University of Ghana http://ugspace.ug.edu.gh QR201. T9 M62 bite C.l G379675 University of Ghana http://ugspace.ug.edu.gh CHARACTERIZATION OF WILD-TYPE SALMONELLA AND THEIR SUSCEPTIBILITY TO “MIST ENTERICA” AN ANTI-TYPHOID HERBAL PREPARATION BY FELIX CHARLES MTLLS-ROBERTSON THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON, IN PARTIAL FULFILMENT OF THE REQUIREMENT FOR THE AWARD OF DOCTOR OF PHILOSOPHY DEGREE IN BIOCHEMISTRY JULY 2004 University of Ghana http://ugspace.ug.edu.gh DECLARATION The work described in this report was carried out by me at the Bacteriology unit, Noguchi Memorial Institute for Medical Research (NMIMR), College of Health Sciences, and the Department of Biochemistry, both of the University of Ghana, Legon under the supervision of Professor Marian E. Addy and Professor Patience A. Akpedonu. Part of the work was carried out at the Emporia State University (ESU), USA, in the laboratory of the Department of Biological Sciences. DAT] SIGNATURE... ..... J L c . ....t ' 7 ^ STUDENT D A TE...?:?........ .^9.9.4.. SIGNATURE ............................ O " SUPERVISOR DATE.. ! ? .........CP.Q SIGNATURE... J P .\ . i CO-SUPERVISOR University of Ghana http://ugspace.ug.edu.gh DEDICATION I dedicate this thesis to the most Gracious and Merciful God, my Family and my three lovely children, Felix, Francis and Maame Efua Mills-Robertson. University of Ghana http://ugspace.ug.edu.gh ACKNOWLEDGEMENT I am very grateful to my supervisors, Professor Marian E. Addy of the Department of Biochemistry and Professor Patience A. Akpedonu formerly of the Noguchi Memorial Institute for Medical Research (NMIMR), University of Ghana, for their invaluable help that has contributed to the completion of this work. To Professor Scott S. Crupper, I extend my since rest appreciation for your advice and the use of your laboratory. My sincere gratitude goes to the former Head of the Department of Biochemistry, University of Ghana, Dr W.S.K. Gbewonyo, for nominating me for the International Student Exchange Programme (ISEP) which enabled me undertake the molecular biology aspect of this study in the United States of America. To the current Head, Dr (Mrs) Yaa Difie Osei and staff of the Department of Biochemistry, I say a big thank you for all the help accorded me during this study. I am also very grateful to Mr Daleth Agbodaze, Dr Kwasi Addo and die entire staff of the Bacteriology Unit, NMIMR. To my dear ones, Winifred Oforiwa Kumi, Mrs Dorothy Yeboah-Manu, Mrs Adwoa Wiredu, Ivy G. Mensah, Mr Daniel Dramanu, Mrs Doris Amanor, Mrs Henrietta Antwi-Boasiako, Mrs Christiana Nettey and the Late H. E. K. Longmartey, I say thank you very much for your understanding, support and prayers. My sincere appreciation goes to Mr Sulley Mante, the herbalist at the Centre for Scientific Research into Plant Medicine (CSRPM) who supplied die “Mist Enterica” as well as the individual plants making up the “Mist Enterica”, for this study. Finally, I thank the Director, Deputy Director, Administrative Secretary and the entire staff of the Centre for Scientific Research into Plant Medicine, Mampong-Akuapem for granting me study- leave with pay to undertake this study. University of Ghana http://ugspace.ug.edu.gh TABLE O F C O N TEN TS CONTENT PAGE TITLE PAGE................................................................................................................i DECLARATION.........................................................................................................» DEDICATION............................................................................................................«i ACKNOWLEDGEMENT..........................................................................................iv TABLE OF CONTENTS.............................................................................................v LIST OF FIGURES..................................................................................................viii LIST OF TABLES.....................................................................................................xi LIST OF ABBREVIATIONS................................................................................... xiii ABSTRACT..............................................................................................................xiv CHAPTER ONE 1.0 . INTRODUCTION AND LITERATURE REVIEW...................................... 1 1.1. General introduction.......................................................................................1 12. Salmonellosis................................................................................................10 12.1. Causative organism...........................................................................11 122 . Pathogenesis of salmonellosis........................................................... 17 1.3. Typhoid fever................................................................................................21 1.3.1 Epidemiology...................................... ............................................. 21 1.3.2. Diagnosis...........................................................................................24 13.3. Drugs used in treatment and prevention of typhoid fever..................25 1.4. Anti-microbial medicinal plants....................................................................34 1.5. Characterization of pathogenic microorganisms........................................... 36 1.5.1. Polymerase Chain Reaction (PCR).................................................... 36 1.5.2. Plasmid incompatibility.....................................................................38 1.5.3. Antibiotic susceptibility pattern......................................................... 38 CHAPTER TWO 2.0 . MATERIALS AND METHODS.................................................................. 40 2.1. Materials....................................................................................................... 40 v University of Ghana http://ugspace.ug.edu.gh CONTENT PAGE 2.1.1. Chemicals, reagents and equipment................................................... 40 2.1.2. Bacterial sample.................................................................................41 2.1.3. Herbal preparations............................................................................ 41 2.2. Methods.........................................................................................................42 2.2.1. Bacterial culture, isolation and identification.....................................42 2.2.2. Minimum inhibitory concentration (MIC) of the antibiotics used.........................................................................43 2.2.3. Storage of the Salmonella isolates..................................................... 45 2.2.4. Isolation and profiling of plasmids..................................................... 45 2.2.5. Plasmid incompatibility testing.......................................................... 46 2.2.6. Transfer of antibiotic resistance via conjugation............................... 47 2.2.7. Preparation of competent cells and transformation by heat shock technique.....................................................................47 2.2.8. Chromosomal DNA........................................................................... 49 2.2.9. Agarose gel electrophoresis............................................................... 50 2.2.10. Determination of the potency of herbal preparations.........................51 2.2.11. Minimum inhibitory concentrations of the herbal preparations.........51 CHAPTER THREE 3.0. RESULTS.................................................................................................... 54 3.1. Bacteriological characterization of the Salmonella strains........................... 54 3.1.1. Culture, isolation and identification..................................................54 3.1.2. Antibiotic susceptibility testing of Salmonella................................. 54 3.1.3. Minimum inhibitory concentration (MIC) of the antibiotics.............69 3.2. Molecular characterization of Salmonella strains......................................... 76 University of Ghana http://ugspace.ug.edu.gh CONTENT PAGE 3.2.1. Plasmid isolation and incompatibility testing.................................... 76 3.2.2. Transfer of antibiotic resistance via conjugation................................76 3.2.3. Transfer of antibiotic resistance via transformation...........................81 3.2.4. DNA fingerprinting...........................................................................85 3.3. Susceptibility of Salmonella strains to the herbal preparations............ .........90 3.3.1. Potency of the herbal preparations......................................................90 33.2. MICs of the herbal preparations....................................................... 103 CHAPTER FOUR 4.0 . DISCUSSION AND CONCLUSION.......................................................... 106 4.1. DISCUSSION............................................................................................. 106 42. CONCLUSION AND RECOMMENDATION........................................... 121 REFERENCES...........................................................................................................122 APPENDIX A.............................................................................................................137 PUBLICATIONS FROM THESIS University of Ghana http://ugspace.ug.edu.gh LIST OF FIGURES FIGURE PAGE 1 Salmonella species and the disease they cause...........................12 2 “Antigenic structures of Salmonella typhi “...............................14 3 Salmonella typhi (Science Photo Library, UK. Copyright protected)..................................................... 15 4 The geographical distribution of typhoid fever cases............... 23 5 Chemical structure of ampicillin.............................................. 26 6 Chemical structure of chloramphenicol..................................... 28 7 Chenical structure of tetracycline.............................................. 29 8 Chemical structures of trimethoprim and sulphamethoxazole..-^ 1 9 Susceptibility/resistance of the 115 isolated Salmonella strains to the different antibiotics.............................................. 57 10 Sources of the thiity-seven Salmonella strains resistant to all five first-line antibiotics..................................... 59 11 Groups of the thirty-seven Salmonella strains resistant to all five first-line antibiotics..................................... 60 12 Resistance of the thirty-two Salmonella strains compared to their sources of isolation...........................................................61 13 Groups of the thirty-two Salmonella strains resistant to four of the first-line antibiotics.............................................64 14 Level of resistance of Salmonella isolates compared to their sources of isolation...................................................................67 15 Level of resistance among the Salmonella strains within the different Salmonella groups to the five different antibiotics.... 67 16 Representative agarose gel with 365-bp Inc amplicon..............77 viii University of Ghana http://ugspace.ug.edu.gh FIGURE PAGE 17 Agarose gel analysis of plasmids from wild-type Salmonella.......87 18 Agarose gel analysis of genotypic patterns obtained with ERIC-PCR....................................................................................88 19 Agarose gel analysis of genotypic patterns obtained with REP-PCR.....................................................................................89 20 Inhibition of the growth of standard Salmonella typhi by three herbal preparations using the agar diffusion method.................. 93 21 Inhibition of growth of the standard Staphylococcus aureus using decoction prepared from Psidium guajava....................... 94 22 Inhibition of standard Staphylococcus aureus by l-“Mist Enterica” and 2-combination of P. guajava, C. ferruginea and H. opposita and 3-chloramphenicol................................................................95 23 Inhibition of growth of wild-type Salmonella strain 8 using “Mist Enterica” .....................................................................................96 24 Inhibition of growth of wild-type Salmonella strain 8 using disk impregnated with 1 -P. guajava, 2-C. ferruginea, 3-/7. opposita, 4-“Mist Enterica” and chloramphenicol..............97 25 Effect of heat on the potency of the “Mist Enterica” .................101 26 Mueller-Hinton agar plates showing the inhibition of Salmonella strains on test plates compared to the control plates..................105 ix University of Ghana http://ugspace.ug.edu.gh LIST OF TABLES PAGE Number of Salmmelia strains isolated from different sources...........................................................................56 Groups of Salmonella strains isolated.......................................... 56 Summary of the resistance within the different groups to the different antibiotics......................................................................63 MICs of four first line antibiotics using the Salmonella isolates which were found to be resistant to all the five antibiotics (5-R strains) in mg/1.............................................................................71 MICs of four first line antibiotics using the Salmonella isolates which were found to be resistant to four of the antibiotics (4-R strains) in mg/1....................................................................72 MICs of four first line antibiotics using die Salmonella isolates which were found to be resistant to three of the antibiotics (3-R strains) in mg/1....................................................................73 MICs of four first line antibiotics using the Salmonella isolates which were found to be resistant to two of the antibiotics (2-R strains) in mg/1....................................................................75 MICs of four first line antibiotics using the SalmomUa isolates which were found to be resistant to only one of the antibiotics (5-R strains) in mg/1....................................................................75 Comparison of resistance pattern of wild-type Salmonella to the transconjugates................................................78 Comparison of resistance pattern of wild-type Salmonella to the transformants................................................... 82 Distribution of Salmonella isolates into discrete Genotypic patterns.......................................................................86 University of Ghana http://ugspace.ug.edu.gh 12 Antimicrobial activity of the heibal decoctions/concoctions against selected standard bacterial strains....................................91 13 Effects of different herbal decoctions against wild-type pathogenic bacteria.......................................................................99 14 Zones of inhibition for the organic fractions with antimicrobial activity against the standard strains of S. aureus, S. typhi and S. paratyphi.............................................................102 15 MICs (mg/ml) of the decoctions/concoctions with antimicrobial against the standard trains.................................... 104 16 MICs (mg/ml) of the decoctions with antimicrobial activity against representative wild-type Salmonella strains......104 17 MICs (mg/ml) of the decoctions with antimicrobial activity against other pathogenic organisms........................................... 104 xi University of Ghana http://ugspace.ug.edu.gh LIST OF ABBREVIATIONS CSRPM - Centre for Scientific Research into Plant Medicine DNA - Deoxyribonucleic Acid ERIC-PCR - Enterobacterial repetitive inteigenic consensus Polymerase Chain Reaction GHAFTRAM - Ghana Federation of Traditional Medicine Practitioners Association ISEP - International Student Exchange Programme LPS - Lipopolysaccharide MIC - Minimum Inhibitory Concentration NMIMR-‘Noguchi Memorial Institute for Medical Research OPD - Out-Patients Department PCR - Polymerase Chain Reaction REP-PCR - Repetitive Extragenic Pallindromic Polymerase Chain Reaction University of Ghana http://ugspace.ug.edu.gh ABSTRACT The purpose of this study was to investigate the antibiotic resistance and clonal lineage of Salmonella isolated from patients suspected of suffering from typhoid fever and the susceptibility of these Salmonella strains to “Mist Enterica”, a herbal preparation used at the Centre for Scientific Research into Plant Medicine (CSRPM) out-patients’ department, Mampong-Akwapim, Ghana, to treat typhoid fever. Other strains of Salmonella isolated from food sources were also included in this study. A total of 1 IS Salmonella strains were examined for drug/multiple resistance, using first-line antibiotics used to treat typhoid fever, namely, ampicillin (Am), chloramphenicol (CmX tetracycline (Te) and trimethoprim-Sulphamethoxazole (Ts). Streptomycin (St), which is a commonly used antibiotic, was also included. These strains were isolated from blood, cerebrospinal fluid, stool, urine, food, and other sources. The minimum inhibitory concentrations (MICs) for the antibiotics were studied using the 1 IS Salmonella strains. The genetic location of those with resistant genes was also investigated. Genetic fingerprinting by plasmid profiling, enterobacterial repetitive intergenic consensus (ERIC) -PCR, and repetitive extragenic pallindromic (REP)-PCR were performed to determine the diversity among the isolates. The efficacy of “Mist Enterica” as an anti-typhoid agent and the contributions made by each of the components of “Mist Enterica” were also investigated. The MICs for “Mist Enterica”, and three of the component plants, namely Cnestisf erruginea, Hostundia opposita and Psidium guajava were also determined. The number of organisms isolated from blood alone was 82 (71.3%). Eight serological groups were identified and the most common isolates were groups D (57.4%) and B (33%), with the least found in groups A, G and 1 Seventy-four percent of the Salmonella strains (85 out of 115) were resistant to one or more of the five antibiotics used and of the 85 resistant strains, 37 (43.53%) were resistant to all five antibiotics, 32 (37.65%) resistant to four, 7 (8.24%) to three, 1 (1.18%) resistant to two and 8 (9.41%) were resistant to one antibiotic. Thus, 76 Salmonella strains out of the total 115 (66.09%) were found to possess multi-drug resistance (resistance to three or more antibiotics). The MIC for ampicillin was found to be equal to or greater than University of Ghana http://ugspace.ug.edu.gh 1280mg/L for 93% of the resistant Salmonella, whilst trimethoprim- Sulphamethoxazole had MIC of 1280mg/L for 78% and 80mg/L for 22% of the strains. The MIC for chloramphenicol was equal to or greater than 1280mg/L for 48% of the strains and 20mg/L for 46%. Tetracycline had MIC of320mg/L or lower for all the 85 resistant Salmonella strains tested. Two groups, Groups B and D, totaling 104 out of the 115 strains (90%), showed high level of resistance. The percentage of resistant strains in Group B was 97.3 and that in Group D was 63.6. In all, majority of the Group B strains (71.05%) were resistant to all five antibiotics whilst majority of the Group D strains (37.88%) were resistant to four. Eighly-one out of the 85 resistant strains (95.29%) possessed conjugable plasmids which conferred multi-drug resistance on 74 of the 81 strains (91.36%). These multi­ drug resistant strains belonged to the incompatibility group IncHl. Out of the 85 wild-type resistant Salmonella strains only 15 (17.65%) could transform recipient E. coli strains, with all these transformants being resistant to ampicillin. Plasmid profiling discriminated 5 unique groupings, while ERIC-PCR and REP-PCR resulted in 2 and 3 groupings, respectively. “Mist Enterica” and decoctions made from Hoslundia opposita, Cnestisf erruginea and Psidium guajava, three of the components of “Mist Enterica” were found to be very active against all the standard strains as well as the wild-type Salmonella strains with zones of inhibition ranging from 9mm to 25mm. These herbal preparations also inhibited growth of other pathogenic microorganisms such as Staphylococcus aureus, Staphylococcus saprophyticus, Escherichia coli, Candida albicans and Neisseria gonorrhoea. Thus, antibiotic resistance is associated with the Salmonella strains whose genes are located on conjugative plasmids and appear to be minimally diversified. The results also indicate that “Mist Enterica” and a combination o f Hoslundia opposita, Cnestis ferruginea and Psidium guajava (3-in-l) are very efficacious and could be used for the management of the type of disease caused by the strains of bacteria studied. University of Ghana http://ugspace.ug.edu.gh CHAPTER ONE INTRODUCTION AND LITERATURE REVIEW 1.1. GENERAL INTRODUCTION: Salmonellosis is a disease of animals and humans, caused by different species of die genus Salmonella that exist in nature primarily as pathogens of humans and animals. The salmonellae may be divided into two main groups based on their pathogenicity, that is, the enteric fever (typhoid and paratyphoid) group found mainly in humans for whom they have a high degree of pathogenicity, and the food-poisoning group, members of which are essentially pathogens of animals from whom humans are frequently infected (Agbodaze et al., 1988). According to Cheesbrough (2003), typhoid fever is a septicaemic disease associated with sigpis and symptoms that include fever, headache, anorexia and rose-spots on light skinned people (pink papules which fade on pressure). It is caused by members of the Salmonella serotype typhi and paratyphi A, B, C, which are flagellated, non-spore bearing, Gram negative bacilli belonging to the family Enterobacteriaceae. They are pathogenic in man and other lower primates. Most salmonellae are found in the intestines of animals especially pigs, cows, goats, sheep, rodents, hens, ducks and other poultry, but S. typhi and S. paratyphi are usually found only in humans and excreted in the faeces and urine of infected patients. S. typhi and S. paratyphi are also present in the gall bladders of chronic carriers. The long duration of the carrier state enables the enteric fever bacilli to survive in the community at non-specific times and to persist in small, relatively isolated communities or to infect families as it happened in the case of the cook 1 University of Ghana http://ugspace.ug.edu.gh called “Typhoid Mary” (Mandal, 1996). Infection is from contaminated hands or by ingesting the organisms in contaminated food or water. S. typhi is spread mainly by water and S. paratyphi by food. Raw fruit and vegetables are important vehicles in some countries where human faeces are used as manure. In schistosomiasis endemic areas there is a high incidence of chronic S. typhi and S. paratyphi infections where the Salmonella is known to adhere to the adult schistosome flukes. Salmonellae are not killed by dryness and therefore survive in products such as dried egg or bone meal fertilizers (Cheesbrough, 2003). The number of officially recorded cases of human salmonellosis has increased significantly in many countries all over the world (Petit and Wamola, 1994; Oosterom, 1991; Ryder et al., 1980). In Ghana, typhoid fever is of public health concern in urban slums and rural communities where its prevalence is highest in children and young people (National Symposium on Enteric fever/salmonellosis for the Southern sector, 1998; Voros et al., 1974). Older people often seem to possess partial immunity, probably following exposure to frequent sub-clinical infective doses of typhoid bacillus (Mirza et al., 1995). Globally, it is estimated that there are over 20 million cases annually, resulting in greater than 700,000 deaths (Thong et al., 1994). The incidence of this disease in the industrialized world is rare primarily due to proper sanitary facilities. The sporadic outbreaks that occur are oftentimes due to transmission from an endemic region or country. The disease in most developing countries is linked to poor water supply, inadequate sewage disposal and unhygienic conditions as revealed by research conducted 2 University of Ghana http://ugspace.ug.edu.gh in rural areas of three African countries namely Ghana, Zambia and Kenya in 1994 (Petit and Wamola, 1994). Treatment of typhoid fever is usually with antibiotics and the drug of choice has been chloramphenicol, a bacteriostatic broad-spectrum antibiotic. However, it has recently been reported that chloramphenicol is becoming increasingly ineffective in treating typhoid cases. Additionally, chloramphenicol-resistant Salmonella strains have been documented abroad (Islam et al., 1993) and in Ghana (Newman, 2000). Many strains of Salmonella have also become resistant to ampicillin, tetracycline and trimethoprim- Sulphamethoxazole, which are considered appropriate alternatives to chloramphenicol (Ling and Chau, 1984). The emergence of these resistant strains could be disturbing because it has been reported that about 12-16% of patients die within four weeks of the disease if they are not well managed (Mims et al., 1998). Relapses are common unless the drug is given in adequate doses and for a sufficient length of time (http://www.merck.com/pubs/mmanual/section 13/chaoter 153/153f.htm; Mandal, 1996; Keusch, 1994). The administration of chloramphenicol for a long period of time, however, may result in aplastic anaemia and destruction of the bone marrow. It may also lead to central and peripheral circulatory failure and mental derangement, probably due to large scale destruction of typhoid bacilli and release of large amounts of typhoid endotoxin (Manson-Bahr, 1987). Thus the use of multi-drug therapy and/or third generation drugs is recommended. 3 University of Ghana http://ugspace.ug.edu.gh Multi-drug resistance, however, is now common among these pathogenic microorganisms, which show both in vivo as well as in vitro resistance to the four first- line antityphoid antibiotics namely, ampicillin, chloramphenicol, tetracycline and trimethoprim-Sulphamethoxazole (Newman, 2000; Rowe et al., 1997; Panigrahi et ed., 1996; Smith et al., 1984; Sajjad, 1996). Resistance to each of these first line antibiotics is often plasmid encoded (Datta eta l., 1981; Olarte and Galindo, 1973) and strains harbouring plasmid encoding resistance to all four antibiotics have been isolated by many researchers (Panigrahi et al., 1996). In most cases, plasmids responsible for the resistance belong to the incompatibility complex IncHl (Rowe et al., 1990). Thus, multiple drug resistant (MDR) S. typhi exist and are on the increase worldwide (Sajjad, 1996; Panigrahi eta l., 1996; Olarte and Galindo, 1973). However, these organisms are poorly documented in Ghana and therefore further investigations are needed to determine the actual situation prevailing in Ghana. Quinolone derivatives such as ciprofloxacin or pefloxacin and third generation cephalosporins such as ceftriaxone or cefotaxin are very effective for treating diseases caused by multi-drug resistant S. typhi strains, particularly ciprofloxacin given by oral route in a 7-day course of therapy (Wallace et al., 1993; Asperilla et al., 1990; Eykyn and Williams, 1987). However, drug resistance to fluoroquinolones has emerged (Chitis et al., 1999; Kapil eta l., 1999; Roweeta l., 1995). In Ghana, although these drugs are effective, they are expensive and out of reach of the poor in the endemic areas, hence, chloramphenicol is still prescribed in many health 4 University of Ghana http://ugspace.ug.edu.gh facilities in Ghana and the resistance to the drug has led to the general notion that typhoid is difficult to treat. There is therefore the need to search for an alternative medicament that is effective and cheaper in the management of typhoid fever Mid other salmonellosis. In a country where over 70% of the populace rely on herbal medicine, the source of such alternative medicaments should include herbal preparations. However, thorough research into the biological and molecular characterization of the causative agent, Salmonella, and the prevalence of MDR strains will have a bearing on the efficacy of the alternative medicinal product. Conduction of such a research forms an integral part in the search for such alternative herbal medicaments that are cheap, easy to produce and very effective with little or no side effects. This is because there is minimal documentation of MDR S. typhi in Africa where some of the first cases of chloramphenicol-resistant strains were reported. The thorough research will also enable better interpretation of results obtained with the herbal medicaments and correct inferences made. The World Health Organization (WHO) defines traditional medicine as uthe total combination ofthe knowledge andp ractices, whether explicable or not, used in diagnosing, preventing or eliminating physical, mental or social diseases and which may rely exclusively on past experience and observation handed down from generation to generation, verbally or in writing* (WHO, 2004). In practice, the term ‘traditional medicine* refers to acupuncture, the practice of traditional birth attendants, mental healing and herbal medicine with the latter being the oldest form known. These approaches to health belong to the traditions of each country (http://www.holistic- online.com/ Herbal.Med/hol herb-intro.htm )■ 5 University of Ghana http://ugspace.ug.edu.gh In Africa, research on traditional medicine dates from the colonial periods. Studies have focused primarily on ethnobotanicaf and phytochemical aspects, but more recent research is examining how traditional health practices and herbal medicines can be integrated into modem medical systems (http://www.idrc.ca/media/commplants e2.html) Ghana today has a dual system of medical practice that recognizes both traditional and modem medical practices in law and promotes their co-existence in order to reach die greatest number of citizens (http://www.unep-wcmc.org/species/plants/ghana). Traditional medicine, for instance, plays a very important role in Ghana where approximately 70% of the population makes use of its services. These services are often affordable and accessible to die vast rural populace and therefore serve as a forerunner in the primary medical care of the population (http://wwwl .cfiks.org/healthmed.htm)- The nation has an extremely rich biodiversity and rich tradition of plant medicine in various forms and has an enormous number of indigenous medicinal plants. Each village has its traditional practitioner who uses local plant remedies and in many cases ritual and no doubt non-plant medicine as well (http://www.nimh.btinternet.co.uk/eihm/ 1 1 hw3.htm). Even though a few herbal medicines have withstood scientific testing, a lot more need to be studied scientifically. Most people believe that herbs are safer and less expensive than most orthodox medicines. However, they can be dangerous if they are not used appropriately. Herbal medicines have been reported to be responsible for 0-35% of cases 6 University of Ghana http://ugspace.ug.edu.gh of acute renal failure (ARF) in some African countries (http://www.uninet.edu/cin2001 / paper / ibanez/fovaca.htmO. Addae-Mensah (1992) has reported that even though Croton membranaceous has diterpens and alkaloids which possess anticancer and anti-ulcer properties, the same plant also has phorbol esters which are known to be co-carcinogenic and therefore can cause cancer of the oesophagus. He also reports that Crotalaria, Senecio, Cynoglossum and Heliotropium genera contain pyrrolizidine alkaloids found to be highly hepatotoxic. Scientific investigations into herbal medicines must therefore involve the therapeutic effects as well as the possible long-term deleterious effects which may not manifest themselves until it is too late. The WHO estimates that, 80% of the world's population, presently use herbal medicine for some aspect of primary healthcare, and that about 74% of the 119 plant-derived pharmaceutical medicines are used in modem medicine in ways that correlate directly with their traditional uses as plant medicine in native cultures (http://www.who.int/inffs/en/fact 134.htm; WHO, 2003). Principe (1989) reported that pharmaceutical companies have shown decreasing interest in the development of new plant products in favour of molecular biology and biotechnology application to microorganisms. However, some others, including this researcher, believe that, plant based resources will regain their importance. This is because even though research based on microorganisms to synthesize therapeutically active chemical compounds is promising, several limitations do exist. The steps of identifying the chemical structure required to achieve a given effect and creating a proper genetic code for this structure, are the most difficult stages of drug development for which plant based genetic material 7 University of Ghana http://ugspace.ug.edu.gh appears to be better than microorganisms. Genetically engineered microorganisms can substitute only for some of the plant based chemicals. The vast majority of plant based chemicals have not been successfully synthesized (http://www.indmedplants-kr.org /ECONOMIC VALUE OF MEDICINAL 2.HTM). In i960, the late President of Ghana, Osagyefo Dr. Kwame Nkrumah, suggested the formation of an association of traditional healers and as a result the Ghana Psychic and Traditional Healers Association was formed. More recently, with the support of the Ministry of Health, the Ghana Federation of Traditional Medicine Practitioners Association (GHAFTRAM) was formed and now forms the authoritative voice on traditional medicine in Ghana (http://www.unep-wcmc.org/species/Dlants/ghana)- hi November 1975, the Government of Ghana established the Centre for Scientific Research into Plant Medicine (CSRPM) at Mampong-Akwapim, as a result of the dream and vision of Dr Kwaku Oku Ampofo. Dr Oku Ampofo saw the therapeutic importance of herbal medicines especially on himself and his father. It is therefore no wonder that he became an apostle of the noble profession of traditional medicine in general and herbal medicine in particular at a tender age. Hie Centre originally started as a small OPD under his able leadership in the present day Mampong-Akwapim community centre. Currently, the Centre conducts and promotes scientific investigations relating to the improvement of plant medicine, ensures the safety of the drugs extracted from plants, co­ operates and liaises with GHAFTRAM, Universities, Research Institutions and commercial organizations world-wide, collaborates in the publication and dissemination a University of Ghana http://ugspace.ug.edu.gh of the results and establishes arboreta for medicinal plants. The Centre also encourages traditional healers to bring their herbal preparations for analysis (CSRPM Annual report, 2002;http://www.unepwcmc.org/species/plants/ghana). Undoubtedly, traditional methods of healing have successfully served die majority of Ghanaians for years. Unfortunately, knowledge about plants used in the art of healing has not been recorded in written text, unlike those found In China and India (http://www.unepwcmc.org/species/nlants/ghana">. The knowledge has been passed on from one generation to the next, mainly by oral tradition and most of these herbal preparations used for treating diseases are used without the patient or the traditional medicine practitioner paying attention to their standardization, quality control and safety. One such herbal preparation is “Mist Enterica”, used for die treatment of typhoid fever. “Mist Enterica” was introduced in 1997 by an herbalist, Mr Sulley Mante, who still works at the Centre as at the time of writing this manuscript. This herbal preparation is made from twelve plants, mostly leaves, and dispensed at the out-patients’ clinic. It is claimed to reduce fever within an hour and treat both sensitive and multiple resistant typhoid fever without any relapse (CSRPM Annual report, 2002). Developing, improving and promoting such medicinal plants will not only supplement western-type medicine, but could be a better approach to meeting the health needs of a majority of the populace including those who may never have the facilities of a modem hospital, or are unable to afford the high cost of imported drugs. In addition, it is important to undertake scientific investigations into the therapeutic potentials of our medicinal plants so as to ensure their safety, efficacy and quality. This will enable more of our health 9 University of Ghana http://ugspace.ug.edu.gh professionals use them, thereby reducing dependency on imported drugs which could be expensive for most people. The main aim of this study was to isolate and characterize serovars of S. typhi, the causative agent of typhoid fever, and other Salmonella species especially those resistant to the first-line anti-typhoid drugs, and to investigate the effect of “Mist Enterica” and its component plants on the isolated strains. The specific objectives were to i. isolate the groups/types of Salmonella species found in Ghana as well as determine their prevalence; ii. identify and characterize the resistant Salmonella species; iii. investigate the efficacy of “Mist Enterica” as an anti-typhoid agent on the isolated strains; and, iv. establish the contributions from each of the twelve plants making up “Mist Enterica” to the anti-typhoid activity. 12. SALMONELLOSIS: Salmonellosis is an infection of bacteria belonging to the genus Salmonella. In Salmonella gastroenteritis, there is abdominal pain of a gripping nature, but it is not usually severe and similarly vomiting, if it occurs, is not severe. Pyrexia is common and is an evidence of the severity of infection, for example, general body pain and shivering. The incubation period for Salmonella gastroenteritis depends on the dose of bacteria 10 University of Ghana http://ugspace.ug.edu.gh ingested but die symptoms usually begin 6 to 48 hours after ingestion of contaminated food or water and usually take the form of nausea, vomiting, diarrhoea and abdominal pain. However, die cardinal manifestation is diarrhoea and together with fever and chills may last for about 2 to 7 days (Ohl and Miller, 2001; Miller, 2000). Typhoid fevers, on the other hand, are severe systemic fonns of salmonellosis with incubation period spanning between 10 and 14 days. The symptoms of enteric fevers are non-specific and include fever, anorexia, headache, myaglias and constipation. Without treatment, mortality is 10-13% (Ohl and Miller, 2001). 1 3 .1. Causative organism: Salmonellae (Fig. 1) are widely distributed in nature, being isolated from the gastrointestinal tracts of humans, animals, reptiles, birds and insects (Agbodaze et al., 1988; Sackey et al., 2001) and usually cause a self-limited enteritis in humans (Ohl and Miller, 2001). Some Salmonella species such as S. typhi and S. paratyphi, are highly adapted to humans and other lower primates with about 2-5% of infected patients becoming chronic carriers and serving as reservoirs. Other species such as S. typhimurium, have a broad host range and can infect a wide variety of animal hosts and humans. Sources of gastroenteritis (non-typhoidal) Salmonella for human infection are largely contaminated water and food products, with person-to-person transmission not considered an important route of transmission. S. enteritidis and S. agona can pass transovarially from chicken to eggs, with infection acquired by consuming raw or partially cooked eggs. Poultry, particularly, hen, duck and turkey are the most significant reservoirs of Salmonella food-poisoning (Cheesbrough, 2003; Caygill eta l., 1994). 11 University of Ghana http://ugspace.ug.edu.gh kuk& feim S.eJiatt9*m u )> 9k a tts ritf tfs & typfiiiMurfwiw & paratyphi! A. B. C. &typM P^aeypltwidfwwr Vrfikaid hrret S+e& t— m-s G*«r3«**e*iejs E rtirie (iwnr Figure 1. Salmonella species and the disease they cause 12 University of Ghana http://ugspace.ug.edu.gh Salmonellae are Oram-negative, flagellated, facultatively anaerobic rods possessing three major antigens (Fig. 2); H or flagellar antigen, O or somatic antigen and Vi antigen, possessed by only a few serovars. H antigen may occur in either or both of two forms, called phase 1 and phase 2. Hie organisms tend to change from one phase to the other. O antigens occur on the surface of the outer membrane and are determined by specific sugar sequences on the cell surface. Vi antigen is a superficial antigen overlying the O antigens; it is present in a few serovars, the most important being S. typhi (Fig. 3) (Keusch and Acheson, 1999; Gianella, 1996 http://www.hc-sc.gc.ca/pphb-dgspsp/msds- ftss/msdsl 32e.html). Salmonellae are subdivided into groups by the Kauffmann-White scheme aid represented by alphabets. For example, S. paratyphi A, S. nitra and S. kiel belong to Group A; S. paratyphi B, S. agona, and S. typhimurium belong to Group B; S. paratyphi C belong to Group C whilst S. Dublin, S. enteritidis and S. typhi belong to Group D ( Le Minor, 1984). 13 University of Ghana http://ugspace.ug.edu.gh Polysaccharide Somatic P Flageffe CHI M affiifigm antigen antigen Figure 2. "Antigenic structures of Salmonella typhi" 14 University of Ghana http://ugspace.ug.edu.gh Figure 3. Salmonella typhi (Science Photo Library, UK. Copyright protected.) 15 University of Ghana http://ugspace.ug.edu.gh The cell envelope of salmonellae contains a complex lipopolysaccharide (LPS) structure that is liberated on lysis of the cell and, to some extent, during culture. The lipopolysaccharide moiety may function as an endotoxin, and may be important in determining virulence of the organisms. This macromolecular endotoxin complex consists of three components, an outer O-polysaccharide coat, a middle portion called the R core, and an inner lipid A coat. The lipopolysaccharide structure is important for several reasons. Firstly, the nature of the repeating sugar units in the outer O- polysaccharide chains is responsible for O antigen specificity; and may also help determine the virulence of the organisms. Salmonellae lacking the complete sequence of O-sugar repeat units are called rough because of the rough appearance of die colonies and are usually avirulent or less virulent than the smooth strains that possess a full complement of O-sugar repeat units. Secondly, antibodies directed against the R-core (common enterobacterial antigen) may protect against infection by a wide variety of Gram-negative bacteria sharing a common core structure or may moderate their lethal effects. Thirdly, the endotoxin component of the cell plays an important role in the pathogenesis of many clinical manifestations of Gram-negative infections. Endotoxins evoke fever, activate the serum complement, kinin and clotting systems, depress myocardial function, and alter lymphocyte function (htt:/gsbs.utmb.edu/microbook/ch 021.htm.). Circulating endotoxin may be responsible in part for many of the manifestations of septic shock that can occur in systemic infections (Miller ef al, 1995: http://pathologv5 .pathology, ihmi.edu/micro/v 16n02.htm ) 16 University of Ghana http://ugspace.ug.edu.gh 1.2.2. Pathogenesis of salmonellosis: Salmonellae are common members of the normal flora of many animals, including chickens, cattle and reptiles. The strains that cause gastroenteritis are usually transmitted by chicken meat, eggs and diary products and unless care is taken in poultry farms, chicken eggs often become contaminated, both on their surface and within (Cheeesbrough, 2003; Ohl and Miller, 2001). Outbreaks are most often related to contaminated eggs or chicken salad. Typhoid fever, on the other hand, is traceable to a human carrier, such as the infamous Typhoid Mary, although the routes of transmission often involve contaminated water or food. Like other enteric pathogens, salmoneilae must be excreted in faeces and passed on from the reservoir to the recipient (Keusch and Acheson, 1999). When food or drink contaminated with the S. typhi is ingested, many of the organisms are normally inactivated by acid in the stomach. However, if a large number of bacteria are ingested, a substantial proportion of them may reach the small intestine. The time from the ingestion of S. typhi to the appearance of the first symptoms is usually 10-14 days, however, it could be as short as three days or as long as two months depending on the size of the ingested dose (Keusch, 1994). For paratyphoid fever, the incubation is usually 1-10 days. Conditions that increase gastric pH reduce the Salmonella infectious dose, which suggests that gastric acidity represents a significant initial barrier to infection (Giannella, 1972; 1973). Salmoneilae interestingly exhibit an adaptive acid-tolerance response on 17 University of Ghana http://ugspace.ug.edu.gh exposure to low pH, possibly promoting survival in acidic host environments such as the stomach (Garcia-del Portillo et al., 1993). Strains that successfully escape being killed in the stomach pass through the duodenum to the distal ileum and colon and then penetrate the mucosal barrier, by microbe-directed phagocytosis, into phagocytic vesicles where they remain for many hours. The bacteria-containing vesicles eventually travel to the basal membrane, and the organisms are released into the lamina propria. Salmonellae are usually resistant to the lysosomal contents of cells or to cryptins, the antibacterial peptides made by intestinal epithelial cells (Ohl and Miller, 2001; Garcia-del Portillo et al., 1993). After invading the epithelium, die salmonellae multiply intracellularly and then spread to mesenteric lymph nodes and throughout the body via the systemic circulation. However, they are rapidly taken up by die phagocytic cell system and effectively killed (Finlay et al., 1992). Thus, they normally do not cause sustained bacteremia. Nevertheless, depending on the serotype and the effectiveness of the host defenses against that serotype, some of the organisms, spread systemically and may infect the liver, spleen, gallbladder, bones, meninges, and other organs (Finlay et a l, 1992). Fortunately, most serovars are killed promptly in extraintestinal sites, and the most common human Salmonella infection, gastroenteritis, remains confined to the intestine (Giannella, 1979). The interaction of gastroenteritis-producing salmonellae with epithelial cells activates die inflammatory response and results in ulceration or damage to the intestinal mucosa initially. The interaction involves the assembly of nonpili appendages by the organism 18 University of Ghana http://ugspace.ug.edu.gh within 15 minutes of contact with the host cell (Mishu et al., 1994). By 30 minutes, ruffles form on the host cell, and the bacterial appendages disappear. Salmonellae that are pathogenic are able to assemble these appendages, and also able to shed them. During the invasion, many biochemical events are activated by signals of which mitogen- activated protein kinase (MAP-kinase) may be the first. MAP-kinase is linked to a receptor on the cell surface, and the binding of the organisms to the receptors lead to the activation of phospholipase Aj(PLA2), release of arachidonic acid, production of eicosanoids, including prostaglandins and leukotrienes, and a sharp increase in intracellular calcium concentration. These events underlie die induction of ruffles and subsequent bacterial uptake, but a number of the mediators involved are also capable of altering electrolyte transport and consequendy, diarrhoea as a result (Galan, 1996; Hobbie et al., 1997; Pace et a l, 1993). In the case of typhoid fever, passage of the organisms into the small intestines is followed by invasion across the mucosa and their rapid uptake by mononuclear cells in regional lymph nodes. An initial bacteremia carries the organisms to the liver and spleen for further growth. The importance of typhoid-causing serovars is their ability to survive and grow within the liver and spleen, in contrast to the gastroenteritis-causing salmonellae. Patients are found to be asymptomatic as the organisms multiply in macrophages of liver, spleen and mesenteric lymph nodes (Ohl and Miller, 2001; Giannella, 1973; 1975). When the number of intracellular organisms reaches a threshold, they are released into the bloodstream, initiating a continuous bacteremia characteristic of typhoid fever. This event signals the start of clinical illness, manifested by daily high fever that continues for 19 University of Ghana http://ugspace.ug.edu.gh 4-8 weeks in untreated cases. This second bacteremia may lead to invasion of the gal I bladder, kidney and reinvasion of the gut mucosa, especially at the Peyer’s patches. At this stage, S. typhi can be isolated not only from blood, but also from stool and urine (Alpuche-Aranda et a l, 1994; Fields et a l, 1986). Invasion of the gall bladder by S. typhi may be temporary or may result in the long-term colonization that characterizes the typhoid carrier state, especially in the presence of gallstones. Occasionally, acute necrotizing cholecystitis may result. S. typhi survive well in gallstones and can be recovered from the centre of a stone and also viable organisms may be obtained even after dipping stones in antibiotics (Keusch and Acheson, 1999). Gallstones are thus a source of prolonged asymptomatic carriage and excretion of the organism in stool. The source of secondary gut invasion may be S. typhi from bloodstream during the prolonged secondary bacteremia or S. typhi shed in the bile. Such secondary reinvasion leads to severe bleeding and/or perforation attributable to the marked inflammatory response induced in the Peyer’s patches. It is not known why the invasion of the gut at this stage results in more extensive damage to the intestinal mucosa than the primary invasion, but severity could be immunologically mediated. Invasion of liver, spleen and kidney can result in hepatitis, splenitis that makes the spleen prone to rupture, or glomerulonephritis. 20 University of Ghana http://ugspace.ug.edu.gh Perforation of the intestine and haemorrhage are two of the most feared complications of typhoid fever occurring in 0.5-1% of cases (Levine, 1999). Relapses are not uncommon. Paratyphoid fever is similar to typhoid fever but is usually much milder and is caused by the organisms S. paratyphi A, B and C. 13. TYPHOID FEVER 13.1. Epidemiology: WHO estimates that there are about 16 million cases of clinical typhoid fever annually and many sub-clinical infections worldwide, resulting in about 600,000 deaths every year throughout the world (WHO, 1996). The incidence of the disease increases wherever developments in sanitation are unable to keep pace with a rapid growth in population. The cultivation of rice in paddy fields, raw fruits washed with contaminated river water, vegetables fertilized with waste products, dairy products contaminated by the hands of carriers and, in some countries, shellfish harvested from contaminated coastal waters, have been associated with the occurrence of typhoid fever. Canned food and bottled water are usually safe, although outbreaks have occurred through faulty processing (http://www.worldwidevaccines.com/public/diseas/typ 13 .asp ). The global distribution of typhoid fever (Fig. 4) is very similar to that of hepatitis A (DuPont and Steffen, 1997). As with hepatitis, typhoid fever is endemic in all developing countries, where children and the youth aged 5-12 years are mostly affected, but relatively high incidence rates are also observed in young adults (Mermin et at., 1996). It is generally accepted that acquired immunity explains the decreased incidence in adults 21 University of Ghana http://ugspace.ug.edu.gh living in endemic areas. For instance, sero-epidemiological studies in Peru and China have shown that by 15-19 years of age 50-80% of teenagers have serological evidence of past infection with S. typhi (Levine, 1999). In endemic areas, typhoid fever is a major cause of absenteeism from school and employment and the direct expenditures for hospitalization and medication further raise the public health costs of this disease. 22 University of Ghana http://ugspace.ug.edu.gh Figure 4. The geographical distribution of typhoid fever cases 23 ■Ilf University of Ghana http://ugspace.ug.edu.gh 1.3.2. Diagnosis: It Is very difficult to diagnose typhoid fever based on the clinical features of the disease since similar signs and symptoms are mimicked by malaria parasite infestation and many other conditions. However, if the fever is accompanied by a slow heart rate (bradycardia) and an abnormally low level of white cells m the blood (leucopenia), typhoid fever is considered as a possible diagnosis with appropriate bone marrow or blood culture in the early stages of the infection or stool culture later on in the course of the disease (http://gsbs.utmb.edu/microbook/ch021 .htm: Keusch, 1994). Thus, the disease is generally diagnosed in the laboratory by culture on selective media and combination of serological and biochemical tests to identify the individual serovars. The gold standard of bacteriological confirmation of typhoid fever is, however, the bone marrow culture, which is positive in 85-90% of cases, even when the patient has received antibiotics (Levine, 1999). In the case of the stool, isolation of S. typhi only confirms the diagnosis if characteristic clinical features are present since the patient may be a chronic carrier. Prompt processing of stool specimen is important, since a drop in pH, which occurs with a decrease in temperature, can inhibit the growth of Salmonella species (http://pathologv5 pathology .ihmi .edu/micro/v 16n02htm ). The Widal agglutination test, which is used in diagnosing typhoid fever in most developing countries, measures the antibodies against flagellar (H) and somatic (O) antigens of S. typhi. However, this test can only support the diagnosis of typhoid if there is a fourfold rise in the titre of antibody to the 0 antigen. The H antibodies appear shortly after O antibodies and persist for more than a few months. Hence, a rise or high 24 University of Ghana http://ugspace.ug.edu.gh O antibody titre generally indicates acute infection, while a rise in H antibody helps to identify the type of enteric fever. H antigen also provides a useful epidemiological tool with which to determine the source of infection and its mode of spread. Agglutination test, however, may often be misleading since raised antibodies may result from typhoid immunization or from earlier infection with salmonella© or other Gram-negative bacteria sharing common antigens. A high Vi capsular antibody is suggestive of a carrier state, but there are high rates of false-positive and of false-negatives. Thus, serological evidence alone is not sufficient for diagnosis (DuPont and Steffen, 1997). Diagnosis can also be based on EnteroTest, which is used to obtain bile cultures for S. typhi from the bowel. It consists of a nylon string affixed to a gelatin capsule with the end of the string taped to the cheek and the gelatin capsule swallowed. After a meal or overnight, the string is removed and mucus scraped from the string cultured for S. typhi. An alkaline pH of the string should confirm a duodenum location of the organism. Recently, indirect haemagglutination, indirect fluorescent Vi antibody, ELISA for IgM and IgG antibodies to S. typhi polysaccharide, monoclonal antibodies and DMA probes have been evaluated with promising results, but these tests are not yet routinely used (DuPont and Steffen, 1997). 1 3 3 . Drags used in treatment and prevention of typhoid fever: Treatment of typhoid fever is usually by antibiotics. However, the early use of antibiotics is associated with a relatively high rate of relapse (Keusch, 1994). In some cases the relapse rate may be as high as 20% compared to 5-12% in most untreated cases. This is 25 University of Ghana http://ugspace.ug.edu.gh because prompt therapy does not allow adequate immune response. Nevertheless, effective therapy potentially reduces suffering, complications and loss of life. Most clinical responses are usually seen within 1-2 days during treatment. The mortality rate may fall from more than 10% to less than 1% in most cases after antibiotic therapy (Homick, 1991). Ampicillin, chloramphenicol, tetracycline and trimethoprim- suphamethoxazole, either used individually or in combination, have been the first-line drugs until recently, due to the appearance of resistant strains to these antibiotics (Newman, 1996; 2000; Rowe et al., 1997). More recently quinolones, such as ciprofloxacin, and third-generation cephalosporins, such as ceftriaxone, are now recommended as the first line treatments for multi-drug resistant typhoid fever. Ampicillin: VCOQH Figure 5. Chemical structure of ampicillin Ampicillin (Fig. 5) is a semi-synthetic penicillin derived from the penicillin nucleus, 6* amino-penicillanic acid. It is an antibiotic with a broad spectrum of bactericidal activity against most of the bacteria that show sensitivity to penicillin G. Ampicillin is indicated 26 University of Ghana http://ugspace.ug.edu.gh primarily for infections with certain Gram-negative organisms and for enterococcal infections. Ampicillin is effective in typhoid fever caused by sensitive organisms and, with probenecid, it has been effective in treating some chronic typhoid carriers. Like other penicillins, ampicillin inhibits the third and final stage of bacterial ceil wall synthesis by preferentially binding to specific penicillin-binding proteins (PSPs) that are located inside the bacterial cell wall. PBPs are responsible for several steps in the synthesis of the cell wall and are found in quantities of several hundred to several thousand molecules per bacterial cell. PBPs vary among different bacterial species. Thus, the intrinsic activity of ampicillin, as well as the other penicillins, against a particular organism depends on their ability to gain access and bind with the necessary PBP. Like all (3-lactam antibiotics, ampiciUin's ability to interfere with PBP-mediated cell wall synthesis ultimately leads to cell lysis. However, due to the increasing bacterial resistance, the efficacy of ampicillin against strains of E. coli, Salmonella, and Shigella has been declining (http://www.medicine.mcgill.ca/cai/meded/drugdb/ampicillin). Ampicillin may be given orally, intramuscularly or intravenously. Oral absorption is variable and may be decreased when die drug is taken with food. Peak blood levels occur about two hours after oral or one hour after intramuscular administration. The usual oral dosage in adults and children weighing greater than 20 kg is 230 to 500mg every six hours. In children less than 20 kg, it is 50 to 100 mg/kg/day in divided doses. The parenteral dosage is l-2g four to six hours in adults and 100 to 200 mg/kg/day in divided doses in children. For bacteremia, the dosage is 150 to 200 mg/kg/day intravenous for adults and 200 to 400 mg/kg/day (maximum dose 12g/day) intravenous in children. 27 University of Ghana http://ugspace.ug.edu.gh Chloramphenicol: Figure 6. Chemical structure of chloramphenicol Chloramphenicol (Fig. 6) has been the drug of choice since 1948 throughout the world, until the 1970s due to the emergence of resistant strains (Rowe et al., 1997). Nevertheless, it is still die standard treatment in some developing countries such as Ghana due to its affordability. Chloramphenicol binds to peptidyl-transferase and inhibits transfer of growing peptide chain to "Acceptor" site ammoacyl-tRNA. It is therefore primarily bacteriostatic and has a wide spectrum of activity against Gram- positive and Gram-negative cocci and bacilli. The drug is well absorbed orally but not intramuscularly (IM), and intravenous (IV) route is used for parenteral therapy. It is metabolised in the liver to the inactive glucuronide which is excreted together with chloramphenicol in the urine. Due to the fact that active chloramphenicol is metabolised in the liver to inactive glucuronide the drug does not accumulate in the plasma of patients with renal insufficiency. Chloramphenicol therapy is mostly restricted to serious infections, because it may cause the potential lethal complication of aplastic anaemia (httD://www.merck.com/pubs/mmanual/section 13/chapter 153/153f.htm ). i i University of Ghana http://ugspace.ug.edu.gh The dosage of chloramphenicol in adults and children is 50 mg/kg/day orally or intravenous in divided doses every six hours. In other serious infections, 75 to 100 mg/kg/day in divided doses are used. To avoid the gray baby syndrome, newborns less than or equal to one month are not given greater than 2$ mg/kg/day initially. Doses are adjusted to result in serum levels of 10-30jig/mL (31-03 jimol/L) to avoid toxicity, especially in newborns, premature infants, and patients with hepatic disease. Chloramphenicol is not given to women m labour, ft should not be used topically because small amounts may be absorbed which can cause aplastic anaemia (http://www.merckcom/pubs/mmanual/section 13/chaoter 153/153f.htm )■ Tetracyclines: Tetracyclines (Fig. 7) bind reversibly to the 30S subunits of bacterial ribosomes where they interfere with binding of charged-tRNA to the "Acceptor" site. They are bacteriostatic rather than bacteriocidal. Tetracyclines can also inhibit protein synthesis in 29 University of Ghana http://ugspace.ug.edu.gh the host, but Me less Ifkely to reach the concentration required because eukaryotic ceils do not have a tetracycline uptake mechanism as prokaryotic cells do. They are amphoteric, and thus form salts with both strong acids and bases (http://www.vet.Durdue.edu/depts/bms). All orally administered tetracyclines produce varying degrees of gastro-intestinal ((3f) adverse reactions, such as nausea, vomiting, and diarrhoea, and can cause pseudomembranous colitis (caused by Clostridium difficile) and Candida superinfections. Thrombophlebitis is common with intravenous use. Tetracyclines can cause staining of teeth, hypoplasia of dental enamel, and abnormal bone growth in children less than or equal to 8 years old and in the foetuses of pregnant women. Therefore, tetracyclines should be avoided after the first trimester of pregnancy and in children less than eight years old. Tetracycline is given orally in dosages of 250 to 500mg every six hours to adults and 25 to 50 mg/kg/day in four divided doses to children older than eight years. Doses should be taken an hour before meals or two hours after. Intramuscular injection is very painful, and the intravenous route is preferred for parenteral therapy. Tetracycline can be given intravenously in dosages o f250 to 500mg (rarely lg) every twelve hours to adults and, in those rare rases when required, 10 to 25 mg/kg/day in two to three equal doses to children older than eight years. 30 University of Ghana http://ugspace.ug.edu.gh Trimethoprim-sulphamethoxazole: Trimethoprim Figure 8. Chemical structures of trimethoprim and sulphamethoxazole Trimethoprim-sulphamethoxazole (TMP-SMX) (Fig. 8) is a fixed combination (1:5) of Trimethoprim and sulphamethoxazole. It is usually bacteriostatic. The dosage ratios are set to produce a twenty to one ratio of SMX to TMP in blood and tissues, which gives maximal antibacterial activity. Both drugs block the folic acid metabolism cycle of bacteria and are much more active together than either agent alone. Sulfonamides are competitive inhibitors of the incorporation of/ j-aminobenzoic acid. TMP prevents reduction of dihydrofolate to tetrahydrofolate. Both TMP and SMX are well absorbed orally and are excreted in the urine. They have similar half-lives of about nine hours in plasma and penetrate well into tissues and body fluids, including the CSF. TMP-SMX is useful in treatment of typhoid fever, especially when ampicillin and chloramphenicol cannot be used. The adverse reactions are usually nausea, vomiting, rash, and folate deficiency resulting in macrocytic anaemia. 31 University of Ghana http://ugspace.ug.edu.gh The usual oral dosage in adults is two regular-strength tablets (each tablet contains 80mg TMP and 400mg SMX) or one double-strength tablet (160mg TMP and 800mg SMX) twice daily. The usual oral dosage in children is 8mg/kg TMP and 40mg/kg SMX daily in two divided doses. The intravenous dosage in adults and children is 8 to 12mg/kg TMP and 40 to 60mg/kg SMX daily in four divided doses. Quinolones and fluoroquinolones: The quinolones and fluoroquinolones are bacteriocidal and inhibit the activity of DMA gyrase. The older quinolones, nalidixic acid and cinoxacin, are active only against Enterobacteriaceae, with no activity against Gram-positive organisms, Pseudommas aeruginosa, or anaerobes. The fluoroquinolones have much greater activity against Enterobacteriaceae and are also active against staphylococci, P. aeruginosa, Mycoplasma, Chlamydia, and some streptococci, but with the exception of trovafloxacin, are not reliably active against anaerobes. Resistance to one fluoroquinolone generally means resistance to all. Fluoroquinolones with die exception of norfloxacin are better absorbed orally, resulting in blood levels adequate for treating systemic infection. Except for ciprofloxacin, ofloxacin, trovafloxacin, and levofloxacin, the quinolones are available only orally. After administration, they are widely distributed to most body fluids and tissues. However, norfloxacin does not reach concentrations adequate for treatment of systemic infection. The quinolones are variably metabolized in the liver and excreted in the urine. All the quinolones and fluoroquinolones are useful in urinary tract 32 University of Ghana http://ugspace.ug.edu.gh infections. Hie fluoroquinolones are effective in bacterial diarrhoea except that caused by Campylobacter difficile. Serious adverse reactions to quinolones are uncommon. About 5% of patients experience gastro-intestinal side effects such as nausea, vomiting and anorexia. Diarrhoea, leucopenia, anaemia, rash and photosensitivity are uncommon. There is some concern that tendonitis, including rupture/Achilles tendon, is associated with fluoroquinolone use. Nephrotoxicity is rare with side effects on the central nervous system (CNS) occurring in less than 5% of patients. These are usually manifested by mild headaches, sleep disturbance or mood alteration. Seizures are rare, but these drugs should be avoided in patients with convulsive or other CNS disorders. The fluoroquinolones are currently contraindicated for use in children and pregnant women, but further research is ongoing. Ciprofloxacin is given orally in dosage o f250 to 750 mg twice daily in adults and intravenous in a dosage o f200 to 400mg every twelve hours. Third-generation cephalosporins: These drugs have excellent activity against Enterobacteriaceae. Of the parenteral drugs, cefotaxime, ceftizoxime, and ceftriaxone have very similar in vitro activity. Ceftazidime is more active than cefoperazone against Enterobacteriaceae and P. aeruginosa. In general, Enterobacteriaceae can be treated with cefotaxime, ceftriaxone, ceftazidime, or ceftizoxime. 33 University of Ghana http://ugspace.ug.edu.gh Ceftriaxone is given intramuscularly or intravenously in a dosage of one to two grams once or twice per day to adults. In children, 50 to 75mg/kg/day (not to exceed 2.0 g) is given in one to two equally divided doses. 1.4. ANTI-MICROBIAL MEDICINAL PLANTS: There are claims of a number of medicinal plants used for die treatment of a variety of ailments caused by microorganisms, from stomachache to diarrhoea, malaria and skin infections. Ocimum gratissimum leaf or whole plant is known to be very effective against diarrhoea. The use ofA zadirachta indica (mem) to treat malaria has been in existence since time immemorial along the Western, Central and Eastern African regions (Sofowora, 1993; Mshana et aL, 2000). Chewing sticks used in many African homes to clean teeth have been shown to possess antimicrobial activity against oral microbial flora (Asuquo and Montefiore, 1977; Moran e ta l, 1988; Al.lafi and Jordan, 1995). In Tanzania the root or root bark of Zanha africana is used to treat various skin diseases and the Traditional Medicine Research Unit (TMRU) of the Muhimbili Medical Centre in Dar-es-Salaam has demonstrated that die methanolic extract of Z africana root possesses strong antifungal activities when tested against Trichophyton rubrum and Trichophyton mentagraphytes using Sabouraud dextrose agar medium and mycobiotic agar medium (Kokwaro, 1993). Addae-Mensah (1992) has reported the treatment of gonorrhoea, syphilis as well as other bacterial and viral infections using Piper guineense. Methanolic extract of Brideliaf erruginea is known to be active against S. dysenteriae, P. aeruginosa, E. coli, S. typhimurium, and P. vulgaris (Akinpelu and Olorunmola, 2000; Muanza, et al., 1994). 34 University of Ghana http://ugspace.ug.edu.gh The dried aerial parts of Hoslundia opposita is used to treat gonorrhoea, cystitis, hookworm, cough, fevers, colds, wounds, and bilharzia in Tanzania (Chhabra and Uiso, 1991). In Cameroon and East Africa, the hot water extract of the dried entire H opposita plant is used for snakebites, herpes, conjunctivitis, yellow fever, stomach troubles, liver diseases, mental disorders and as an antibiotic, (Ngadjui eta!., 1991; Hedberg, et al., 1983). In Ghana, the hot water extract from the leaves of H. opposita is known to reduce fever possibly due to malaria (Boye, 1989) whilst in Ivory Coast, it is used for dysmenorrhoea (Bouquet and Debray, 1974). In Nigeria, the hot water extract is used for convulsions, to treat bad breath accompanied by aching chest and head (Aka and Nwambie, 1993). In Ivory Coast, hot water extract of the entire plant of Cnestis ferruginea is used as an aphrodisiac (Bouquet and Debray, 1974), whilst in Senegal, it used for conjunctivitis, syphilis, gum pain, wounds/sores, diarrhoea and dysentery (Le Grand, 1989). Psidium guajava is used to treat acute and chronic diarrhoea as well as Herpes zoster, a virus infection (Ghana Herbal Pharmacopoiea, 1992; Mshana, 2000). 1.5. CHARACTERIZATION OF PATHOGENIC MICROORGANISMS: 1.5.1 Polymerase chain reaction (PCR): PCR is a technique that amplifies a specific DNA segment from a gene (Coen, 1994). Amplification of the target DNA sequence is accomplished in three basic steps. The first step, which is denaturation, involves separating the double stranded DNA molecule into single strands. The second step, annealing, refers to the ability of gene-specific primers to bind to specific sequences of the DNA sequence now being used as a template, and the final step, elongation, involves extension of primers by Thermos aquaticus (Taq) DNA 35 University of Ghana http://ugspace.ug.edu.gh polymerase. These three steps are repeated approximately 30 times, resulting in the amplification of the desired gene sequence. There are several applications of PCR including direct cloning of amplified fragments, detection of mutagenesis, and genetic fingerprinting of complex genomes (Belkum, 1994; Coen, 1994). PCR typing methods are simple, fast, and provide a comparative way to differentiate organisms (Liu et al., 1994). Randomly amplified polymorphic DNA (RAPD) PCR: This is based on decreased annealing temperatures resulting in low stringent amplification of random DNA fragments within the genome of an organism (Sechi et al., 1999). RAPD requires no previous knowledge of the DNA that is to be amplified and involves primers that are randomly selected and vary in length. The primers are generally shorter than primers used in conventional PCR, Since the number of annealing sites vary between strains, amplification results in variable DNA patterns (Power, 1996). Fingerprints generated from RAPD provide the highest level of taxonomic resolution achieved by PCR methods (Vinuesa et al., 1998). Enterobacterial repetitive intergenic consensus sequence (ERIC) PCR: This is based on a consensus sequence found in the Enterobacteriaceae family (Power, 1996). ERIC sequences are repetitive elements that are 126 base pairs long and contain a highly conserved central inverted repeat. They appear to be restricted to transcribed regions of the chromosome and their position seems to be variable in different species. ER1C-PCR has been used to successfully fingerprint numerous organisms including, 5. 36 University of Ghana http://ugspace.ug.edu.gh enterica and S. typhimurium (Versalovic et a l 1991; Beyer et al., 1998; Sechi et tit., 1999). Repetitive extragenic palindromic (REP) PCR: This is based on short extragenic repeat sequences found throughout the genome of bacteria (Power, 1996). These sequences, which have a consensus 38 base pair sequence, appear to be highly conserved among many members of die family Enterobacteriaceae. Functions proposed for REP elements include roles in transcription termination, mRNA stability, and chromosomal domain organisation. No examples of the REP sequence coding for a protein have been reported. Even though the functions of REP sequences are unclear, they are a significant part of the bacterial genome. REP-PCR is simple, rapid, and sensitive for discriminating between closely related strains. It has been used in die typing of many organisms such as S enterica and S. typMmurium (Stem et al,, 1984; Versalovic eta l., 1991; Wood et al., 1992; Beyer et al., 1998). 1.5.2 Plasmid incompatibility: Plasmids are small circular, double-stranded DNA molecules that replicate independently of the cell’s chromosomes and found mainly in bacteria and some eukaryotic microorganisms, such as Saccharomyces cerevisiae. It has been found that not all plasmids are able to coexist in the same cell and any two plasmids known to bear this trait are described as incompatible. Plasmids which have die same replication control functions are incompatible, and those plasmids which share the trait of a similar nature are assigned to the same incompatibility group (inc group). Thus, plasmids of one 37 University of Ghana http://ugspace.ug.edu.gh incompatibility group are related to each other, but cannot survive together in the sam£ bacterial cell, as only different kinds of plasmids are compatible. In many cases, incompatible plasmids belonging to the complex group IncHl have been implicated in bacterial resistance to antibiotics by S. typhi (Rowe etal., 1990) and therefore could be used to characterize different strains of S, typhi. 1.5.3 Antibiotic susceptibility patterns: Laboratories involved in epidemiological studies frequently perform antibiotic susceptibility tests to bacteria. Most of these tests are qualitative in terms of categorizing strains as susceptible, intermediate, or resistant to various antibiotics (Pfaller and Cormican, 1996). When the method is used to determine minimal inhibitory concentrations (MIC) it is considered quantitative. Common approaches to antibiotic susceptibility testing include the Kirby-Bauer test (Tortora et al^ 1995), in which paper disks impregnated with different concentrations of antibiotics are placed in contact with bacterial lawns (Hunt and Sandham, 1969), Most strains of pathogenic bacteria isolated from the same hospital often share similar susceptibility patterns, resulting in poor discrimination of the isolates (Debast et al., 1995). The information acquired from these tests, however, may be helpful in the recognition of different bacterial strains and in detecting early trends of elevating MIC among groups of organisms (Pfaller and Cormican, 1996). Generally, determination of MIC is not suitable for epidemiological typing by itself. If used in combination with other typing methods, it can further discriminate between strains (Larose et al., 1990) and 38 University of Ghana http://ugspace.ug.edu.gh be useful as an epidemiological tool (Acar, 1986). Antibiotic susceptibility testing is relatively inexpensive and generally adequate in most clinical settings which have the facilities (Pfaller and Cormican, 1996). 39 University of Ghana http://ugspace.ug.edu.gh CHAPTER TWO MATERIALS AND METHODS 2.1. MATERIALS: 2.1.1. Chemicals, media and reagents: Ampicillin, chloramphenicol, rifampicin, tetracycline, trimethoprim-Sulphamethoxazole, Mueller Hinton agar and Mueller Minton broth were obtained from Becton Dickinson Microbiology System, Cockeysville, MD, USA. Dimethylsulfoxide (DMSO) was from the British Drug House (BDH), UK whilst the Salmonella antisera was obtained from Denka Seiken Co., Ltd., Japan. Agarose gel, glycerol, Luria-Bertani (LB) broth and sterile swabs were obtained from Fisher Scientific, Maryland, USA whilst the E, coli DH5a and E. coli HMS 174 were from Genetic Stock Center, Yale University, New Haven, USA. From Oxoid, Maryland, MD, USA the following ware obtained; blood agar, desoxycholate agar (DCA), Kovac’s reagent, MacConkey agar, nutrient agar, Salmonella/Shigella (SS) agar, selenite F broth, sulphur indole motility (SIM) agar, triple sugar iron (TSI) agar, trypton soya agar (TSA), trypton soya broth (TSB), urea agar and 40% urea solution. The wizard genomic DNA purification kit was obtained from Promega, Maryland, USA whilst the QIAprep spin miniprep kit was obtained from QIAGEN, Valencia, USA. Acetic acid, deoxynucleoside triphosphate (dNTP), ethidium bromide, ethylenediaminetetraaceticacid (EDTA), calcium chloride, magnesium chloride, potassium chloride, Thermos aquaticus (Taq) polymerase, tris-hydrochloric acid (Tris- HC1) and triton-XlOO were from Sigma-Aldrich, Germany. 40 University of Ghana http://ugspace.ug.edu.gh 2.1.2. Bacterial sample: Majority of the Salmonella isolates were supplied by the Microbiology Department, Korle-Bu Teaching Hospital, whilst the others were isolated from samples collected by the staff of die Bacteriology Unit, Noguchi Memorial Institute for Medical Research (NMIMR), Legon. The sources of the samples were blood, cerebrospinal fluid, food, stool, urine, and from other miscellaneous sources. 2.13. Herbal preparations: The aqueous herbal concoction and the decoctions were supplied by the Production Department of the Centre for Scientific Research into Plant Medicine (CSRPM) at Mampong-Akwapim. At the Production Department, the twelve (12) plant materials were boiled together with water to extract the juice. The extracted juice was cooled and lyophilized at the Pharmacology and toxicology Department also of CSRPM, The leaves from each plant were also individually boiled in water and cooled at the Production Department, The aqueous extracts were then filtered and subsequently lyophilized at the Pharmacology and toxicology Department. In this study, the freeze-dried products were reconstituted in distilled water (32% w/v), dispensed into 15ml centrifuge tubes and refrigerated at 4°C until needed. Some of the herbal preparations were sterilized by autoclaving at 121°C for ISmin, cooled, and centriftiged at 7,00Qrpm for 15min. The supernatants were then refrigerated at 4°C until needed. 41 University of Ghana http://ugspace.ug.edu.gh Solvent-solvent extraction method was used to obtain fractions of plant extracts found to have activity against the standard Salmonella. The following organic solvents, petroleum ether, chloroform, ethylacetate, and n-butanol were used for the extraction. Volumes of 400ml of aqueous extract of the plant and 200ml of the organic solvent were added in a separating funnel and shaken intermittently. After 48 hours the aqueous layer was removed and the solvent from the organic layer evaporated using a rotary evaporator. The residue from each fraction was then reconstituted into 10ml solution using 20% dimethylsulphoxide (DMSO), The antimicrobial activities of the fractions were then investigated using the agar diffusion method. The plants used were Hoslundia opposita, Cnestis ferruginea, and Psidium guajava. 22. METHODS: I 1 L Bacterial culture, isolation and identification: The specimens were plated out using appropriate selective media such as MacConkey agar, blood agar and desoxycholate agar and/or Salmonella/Shigella agar, and colonies with the characteristics o f Salmonella isolated and purified using standard microbiological methods (Farmer, 1999), Identification o f Salmonella from the various sources was done using the following biochemical tests; Triple Sugar Iron (TSI) agar test, Sulphur Indole Motility (SIM) agar test, and Urea agar test. The presence of Salmonella was confirmed and grouped using Salmonella antisera kit from Denka Seiken Co., Ltd., Japan. Briefly, a needle of solid bacterial growth (or two loops of broth bacterial growth) was placed in the centre of a clean sterilized slide. One drop (and only one drop) of 42 University of Ghana http://ugspace.ug.edu.gh sterile physiological saline was added to Hie specimen. Where broth medium was used no saline was added. Using an inoculating loop or the tip of a toothpick, the specimen-saline mixture was completely mixed after which a drop of the Salmonella antisera was added. The resulting mixture was rocked for about 5 seconds and observed for coagulation. In vitro antibiotic susceptibility against ampicillin (10|ig), chloramphenicol (30^g), tetracycline (30pg), and trimethoprim-Sulphamethoxazole (1.25/23.75|ig) was tested according to the guidelines set by the National Committee for Clinical Laboratory Standards (NCCLS, 1998). 2.2.2. Minimum inhibitory concentration (MIC) of the antibiotics used: The minimum inhibitory concentration for the antibiotics against the Salmonella isolates were determined by the agar dilution technique according to the guidelines set by the National Committee for ClinicaJ Laboratory Standards (NCCLS, J 997), Sterile MueJJer- Hinton agar in molten form was prepared and distributed in exact aliquots sufficient to dilute the starting antibiotic] 0-fold, The appropriate volume of the starting antibiotic was added to the molten Mueiler-Hinton (MH) agar that had been allowed to equilibrate to 48-50°C in a water bath. Hie agar-antibiotic mixture was mixed thoroughly by gentle inversion and the mixture poured intolOOmm petri dishes on a level surface to result in an agar depth of about 4mm. The agar was allowed to solidify at room temperature and the plates used immediately. For growth controls, plates containing no antibiotic were prepared. 43 University of Ghana http://ugspace.ug.edu.gh The top of a well isolated Salmonella colony was touched with a wire loop and transferred into 3ml MH broth. The broth culture was incubated at 37°C until it achieved the turbidity of 0.5 McFarland standard resulting in a suspension containing approximately 1-2 x 10® CFU/ml. By using sterile broth, a 1:10 dilution of the bacterid! suspension for each of the 115 strains was made to give an adjusted concentration of 107 CFU/ml, An aliquot of each diluted suspension was placed in a well of a replicator inoculum block, A J -2ui aliquot of each inoculum was applied to the agar surface by the use of an inocula-replicating device, A growth control plate (no antimicrobial agent) was inoculated first and then, starling with the lowest concentration, the plates containing the different antimicrobial concentrations were inoculated. A second growth control plate was inoculated last to ensure that there was no contamination or significant antimicrobial carryover during the inoculation. A sample of each inoculum was streaked on a nutrient agar plate and incubated overnight to detect any probable contamination and to provide freshly isolated colonies in case retesting proved necessary. The inoculated plates were allowed to stand at room temperature until the moisture in the inoculum spots had been absorbed into the agar. The plates were then inverted and incubated at 35°C for 16-20 hours. The lowest concentration of antibiotic that allowed no more than one or two CFU or only a slight haze to grow was chosen as the MIC. 44 University of Ghana http://ugspace.ug.edu.gh 2.23. Storage of Salmonella isolates: The salmonellae were grown overnight at 37°C in 1.5m] TSB with shaking. To each overnight culture was added l,Sm l 40% glycerol-TSB mixture and mixed gently without vortexing. Two milliliter sample of the mixed cultures was put into a 2mJ cryovial under sterile conditions, labelled with name/type of organism and date and stored at -70°C until needed. 2.2.4. Isolation and profiling of plasmids: Plasmids from the 115 strains were isolated using the QIAprep spin miniprep kit according to the manufacturer’s guidelines. This procedure uses the modified alkaline lysis method of Bimboim and Doly (1979). The organisms were grown in 3ml Luria- Bertani (LB) broth for about 16 hours at 37°C and centriftiged at 13,000g for about 1 minute. The pellet obtained was resuspended in 250\d of glucose solution (making sure that no clumps were visible after resuspension), and the whole content transferred to a microfuge tube. Into this tube was added 250\il of alkaline-sodium dodecyl sulphate (SDS) buffer, gently inverted 4-6 times or until the solution became viscous and slightly clear. Potassium acetate (KAC) solution was then added and the tube immediately inverted, but gently, 4-6 times or until the solution became cloudy, care being taken to avoid local precipitation. Centrifugation of the microfuge tube with its content was done at 13,O00g for lOmin, The supernatant fraction was decanted into QIAprep column and centrifuged again at I3,000g for 30-60 seconds. The flow-through was discarded and the QIAprep Spin column washed with 0.75ml of 95% ethanol and centrifljged for 30-60 seconds after which the flow-through was discarded and the column centrifuged again for 45 University of Ghana http://ugspace.ug.edu.gh 30-60 seconds. The QIAprep column was placed In a clean 1.5ml microftige lube and th6 DNA was eluted with pre-heated polished water after centrifligation at 13,000g for 1 minute. The eluted plasmids were stored at 4°C until needed. Agarose gel electrophoresis was used to visualize plasmid DNA products. A 0.7% agarose gel was prepared by dissolving 0.28g of agarose in 40ml of IX TAE (Tri-acetic acid-EDTA), which was prepared from a 50X stock (242g Tris, 57.1ml acetic acid, aid 4ml 0.5MEDTA/JL). Ethidium bromide (Ipi of a JOmg/mi solution) was added to aid visualization of the DNA. The electrophoretic chamber was a Minicell EC370M powered by a Bio-RAD model 250/2.5 power supply. The agarose gels were visualized using a UV Intensify Trans-illuminator and documented with Panasonic CCD Ultra Lum camera and scion image software. 2.2.5. Plasmid incompatibility testing: Plasmid DNA was isolated from each Salmonella strain, transformants and transconjugates to determine if they belonged to the incompatibility group Inc HI. The Rep HI1A replicon, present in Inc HI plasmids, was amplified via the polymerase chain reaction (PCR) using the primers 5’GGTCCAACCCATTGCTTTAC3’ and 5’CACGGAAAGAAATCACAAC3’ on a model P T 150 MiniCycler, Reaction conditions consisted of 50ng plasmid DNA and 50nM of each primer in a buffer composed of lOmM Tris-HCJ (pH 8.3), 50mMKCJ, 1.5mMMgCJ2,200jiM dNTP mixture, and 1U of Taq polymerase in a final volume of 100^1. Amplification conditions were 30 cycles of 94°C/30sec, 55 °C/30sec, and 72 °C/30sec, with a final extension step 46 University of Ghana http://ugspace.ug.edu.gh of 72°C for lOmin. Amplicons of365bp were considered positive for the Rep HI1A replicon. 2.2.6. Transfer of antibiotic resistance via conjugation: This was carried out using the resistant Salmonella isolates as the donors and E, coli HMS J 74 as the recipients. Preliminary investigations were done to establish that the Salmonella strains were sensitive to JOOpg/mJ rifampicin whilst the R, coH HMS J 74 was resistant at this concentration. These organisms were grown separately overnight at 37°C with shaking in 3ml tryptic soy broth (TSB). Into fresh 3ml TSB was added 0.3ml overnight cultures and the mixture incubated at 37°C with shaking for about 1 hour or until 0.S McFarland turbidity standard was obtained. Five hundred microlitres of each suspension of Salmonella strain was mixed with the same quantity of E. coli HMS 174 in a sterile tube and the suspension incubated at 37°C without shaking for 90 minutes. At 30-minute intervals, the cultures were mixed by gentle inversion. These conjugation mixtures were then plated on MacConkey agar plates containing lOOfig/ml rifampicin and either ampicillin (32jig/ml), chloramphenicol (32|ig/mJ), or trimethoprim- Sulphamethoxazole (4jxg/m]; lfyg/ml) and incubated overnight at 37°C. Lactose fermenting colonies growing on the plates indicated conjugational transfer of antibiotic resistance to E. coli HMS 174. 2.2.7. Preparation of competent cells and transformation by heat shock technique: Competent cells were prepared by inoculating 2ml of 2X Luria Bertani (LB) broth with a single colony from a plate culture and grown overnight at 30°C with shaking. 47 University of Ghana http://ugspace.ug.edu.gh Aseptically, 0.5ml of the overnight culture was added to 200ml pre-warmed (30°C) 2X LB contained in a 1 litre flask. This represented 1:400 dilution. The cells were incubated at 30°C with shaking until an OD̂ oo of 0,3 was obtained. Four milliliters of 1M magnesium chloride (MgCla) was then added and growth continued until the ODm was 0,45-0,55, The cells were chilled on ice for 2 hours, and the content placed in a sterile centrifuge tube and spun at 3000g for 5min at 4°C. The supernatant fraction was discarded and the cells resuspended in 100ml of JM ice cold calcium chloride (CaClz) solution using a pipetteman without vortexing. The resuspcnded cells were put back on ice for another 40min after which the tube was centrifbged at 3000g for 5min at 4°C, The supernatant fraction was again discarded and the cells resuspended in 5,1ml of ice-cold CaClj-glycerol media. The suspension, containing competent cells, was aliquoted into sterile microfiige tubes and stored at -70°C. Plasmid DNA was isolated as previously described and used to transform R coll DH5a according to standard procedures (NCCLS, 1997). Briefly, 2^1 of the plasmid preparation was added to 100f*J of the competent cell suspension and incubated on ice for 15-30min. The DNA-competent cell suspension was placed in a 42°C water bath for 90sec and then chilled on ice for lmin. Nine hundred microlitre volume of LB was added immediately and the cells incubated at 37°C for 1 hour for expression of antibiotic resistance. Selection of transformants was made on trypton soy agar (TSA) plates containing either ampicillin (32|ig/ml), chloramphenicol (32fig/ml), or trimethoprim- Sulphamethoxazole (4|Ag/ml:16|Ag/ml). Previous testing had proved that the E. coli DH5a was sensitive to all antibiotics investigated in this study. 48 University of Ghana http://ugspace.ug.edu.gh 22.%. Chromosomal DNA: Isolation: Chromosomal DNA was isolated from each Salmonella strain using the Wizard Genomic DNA Purification Kit. Samples of 1ml each of overnight culture of the Salmonella strains were dispensed into a 1,5ml microfuge tube and centrifuged at 13,000-16,OOOg for 2 minutes to peJlet the cells. Hie supernatant fraction was discarded and 600^1 of NueJei Lysis Solution added and gently pipetted until the cells were resuspended. The suspension was incubated at 80°C for 5 minutes to Jyse the cells. It was then cooled to room temperature after which 3pl ribonuclease (RNase) solution was added and mixed by inverting the tubes 25 times. The cell lysate was incubated at 37°C for 15-60 minutes and cooled again to room temperature. The RNase-treated cell lysate was mixed with 200{U of protein precipitation solution and vortexed vigorously at high speed for 20 seconds in order to mix the two. The protein precipitation solution/cell lysate mixture was incubated on ice for 5 minutes and then centrifuged at 13,000-16,OOOg for 3 minutes. The supernatant fraction containing the DNA was transferred to a dean 1.5ml microcentrifuge tube containing 600fil of isopropanol at room temperature and mixed gently by inversion until thread-like strands of DNA were visible. The mixture was centrifuged at 13,000-16,OOOg for 2 minutes and the supernatant fraction poured off. The tube was drained on a clean absorbent paper and 600(il of 70% ethanol at room temperature was added and gently inverted several times to wash the DNA pellets. Centrifugation at 13,000-16,OOOg for 2 minutes was repeated, the ethanol was carefully aspirated and the tube drained on a clean absorbent paper. The pellet was allowed to air- 49 University of Ghana http://ugspace.ug.edu.gh dry for 10-15 minutes, lOOpl of DNA rehydration solution was added and the mixture was incubated overnight at 4°C. Storage of the DNA was at 4°C. Amplification: Chromosomal DNA from each Salmonella strain was amplified using the PCR on a MJ Research MiniCycler, The PCR techniques used were repetitive extragenic palindromic (REP) elements and enterobacterial repetitive intergenic consensus (ERIC) sequences (Sander et. al., 199*). The primer used for ERIC was *GTGAATCCCCAGCAGCTT ACAT3’ and die primers used for REP were ^REPIR-Dt: 5’NCGNCGNCATCNGGC3 and S’RE 2D:5’RCGYCTTATCMGGCC- TAC3’ (N=A,C,G, or T; M=A or C; R=A or G; Y=C or T). For both PCR types the amplification conditions were 94°C for lmin, 52°C for lmin and 72°C for lmin, all representing one cycle. However, all the PCR conditions included an initial 94°C for 5min and final 72°C for 5min. Typical reaction mixtures consisted of500ng DNA, 200jiM deoxynucleotide triphosphates (dNTPs), 1.5ftM MgCk, 0.5fil Taq polymerase, and 50nM of each primer in buffer containing 50mM TrisCl, 5GmM KC1, and 0.01% Triton-XlOO in a final volume of lOOpl. 2.2.9. Agarose gel electrophoresis: Agarose gel electrophoresis was used to separate the PCR products and to obtain DNA fingerprints of the Salmonella isolates. Preparation of agarose gel size of 60 wells was done by dissolving 3g of agarose powder in 200ml of TAE after which 6fil ethidium bromide was added and the mixture poured into the appropriate electrophoretic trays. Each electrophoresis was run at 120V for V/A. The electrophoretic chambers included a 50 University of Ghana http://ugspace.ug.edu.gh Minicell EC370M and Maxicell EC360M powered by a Bio-RAD model 250/2.5 power supply. Agarose gels were visualized using a UV Intensity Transilluminator and documented with Panasonic CCD Ultra Lum camera and scion image software. The TAE was prepared from a SOX stock (242g Tris, 57.1ml acetic acid, 4ml 0.5 EDTA/IL). 2.2.10 Determination of the potency of the herbal preparations: This study was conducted to determine if the herbal preparations had any antimicrobial activity. The methods employed were as described in the British Pharmacopoeia (A 147 Appendix XIVA, 1988, Vol. II) Hundred millimeter petri dishes were filled with 25ml of molten Mueller-Hinton agar to a depth of about 4mm and allowed to solidify. Each plate was then flooded with a particular Salmmelia strain and the plate allowed to dry at room temperature for an hour on a level surface. A sterilized borer of an internal diameter of about 6mm was used to bore holes in the medium and into these holes were added 100j.il of the different herbal preparations. Chloramphenicol was always added to one hole to serve as the control. The plates were kept in the refrigerator overnight, for complete absorption of the extract or antibiotic, and then incubated at 37°C for approximately 18 hours. The zones of inhibition produced by the various preparations were measured by using a metric ruler. 2.2.11. Minimum inhibitory concentrations (MICs) of the herbal preparations: The MIC for the herbal preparation was determined using the agar dilution method as described in the NCCLS (1997). A dilution scheme for the stock solution of herbal 51 University of Ghana http://ugspace.ug.edu.gh preparation, with concentration 320mg/ml was prepared. Sterile Mueller-Hinton agar in molten form was prepared and distributed into universal bottles in exact aliquots sufficient to dilute the starting herbal concentration 10-fold. The agar was allowed to equilibrate in a water bath to 48-50°C. Hie appropriate volume of the starting herbal (heat stable) concentration that has been sterilized by autoclaving was added to the molten Mueller-Hinton agar. The agar-herbal preparation was mixed thoroughly by gentle inversion and the mixture poured into 100mm petri dishes on a level surface to result in an agar depth of about 4mm, The agar was allowed to solidify at room temperature and the plates used immediately. Plates containing no herbal preparation were prepared to serve as growth controls. The top of s well isolated Salmonella colony was touched with a wire loop and transferred into 5ml Mueller-Hinton broth. The broth culture was incubated at 37°C until it achieved the turbidity of the 0.5 McFarland standard resulting in a suspension containing appi. ately 1-2 x JO8 colony forming Units (CFUYnil. By iisirig sterile broth, a 1:10 dilution of the bacterial suspension was made to give an adjusted concentration of 107 CFU/ml. An aliqiiof of each well-mixed suspension was placed in the corresponding well in the replicator inoculum block. A 1 -2ul aliquot of each inoculum was applied to the agar surfece by the use of an inocula-replicating device. A growth control plate (no herbal preparation) was inoculated first and then, starting with the lowest concentration, the plates containing die different concentrations of the decoctions/concoctions were inoculated. A second growth control plate was inoculated last to ensure that there was no contamination or significant antimicrobial carryover 52 University of Ghana http://ugspace.ug.edu.gh daring the inoculation. A sample of each inoculum was streaked on a nutrient agar plate and incubated overnight to detect any probable contamination and to provide freshly isolated colonies in case retesting proved necessary. The inoculated plates were allowed to staid at room temperature until the moisture in the inoculum spots had been absorbed into the agar. The plates were then inverted and incubated at 35°C for 16-20 hours. The lowest concentration of agent that allowed no more than one or two CFU or only a slight haze to grow was chosen as the MIC. 53 University of Ghana http://ugspace.ug.edu.gh CHAPTER THREE RESULTS 3.1. BACTERIOLOGICAL CHARACTERIZATION OF THE SALMONELLA STRAINS 3.1.1. Bacterial culture, isolation and identification: One hundred and fifteen (115) Salmonella strains were isolated from the samples obtained from the various sources, including Mood, CSF, food, stool, and urine at the Microbiology Department Korle Bu Teaching Hospital and the Bacteriology unit, NMIMR. The breakdown is as found in Table 1. The Salmonella isolates were characterized using Salmonella antisera kit into eight different groups, based on die Kauffmann-White scheme, with Groups B and D forming 90.4% (Table 2). 3.1.2. Antibiotic susceptibility testing of Salmonellai One hundred and fifteen Salmonella strains were examined for their antibiotic susceptibility. The antibiotics chosen were based on NCCLS standards as well as current treatment regimens for Salmonella infections in Ghana. Figure 9 shows that, 74% Salmonella strains (85 out of 115) were resistant to one or more of the first-line anti­ typhoid antibiotics namely; ampicillin, chloramphenicol, tetracycline and trimethoprim- Sulphamethoxazole as well as streptomycin. The remaining strains were found to be susceptible to all five antibiotics used. Of the eighty-five resistant strains, 37 (43.53%) were resistant to all five antibiotic, thirty-two (37.65%) resistant to four antibiotics, seven (8.24%) to three antibiotics, one (1.18%) to two antibiotic and 8 (9.41%) were resistant to 54 University of Ghana http://ugspace.ug.edu.gh tine antibiotic. Thus, 76 Salmonella strains out of the total of 1 IS (66.09%) were found to possess multi-drug resistance (resistance to three or more antibiotics). 55 University of Ghana http://ugspace.ug.edu.gh Table 1. Number of Salmonella strains isolated from different sources. SOURCE OF SAMPLE No. OF SALMONELLA PERCENTAGE (%) ISOLATED Blood 82 71.3 Cerebrospinal fluid 3 2.6 Food 14 12.2 Stool 6 5.2 Urine 4 3.5 Other sourees 6 5.2 TOTAL 115 100.0 Identification of Salmonella from the various sources was done using the fallowing biochemical tests; Triple Sugar Iron (TSI) agar test, Sulphur Indole Motility (SIM) agar test, and Urea agar test. Table 2. Groups of Salmonella strains isolated GROUP No. OF ORGANISMS PERCENTAGE f%> A 1 0.9 B 38 33.0 Ct 4 3.5 Q 2 1.7 D 66 57.4 E, 2 1.7 G 1 0.9 I 1 0.9 TOTAL 8 115 100.0 Salmonella were grouped using Salmonella antisera kit from Denka Seiken Co., Ltd., Japan. Briefly, a needle o f solid bacterial growth (or two loops of broth bacterial growth) was placed in the centre of a clean steril ized slide. One drop of sterile physiological saffoe was added to the specimen. Where broth medium was used no safirte was added, Usingartirtoculafiflgfooportfietipofa toothpick, the specimen-saline mixture was completely mixed after which a drop of the Salmonella antisera was added. The resulting mixture was rocked for about 5 seconds and observed for coagulation. 56 University of Ghana http://ugspace.ug.edu.gh RESISTANCE TO ONE ANTIBIOTIC 7% RESISTANCE TO TWO ANTIBIOTICS SUSCEPTIBLE TO ALL 1% FIVE ANTIBIOTICS RESISTANCE TO THREE 26% ANTIBIOTICS 6% RESISTANCE TO FOUR ANTIBIOTICS 28% RESISTANCE TO FIVE ANTIBIOTICS 32% Fignre 9. Susceptibility/resistance of the 115 isolated Salmonella strains to the different antibiotics The level a f resistance or susceptibility of all the 115 Salmonella strains was determined using disks impregnated with ampiciflm (ffl|ig), chloramphenicol (50^g); tetracycline (30jig), trimethoprim- Sulphamethoxazole (1.25/23.75jig) and streptomycin (lOjig) according to the guidelines set by the National Committee for Clinical Laboratory Standards (NCCLS)/ 57 University of Ghana http://ugspace.ug.edu.gh The sources of this type of resistant strains are shown to Fig. 10. The figure compares the strains found to be resistant to all five antibiotics used (5-R) to the total number of strains isolated from each different source. Although the majority of the thirty«seven 5«R Salmonella strains were isolated from blood (78.38%), urine samples appear to have the highest percentage. Twenty«seven out of the total 37 (72.97%) of these 5.R strains belong to Group B, one each (2.70%) to groups Cx and I and eight (21,62%) to group D. The 27 5«R strains belonging to Group B form 71% of the total Group B Salmonella isolated for this study whilst the eight 5-R stains belonging to Group D formed only 12.1% of the total Group D (8 out of 66) strains isolated (Figure 11). Thus majority (72.97%) of the Salmonella strains that were resistant to all five antibiotics belong to Group B. Thirty-two Salmonella isolates were found to be resistant to four of the five antibiotics (4-R strains). Twenty-four of the thirty-two 4-R strains were susceptible to chloramphenicol but resistant to AmTeTsSt, seven were susceptible to tetracycline but resistant to AmCmTsSt whilst only one was susceptible to trimethoprim* sulphamethoxazole but resistant to AmCmTsSt. Thus, all the 4-R strains were resistant to ampicillin and streptomycin (Appendix A). Twenty-six (81.25%) of the 4-R strains were from blood and the distribution for the other sources for these 4-R strains is as found in Fig 12. The figure also compares the resistant strains to the total number of organisms from each of the sources, and indicates that the highest percentage was from blood. 58 University of Ghana http://ugspace.ug.edu.gh itno □ SALMONELLA STRAIN 05 -R STRAINS ow oz (<0 BLOOD CSF FOOD STOOL URINE OTHERS SOURCE OF SALMONELLA Figure 10. Sources of the thirty-seven Salmonella strains resistant to an live first line antibiotics. The Salmonella strains were iso fated from food sources and from patients suffering from typho id fever Resistance o f Salmonella strains were determined using the standards described in the materials and methods. 59 University of Ghana http://ugspace.ug.edu.gh GROUP OF SALMONELLA Figure 11. Groups of the thirty-seven Salmonella strains resistant to ail five first line antibiotics. Groups of the 37 Salmonella strains resistant to all five first line antibiotics were determined using Salmonella antisera kit from Denka Seiken CoT, Ltd, Japan as described in the materials and methods. 60 SAILMONELLA STRAINS University of Ghana http://ugspace.ug.edu.gh 90 SOURCE OF SALMONELLA Figure 12. Resistance of the thirty-two Salmonella strains compared to their sources of isolation The ¥1 resistant Salmonella strains were isolated from food sources and patients as described in the materials and methods. Briefly, the specimens were plated out using appropriate selective media socfi as MacConkey agar, blood agar and desoxycholate a ^ rm d /o r Salmonella/Shigella agar, and colonies with the characteristics of Salmonella isolated and purified using standard microbiological methods 61 University of Ghana http://ugspace.ug.edu.gh Four of the 32 4-R strains belong to Group B, one each to Groups Ci, C2 and 25 to Group D whilst Group G also had one. Thus, majority (78.13%) of the 4-R strains belongs to Group D but form only 37.88% of the total Group Ds isolated with only 12.5% belonging to Group B. Figure 13 compares the 4-R strains to the total numbers isolated from the different groups. Seven of the Salmonella strains were resistant to three of fee antibiotics (3»R sixains). Four (57.14%) were isolated from blood whilst one was isolated from CSF and two from stool. All die seven strains were resistant to tetracycline. One strain was resistant to AmCmTe, another strain was resistant to AmTeSt and a third was resistant to TeTsSt The rest of the strains were resistant to AmTeTs. Thus, six of the 3-R strains were susceptible to chloramphenicol. One of the 3-R strains belong to Group B with six belonging to Group D (85.72%) The Group D, however, forms only 9.09% of the total Group Ds isolated. Only one organism was resistant to two different antibiotics. This strain was isolated from blood and belongs to Group D. Eight Salmonella strains were resistant to only one of the antibiotics (1-R strains). Four of these organisms were isolated from food, three from blood and one from urine. They were found to belong to Group B (62.50%), Group E| (12.50%) and Group D (25.00%). AH eight organisms were susceptible to Cm and Ts. 62 University of Ghana http://ugspace.ug.edu.gh Table 3. Summary of the resistance within the different groups to the different antibiotics Group of No of Level of resistance to the different antibiotics Resistant organism organism 5-R 4-R 3-R 2-R 1-R strains s 37 32 7 1 8 85 A 1 0 0 0 0 0 0 B 38 27(71.05%) 4(10.53%) 1(2.63%) 0 5(13.16%) 37(97.37%) Ci 4 1(25%) 1(25%) 0 0 0 2(50%) c2 2 0 1(50%) 0 0 0 1(50%) D 66 8(12.12%) 25(37.88%) 6(9.09%) 1(1.52%) 2(3.03%) 42(63.64%) E, 2 0 0 0 0 1(50%) 1(50%) G 1 0 1(100%) 0 0 0 1(100%) I 1 1(100%) 0 0 0 0 1(100%) TOTAL 115 37(32.17%) 32(27.83%) 7(6.09%) 1(0.87%) 8(6.96%) 85(73.91%) The resistance tevds were determined for the organisms from the different groups ustng sntrtmytic disks impregnated with antibiotics such as ampicillin (lOjig), chloramphenicol (30ng), tetracycline (30jig), trimethoprim-Sulphamethoxazole (1.25/23.75Jig) and streptomycin (10|ig). These antibiotics are the first line antibiotics used in the management of salmonellosis 63 University of Ghana http://ugspace.ug.edu.gh 70 GROUP OF SALMONELLA Figure 13. Groups of the thirty-two Salmonella strains resistant to four of the first line antibiotics Salmonella aniisera kit fiom Denka Seiken Co.. Ltd-, Japan was used to determine the groups of the 32 -Srtlmnnelto strains resistant to four of the first line antibiotics as described in the materials and methods 64 SALMONELU STRAINS University of Ghana http://ugspace.ug.edu.gh Hie results also indicated that, resistance to the antibiotics tested varied with the sources of the samples. Sixty-three of die 82 strains (76.83%) isolated from blood were resistant to one or more of the five antibiotics with 60 (95.24%) of these strains being multi resistant, that is, being resistant to three or more antibiotics. The four strains isolated from urine and the three strains isolated from CSF were all resistant to one or more of the five antibiotics used. Resistance to one or more of the five antibiotics among the strains isolated from the other sources was as follows: Four out of the six (66.67%) from stool, eight out of 14 (57.14%) from food, and three out of 6 (50%) strains from other sources (Fig. 14). Resistance of Salmonella strains belonging to the different groups was also evaluated. The results indicated that, Groups B and D which formed the majority of the isolates with 104 strains showed a high level of resistance. The two groups formed 90.4% of the isolates and the number resistant to one or more of the five antibiotics was 76%, (79 out of 104) or 68.70% of the total number isolated, that is, 79 out of the 115 strains. Resistance among Group B was 97.4% (37 out of 38) and 63.6% (42 out of 66) among Group D. Analysis was made for multi-drug resistance (MDR), that is, resistance to three or more of the antibiotics. Multi-drug resistance among die two groups, that is, Groups B and D was high; 71 out of 76, or 93.4% with 42% among Group B and 51% among Group D. Of the 37 resistant organisms belonging to Group B, 32 or 86% showed MDR die majority (27 or 84%) of which had resistance to all 5 antibiotics used (5-R). Of the 42 65 University of Ghana http://ugspace.ug.edu.gh resistant strains among Group D, 39 or 93% showed MDR and for most of these MDR strains, 25 or 60% had resistance to 4 of the antibiotics used (4-R). When the 37 5-R strains are considered, organisms in Group B constituted 73% whilst those in Group D formed 21.6%. Of the 32 4-R strains, only 12.5% belong to Group B and 78% to Group D. There were only seven 3-R strains and six of these, 85.7% belonged to Group D and only one to Group B. As Figure 15 shows, the rest of the strains showed various levels of resistance but the numbers are too small to be meaningful. 66 University of Ghana http://ugspace.ug.edu.gh 90 80 70 60 50 40 0 SALMONELLA STRAINS 0 RESISTANT STRAINS 30 20 10 1 S S BLOOD CSF FOOD STOOL URINE OTHERS SOURCE OF SALMONELLA Figure 14. Level of resistance of Salmonella isolates compared to their sources of isolation The resistance within each source of specimen was investigated using antibiotic disks impregnated with ampfciJlin (lOfig), chloramphenicol (30jig), tetracycline (30^g), trimethoprim-sulphamethoxazole (1.25/23,75jig) and streptomycin (lOjig). according to the guidelines set by the National Committee for Clinical Laboratory Standards. The organisms were isolated from different sources as described in the bacterial culture, isolation and identification under the materials and methods section. 67 SALMONELLA STRAINS University of Ghana http://ugspace.ug.edu.gh 70 GROUP OF SALMONELLA Figure 15. Level of resistance among the Salmonella strains within the different Salmonella groups to the five different antibiotics Each group of Salmonella was determ ined using Salmonella antisera k it w ith details described in the materials and methods. The resistance, on the other hand, was determined using antibiotic disks prepared from am picillin (lOjig), chloram phenicol (30^g), tetracycline (30jig), trim ethoprim -Sulpham ethoxazole (1 .25/23.75^g) and streptomycin (] Ojjg) and analysed using the guidelines set by the National Committee for Clinical Laboratory Standards 68 University of Ghana http://ugspace.ug.edu.gh 3.1.3 Minimum inhibitory concentration (MIC) of the antibiotics: Four of the five antibiotics were used for the MIC determinations and the results are shown in Tables 4-8. The 5-R strains that were resistant to all the five antibiotics used for the susceptibility test had very high MICS for ampicillin, chloramphenicol and trimethoprim- Sulphamethoxazole. For example, with the exception of strains 67 and 89 which had die lowest MICs of 80mg/L all the organisms had MIC of 1280mg/L and above. Tetracycline was the only antibiotic with MICs ranging from 20-320mg/L. Thus, even though these strains were resistant to tetracycline during the susceptibility testing one needs not more than 320mg/L to eliminate the 5-R strains (Table 4). For the 4-R strains, ampicillin had MIC of 1280mg/L or more with the exception of strain 38, which had MIC of640mg/L. In the case of trimethoprim-Sulphamethoxazole only four strains had MICs of 80mg/L or below with the rest having MICs of 1280mg/L. Chloramphenicol had the best MICs with only eight of the 32 4-R strains having MICs above 20mg/L. This compares with results of the susceptibility testing for the 4-R strains (Appendix A). The median MIC for tetracycline was found to be 80mg/L (Table 5). The 3-R strains had MICs of 1280mg/L or above for ampicillin whereas chloramphenicol had MICs of20mg/L except strain 7 that had MIC of 8Gmg/L, In the case of tetracycline 5 of the 7 strains had MICs of 80mg/L, and the other two had values of 40 and 160mg/L whilst values for that of trimethoprim-Sulphamethoxazole were 20,80 and 1280mg/L 69 University of Ghana http://ugspace.ug.edu.gh (Table 6). These figures correlate with the results obtained for the susceptibility testing for the 3-R strains (Appendix A). 70 University of Ghana http://ugspace.ug.edu.gh Table 4. MICs of four first line antibiotics using the Salmonella isolates which were found to be resistant to all the five antibiotics (5-R strains) in mg/1. STRAIN SOURCE GROUP Am Cm Te Ts 8 URINE D >1280 1280 320 1280 13 BLOOD D >1280 1280 160 1280 33 MISC D >1280 1280 320 1280 39 BLOOD Cl >1280 1280 20 1280 48 BLOOD B >1280 1280 320 1280 49 BLOOD B >1280 1280 320 1280 51 BLOOD B >1280 1280 20 1280 52 BLOOD B >1280 1280 320 1280 53 STOOL D >1280 1280 20 1280 55 BLOOD B >1280 1280 320 1280 66 FOOD D >1280 1280 320 1280 67 FOOD I 80 80 160 80 12 BLOOD B >1280 1280 320 1280 73 BLOOD B >1280 1280 320 1280 74 BLOOD B >1280 >1280 320 1280 75 BLOOD D >1280 1280 320 1280 76 CSF B >1280 1280 320 1280 77 URINE D >1280 640 320 1280 78 URINE B >1280 1280 320 1280 83 BLOOD B >1280 1280 160 1280 89 BLOOD D 80 80 80 80 90 BLOOD B >1280 1280 160 1280 95 BLOOD B >1280 1280 160 1280 97 BLOOD B >1280 1280 160 1280 98 BLOOD B >1280 1280 160 1280 99 BLOOD B >1280 1280 160 1280 101 BLOOD B >1280 1280 160 1280 102 BLOOD B >1280 1280 160 1280 104 BLOOD B >1280 1280 160 1280 105 BLOOD B >1280 1280 160 1280 106 BLOOD B >1280 1280 160 1280 108 BLOOD B >1280 >1280 20 >1280 109 BLOOD B >1280 1280 160 1280 110 BLOOD B >1280 1280 160 1280 111 BLOOD B >1280 1280 160 1280 112 BLOOD B >1280 1280 160 1280 115 BLOOD B >1280 1280 80 1280 The minimum inhibitory concentrations for four antibiotics against the 37 resistant Salmonella isolates were determined using Hie agar dilution technique according to the guidelines set by the National Committee for Clinical Laboratory Standards Anr^ampietUin Cnr=chIoramphenicol Te=tetrapycline Ts^jo-trimoxazole. 71 University of Ghana http://ugspace.ug.edu.gh Table 5. MICs of four lint line antibiotics using the Salmonella isolates which were found to be resistant to four of the antibiotics (4-R strains) in mg/I. STRAIN SOURCE GROUP Am Cm Te Ts 1 MISC G >1280 20 80 1280 3 BLOOD D >1280 20 80 1280 4 CSF D >1280 20 160 1280 6 BLOOD D >1280 20 80 1280 17 BLOOD D 1280 80 20 80 21 STOOL B 1280 20 80 80 22 BLOOD D >1280 20 160 1280 23 MISC C2 >1280 320 80 20 27 BLOOD D >1280 20 80 1280 35 BLOOD D >1280 20 80 1280 38 BLOOD D 640 20 80 1280 40 BLOOD D >1280 20 80 1280 46 BLOOD D >1280 20 160 1280 47 BLOOD D >1280 1280 20 1280 56 BLOOD D >1280 20 160 1280 63 FOOD D >1280 1280 20 1280 68 FOOD B >1280 1280 '20 1280 71 BLOOD B >1280 1280 20 1280 79 BLOOD D 1280 640 20 1280 81 BLOOD D >1280 20 80 1280 82 BLOOD D >1280 20 80 1280 84 BLOOD D 1280 20 80 80 88 BLOOD D >1280 20 80 1280 91 BLOOD D 1280 20 80 1280 92 BLOOD D >1280 20 80 1280 93 BLOOD D >1280 20 80 1280 94 BLOOD Cl >1280 20 80 1280 96 BLOOD D >1280 20 80 1280 100 BLOOD D >1280 20 80 1280 103 BLOOD D >1280 20 80 1280 107 BLOOD D >1280 20 80 1280 114 BLOOD B >1280 1280 20 1280 The minimum inhibitory concentrations for the antibiotics against the 32 SabaoneBa isolates resistant to four of the antibiotics used were determined using the agar dilution technique according to the guidelines set by the National Committee for Clinical Laboratory Standards Am=cunpiciUin Cm=ch I oramphen icol Tes=tetracy cline Ts=c[>trimoxazolB 72 University of Ghana http://ugspace.ug.edu.gh Table 6. MICs of four first line antibiotics using die Salmonella isolates which were found to be resistant to three of the antibiotics (3-R strains) in mg/1. STRAIN SOURCE GROUP Am Cm Te Ts 2 BLOOD D >1280 20 80 1280 7 BLOOD D 1280 80 80 20 14 BLOOD D 1280 20 160 1280 24 CSF D >1280 20 80 20 28 BLOOD D >1280 20 80 1280 30 BLOOD D >1280 20 80 80 113 BLOOD B 1280 20 40 80 Am=ampicillin Cnrchloramphenicol le=tetracycline Ts=co-trimoxazole The minimum inhibitory concentrations for the antibiotics ming the 7 SaimmeJia iwfatw that w e reaisant to thro of the antibiotics were determined using tbe agar dilution technique according to the guidelines set by the National Committee for Clinical Laboratory Standards 73 University of Ghana http://ugspace.ug.edu.gh The only 2-R strain investigated had MIC of 20mg/L for chloramphenicol, tetracycline and trimethoprim-Sulphamethoxazole and over 1280mg/L for ampicillin (Table 7). Compared to the susceptibility test (Appendix A), it is found that this strain was susceptible to chloramphenicol, tetracycline and trimethoprim-Sulphamethoxazole. The 1-R strains had, on the average low MICs of20mg/L for chloramphenicol, tetracycline and trimethoprim-Sulphamethoxazole. However, for ampicillin, the MIC was over 1280mg/L for four of the strains isolated from blood and urine, and MIC values of 20mg/L for the strains isolated from food sources (Table 8). 74 University of Ghana http://ugspace.ug.edu.gh Table 7. MICs of four first line antibiotics using the Salmonella isolates which were found to be resistant to two of the antibiotics (2-R strains) in mg/1. STRAIN SOURCE GROUP Am Cm Te Ts 87 BLOOD D >1280 20 20 20 The minimum mhibtfwy concentrations fiir the antibiotics against one Salmonella isolate which was found to be rwistant to two of the antibiotics were determined using the agar dilution technique according to the guidelines set by the National Committee for Clinical Laboratory Standards Am=ampicillin Cm=ehlaiamphenicol Te=t£tf&cyc(tfte Ts=co-trimoxazole Table 8. MICs of four first line antibiotics using the Salmonella isolates which were found to be resistant to only one of the antibiotics (1-R strains) in mg/1. STRAIN SOURCE GROUP Am Cm Te Ts 26 URINE B >1280 20 20 20 29 BLOOD B >1280 20 20 20 36 BLOOD D >1280 20 20 20 58 FOOD B 20 20 40 20 59 FOOD B 20 20 40 20 61 FOOD El 20 20 20 20 65 FOOD B 20 20 20 40 80 BLOOD D >1280 20 20 20 The minimum inhibitory concentrations for the antibiotics against the 8 Salmonella isolates resistant to only one of the antibiotics were determined using the agar dilution technique according to the guidelines set by the National Committee for Clinical Laboratory Standards Am=ampjcillin Cm=chloramphenicol Te=tefracycline Ts**co-irffiKmz9k 75 University of Ghana http://ugspace.ug.edu.gh 3.2 MOLECULAR CHARACTERIZATION OF SALMONELLA STRAINS 3.2.1 Plasmid isolation and incompatibility testing Purified plasmid preparations were used as template along with incompatibility group HIlA-specific primers in order to amplify a 365-bp region indicative of fee RepHIlA replicon. Plasmid preparations from fee Salmonella strains feat were able to transfer antibiotic resistance genes via conjugation and their corresponding transconjugates yielded positive amplicons (Figure 16). The plasmid preparations derived from fee transformants were negative. These data provide evidence feat fee conjugable plasmids in fee Salmonella isolates examined belong to incompatibility group IncHl. 3.2.2. Transfer of antibiotic resistance via conjugation: The ability of fee resistant Salmonella strains to transfer resistance phenotype via conjugation to E. coli HMS 174 was investigated in order to determine if fee antibiotic resistance associated wife fee Salmonella isolates was plasmid-encoded. In fee investigation, fee Salmonella strains wife resistance to one or more of fee antibiotics were mated wife fee recipient E eoli and fee trans-conjugates selected on MacConkey media containing ampicillin, chloramphenicol or trimethoprim-Sulphamethoxazole. The susceptibility for fee trans-conjugates was earned out using the five antibiotics previously tested on fee wild-type Salmonella. As presented in Table 9 .80 out of fee total of 85 (94.12%) resistant strains possessed conjugable plasmids wife 73 of fee 80 (91.25%) strains conferring multi-drug resistance. 76 University of Ghana http://ugspace.ug.edu.gh Figure 16. Representative agarose gel with 365-bp the amplicon. The Rep HI1A replicon, present in Inc HJ plasmids, was amplified via the polymerase chain reaction (PGR) using the primers 5’GGTCCAACCCATTGCi r i AC3’ and 55CACGGAAAGAAATCACAAC3’ on a model PT 150 MiniCycler. Lane M, molecular mass markers; lane t, amplicon from Salmonella strain 8; lane 2, amplicon firoti the corresponding Salmonella Stfain 8 transconjugate. 77 University of Ghana http://ugspace.ug.edu.gh Table 9. Comparison of resistance pattern of wild-type Salmonella to the trans-conjugates STRAIN SOURCE GROUP RESISTANCE PATTERN TRANSCONGUGATES (wild-type Salmonella) (recipient E. coli) 1 MISC G AmTsTeSt AmTsTeSt 2 BLOOD D AmTsTe AmTsTeSt 3 BLOOD D AmTsTeSt AmTsTeSt 4 CSF D AmTsTeSt AmTsTeSt 6 BLOOD D AmTsTeSt AmTsTeSt 7 BLOOD D AmCmTe - 8 URINE D AmCmTeTsSt AmCmTeTsSt 13 BLOOD D AmCmTeTsSt AmCmTeTsSt 14 STOOL D AmTeTs AmTeTs 17 BLOOD D AmCmTsSt AmCmTsSt 21 STOOL B AmTsTeSt AmTsTeSt 22 BLOOD D AmTeTsSt AmTsTeSt 23 MISC C2 AmCmTeSt AmCmTeSt 24 CSF D AmTeSt Am 26 URINE B Am Am 27 BLOOD D AmTeTsSt AmTeTsSt 28 STOOL D AmTeTs Am 29 BLOOD B Am Am 30 BLOOD D AmTsTe AmTsTe 33 MISC D AmCmTeTsSt AmCmTeTsSt 35 BLOOD D AmTsTeSt TsTeSt 36 BLOOD D Am Am 38 BLOOD D AmTeTsSt AmTeTsSt 39 BLOOD Cl AmCmTeTsSt AmTeTsSt 40 BLOOD D AmTeTsSt AmTeTsSt 46 BLOOD D AmTeTsSt AmTeTsSt 47 BLOOD D AmCmTsSt AmCmTsSt 48 BLOOD B AmCmTeTsSt AmCmTsSt 49 BLOOD B AmCmTeTsSt AmCmTsSt 51 BLOOD B AmCmTeTsSt AmCmTsSt 52 BLOOD B AmCmTeTsSt AmCmTsSt 53 STOOL D AmCmTeTsSt AmCmTsSt 55 BLOOD B AmCmTeTsSt AmCmTsSt 56 BLOOD D AmTeTsSt AmTeTsSt 58 FOOD B Te - 59 FOOD B Te - 61 FOOD El St - 63 FOOD D AmCmTsSt AmCmTsSt 65 FOOD B St - 78 University of Ghana http://ugspace.ug.edu.gh itirn LAI? SOURCE GROUP RESISTANCE PATTERN TRANSCONJUGATES (wild-type Salmonella) (recipient E. coli) "67" FOOD I AmCmTeTsSt AmCmTeTsSt 68 FOOD B AmCmTsSt AmCmTsSt 71 BLOOD B AmCmTsSt AmCmTsSt 72 BLOOD B AmCmTeTsSt AmCmTeTsSt 73 BLOOD B AmCmTeTsSt AmCmTeTsSt 74 BLOOD B AmCmTeTsSt AmCmTeTsSt 75 BLOOD D AmCmTeTsSt AmCmTeTsSt 76 CSF B AmCmTeTsSt AmCmTsSt 77 URINE D AmCmTeTsSt AmTeTsSt 78 URINE B AmCmTeTsSt AmCmTsSt 79 BLOOD D AmCmTsSt AmCmTsSt 80 BLOOD D Am Am 81 BLOOD D AmTeTsSt AmTeTsSt 82 BLOOD D AmTeTsSt AmTeTsSt 83 BLOOD B AmCmTeTsSt AmCmTeTsSt 84 BLOOD D AmTeTsSt AmTeTsSt 87 BLOOD D Am St AmSt 88 BLOOD D AmTeTsSt AmCmTsSt 89 BLOOD D AmCmTeTsSt AmCmTeTsSt 90 BLOOD B AmCmTeTsSt AmCmTsTeSt 91 BLOOD D AmTeTsSt AmTeTsSt 92 BLOOD D AmTeTsSt AmTeTsSt 93 BLOOD D AmTeTsSt AmTeTsSt 94 BLOOD Cl AmTeTsSt AmTeTsSt 95 BLOOD B AmCmTeTsSt AmCmTsSt 96 BLOOD D AmTeTsSt AmTeTsSt 97 BLOOD B AmCmTeTsSt AmCmTsSt 98 BLOOD B AmCmTeTsSt AmCmTeTsSt 99 BLOOD B AmCmTeTsSt AmCmTeTsSt 100 BLOOD D AmTeTsSt AmTeTsSt 101 BLOOD B AmCmTeTsSt AmCmTeTsSt 102 BLOOD B AmCmTeTsSt AmCmTeTsSt 103 BLOOD D AmTeTsSt AmTeTsSt 104 BLOOD B AmCmTeTsSt AmCmTeTsSt 105 BLOOD B AmCmTeTsSt AmCmTeTsSt 106 BLOOD B AmCmTeTsSt AmCmTeTsSt 107 BLOOD D AmTeTsSt AmTeTsSt 108 BLOOD B AmCmTeTsSt AmCmTsSt 109 BLOOD B AmCmTeTsSt AmCmTeTsSt 79 University of Ghana http://ugspace.ug.edu.gh Table 9 continued STRAIN SOURCE GROUP RESISTANCE PATTERN TRANSCONGUGATES (wild-type Salmonella) (recipient E. coli) 112 BLOOD B AmCmTeTsSt AmCmTeTsSt 113 BLOOD B TsTeSt TsTeSt 114 BLOOD B AmCmTsSt AmCmTsSt 115 BLOOD D AmCmTeTsSt AmCmTsSt Conjugation was carried out using the resistant Salmonella isolates as the donors and E. coli HMS 174 as the recipients. These organisms were grown separately overnight at 1TC with shaking in 3m( tryptic soy broth (TSB), tnto fresh 3mf TSB was added 0.3ml overnight cultures and the mixture incubated at 3TC with shaking for about 1 hour or until 0,5 McFarland turbidity standard was obtained. Five hundred microlitres of each suspension of Salmonella strain was mixed with the same quantity o€E. coli HMS 174 in a sterile tube and the suspension incubated at 37°C without shaking for 90 minutes. At 30-minute intervals, the cultures were mixed by gentle inversion. These conjugation mixtures were then plated on MacConkey agar plates containing lOQ^g/ml rifampicin and either ampicillin (32pg/ml)* chloramphenicol (32jig/ml), or trimethoprim-Sulphamethoxazole (4^g/ml; 16ng/ml) and incubated overnight at 37°C. Lactose fermenting colonies growing on the plates indicated conjugational transfer of antibiotic resistance to E. coli HMS 174. Am^ampicillin Cm=chloramphenicol Te=tetracycUne Ts^co-trimoxazoie Sfc=streptomycin 80 University of Ghana http://ugspace.ug.edu.gh 3.2.3. Transfer of antibiotic resistance via transformation: To determine if the antibiotic resistance associated with each Salmonella was located on a transformable plasmid, recipient E, coli were transformed with plasmid preparation obtained from each of the Salmonella strains resistant to one or more of the antibiotics used. These were then selected on media containing either ampicillin, chloramphenicol, or trimethoprim-Sulphamethoxazole. The susceptibility of the transformants was done using the five antibiotics previously tested on the wild-type Salmonella. The results showed that out of the 85 wild-type resistant Salmonella only 15 (17.65%) of the recipient R coli strains were transformed with all the transformants being resistant to ampicillin (Table 10). 81 University of Ghana http://ugspace.ug.edu.gh Table 10. Comparison of resistance pattern of wild-type Salmonella to the transformants. STRAIN SOURCE GROUP RESISTANCE PATTERN TRANSFORMANTS (wild-type Salmonella) (recipient E.coli) 1 MISC G AmTsTeSt - 2 BLOOD D AmTsTe - 3 BLOOD D AmTsTeSt - 4 CSF D AmTsTeSt AmTsTeSt 6 BLOOD D AmTsTeSt AmTsTeSt 7 BLOOD D AmCmTe - 8 URINE D AmCmTeTsSt AmCmTeTsSt 13 BLOOD D AmCmTeTsSt AmCmTeTsSt 14 STOOL D AmTeTs - 17 BLOOD D AmCmTsSt - 21 STOOL B AmTsTeSt - 22 BLOOD D AmTeTsSt AmTsTeSt 23 MISC C2 AmCmTeSt - 24 CSF D AmTeSt Am 26 URINE B Am - 27 BLOOD D AmTeTsSt AmTeTsSt 28 STOOL D AmTeTs - 29 BLOOD B Am . 30 BLOOD D AmTsTe - 33 MISC D AmCmTeTsSt - 35 BLOOD D AmTsTe - 36 BLOOD D Am Am 38 BLOOD D AmTeTsSt - 39 BLOOD Cl AmCmTeTsSt - 40 BLOOD D AmTeTsSt - 46 BLOOD D AmTeTsSt - 47 BLOOD D AmCmTsSt - 48 BLOOD B AmCmTeTsSt - 49 BLOOD B AmCmTeTsSt - 51 BLOOD B AmCmTeTsSt - 52 BLOOD B AmCmTeTsSt - 53 STOOL D AmCmTeTsSt - 55 BLOOD B AmCmTeTsSt - 56 BLOOD D AmTeTsSt Am 58 FOOD B Te - 59 FOOD B Te . 61 FOOD El St _ 63 FOOD D AmCmTsSt - 82 University of Ghana http://ugspace.ug.edu.gh ltm n w SOURCE GROUP RESISTANCE PATTERN TRANSFORMANTS _____________________(wild-type Salmonella)______(recipient E. coli) ~66 FOOD D AmCmTeTsSt - 67 FOOD I AmCmTeTsSt - 68 FOOD B AmCmTsSt - 71 BLOOD B AmCmTsSt - 72 BLOOD B AmCmTeTsSt - 73 BLOOD B AmCmTeTsSt . 74 BLOOD B AmCmTeTsSt - 75 BLOOD D AmCmTeTsSt Am 76 CSF B AmCmTeTsSt - 77 URINE D AmCmTeTsSt Am 78 URINE B AmCmTeTsSt - 79 BLOOD D AmCmTsSt _ 80 BLOOD D Am _ 81 BLOOD D AmTeTsSt 82 BLOOD D AmTeTsSt _ 83 BLOOD B AmCmTeTsSt e 84 BLOOD D AmTeTsSt Am 87 BLOOD D AmSt 88 BLOOD D AmTeTsSt . 89 BLOOD D AmCmTeTsSt Am 90 BLOOD B AmCmTeTsSt - 91 BLOOD D AmTeTsSt • 92 BLOOD D AmTeTsSt Am 93 BLOOD D AmTeTsSt Am 94 BLOOD Cl AmTeTsSt _ 95 BLOOD B AmCmTeTsSt 96 BLOOD D AmTeTsSt _ 97 BLOOD B AmCmTeTsSt 98 BLOOD B AmCmTeTsSt 99 BLOOD B AmCmTeTsSt - 100 BLOOD D AmTeTsSt 101 BLOOD B AmCmTeTsSt $ 102 BLOOD B AmCmTeTsSt _ 103 BLOOD D AmTeTsSt 104 BLOOD B AmCmTeTsSt 105 BLOOD B AmCmTeTsSt * 106 BLOOD B AmCmTeTsSt 107 BLOOD D AmTeTsSt BLOOD B AmCmTeTsSt _ 83 University of Ghana http://ugspace.ug.edu.gh Table 10 continued STRAIN SOURCE GROUP RESISTANCE PATTERN TRANSFORMANTS re holes in the medium and into these holes were added lOOjd of the different preparations made from 1 -“Mist Enterica” and 2-combination of Psidium guajava, Cnestis ferruginea and Hoslundia opposita, and 3- chloramphemcol, The plate was kept in the refrigerator overnight, for complete absorption of the extracts anti then incubated at 37°C for approximately i 8 hours. The mires o f inhibition produced were measured in millifitres 95 University of Ghana http://ugspace.ug.edu.gh Figure 23. Inhibition of growth of wild-type Salmonella strain 8 using “Mist Enterica”. The plate was flooded with the wild-type Salmonella strain 8 and allowed to dry a t room temperature for an hour on a level su rface. A sterilized borer of an internal diameter of about 6mm was used to bore boles in the medium and into these holesw ere added IOOfil of I-“M ist Enterica” and 2-efiIoram^henieol. The plate was kept in the refrigerator Overnight* for complete abstiFptioft o f the extfaet aftd then incubated at 3 T C for approximately 18 hours, The zones of inhibition produced were measured in millilitres 96 University of Ghana http://ugspace.ug.edu.gh Figure 24. Inhibition of growth of wild-type Salmonella strain 8 using disk impregnated with 1-P. guajava, 2-C. ferruginea* 3-H. opposita, 4-“Mist Enterica” and 5- ChJor' . jft&ifii 01. The plate was flooded with the wild-type Salmonella strain 8 and allowed to dry at room temperature for an hour on a level surface. The susceptibility of the wild-type Salmonella strain 8 to the different disks was investigated using the Kirby-Bauer disks diffusion method 97 University of Ghana http://ugspace.ug.edu.gh Antimicrobial activity of the herbal decoctions against other wild-type pathogenic bacteria was also investigated. The three decoctions prepared from C.ferruginea, H. opposite, P. guajava and a mixture of these three were tested for their antibacterial and antifungal activity using C albicans from high vaginal swab (Candida-HVS), 51 saprophyticus, isolated from a female patient with vaginitis, S. aureus, haemolytic E. coli both isolated from a patient with urethral discharge, and K gonorrhoea from a male having urinary tract infection (UTI). The results are presented in Table 13. Each of the three plant extracts showed complete bactericidal activity against the Gram positive bacteria, S. aureus and S. saprophyticus at a concentration of 320mg/ml. However, the bactericidal activity varied depending on the medicinal plant used in the case of the Oram negative bacteria. Of the Oram negative organisms, N. gonorrhoea appeared to be the most susceptible to the medicinal plant attracts at a concentration of 320mg/ml whilst haemolytic E. coli was not susceptible to C.ferruginea and H. opposite and only slightly susceptible to P. guajava. All four herbal preparations showed antifungal activity against Candida-HVS at a concentration of320mg/ml. 98 University of Ghana http://ugspace.ug.edu.gh Table 13. Effects of different herbal decoctions against wild-type pathogenic bacteria. Organisms C. ferruginea H. opposita P. guajava 3 in 1 S. aureus +++ +++ +++ +++ S. saprophyticus +++ +++ +-H - +++ Haemolytic E. coli NS NS + NS Candida (HVS) +++ ++ + +++ N. gonorrhoea +++ ++ ++ +++ Each petri plate was flooded with a particular pathogen and the plate allowed to dry at room temperature for an hour on a level surface. A sterilized borer o f an internal diameter o f about 6mm was used to bore holes in the medium and into these holes were added IOOji! o f the different herbal preparations. Detailed method is described in the materials and methods NS = organism is not susceptible + = zone o f inhibition < 9mm ++ = zone o f inhibition ranging from 10-15mm +++ - zone o f inhibition ally,M^NonrEtDeenr A^ Threlfall, E-L, Rowe, B.TMapesT T,, Hedstrom, R., Bourgeois, AL., and Muiphy, J.R-, (1993): Multiple-drug-resistant Salmonella typhi. Clin. Infect. Dis. 17:135-136 Mshana N. R„ Abbiw D. K., Addae-Mensah I., Adjanouhoum E , Ayi M. R. A., Ekpere I. A*, Enow-Orock E. G., Gbile Z. O., (2000): Traditional MpHirinre and Pharmacopoeia: Flouristic Studies in Ghana. OAU/STRC Muanza, DJi^Kim , B.W., Euler, KT-, Williams, L , (1994): Antibacterial andantifimgai activities of nine medicinal plants from Zaire. Int. J. Pharmacog. 32:337-345 National Symposium on Enteric fever/Salmonellosis for the Southern sector (1998). Organized by the Ghana Medical Association (GMA) Ghana. Ghana Registered Nurses Association Conference Hall, Accra, Ghana 130 University of Ghana http://ugspace.ug.edu.gh Newman, M. J., (2000): Antibiotic sensitivity patterns of typhoidal and noo-typhoidal Salmonella isolates from Accra, Ghana (1991-1994). G. Med. J. 34:21-23 Newman, M J., (1996): Multiple resistant Salmonella Group G outbreak in a neonatal intensive care unit W. AfriJ Med 15: 165-169 NCCLS, (1997): National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A4. Wayne, PA, USA NCCLS, (1998): National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial disk susceptibility tests Approved standard M2-A6. Wayne, PA, USA Ngadjui, B.Tt Ayafor, Sondengam, B JL, Connolly, JJ>^ Rycroft, D.S^ (1991)t Hoslundin, Hoslundial and Hoslunddiol; Three new flavonoids from the Hoslundia opposita (Lamiaceae). Tetrahedron 47: 3555-3564 Qhl, M.E., and Miller, Si-, (2001): SALMONELLA-. A Model for Bacterial Pathogenesis. A nniL Rev. Med. 52:259-274 Okeke, I.N., Lamikmira. a . and Edelman, R., (1999): Socioeconomic and Behavioral Factors Leading to Acquired Bacterial Resistance to Antibiotics in Developing Countries. Emer. Inf. D. 5: 1-9 Olarte, J., and Galindo, E., (1973): Salmonella typhi resistant to chloramphenicol, ampicillin, and other antimicrobial agents: strains isolated during an extensive typhoid fever epidemic in Mexico. Antimicrob. Agents Chemother. 4: 597-601 Oosterom, J., (1991): Epidemiological studies and proposed preventive measures in the fight against human salmonellosis. Int. J. Food Microb. 12:41-51 131 University of Ghana http://ugspace.ug.edu.gh Pace, J., Hayman, M J., Galan, J.E., (1993): Signal transduction and invasion of epithelial cells by S. typhimurium. Cell 72:505-514 Panigrahi, D , Al-Aneziz, A.H., and West P .E J, (1996): Plasmid-mediated multi-drug resistance in Salmonella typhi in Kuwait. Trap. Med. and Int. Health. I; 4:439-442 Paniker, CJC.. and Vimla, K.N, (1972): Transferable chloramphenicol resistance in Salmonella typhi. Nature 239:109-110 Petit, P.L.C., and Wamola, IA ., (1994): Typhoid fever; A review of its impact and diagnostic problems. E. Afri. Med. J. 71:1 S3-188 Pfaller, M. A„ and Cormican. M.G, (1996): Role of the microbiology laboratory in monitoring and identifying resistance: use of molecular biology. New Horiz. 4:361-369 Power, E , (1996): RAPD typing in microbiology-a technical review. J. Hasp. Infect. 34:247-265 Principe, P., (1989): The economic significance of plants and their constituents as drugs. Wagner, H.; Hikino, FL, and Farnsworth, N. Economic and Medicinal Plant Research. 3 ed. London: Academic Press Richmond, MJL, (1972): Some environmental consequences of the use of antibiotics. J. Appl. Bad. 35:155-176 Rivera, I.O , Chowdhury, MAJL, Huq, A , Jacobs D., Martins, M.T, and Colwell, R., (1995): Enterobacterial repetitive intergenic consensus sequences and the PCR to generate fingerprints of genomic DNAs from Virbio cholarae 01, 0139, and non-01 strains. Appl. Environ. Microbiol. 61:2898-2904 132 University of Ghana http://ugspace.ug.edu.gh Rodriguez-Barradas, M.C., Hamill, R J ., Houston. ED.,Gearghiau, P.R., Clarridge, JJL, Regnery, R.L., and Koheler, J.E., (1995): Genomic fingerprinting of Bartonella species by repetitive element PCR for distinguishing species and isolates. J. Clin. Microbiol. 33: 1089-1093 Rowe, B., Ward L. IL, Threlfall E. JL, (1997): Multidrug-resistant Salmonella typhii tL worldwide epidemic. C. Infect. Dis. Suppl. 1: S106-109 Rowe, B., Ward, L it., and ThreHall, EJ., (1995): Ciprafloxacin-resistant Salmonella typhi in the UK (Letter). Lancet. 346:1302 Rowe, B., Ward, LJt., and Thretfail, EJ., (1990): Spread of mtrttiresfsrant Salmonella typhi (Letter). Lancet. 337: 1065. Ryder, R. W., Blake, P A , Marlin, AjC., Carter, CLP., Pollard, R.A., Merson, MJ L, Allen, S.D. and Brenner, D.J., (1980): Increase in Antibiotic Resistance among Isolates of Salmonella in the United States, 1967-1974. J. Inf Dis. 142:485-491 Sackey, B A , Mensah, P„ CoHison, E., Sakyi-Dawson, IL, (2001): Cumpyiabaeter, Salmonella, Shigella and Escherichia coli in live and dressed poultry from metropolitan Accra. Int. J. of Food Microbiol. 71:21-28 Sander, A., Ruess, M., Bereswill, S., S choppier, M. and Sttinbmeckner, B., (1998): Comparison of different DNA fingerprinting techniques for molecular typing of Bartonella henselae isolates. J. Clin. Microbiol. 36:2973-2981 Sajjad Hussain feL, (1996): Multidrug-resistam Salmamlla typht A Global Review. LabMedica Int., 13:40-42 Sechi, L. A^ Leori, G., Lnliai, S. A^ Dupre, L, Molicotti, P., Fadda, G. and Zanetti, S., (1999): Different strategies for molecular differentiation of Mycobacterium bovis strains 133 University of Ghana http://ugspace.ug.edu.gh isolated in Sardinia, hafy.Appl. Environ. McrobioL 65: 1781-1785 Shanahan, P.M.A., Jesndason, M.V, Thomson, C_J, and Amyes, S.GJ3, (1998): Molecular analysis of and identification of antibiotic resistance genes in clinical isolates of Salmonella typhi from India. J. Clin. Microbiol. 36: 1595-1600 Smith, Sinf, Palumbo, P.E., Edelson, P J , (1984): Salmonella strains resistant to multiple antibiotics; Therapeutic implications. Pediatr. Infect. Dis. 3:455-460 Sofowora, A , (1993): Medicinal Plants and Traditional Medicine to Africa. Spectrum Books Limited, Sunshine House, Ibadan, Nigeria, pp. 67-73 Stern, M , Ames, CL F , Smith, M. H , Robinson, E* C. and Higgins, C. F , (1984): Repetitive extragenic palindromic sequences: a major component of the bacterial genome. Cell 37:1015-1026 Stormon, MX), McIntyre, P.B., Morris, J , Fisher, B , (1997): Typhoid fe^er in children: Diagnostic and therapeutic difficulties. Pediatr. btfect. Dis. J. 16; 713-714 Thong, K .L, Cheong, M.Y, Pathnchcary, S , Koh, C .L, and Pang, T , (1994): Epidemiologic analysis of sporadic Salmonella typhi isolates and those from outbreaks by pulsed-field gel electrophoresis. J. Clin. Microbiol. 32:1135-1141 Threlfall, E J , Ward, LJR, Rowe, B., Raghupathi, S , Chandrasekaran, V , Vandepitte, J , and Lemmens, p„ (1992): Widespread occurrence of multiple drug-resistant Salmonella typhi in India. Eur. J. Clin. Microbiol. Infect. Dis. 11: 990-993 Tortora, G. J , Funke, B. R , and Case, C. L , (1995): Microbiology an introduction. 5th ed> The Benjamin/Cummings Publishing Company. Inc. Redwood City, CA, USA V ersalovic, J , Koeuth, T. and Lupski, J. T , (1991): Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic 134 University of Ghana http://ugspace.ug.edu.gh Jrisb&es. 19; 6823-6831 Vinuesa, P_, Rademaker, J. L. W., DeBruijn, F. JL and Werner, D., (1998): Genotypic characterization of Bradyhaobiiaa strains nodulaling endemic woody legumes of the canary islands by PCR-restriction fragment length polymorphism analysis of genes encoding 16s rRNA (16s rDNA) and 16s-23s rDNA intergenic spacers, repetitive extragenic palindromic PCR genomic fingerprinting and partial 16s rf>NA sequencing, Appl. Environ. Microbiol. 64:2096-2104 Voros, Su, Vieu, JLF ̂Sallas, CA-,(1974): Phage type distribution of Salmamlla typhi strains isolated from Ghana during the period 1971-1974. G. Med.J. 180-184 Wallace, M., and Yousif AA^ (1993): Spread o f multiresistant Salmamlla typbL Lancet. 336:1065-1066 Ward, L.R., Rowe, B.r and Threlfall, EJ^ (1982): Incidence of trimethoprim resistance in salmonellae in Britaina; a twelve years study. Lancet II: 705-706 Wood, C. R- J^ Versalovic, Koeuth, T. and Lupski, J. R , (1992): Analysis of relationships among isolates of Citrobacter diversus by using DNA fingerprints generated by repetitive sequence-based primers in the polymerase chain reaction. J. Clin. Microbiol. 30: 2921-2929 World Health Organization, (1978): Technical Report Seri®, StjrveUlaneefarthe prevention an A control o f health hazards due to antibiotic-resistant enterobacteria. No. 624 World Health Organization, (19%): World Health Report; Fighting disease, fostering development. WHO, Geneva World Health Organization, (1993): Research Guidelines for evaluating the safety and 135 University of Ghana http://ugspace.ug.edu.gh efficacy of herbal medicines, pp. 1 • World Health Organization, (2003): Draft guidelines for clinical observational study of fradftional herbal medicine in WHO AfHcar egio , Brazzaville World Health Organization, (2004): Essential Drug and Medicines Policy: Definitions. http://www.worldwidevaccines.cotn/Dublic/diseas/tVDl3.asp http://pathologv5.ihmi.edu/micro/vl6n02.htiTi http://gsbs.utmb.edu/microbook/ch02.htm http://www.merck.com/pubs/mmanual/section 13/chapter 153/153f.htm http://www.medicine.mcgill.ca/cai/meded/drugdb/ampicillin/ampicillin omnioen db.htm http://www.vet.purdue.edu/depts/bms/courses/chmrx/tetra.htm http://Avww.holistic-online.com/Herbal.Med/hol herb-intro.htm http://www.who.int/inf-fs/en/fact 134.htm http://uninet.edu/cin2001 /paper/ibanez/fovaca.htm http://www.indmedplants-kr.org/ECONOMIC VALUE OF MEDICINAL 2.HTM http://www.unep-wcmc.org/species/plants/ghana http://www 1 .cfiks.org/healthmed.htm http://www.nimh.btintemet.co.Uk/eihm/l 1 hw3.htm http://www.idrc.ca/media/commplants e2.html 136 University of Ghana http://ugspace.ug.edu.gh APPENDIX A TABLE » Salmtmetia isolates resistant to alt the five antibiotics AmCmTeTsSt 8,13,33,39,48,49,51-53,55,66,67,72-78,83, 89,90,95,97-99,101,102,104*106,108412,115 TABLE 2 Salmonella isolates resistant to fonr of the antibiotics____________ AmCmTeSt 23 AmCmTsSt 17,47,63,68,71,79,114 AmTeTsSt 1,3,4,6,21,22,27,35,38,40,46,56,81,82,84,88,91-94,96, 100,103,107 TABLE 3- Salmonella isolates resistant to three of the antibiotics AmCmTe 7 AraTeSt 24 AmTeTs 2,143,30 TcTFsSt 113 TABLE 4. Salmmelia isolates resistant to two of the antibiotics Am St 87 TABLE 5. Salmonella isolate resistant to one of the antibiotics Am 26,29,36,80 Te 58,59 St 61,65 137 University of Ghana http://ugspace.ug.edu.gh December 2003 Volume 37, Number 4 GHANA MEDICAL JOURNAL MULTIPLE RESISTANT SALMONELLA IN ACCRA, GHANA F.C. MILLS-ROBERTSON1’4, MERCY J. NEWMAN2, PATIENCE MENSAH3 AND ‘MARIAN E. ADDY4. 'Centre for Scientific Research into Plant Medicine, P.O. Box 73, Mampong-Akwapim, Ghana, department of Microbiology, University of Ghana Medical School, P.O. Box 4236, Accra, Ghana. 3Bacteriology Unit, Noguchi Memorial Institute for Medical Research, P.O. Box LG 581, Legon, Ghana department of Biochemistry, University of Ghana, P.O. Box LG54, Legon, Ghana SUMMARY is highest in children and young people4. This is A total of 115 Salmonella strains isolated during because older people often seem to possess partial 1998-1999 in Accra, Ghana were examined for immunity, probably following exposure to fre­ drug/multiple drug resistance, using first-line anti­ quent sub-clinical infective doses of typhoid bacil­ typhoid antibiotics, namely, ampicillin (Am), lus5. A review conducted in rural areas of three chloramphenicol (Cm), Tetracycline (Te) and African countries namely Ghana, Zambia and Trimethoprim/sulphamethoxazole (Ts). These or­ Kenya in 1994, revealed that incidence of typhoid ganisms were isolated from urine, stool, food, was much higher in Ghana compared to the rest3. cerebrospinal fluid, blood and other sources. The This was linked to poor water supply, inadequate number of organisms isolated from blood alone sewage disposal and unhygienic conditions. was 82(71.3%). Eight serological groups were identified and the most common isolates were Treatment of typhoid fever is usually by antibiot­ groups D (57.4%) and B (33%), with the least ics and the drug of choice has been chlorampheni­ found in groups A, G and I. col, a broad-spectrum antibiotic. This drug is inex­ pensive and has remarkably been effective in the Forty-four (38.3%) isolates were found to be sensi­ treatment of typhoid fever in the past However, it tive to all four antibiotics whilst 71 (61.7%) were has recently been reported to increasingly becom­ resistant to one or more of the antibiotics used. ing ineffective in treating typhoid cases6. This is Thirteen (11.3%) of the resistant strains were resis­ very disturbing because it has been reported that tant to only one of the antibiotics, 6 (5.2%) were about 12-16% of patients die within four weeks of resistant to two of the antibiotics, 22 (19.1%) were the disease if not well managed7. This has led to resistant to three of the antibiotics, and 30 (26.1%) the recommendation of the use of multi-drug ther­ were resistant to all four o f the antibiotics used. apy and/or third generation drugs. Multi-drug re­ All the organisms were however, sensitive to sistance is, however, now common among these Ciprofloxacin, and Ceftriaxone and Gentamicin. pathogenic microorganisms, which show both in vivo as well as in vitro resistance to the four first- These findings indicated that multiple resistant line antityphoid antibiotics namely, ampicillin, Salmonella are prevalent in Ghana and national chloramphenicol, tetracycline and trimethoprim- surveillance to determine the level of resistance is Sulphamethoxazole8’ 9’10-11-11-12. needed for the nation. Quinolone derivatives such as Ciprofloxacin or Keywords: Antibiotic susceptibility, multiple Pefloxacin and third generation cephalosporins resistance, Salmonella such as Ceftriaxone or Cefotaxin are very effective for treating diseases caused by multi-drug resistant INTRODUCTION S. typhi strains, particularly Ciprofloxacin given by The number of officially recorded cases of human oral route in a 7-day course of therapy13. However, salmonellosis has significantly increased over the these drugs are expensive and out of reach of the past two decades in many countries all over the poor in the endemic areas, hence, chloramphenicol world1,2,3. In Ghana, salmonellosis, especially ty­ is still prescribed in many health facilities in Ghana and this has led to the general notion that phoid fever is of public health concern in urban slums and rural communities where its prevalence typhoid is difficult to treat. ' Author fo r correspondence 165 University of Ghana http://ugspace.ug.edu.gh December 2003 F.C. Mills-Robertson et al Multiple resistant salmonella The present study was carried out to evaluate the The study serologically identified eight groups of prevalence of multiple resistant Salmonella in Ac­ Salmonella, Group D (57.4%). Group B (33%), cra, Ghana during the period August 1998 to July Group C, (3.5%), Group C2 (1.72%), Group E, 1999. (1.7%) and Groups A, G and I (0.9%) each. MATERIALS AND METHODS The antibiotic susceptibility tests showed that, The above study was carried out at the Bacteriol­ 44(38.3%) were susceptible to all four antibiotics ogy Unit, Noguchi Memorial Institute of Medical and the remaining 71 (61.7%) of the 115 Salmo­ Research (NMIMR), University of Ghana, Legon. nella strains were resistant to one or more of the The isolates of Salmonella from stool, blood, first-line anti-typhoid antibiotics (Table 2). urine, cerebrospinal fluid, food and chicken, were from the Microbiology Department, Korle Bu Table 2 Susceptibility patterns of Salmonella iso­ Teaching Hospital, and the Bacteriology Unit, lated (n=71). NMIMR, Legon. The specimens were plated on the appropriate media (MacConkey agar, chocolate Total number of resis- agar, blood agar or Dexycholate agar) from Oxoid, Resistance pattern_________tant strains < %) (Maryland, USA), depending on the source of the sample and colonies with the characteristics of AmCmTeTs 30 (42.3) Salmonella isolated using standard microbiologic AmCmTe 1 (1.4) methods14 Identification of Salmonella from the various sources was done using the following bio­ AmTeTs 17 (23.9) chemical tests; Triple Sugar Iron (TSI) agar test, CmTeTs 4(5.6) Sulphur Indole Motility (SIM) agar test, and Urea AmTs 1 (1.4) agar test, all from Oxoid (Maryland, USA) and the presence of Samonella was confirmed and grouped CmTe 1 (1.4) using Salmonella antesera kit from Denka Seiken TeTs 4(5.6) Co., Ltd., Japan. Am 4(5.6) In vitro antibiotic susceptibility against ampicillin Te 9(12.7) (10/tg), chloramphenicol (30/ig), tetracycline Total 71 (100) (30/ig), and trimethoprim/sulphamethoxazole Am=A mpicillin Cm=C h 1 orampheni col (1.25/23.75/xg) from Britania (Buenos Aires, Ar­ Te= Tetracycline Ts = Trim ethoprim /Sulpham ethoxazole gentina) was tested according to the guidelines set by the National Committee for Clinical Laboratory Of these resistant isolates, 6(5.2%) were resistant Standards (NCCL)15. to two antibiotics, 22 (19.1%) were resistant to three antibiotics whilst 30 (26.1%) were resistant RESULTS to all four antibiotics. Interestingly, 4 (3.5%) were fesista'nt' tcTampicillin'aIoner9_(7.8%) were resis­ In all, one hundred and fifteen (115) Salmonella tant to tetracycline alone but none was resistant to strains were isolated. Table 1 shows the sources chloramphenicol or trimethoprim/sulphamethoxa­ and.number of Salmonella strains isolated. zole alone. Table 1 Number of Salmonella strains isolated DISCUSSION Source of salmonella____ Number of salmonella (%) There is an increase in the prevalence of salmonel­ Blood 82 (71.3) losis in most rural tropical areas and urban slums probably due to HIV, malnutrition, sickle cell Food 14(12.2) anaemia, G6PD-deficiency3'16, nematodiasis and Stool 6 (5.2) schistosomiasis16. Most of these clinical conditions Urine impair mononuclear cells, hence susceptibility to 4 (3.5) Salmonella bacteraemia. The high incidence of Cerebrospinal fluid 3 (2.6) such infectious diseases has resulted in the ac­ Others 6 (5.2) quired bacterial resistance in isolates of even healthy persons and from patients with commu­ Total 115(100) nity-acquired infections17. 16 6 University of Ghana http://ugspace.ug.edu.gh December 2003 Volume 37, Number 4 GHANA MEDICAL JOURNAL The present study confirms the presence of multi­ and the method of application18. Unfortunately, drag resistant strains (MRS) of Salmonella in precise data on antibiotic use in Ghana and many Ghana12'26. In the study, 60% of the 115 Salmo­ other countries are not available but consumption nella species isolated, during a 12 month period, appears to be rising on a worldwide scale. This is were resistant to one or more of the four first-line not surprising since in Ghana antibiotics are easily anti-typhoid antibiotics, with 70% of these being obtained as over-the-counter drug, in spite of laws multi-drug resistant strains. Thus, the multi-drug and regulations to the contrary which specify their resistant strains form 45.2% of the total number of sale only on prescription. organisms investigated. This is similar to the per­ centage reported from the Indian sub-continent5, The use of antimicrobial drugs in animals for known for its extremely high levels of multi-drug growth promotion has also led to selection of resis­ resistant Salmonella. These findings have grave tant strains of pathogens, which may be transmit­ implications for antibiotic therapy in Ghana as the ted to humans through food1,2,21,22. A typical ex­ resistance is to the inexpensive first-line antibiot­ ample involves the emergence and spread of drug- ics. resistant salmonellae from antibiotics used in ani­ mals during the 1960s23, with the subsequent No single strain o f Salmonella was found to be transmission of these salmonellae to man resulting resistant to chloramphenicol or trimethoprim/sul­ in many human infections. A study conducted in phamethoxazole alone with the rest being Accra revealed that, imported and locally produced susceptible, and this corroborates investigations by chicken are a potential source of multiple- other workers, who indicated no single strain of antibiotic-resistant enteropathogenic bacteria24. Salmonella being resistant to chloramphenicol Richmond25 reported in 1972 that, sewage and alone9. The organisms that were found to be resis­ surface waters contribute to the distribution and tant to chloramphenicol and/or trimethoprim- circulation of resistant organisms. These sources Sulphamethoxazole were always resistant to am­ represent a natural medium in which R-plasmid picillin and/or tetracycline but never vice versa. transfer can occur under certain physical, chemical All the resistant Salmonella strains in this study or biological condition and transferred to food and were resistant to ampicillin and/or tetracycline, drinking water, leading to recycling to man and and therefore treatment with chloramphenicol animals. It is therefore not surprising that, as much and/or trimethoprim-Sulphamethoxazole cannot be as 11(79%) of the Salmonella isolated from food relied on to eliminate these pathogens. Fortunately, for this study, were resistant to one or more of the all the isolates were susceptible to ciprofloxacin, antibiotics used. ceftriaxone and gentamicin. The results of this study would suggest that, con­ The appearance of such antibiotic-resistant strains trol measures be tackled through multisectoral of Salmonella is closely linked to antibiotics use methods and not only be dependent on the health for_tBe'tfeafment“of human infection and in poultry sector Ihus. the unnecessar y Frequent use of farming, which provides selective pressure favour­ antibiotics must be curbed whilst prompt diagnosis ing resistant strains18,19. It is therefore not surpris­ and antibiotic therapy for patients and proper man­ ing that, the drugs most commonly affected by agement of asymptomatic carriers be practiced. bacterial resistance in Ghana and many other de­ The provision of potable drinking water and 21s1 veloping countries are generally the inexpensive century sewage disposal practices as well as health and popular broad-spectrum antibiotics such as the education must be intensified to help control the four used in this study. disease. The spread of these resistant organisms may be ACKNOWLEDGEMENTS traced to socio-economic and behavioural antece­ The authors wish to thank the staff at the Bacteri­ dents contributing to the escalating resistance to ology Unit, Noguchi Memorial Institute o f Scien­ antibiotics worldwide. This may result from the tific Research especially Mr. H. E. Longmatey and misuse of antibiotics by either the physicians in the Microbiology Department of University of clinical practice, the unskilled practitioners, or by Ghana Medical School especially Francis Coudjoe the public, sub-optimal use and poor quality of and Patrick Owiafe, for their help during the isola­ antibiotics, all o f which may bring about resis­ tion of some of the organisms from patients. tance . The resistance may however appear rap­ idly or slowly, depending on the organism con­ cerned, the volume and type of antibiotics used, 167 University of Ghana http://ugspace.ug.edu.gh December 2003 F.C. Mills-Robertson et al Multiple resistant salmonella REFERENCES lates from Accra, Ghana (1991-1994). Ghana 1. Ryder RW, Blake PA. Murlin AC, Carter GP, M edJ 2000; 34(1): 21-23. Pollard RA, Merson MH, Allen SD and Bren­ ner DJ. Increase in antibiotic resistance among 13. Wallace MR, Youssif AA Mahroos GP, Threl­ isolates of Salmonella in the United States, fall EJ et al. Ciprofloxacin versus Ceftriaxone 1967-1974. J In f Dis 1980; 142(4): 485-491. in the treatment of multi-resistant typhoid fe­ ver. Ear J Clin Microbiol Infect Dis 1993; 12: 2. Oosterom J. Epidemiological studies and pro­ 907-910. posed preventive measures in the fight against human salmonellosis, hit J Food Microb 14. Farmer JJ III. Enterobacteriaceae: introduction 1991; 12: 14-51. and identification In: Manual of Clinical Mi­ crobiology. 7lh Ed 1999; Muray PR, Baron EJ, 3. Petit PLC and Wamola IA. Typhoid fever; A Pfaller MA, Tenover FC, and Yolken RH. review of its impact and diagnostic problems. ASM Press, Washington, DC. 442-458. E Afri Med J 1994; 71(3): 183-188. 15. National Committee for Clinical Laboratory 4. Voros S, Vieu JF, Sallas CA et al. Phage type Standards Performance Standards for Antim­ distribution of Salmonella typhi strains iso­ icrobial Disk Susceptibility Tests. Approved lated in Ghana during the period 1971-1974. standard M2-A5, National Committee for Ghana Med J 1974; 180-184. Clinical Laboratory Standards, Wayne, PA 1993; 13: 24. 5. Mirza NB, Wamola IA, Estambale BA, Mbithi E and Poillet. Typhimurium Vj vaccine 16. Okome-Nkoumou M, Ayo Nkana E, Bekale J against typhoid fever: A clinical trail in and Kombila M. Typhoid and paratyphoid fe­ Kenya. East Afri Med J 1995; 72(3): 162-164. ver in adults in the Internal Medicine Depart­ ment at Libreville (Gabon). Sante 2000; 10(3): 6. Mandal BK. Salmonella infections. In Man­ 205-209. son’s Tropical Diseases 1996; 20Ul Edition. In­ ternational Student Edition. Paston Press Ltd., 17. Kunin CM. Resistance to antimicrobial drugs: London. 42: 849-863. A worldwide calamity. Ann Intern Med 1993; 118:557-561. 7. Mims C, Playfair J, Roitt I, Walkelin D and Williams R. Medical Microbiology 1998; 18. WHO Technical Report Series. Surveillance Second edition. London: Mosby 213. for the prevention and control of health haz­ ards due to antibiotic-resistant enterobacteria. 8. Smith SM, Palumbo PE, Edelson PJ. Salmo- 1978; 624. yieWo_strains resistant to _ multiple antibiotics; . Therapeutic implications. Paediatr Infect Dis 19. Rahal K, Wang F, Schindler J, Rowe_ B,’ 1984; 3: 455-460. Cookson B, Huovinen P et al. Report on sur­ veillance of antimicrobial resistance in indi­ 9. Panigrahi D, Al-Aneziz AH, and West PEJ. vidual countries. Clin Infect Dis 1997; Plasmid-mediated multi-drug resistance in 24(Suppl 1): S169-S175. Salmonella typhi in Kuwait. Trop Med and bit Health 1996; 1(4): 439-442. 20. Okeke IN, Lamikaura A and Edelman R. So­ cioeconomic and behavioural factors leading 10. Rowe B, Ward LP Threlfall EJ. Multiresistant to acquired bacterial resistance antibiotics in Salmonella typhi - a world-wide epidemic. developing Countries. Emerg In f D 1999; Clin Infect Dis 1997; 24: 5106-5109. 5(1): 1-9. 11. Sajjad Hussain Mirza Multidrug-resistant 21. Khachatourians GG. Agricultural use of anti­ Salmonella typhi: A Global Review. Lab- biotics and the evolution and transfer of anti­ Medica Int 1996; XIII(6): 40-42. biotic-resistant bacteria. CMAJ 1998; 159: 1129-1136. 12. Newman MJ. Antibiotic sensitivity patterns of typhoidal and non-typhoidal Salmonella iso­ 168 University of Ghana http://ugspace.ug.edu.gh December 2003 Volume 37, Number 4 GHANA M EDICAL JOURNAL 22. Mensah P. The role of street food vendors in poultry from metropolitan Accra. Int J o f the transmission of enteric pathogens in Ac­ FoodMicrob 2001; 71: 21-28. cra. Ghana M edJ 1999; 33(1): 19-29. 25. Richmond MH.. Some environmental conse­ 23. Anderson ES. Drug resistance in Salmonella quences of the use of antibiotics. J Appl B ad typhimurium and its implications. Bri Med J 1972;35:155-176. 1968; 3: 333-339. 26. Newman MJ. Multiple resistant Salmonella 24. Sackey BA, Mensah P, Collison E, Sakyi- Group G outbreak in a neonatal intensive care Dawson E. Campylobacter, Salmonella, Shig­ unit. W A friJM ed 1996; 15:165-169. ella and Escherichia coli in live and dressed 169 University of Ghana http://ugspace.ug.edu.gh Journal o f Applied M icrobiology 2003, 94, 289-294 Antibiotic resistance and genotyping of clinical group B Salmonella isolated in Accra, Ghana F. Mills-Robertson1'2, S.S. Crupper3, M.E. Addy2 and P. Mensah4 'Centre for Scientific Research Into Plant Medicine, WHO Collaborating Centre for Traditional Medicine, PO Box 73, Mampong- Akwapim, Ghana, zDepartment of Biochemistry, PO Box LG 54, University of Ghana, Legon, Ghana, 3Department of Biological Sciences, 1200 Commercial, Emporia State University, Emporia, KS, 66801, and 4Noguchi Memorial Institute for Medical Research, PO Box LG 581, University of Ghana, Legon, Ghana 2002/221: received 5 June 2002, revised 17 October 2002 and accepted 29 October 2002 A B S T R A C T F. M IL L S -R O B E R T S O N , S .S . C R U P P E R , M .E . A O D Y A N D P. M E N S A H . 2003. Aims: T he purpose o f this study was to investigate the antibiotic resistance and clonal lineage o f serogroup B Salmonella isolated from patients suspected o f suffering from enteric fever in Accra, Ghana. M ethods a n d R esu lts: Serogroup B Salmonella were isolated from blood (b = 28), cerebral spinal fluid (CSF) [n = 1), or urine (n = 2), and identified based on standard biochemical testing and agglutinating antisera. Isolates were examined for their susceptibility to ampicillin, chloramphenicol, tetracycline and trim ethoprim -sulfam eth- oxazole. M ost o f the isolates could be classified as m ultiple-drug resistant. Furtherm ore, the genetic location of resistance genes was shown to be on conjugative plasmids. G enetic fingerprinting by plasmid profiling, enterobacterial repetitive intergenic consensus (ERIC)-PCR, and repetitive element (REP)-PCR were performed to determine the diversity among the isolates. Plasmid profiling discrim inated five unique groupings, while ERIC-PCR and REP-PCR resulted in two and three groupings, respectively. Conclusions: A high rate o f antibiotic resistance was associated with the Salmonella isolates and the genes responsible for the resistance are located on conjugative plasmids. Also, there appears to be minimal diversity associated with the isolates. Significance an d Im p a c t o f th e S tu d y : As a result o f the increasing antibiotic resistance among bacteria o f all genera, surveys to monitor microbial populations are critical to determine the extent o f the problem. T he inability to treat many infectious diseases with current antibiotic regimens should prom pt the medical community to be more prudent with its antibiotic use. Keywords: antibiotic resistance, genotyping, G roup B Salmonella. paratyphoid fever, a contagious condition similar to typhoid INTRODUCTION fever (Barrow 2000). Clinically, both typhoid and paraty­ Typhoid fever poses a serious health problem to the phoid fever are grouped together under the category of developing world. The annual incidence of this disease is enteric fever and patients exhibit headache, high fever, estimated to be 20 million cases, resulting in greater than stomach and intestinal pain, and vomiting. Cases of enteric 700 000 deaths (Thong el al. 1994). Most cases are the result fever are self-limiting if the appropriate antimicrobial of infection with Salmonella typhi (DuPont 1993), but regimen is started promptly. Chloramphenicol has been colonization with Salm. paratyphi A, B or C, results in the ‘first line of defense’ for many years, but the emergence of chloramphenicol-resistant strains prompted the use of Correspondence to: S S . Crupper, Department o f Biological Sciences, 1200 Commercial, Emporia State University, Emporia, KS, 66801 ampicillin and trimethoprim/sulfamethoxazole, which are (e-mail: cruppers@Amporia.edu). considered appropriate alternatives to chloramphenicol C 2003 The Society for Applied Microbiology University of Ghana http://ugspace.ug.edu.gh 292 F. M ILLS -R O B E R T S O N ETAL. (a) Fig. 1 Agarose gels o f representative genotypic patterns obtained with (a) plasm id profiling, (b) R EP-PC R , and (c) E R IC -PC R . T h e num bers above each gel refer to the d ifferent amplification p attern (refer to T ab le 2). M , markers Table 2 D istribution o f gTOup B Salmonella isolates in to discrete 1993). We initiated this study to examine if this trend was genotypic patterns occurring in patients suspected of suffering from enteric Genotypic Strains with indicated fever in Accra, Ghana. Thirty-one group B Salmonella pattern genotypic pattern isolates were examined for their susceptibility to five different antibiotics. An alarming rate of antibiotic resistance p p . was noted, as 93% of the isolates could be classified as 1 1.2 MDR. Although these ‘first line’ antibiotics had no effect, all 2 3,4 isolates were sensitive to ceftriaxone and ciprofloxacin (data 3 5-7,9 not shown). The cost of these antibiotics, however, will have 4 8,10-29,31 to become less prohibitive if they are to find application in 5 30 REP the developing world. 1 1-7,26,27 Previous studies have indicated antibiotic resistance 2 8-14,30,31 associated with Salm. typhi is in large part the result of 3 15-25,28,29 large conjugative plasmids (Goldstein et al. 1986; Karmaker ERIC et al. 1991; Mirza and Hart 1993). To determine if the 1 1-7,16-19,25,26,28-30 observed antibiotic resistance in this study was encoded by 2 8-15,20-24,27,31 conjugative plasmids, mating experiments between each Salmonella isolate and E. coli were carried out. An identical *PP, plasmid profiling. antibiotic resistance phenotype was conferred on the recipient E. coli in all cases where the Salmonella isolate DISCUSSION was resistant (Table 1). Furthermore, transferring antibiotic resistance to the recipient E. coli via transformation was not Enteric fever is predominately the result of infection by accomplished. These data indicate the genetic determinants Salm. typhi, Salm. paratyphi A, B, or C. Ten to fifteen years for antibiotic resistance are located on conjugative plasmids. ago, patients with enteric fever were successfully treated We did note differences in transferable resistance patterns using either of the ‘first line’ antibiotics (ampicillin, when matings were performed at either 28 or 37°C. Most chloramphenicol, or trimethroprim/sulfamethaxozole). notably, transferable tetracycline resistance was in some However, as with the trend of many bacterial pathogens in cases only accomplished at 28°C, while in other instances it today’s world, classical antibiotic treatment regimens are no occurred at only 37CC; oftentimes both conjugation tem­ longer effective (Mourad et al. 1993; Wallace and Yousif peratures resulted in tetracycline resistance. These data © 2003 The Society for Applied Microbiology, Journal of Applied Microbiology, 94, 289-294 University of Ghana http://ugspace.ug.edu.gh C LIN IC A L GROUP B S A LM O N E LLA IN GHANA 293 suggest multiple conjugative plasmids that are temperature R E F E R E N C E S sensitive with respect to transfer exist in the host cell and A nonym ous (1997) Methods fo r Dilution Antimicrobial Susceptibility Tests these plasmids may or may not contain tetracycline fo r Bacteria that Grow Aerobically. A pproved standard M 7-A4. W ayne, resistance determinants. Although temperature sensitive PA , U SA : N ational C om m ittee for Clinical L aboratory Standards. conjugative transfer has been documented in Salm. typhi, A nonym ous (1998a) Performance standards fo r Antimicrobial Disk no difference in resistance phenotypes were noted in a Susceptibility Tests. A pproved standard M 2-A 6. W ayne, PA , U SA : previous study (Shanahan et al. 1998). Furthermore, N ational C om m ittee for Clinical L aboratory Standards. temperature sensitive MDR in Salmonella and other enteric A nonym ous (1998b) Development o f in vitro Susceptibility Testing bacteria has been documented (Cohen et al. 1993; Kunonga Criteria and Q uality Control Parameters. N C C L S docum ent et al. 2000), and could possibly account for our observa­ M 23-T 2 . W ayne, PA , U SA : N ational C om m ittee for Clinical tions. However, we currently have no data to support this Laboratory Standards. hypothesis. A nonym ous (1999) Performance Standards fo r Antimicrobial Susceptibil­ Epidemiological investigations examining the clonal ity Testing. S upp lem ent M 100-S9. W ayne, PA , U SA : N ational C om m ittee for Clinical Laboratory S tandards. nature of disease outbreaks and for routine surveillance are Asperilla, M .O ., Sm ego, R.A . J r . and Scott, L .K . (1990) Q uinolone commonplace in clinical settings. Such data allows public antibiotics in the trea tm en t o f Salmonella infections. Review o f health officials the ability to determine if the causative Infectious Diseases 12, 873-889. organisms are part of the transient or resident populations. B arrow , P.A . (2000) T h e paratyphoid salmonellae. Revue Scientifique et Many genetic fingerprinting techniques are available, each Technique 19, 351-375. demonstrating variable degrees of utility. We investigated Beyer, W ., M ukendi, F .M ., K im m ig, P. and Bohm , R . (1998) the clonal nature of the group B Salmonella isolated in this Suitability o f repetitive-D N A -sequence-based P C R fingerprinting study using plasmid profiling and the PCR-based method­ for characterizing epidem ic isolates o f Salmonella enterica serovar ologies of ERIC- ahd REP-PCR. Plasmid profiling was the saintpaul. Journal o f Clinical Microbiology 36, 1549-1554. simplest procedure, but yet yielded the most genotypic C hitn is, V., Chitnis, D ., V erm a, S. and H em vani, N . (1999) groupings. Five distinct patterns were observed upon M ultid rug-resistan t Salmonella typhi in India. Lancet 354, 514-515. C ohen, S .P ., H achler, H . and Levy, S.B. (1993) G enetic and functional electrophoresis, and most importantly, this procedure analysis o f the m ultip le antibiotic resistance (mar) locus in Escheri­ grouped two strains that were sensitive to all of the chia coli. Journal o f Bacteriology 175, 1484—1492. antibiotics examined and one strain that was only resistant D atta, N ., R ichards, H . and Darta, C. (1981) Salmonella typhi in-vivo to ampicillin into two unique genotypic groupings (Table 2). acquires resistance to both chloram phenicol and cotrimoxazole. In contrast, we observed little variation among the 31 Lancet I, 1181-1183. isolates examined in this study using the PCR-based D e Bruijn , F .J. (1992) U se o f repetitive (repetitive extragenic methodologies. Both REP and ERIC are composed of short palindrom ic and enterobacterial repetitive intergenic consensus) extragenic repetitive sequences located throughout the sequences and the polym erase chain reaction to fingerprint the chromosome and have been used to fingerprint many genomes o f Rhizobium meliloti isolates and ocher soil bacteria. Applied bacterial species (De Bruijn 1992; Georghiou et al. 1994; and Environmental Microbiology 58, 2180-2187. -Rivera-ef-