469.2963, 451.2858. m/z 495.2752 corresponds to [M－H －H － 2O] while [M－H－CO ]－ 2 represents m/z 469.2963 and m/z 451.2858 corresponds to [M－H－CO －H O]－2 2 . Compounds 4–6 were identified on the basis of the fragmenta- tion patterns and retention times of their reference compounds. Compound 4 was identified as ganoderenic acid D (product ion, [M －H]－ 511.2701). The fragment ions represent the following frag- mentation pattern: m/z 493.2597 [M－H－H2O]－; m/z 449.2700 [M －H－CO2－H2O]－ etc (Supplementary Fig. S4). The product ion of compound 5 was [M－H]－ 513.2860 with fragments of the following m/z values 495.2752, 465.2677, 381.2426, 301.1822, 211.0972, 193.0873, 167.0714, 123.0814. Similar to the other triterpenic acids, the pattern of fragmentation of this compound which was confirmed to be ganoderenic acid A basically involved the losses of CO2 and H2O molecules. For instance, the following represent the characteristic patterns of fragmentation for these fragment ions: m/z 495.2752 is [M－H－H2O]－; m/z 381.2426 is [M －H－3CO －2] ; m/z 301.1822 is [M－H－4CO － 2－2H2O] etc. (Supplementary Fig. S5). Finally, compound 6 which was detected at 40.392 min, was identified as ganoderic acid G based on the product ion, [M－H]－ 531.2964 and corresponding fragment ions of m/z values 513.2858, 469.2956, 301.1820, 265.1443, 203.1444. The fragmentation pattern of these ions is summarized as follows: m/z 513.2858 [M－H－ H O]－2 ; m/z 469.2956 [M－H－CO －2－H2O] ; m/z 301.1820 [M－H－ 4CO2－3H O]－2 ; m/z 265.1443 [M－H－4CO2－5H O]－2 ; m/z 203.1444 [M－H－5CO2－6 H2O]－ (Supplementary Fig. S6). The results of this metabolomic study provides further evidence that the mycelial biomass of the three isolates differ in their meta- bolite compositions. All the 4 compounds positively identified were present in both Ganoderma LVRB-1 and Ganoderma LVRB-17 and but only Ganoderic acid G was detected in Ganoderma LVRB-9 (Table 2). As described earlier, the amounts of metabolites vary significantly among the three ganodema isolates. Even though the other three triterpenoids were not found in the mycelia biomass of Ganoderma LVRB-9, the level of Ganoderic acid G in this particular isolate was more abundant as compared to the other two ganoderma isolates. 4. Discussion The medical fungus ganoderma is receiving a special attention in the nutriceutical and cosmetic industries because of its rich mac- ronutrients and bioactive compounds. Pharmacokinetics studies revealed ganoderic acids are the major bioactive components of the medicinal mushroom ganoderma with structures closely related to lanostane tetracyclic triterpenoids [17]. Metabolomics is one of the most powerful tools for identification of fungal species through ex- haustive profiling of their metabolites. In this study, a combination of ultra performance liquid chromatography-quadrupole time-of- flight mass spectrometry (UPLC-Q-TOF-MS), ultra performance li- quid chromatography–tandem mass spectrometry (UPLC-MS/MS) and multivariate statistical analysis was employed to systematically profile the secondary metabolites of the mycelial biomass of three ganoderma isolates collected from the Lower Volta River Basin of Ghana to help unlock their nutraceutical, cosmeceutical and bio- pharmaceutical applications. The results of the total ion chromatogram (TIC) showed variation in the metabolite profile of the mycelial biomass of the three 6 Table 2 Details of secondary metabolites (triterpenoids) identified in Ganoderma species. No. RT (min) Formula Cal. m/z [M-H]- Det. m/z [M-H]- ∆ ppm MS/MS fragmentation Identity Ganoderma species A B C 1 30.752 C30H42O8 529.2807 529.2810 0.5668 511.2707, 496.2180, 467.2801, 437.2318, 303.1602, 273.1458, 209.3146 Ganoderic acid C6a Present Present Absent 2 32.232 C32H44O9 571.2913 571.2932 3.3258 553.3533, 529.3535, 511.3429 Ganoderenic acid K Present Present Absent 3 33.592 C30H42O7 513.2858 513.2856 0.3896 495.2752, 469.2963, 451.2858 Ganoderic acid AM1 Present Present Absent 4 33.607 C30H40O7 511.2701 511.2701 0.0000 493.2597, 449.2700, 416.2314, 374.1863, 329.1749, 301.1811 Ganoderenic acid Da Present Present Absent 5 34.596 C30H42O7 513.2858 513.2860 0.3896 495.2752, 465.2677, 381.2426, 301.1822, 211.0972, 193.0873, 167.0714, 123.0814 Ganoderenic acid Aa Present Present Absent 6 40.392 C30H44O8 531.2963 531.2964 0.1882 513.2858, 469.2956, 301.1820, 265.1443, 203.1444 Ganoderic acid Ga Present Present Present A = Ganoderma LVRB-1; B = Ganoderma LVRB-17; C = Ganoderma LVRB-9. a Denotes compounds confirmed with reference compounds. G. Adotey, R.N. Alolga, A. Quarcoo et al. Journal of Pharmaceutical and Biomedical Analysis 205 (2021) 114355 ganoderma isolates. The PLS-DA score plot has also revealed that the angiotensin II, which increases blood pressure by its vasoconstrictive mycelial biomass of the three ganoderma samples unambiguously effect and promotes sodium and water retention in the body [23]. separated into three distinct clusters based on their mass spectra. Ganoderenic acid A identified in Ganoderma LVRB-11 and Gano- This finding is also consistent with our DNA phylogenetic tree, which derma LVRB-1, and ganoderic acid G found in all the three isolates suggested the three isolates from the Lower Volta Basin of Ghana have been shown to inhibit hydrolyzing activity of angiotensin- belongs to three different species namely G. enigmaticum, G. re- converting enzyme (ACE) [24]. This finding is very interesting sinaceum and G. weberanium-sichuanese complex. The variation in because current evidence indicates that angiotensin-converting en- the metabolite profile of the three isolates has also been further zyme inhibitors (ACEI) reduce mortality in cardiovascular disease clarified in the heatmap. and the progression of chronic kidney disease. This probably may The results further revealed that by combining the UPLC-Q-TOF- explain why angiotensin-converting enzyme inhibitors (ACEI) are MS and UPLC-MS/MS, lanostane tetracyclic triterpenoids could be considered as the cornerstone for the treatment of heart failure and detected from the mycelial biomass of the three ganoderma isolates. hypertension [25]. It is also known that elevated plasminogen acti- [18] in a similar study, detected lanostane tetracyclic triterpenoids as vator inhibitor-1(PAI-1) levels are associated with increased cardi- the main metabolites from the primordial stage of G. lingzhi, another ovascular risk. ACEI have been shown to lower PAI-1 levels and polypore fungus belonging to the division Basidiomycota by LC-MS increase the release of tissue plasminogen activators (tPA) through analysis [18]. In this study where secondary metabolites in G. lingzhi elevated bradykinin and thereby prevents the formation of blood were profiled by means of LC-IT-TOF-MS data, in combination with clot [26]. In a multicenter retrospective study, in-hospital use of ACEI multivariate analysis, triterpenoids including ganoderenic acid C, or angiotensin II receptor blockers (ARB) was associated with lower ganoderic acid C2, ganoderenic acid A, ganoderic acid K, ganoderic risk of all-cause mortality due to COVID-19 compared with either acid H, ganoderic acid A, and ganoderenic acid D were found, to- nonuse of ACEI/ARB or use of a different class of antihypertensive gether with some other unidentified metabolites at the primordial agent among patients with hypertension [27]. Since ganoderenic stage [18]. In another study, ganoderic acid A, ganoderenic acid A, acids A and G have been demonstrated to inhibit hydrolyzing activity ganoderic acid B, ganoderic acid H, ganoderic acid C2, ganoderenic of angiotensin-converting enzyme their detection in these two ga- acid D, ganoderic acid D, ganoderenic acid G, ganoderic acid Y, noderma isolates from the Lower Volta River may be useful in the kaemferol, genistein and ergosterol were identified from the G. lu- treatment of heart failure and hypertension regardless of COVID-19 cidiun extract by HPLC, EI-MS and NMR [19]. and therefore worthy of further investigation. In another interesting In this current study, 4 triterpenoids were identified from the study, ganoderenic acid A exhibited aldose reductase inhibitory ac- mycelial biomass of the three ganoderma isolates from the Lower tivity [28]; thereby reducing secondary complications induced by Volta River Basin of Ghana. The identified triterpenoids include ga- diabetes, specifically in tissues in which glucose uptake is not in- noderic acid C6, ganoderenic acid A, ganoderenic acid D, and gano- sulin-dependent. In our current study, ganoderenic acid A was de- deric acid G. Besides the above four triterpenoids, ganoderenic acid tected in the mycelia biomass of Ganoderma LVRB −1 and Ganoderma K and ganoderenic acid AM1 were annotated from Ganoderma LVRB- LVRB-17. The combination of ACE inhibitory and aldose reductase 1 and Ganoderma LVRB-17 collected from the Lower Volta River inhibitory activity of ganoderenic acid A, suggest Ganoderma LVRB-1 Basin of Ghana. Intriguingly, ganoderic acid G was the only tri- and Ganoderma LVRB-17 from the Lower Volta River Basin of Ghana terpenoid successfully identified in Ganoderma LVRB-9 although may be useful as antihypertensive and human aldose reductase in- several other unknown metabolites were present in relatively higher hibitory agent for treating hypertension and diabetic polyneuro- quantities. pathy, a common complication of diabetes mellitus that causes pain The identified triterpenoids in this study have been reported to and sensory and motor deficits in the arms and legs [29]. be associated with a number of interesting biological activities. Ganoderic acid C6 and ganoderic acid G, for example, have been shown to exhibit antinociception using the acetic acid-induced 5. Conclusion and study limitation writhing method [20] whereas ganoderenic acid D was reported have to cytotoxic effect against cervical (HeLa), colon (CaCo-2), and In conclusion, the outcome of this study revealed marked dif- liver (HepG2) cancer cells [21]. ferences in the chemical composition of the three ganoderma iso- It is known that most fatal mushroom poisonings are caused by lates as clearly captured by the heatmap, and PLS-DA score plot species belonging to the genus Amanita because of the presence of analyses. A total of 4 lanostane triterpenoids, namely ganoderic acid α-, β- and γ-amanitin, which inhibit RNA polymerase II and thereby C6, ganoderenic acid D, ganoderenic acid A and ganoderic acid G blocks the synthesis of proteins, leading to cell death. Wu were found in Ganoderma LVRB-1 and Ganoderma LVRB-17, together et al. showed that ganoderic acid G from G. lucidum has hepato- with ganoderenic acid K and ganoderenic acid AM1 as annotated protective effects on liver injury induced by α-amanitin (α-AMA) in compound, which their identity need to be confirmed with pure mice, thereby reducing mortality rates [22]. The finding suggest that reference compounds. In the current study, although ganoderic acid Ganoderma LVRB-1, Ganoderma LVRB-9 and Ganoderma LVRB-17 G was the only lanostane triterpenoids successfully detected in the collected from the Lower Volta River Basin of Ghana may possess isolate designated Ganoderma LVRB-9; which belongs to the species hepatoprotective effects on acute liver injury induced by α-AMA Ganoderma weberianum-sichuanese complex, several other unknown because of the presence of ganoderic acid G. Thus collectively, Ga- metabolites were present together with ganoderic acid G. This study noderma LVRB-1, Ganoderma LVRB-9 and Ganoderma LVRB-17 may provides the first ever metabolomic data on the chemical con- possess anticancer, hepatoprotective and anti-nociceptive effects stituents of the mycelial biomass of these three ganoderma isolates due to the presence of their bioactive components. Since the tri- from the Lower Volta River Basin of Ghana. terpenoids in the three ganoderma isolates have been reported to The main limitation of this study stems from the fact that most of have various biological activities, specific condition products can be the secondary metabolites particularly the abundant ones could not prepared from their mycelial biomass, which comprises of mycelium be identified due to the unavailability of reference compounds. In and primordia and extracellular compounds. future studies, with the aid of reference compounds we would Angiotensin‐converting enzyme (ACE) is a zinc metallopeptidase broaden the scope of the compounds to seek for and identify in these that plays a vital role in the regulation of vascular tone. ACE func- species of ganoderma. Other studies including bioassay-guided iso- tions by converting the inactive peptide angiotensin I into active lations of compounds and bioactivity studies would be conducted. 7 G. Adotey, R.N. Alolga, A. Quarcoo et al. Journal of Pharmaceutical and Biomedical Analysis 205 (2021) 114355 CRediT authorship contribution statement [11] N. Bhardwaj, P. Katyal, A.K. Sharma, Suppression of inflammatory and allergic responses by pharmacologically potent fungus Ganoderma lucidum, Recent Pat. Inflamm. Allergy Drug Discov. 8 (2) (2014) 104–117. GA, RNA, AKA conceived and designed the study. RNA, AKA, JCH [12] S. Wachtel-Galor, J. Yuen, J.A. Buswell, I. Benzie, Ganoderma lucidum (Lingzhi or supervised the study. GA, RNA, MAG, AQ performed the various ex- Reishi): a medicinal mushroom (et. al.), in: I. Benzie (Ed.), Herbal Medicine: perimental work. GA, AQ, MAG wrote a draft of the manuscript Biomolecular and Clinical Aspects, second ed., CRC Press/Taylor & Francis, 2011. which was cross-checked RNA, AKA and JCH. RNA received funding [13] H.A. Raja, A.N. Miller, C.J. Pearce, N.H. Oberlies, Fungal identification using mo-lecular tools: a primer for the natural products research community, J. Nat. Prod. for the study. 80 (3) (2017) 756–770, https://doi.org/10.1021/acs.jnatprod.6b01085 [14] F. Hennicke, Z. Cheikh-Ali, T. Liebisch, J.G. Maciá-Vicente, H.B. Bode, Declaration of Competing Interest M. Piepenbring, Distinguishing commercially grown Ganoderma lucidum from Ganoderma lingzhi from Europe and East Asia on the basis of morphology, molecular phylogeny, and triterpenic acid profiles, Phytochemistry 127 (2016) The authors declare that they have no known competing fi- 29–37. nancial interests or personal relationships that could have appeared [15] H. Xin, L. Fang, J. Xie, W. Qi, Y. Niu, F. Yang, D. Cai, Y. Zhang, Z. Wen, Identification and quantification of triterpenoids in Lingzhi or Reishi medicinal mushroom, to influence the work reported in this paper. Ganoderma lucidum (Agaricomycetes), with HPLC-MS/MS methods, Int. J. Med. Mushrooms 20 (10) (2018) 919–934. Acknowledgments [16] M. Yang, X. Wang, S. Guan, J. Xia, J. Sun, H. Guo, D.A. Guo, Analysis of triterpe- noids in ganoderma lucidum using liquid chromatography coupled with elec- trospray ionization mass spectrometry, J. Am. Soc. Mass Spectrom. 18 (5) (2007) We appreciate the kind support given by Kofi Bedzra of Ghana 927–939. Atomic Energy Commission (GAEC) and Paul Yirenkyi in collecting [17] C.R. Cheng, J. Ding, Y. Yang, X.Y. Liang, D.A. Guo, M. Yang, S.H. Guan, Pharmacokinetic studies of ganoderic acids from the Lingzhi or Reishi medicinal the fruiting bodies of the ganoderma isolates. We also thank Kwasi mushroom, Ganoderma lucidum (Agaricomycetes), by LC-MS/MS, Int. J. Med. Asigbe (Jnr) for his invaluable assistance in taking the team around Mushrooms 18 (5) (2016) 405–412, https://doi.org/10.1615/intjmedmushrooms. the Lower Volta River Basin of Ghana. Finally, we thank Yuan-Yuan v18.i5.40 Cai of China Pharmaceutical University for her help in constructing [18] D. Satria, S. Tamrakar, H. Suhara, S. Kaneko, K. Shimizu, Mass spectrometry- based untargeted metabolomics and α-glucosidase inhibitory activity of lingzhi the figures using R studio. This work was financially supported by (Ganoderma lingzhi) during the developmental stages, Molecules 24 (11) (2019) China Pharmaceutical University, Courtesy of the Start-up Research 2044, https://doi.org/10.3390/molecules24112044 Fund for High-level Talents (Grant number 3150020061). [19] R.L. Zhao, Y.M. He, Network pharmacology analysis of the anti-cancer pharma- cological mechanisms of Ganoderma lucidum extract with experimental support using Hepa1-6-bearing C57 BL/6 mice, J. Ethnopharmacol. 210 (2018) 287–295. Appendix A. Supporting information [20] K. Koyama, T. Imaizumi, M. Akiba, K. Kinoshita, K. Takahashi, A. Suzuki, S. Yano, S. Horie, K. Watanabe, Y. Naoi, Antinociceptive components of Ganoderma lu- cidum, Planta Med. 63 (3) (1997) 224–227. Supplementary data associated with this article can be found in [21] L.Y. Liu, H. Chen, C. Liu, H.Q. Wang, J. Kang, Y. Li, R.Y. Chen, Triterpenoids of the online version at doi:10.1016/j.jpba.2021.114355. Ganoderma theaecolum and their hepatoprotective activities, Fitoterapia 98 (2014) 254–259. [22] H. Wu, S. Tang, Z. Huang, Q. Zhou, P. Zhang, Z. Chen, Hepatoprotective effects and References mechanisms of action of triterpenoids from Lingzhi or Reishi medicinal mush- room Ganoderma lucidum (Agaricomycetes) on α-amanitin-induced liver injury [1] B. Boh, M. Berovic, J. Zhang, L. Zhi-Bin, Ganoderma lucidum and its pharma- in mice, Int. J. Med. Mushrooms 18 (9) (2016) 841–850, https://doi.org/10.1615/ ceutically active compounds, Biotechnol. Annu. Rev. 13 (2007) 265–301. IntJMedMushrooms.v18.i9.80 [2] P.N. Kadhila-Muandingi, P.M. Chimwamurombe, Uses of ganoderma and other [23] N. Al Shukor, J. Van Camp, G.B. Gonzales, D. Staljanssens, K. Struijs, M.J. Zotti, mushrooms as medicine in Oshana and Ohangwena regions of Northern K. Raes, G. Smagghe, Angiotensin-converting enzyme inhibitory effects by plant Namibia, J. Res. Agric. 1 (2) (2012) 146–151 2012. phenolic compounds: a study of structure activity relationships, J. Agric. Food [3] G.M. Halpern, Healing Mushrooms, Square One Publishers, Garden City Park Chem. 61 (48) (2013) 11832–11839. (NY), 2007. [24] T. Hai-Bang, K. Shimizu, Structure–activity relationship and inhibition pattern of [4] Chinese Pharmacopoeia Commission, Chinese Pharmacopoeia of the People’s reishi-derived (Ganoderma lingzhi) triterpenoids against angiotensin-con- Republic of China 1 China Medical Science and Technology Press, Bejing, 2010, verting enzyme, Phytochem. Lett. 2015 (12) (2015) 243–247. pp. 198–199 2010. [25] F. Sanchis-Gomar, C.J. Lavie, C. Perez-Quilis, B.M. Henry, G. Lippi, Angiotensin- [5] R.R. Paterson, Ganoderma - a therapeutic fungal biofactory, Phytochemistry 67 converting enzyme 2 and antihypertensives (angiotensin receptor blockers and (18) (2006) 1985–2001, https://doi.org/10.1016/j.phytochem.2006.07.004 angiotensin-converting enzyme inhibitors) in coronavirus disease 2019, Mayo [6] B.S. Sanodiya, G.S. Thakur, R.K. Baghel, G.B. Prasad, P.S. Bisen, Ganoderma lu- Clin. Proc. 95 (6) (2020) 1222–1230. cidum: a potent pharmacological macrofungus, Curr. Pharm. Biotechnol. 10 (8) [26] B.M. Henry, J. Vikse, S. Benoit, E.J. Favaloro, G. Lippi, Hyperinflammation and (2009) 717–742. derangement of renin-angiotensin-aldosterone system in COVID-19: a novel [7] Y. Gao, H. Gao, E. Chan, W. Tang, A. Xu, H. Yang, M. Huang, J. Lan, X. Li, W. Duan, hypothesis for clinically suspected hypercoagulopathy and microvascular im- C. Xu, S. Zhou, Antitumor activity and underlying mechanisms of ganopoly, the munothrombosis, Clin. Chim. Acta Int. J. Clin. Chem. 507 (2020) 167–173. refined polysaccharides extracted from Ganoderma lucidum, in mice, Immunol. [27] P. Zhang, L. Zhu, J. Cai, F. Lei, J.J. Qin, J. Xie, Y.M. Liu, Y.C. Zhao, X. Huang, L. Lin, Investig. 34 (2) (2005) 171–198. M. Xia, M.M. Chen, X. Cheng, X. Zhang, D. Guo, Y. Peng, Y.X. Ji, J. Chen, Z.G. She, [8] P.Y. Wang, X.L. Zhu, Z.B. Lin, Antitumor and immunomodulatory effects of Y. Wang, H. Li, Association of Inpatient use of angiotensin-converting enzyme polysaccharides from broken-spore of Ganoderma lucidum, Front. Pharmacol. 3 inhibitors and angiotensin II receptor blockers with mortality among patients (2012) 135. with hypertension hospitalized with COVID-19, Circ. Res. 126 (12) (2020) [9] S. Dudhgaonkar, A. Thyagarajan, D. Sliva, Suppression of the inflammatory re- 1671–1681. sponse by triterpenes isolated from the mushroom Ganoderma lucidum, Int. [28] S. Fatmawati, K. Shimizu, R. Kondo, Inhibition of aldose reductase in vitro by Immunopharmacol. 9 (11) (2009) 1272–1280. constituents of Ganoderma lucidum, Planta Med. 76 (15) (2010) 1691–1693, [10] M. Huang, X. Mei, S. Zhang, Mechanism of nitric oxide production in macro- https://doi.org/10.1055/s-0030-1249782 phages treated with medicinal mushroom extracts (review), Int. J. Med. [29] C. Chalk, et al., Aldose reductase inhibitors for the treatment of diabetic poly- Mushrooms 13 (1) (2011) 1–6, https://doi.org/10.1615/intjmedmushr.v13.i1.10 neuropathy, CD004572, Cochrane Database Syst. Rev. 4 (17 . 2007) CD004572. 8