RESEARCH ARTICLE
Aetiology of viral hepatitis among jaundiced
patients presenting to a tertiary hospital in
Ghana
Michael Owusu1*, Joseph Kofi Bonney2, Augustina Angelina Annan1,3, Gifty Mawuli2,
Kennedy Okyere4, Mohamed Mutocheluh4, Juliana Aryeequaye2, Nicholas
Kwabena Adjei5, Mary Afihene6, Kathryn Spangenberg7, Justice Sylverken5, Ellis Owusu-
Dabo1,8, Christian Drosten9, Yaw Adu-Sarkodie4
1 Kumasi Centre for Collaborative Research in Tropical Medicine, Kwame Nkrumah University of Science
a1111111111
and Technology, Kumasi, Ghana, 2 Department of Virology, Noguchi Memorial Institute for Medical
a1111111111
Research, University of Ghana, Legon, Ghana, 3 Department of Theoretical and Applied Biology, Kwame
a1111111111 Nkrumah University of Science and Technology, Kumasi, Ghana, 4 Department of Clinical Microbiology,
a1111111111 School of Medical Sciences, Kwame Nkrumah University of Science and Technology, Kumasi, Ghana,
a1111111111 5 Department of Child Health, Komfo Anokye Teaching Hospital, Kumasi, Ghana, 6 Department of Medicine,
Komfo Anokye Teaching Hospital, Kumasi, Ghana, 7 Department of Family Medicine, Komfo Anokye
Teaching Hospital, Kumasi, Ghana, 8 Department of Global Health, School of Public Health,Kwame
Nkrumah University of Science and Technology, Kumasi, Ghana, 9 Institute of Virology, Charité -
Universitätsmedizin Berlin, Berlin, Germnany
OPENACCESS * mowusu55@knust.edu.gh
Citation: Owusu M, Bonney JK, Annan AA, Mawuli
G, Okyere K, Mutocheluh M, et al. (2018) Aetiology
of viral hepatitis among jaundiced patients Abstract
presenting to a tertiary hospital in Ghana. PLoS
ONE 13(9): e0203699. https://doi.org/10.1371/
journal.pone.0203699
Background
Editor: Jee-Fu Huang, Kaohsiung Medical
University, TAIWAN Viral hepatitis continues to play significant role in causing morbidity and mortality in sub-
Received: April 23, 2018 Saharan Africa. Apart from the few population based studies available, not many have
investigated the burden of these viruses in jaundiced patients. Among the few studies, hepa-
Accepted: August 24, 2018
titis E is the least studied among jaundiced patients. This study was aimed at describing the
Published: September 12, 2018
frequency, distribution and risk of the different hepatitis viruses among jaundiced patients
Copyright: © 2018 Owusu et al. This is an open reporting to the second largest teaching hospital in Ghana.
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and Methods
reproduction in any medium, provided the original
author and source are credited. From November, 2015 to April, 2016, a cross-sectional study was conducted among jaun-
diced patients attending the Komfo Anokye Teaching Hospital. Between 3–5 ml of blood
Data Availability Statement: All relevant data are
within the paper and its Supporting Information was collected from each patient and screened for viral hepatitis agents using both serologic
file. and molecular-based assays.
Funding: The reagents for this research were
provided by Institute of Virology, Charité -
Results
Universitätsmedizin Berlin through funding from
the Deutsche Forschungsgemeinschaft grant In the 155 patients recruited, hepatitis B was the most prevalent [54.2% (95% CI = 46.0%–
number DR 772/12-1 and the Virology Unit of the
62.2%)] followed by hepatitis E [32.9% (95% CI = 25.6–40.9%)]. Most cases of hepatitis E
Noguchi Memorial Institute of Medical Research,
University of Ghana, Legon. The funders had no occurred as co-infections with hepatitis B (18%), with the predominant clinical feature being
role in study design, data collection and analysis, hepatocellular carcinoma. Risk factor variable analysis showed middle and older aged
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 1 / 14
Viral hepatitis in Ghana
decision to publish, or preparation of the individuals were more at risk of hepatitis B exposure whereas younger age groups (<18
manuscript. years) were more at risk of hepatitis E virus infection.
Competing interests: The authors have declared
that no competing interests exist.
Abbreviations: CHRPE, Committee for Human
Conclusion
Research, Publications and Ethics; CI, Confidence
interval; HAV, Hepatitis A virus; HBV, Hepatitis B Hepatitis viruses are still important in the viral aetiology of jaundice in Ghana. Hepatitis B
virus; HCC, Hepatocellular carcinoma; HCV, and hepatitis E co-infections could play significant roles in causing severe disease. A more
Hepatitis C; HDV, Hepatitis D; HEV, Hepatitis E;
aggressive approach needs to be adopted in order to reduce the morbidity and mortality
HRP, Horseradish peroxidase; IQR, Inter-quartile
ranges; KATH, Komfo Anokye Teaching Hospital; associated with hepatitis causing viruses in Ghana and other developing countries.
OR, Odd ratios; RNA, Ribonucleic Acid; WHO,
World Health Organisation.
Introduction
Viral hepatitis continues to pose significant public health challenges in developing countries
especially in sub-Saharan Africa. Five main causes of viral hepatitis have been identified to
date. These are hepatitis A (caused by hepatitis a virus; HAV), hepatitis B (HBV), hepatitis C
(HCV), hepatitis D (HDV) and hepatitis E (HEV).
HBV and HCV are transmitted mainly through body fluids. HBV is the most common hep-
atitis causing virus accounting for nearly 2 billion infections globally and around 5–10% of
chronic infections among adult populations in sub-Saharan Africa and East Asia [1, 2]. Simi-
larly, an estimated proportion of 2.8% of the world’s population representing 180 million indi-
viduals are infected with HCV [3]. In Ghana, HBV and HCV respectively account for about
10–15% and 3% of infections in the general population [4, 5]. These two viruses have been
implicated in the development of hepatocellular carcinoma (HCC). Whereas about 1–5% of
chronic HCV sufferers are likely to develop HCC, up to 50% of HCC cases are attributed to
both direct and indirect oncogenic effects of HBV [6, 7]. HAV and HEV on the other hand are
transmitted through the faecal-oral route and often associated with asymptomatic illness but
can cause acute disease characterised by clinical jaundice. HEV especially may develop into
fulminant hepatitis with a case fatality rate between 1 and 2% in the general population [8].
This fatality can rise to over 40% in pregnant women [9, 10]. Few cases of sporadic outbreaks
of HAV and HEV have been reported in Ghana, Kenya, and other developing countries [11–
13]. A report by the World Health Organisation (WHO) and other researchers show that more
than 1.5 million cases of hepatitis A and 20 million cases of HEV infections occur annually
resulting in over 3 million symptomatic cases [14, 15].
Infections associated with HAV and HEV still remain a public health concern in Africa
because of poor sanitation, unhygienic practices and lack of access to clean water. Individuals
in rural parts of Africa who use wells are reported to have 8.6% case fatality whereas those rely-
ing on river and pond water have 2.5% and 0.8% case fatality rates, respectively [16]. Of the
limited data that exist on the prevalence of hepatitis causing viruses in Ghana and other parts
of Africa, a higher proportion were extracted from healthy populations. Information on the
occurrence of these viruses in patients with hepatic related jaundice is limited. Knowledge on
the burden of these viruses in jaundiced patients would provide a good estimate of the morbid-
ity and mortality associated with exposure to hepatitis viruses and help direct therapies.
This study was conducted to determine the epidemiology of hepatitis causing viruses
among patients presenting with jaundice to the Komfo Anokye Teaching Hospital (KATH).
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 2 / 14
Viral hepatitis in Ghana
Methods
Ethics and consent to participate
This study was approved by the Committee on Human Research Publication and Ethics of the
Kwame Nkrumah University of Science and Technology. Informed consent was obtained
from all patients prior to recruitment. Consent to publish the findings of this study was also
obtained from all patients during the consenting process. It was however made known to them
that their names would be excluded from the manuscript.
Study area
The study was carried out at KATH; the second largest tertiary medical facility in Ghana.
KATH is approximately a 1200 bed tertiary medical facility located in Kumasi; the Ashanti
region of Ghana. The hospital serves over 4 million people within its catchment area. The aver-
age patient utilisation is approximately 350,000 [17]. Three units in the hospital attend to
patients presenting with jaundice. These are the Medicine Gastroenterology, Paediatric
Gastroenterology and the Family Medicine units. The Medicine and Child Health units
respectively identified liver disease and jaundice as the second and third causes of death in the
2015 annual year [18].
Study design and sample size
We conducted a cross-sectional study to determine the sero- and molecular epidemiology of
hepatitis viruses among jaundiced patients reporting to the hospital from November, 2015 –
April, 2016. Recruitments were done from the Medicine, Child Health and the Family Medi-
cine units of the hospital. Patients with ages 3 months and above were assessed by specialist
physicians and those found to be jaundiced were prospectively enrolled. Prior to the study, a
sample size of at least 153 was determined taking into consideration a two sided alpha level of
5%, a study power of 80% and design effect of 1. The estimate was based on a HBsAg seroprev-
alence of 50.6% among patients presenting with jaundice [19].
Patient sampling
For all patients, blood samples processed into serum were collected after informed consent or
assent was sought. Variables including socio-demographic characteristics, history of present-
ing medical complains, exposure to livestock, consumption of pork and serum liver markers
were entered on standard questionnaires. Attempts were made to sample every subject that
presented to the clinics within the study period in order to reduce bias that may result from
sampling. All samples were transported to the Kumasi Centre for Collaborative Research in
Tropical Medicine under cold chain conditions for processing and testing.
Laboratory processes
All specimens collected were screened for HBV, HCV and HEV with both serologic and
molecular tools. HAV was screened using only molecular methods. Prior to molecular
analysis, nucleic acids of all serum samples were extracted and purified with the Viral RNA
Mini kit (Qiagen, Hilden, Germany). Extraction was done following the manufacturer’s
protocol.
Hepatitis A virus. Molecular test for HAV was performed using a OneStep Reverse Tran-
scription (RT)-PCR reagent kit (Qiagen, Hilden, Germany). Briefly, a 25 μl reaction mix con-
tained 1 μl of 10 mM dNTPs, 1 μl of 10 μM each of forward and reverse primers, 5 μl of Q
solution, 6 μl of RNase free water, 1 μl of enzyme mix and 5 μl of nucleic acid extract. Cycling
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 3 / 14
Viral hepatitis in Ghana
conditions comprised RT at 48˚C for 30 minutes, denaturation of 94˚C for 2 minutes and 40
cycles of 95˚C for 15 seconds, 50˚C for 30 seconds and 68˚C for 60 seconds. PCR products
were visualized on a 2% agarose gel with 2 μl of Ethidium bromide per 100 ml gel solution,
and bands of 510 bp were noted as positive for HAV. For all the tests, known control samples
positive for HAV were used to validate the run.
Hepatitis B. HBV testing was done using both molecular and serological methods. Molec-
ular tests were done using real time PCR. Briefly, a 25μl reaction mix contained 0.88 μl of
10mM dNTPs, 1.32μl of 50mM MgCl2, 4.4μl of 10X Platinum buffer, 0.88μl of 10 μM each of
forward and reverse primers mix (made up of equal volumes of R1, R2, R3), 12.7μl of water,
0.5μl of Platinum Taq and 0.3 μl of viral DNA. Thermocycling parameters comprised of dena-
turation at 95 ˚C for 10 min, followed by 3 cycles at 95 ˚C for 15 seconds and 60˚C for 45 sec-
onds and then 45 cycles at 93 ˚C for 10 seconds and 60˚C for 40 seconds.
Serological tests were performed using Abon HBsAg test kit (Biopharm, China)[20]. The
test strip is a qualitative immunoassay for identifying HBsAg. The kit principle is based on the
serum or plasma antigens binding to the pre-coated anti-HBsAg antibody on the strip. Testing
was performed by dipping the strip in serum for 15 seconds.
Hepatitis C. HCV testing was similarly performed using both molecular and serological
method. Molecular testing was done using One Step RT-PCR Kit (Qiagen, Hilden, Germany).
Briefly, a 25μl reaction mix contained 5μl of 5x Reaction Buffer, 5 μl of Q Solution, 1μl of
10mM dNTPs, 1.5μl of 10μM each of forward and reverse primers, 1μl of enzyme mix and 5μl
of RNA extract. Cycling conditions comprised of an RT step of 50˚C for 30 minutes, denatur-
ation of 95˚C for 15 seconds and 45 cycles of 95˚C for 15 seconds, 60˚C for 15 seconds and
72˚C for 30 seconds. DNA products were visualized on a 2% agarose gel and band sizes equiva-
lent to 380bp were noted as HCV viruses. Control strains of known HCV viruses were used to
validate PCR testing.
For rapid serologic tests, Abon (Biopharm, China)[20] HCV test strip was used. The kit is a
qualitative immunoassay for identification of antibody to HCV. The membrane within test
strip is pre-coated with HCV antigen. During the test, the sample antibodies bind to the pre-
coated HCV antigen resulting in a colored line. The test was performed by dipping the strip in
serum specimen for 15 minutes. Samples with coloured lines at both the test and control win-
dows were noted as positive for HCV.
Hepatitis E. Serum samples were screened for HEV IgG and IgM class antibodies with
AXIOM ELISA assays (Axiom diagnostics, Germany) and real time PCR using Taqman
based probes. For the indirect ELISAs, 100μl of sample diluent was first added to micro-
plates already pre-coated with recombinant antigens corresponding to the structural regions
of HEV Open Reading Frame-2. Ten microliters (10μl) of study samples including negative
and positive controls were added to each pre-labelled sample wells. The plates were incu-
bated at 37˚C and 100μl of horseradish peroxidase (HRP) followed by the addition of 50μl
of chromogen A and B substrates. The final reaction was read at 450nm. The cut off values
(C.O) for the wells (samples) were calculated according to the manufacturer’s directions
using the formula: C.O = Nc + 0.16, (Nc = the mean absorbance value for three negative
controls).
Real time RT-PCR was performed on the extracted nucleic acid to identify the ORF3 of
HEV virus. The reactions were carried out in a 25μl mixture containing 2μl of 10 μM each of
forward and reverse primer, 1μl of each dNTPs and bovine serum albumin, 5μl of 5X OS
buffer, 7.3μl of RNASE free water, 1μl of enzyme mix and 5μl of nucleic acid extract. Thermo-
cycling parameters comprised of reverse transcription at 50˚C for 30 min, denaturation at
95˚C for 15min, followed by 45 cycles at 95˚C for 15 seconds and annealing at 58˚C for 30 sec-
onds. The sequences of probes and primers are shown in Table 1.
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 4 / 14
Viral hepatitis in Ghana
Table 1. List of primers and target regions of sequences.
Virus Reagents Primers sequences (5’–3’) Target region Amplicon length Reference
HAV OneStep RT-PCR Kit (Qiagen) 2870 (GACAGATTCTACATTTGGATTGG), VP1/2A junction 510 [21]
3381 (CCATTTCAAGAGTCCACACACT)
HBV Platinum Taq polymerase (Invitrogen) F- GAT GAG GCA TAG CAG CAG GAT PreS2 gene N/A [22]
R1- CAA CCT CTT GTC CTC CAA CTT GT
R2- AAC CTC CTG TCC TCC AAC TTG T
R3- CAA CCT GTT GTC CTC CAA TTT GT
P—FAM-ATC GCT GGA TGT GTC TGC GGC GTT-TAMRA
HCV OneStep RT-PCR Kit (Qiagen) Pr3 (TATGAYACCCGCTGYTTTGACTC), NS5B 380 [23]
Pr4 (GCNGARTAYCTVGTCATAGCCTC)
HEV OneStep RT-PCR Kit (Qiagen) HEV_F GGTGGTTTCTGGGGTGAC ORF3 N/A [24]
HEV_R AGGGGTTGGTTGGRTGRA
HEV_P FAM-TGATTCTCAGCCCTTCGC-MGB
https://doi.org/10.1371/journal.pone.0203699.t001
Ethical approval
The study protocol was approved by the Committee for Human Research, Publications and
Ethics (CHRPE) of KATH and School of Medical Sciences, KNUST, Kumasi, Ashanti region,
Ghana. Prior to recruiting the patients, the study protocol was explained to them in their local
dialect. Written informed consent was obtained for data and sample collection from adults
and parents or guardians of children. For children between 13 and 17 years, assent was also
obtained.
Statistical analysis
All data obtained from patients were recorded using Microsoft Excel. Subsequent analysis was
performed using R statistical software (version 3.3.2). Categorical variables and their associa-
tion with hepatitis viruses were analysed with Fisher’s exact or Chi-square test where appropri-
ate. In defining positivity of HBV viruses, a combined binary variable was created from both
PCR and serology results to allow for correlation with clinical and socio-demographic charac-
teristics. All continuous variables were expressed as medians with their inter-quartile ranges
(IQR). A non-parametric K-sample test on equality of medians was used to evaluate the differ-
ences in the medians of the various subgroups of the continuous variables. Independent risk
factors for exposure to various hepatitis viruses were determined by entering possible risk fac-
tors which were significant at p< 0.2 into a multivariable logistic regression using both for-
ward and backward selection approaches. Independent risk factors were expressed as the
adjusted odd ratios (OR) and 95% confidence interval (CI).
Results
Socio-demographic and clinical characteristics of patients
Within the period of this study, we screened a total of 195 all jaundiced cases. Fifty three (53)
were from the Department of Child Health, 133 from the Department of Gastroenterology
and 9 from the Department of Family Medicine. Of the number screened, 155 patients were
recruited into this study. The algorithm for screening and recruitment of subjects is shown in
Fig 1.
Nine patients were below 12 months of age and 146 patients were above 12 months. The
median age of patients below 12 months was 6 months (IQR = 5–7) and that of patients above
12 months was 35 years (IQR = 17–47). Most of the patients were males (92; 59.4%) with the
predominant religion being christian (118; 77.1%). Of the 155 patients recruited, 35 (24.3%)
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 5 / 14
Viral hepatitis in Ghana
Fig 1. Flowchart of subject recruitment.
https://doi.org/10.1371/journal.pone.0203699.g001
had no formal education, 29 (20.1%) had senior high school education, 25 (17.4%) had junior
high school education, 16 (11.1%), 16 (11.1%) had tertiary and the rest had both primary and
nursery education. Of all patients recruited, 85 (57.8%) were employed.
The study also observed 60 (38.7%) patients presenting with hepatomegaly and 16 (10.3%)
presenting with splenomegaly. The predominant diagnosis identified among study subjects
was chronic liver disease. Tables 2 and 3 describe summaries of the socio-demographic and
clinical characteristics of study patients.
Virus distribution
The present study identified four hepatitis viruses among the study patients. Of the 155 sub-
jects, 108 (70%) had one or more virus exposures. HBV was the most prevalent virus with
detectable viral DNA in 43 (27.7%) patients and HBsAg detection in 70 (45%). The overall
prevalence of HBV was [54.2% (95% CI = 46.0%–62.2%)]. HAV RNA was identified in 2
patients (1.3%); one was identified in a 9-year-old female and the other in a 2-year old male.
All samples were negative for HCV and HEV viral RNA.
Based on serologic methods, the prevalence of HCV antibodies was 11.6% (95%CI = 7.0%–
17.7%). HEV IgM antibodies were identified in 3 (1.9%) patients and IgG antibody was
identified in 51 (32.9%) patients. The overall prevalence of HEV infection was 32.9% (95%
CI = 25.6–40.9%).
Our study also identified cases of single and multiple infections. Single infections occurred
in 48 patients (31%) for HBV, followed by 11 patients (7.1%) for HEV and 5 patients (3.2%)
for HCV. Table 4 summarizes combinations of infections observed.
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 6 / 14
Viral hepatitis in Ghana
Table 2. Socio-demographic characteristics of patients.
Variable Frequency Percent
Age
3 months– 18yrs 47 30.3
19yrs– 40yrs 59 38.1
41yrs– 79yrs 49 31.6
Gender
Male 63 40.6
Female 92 59.4
Religion
Christian 118 77.1
Muslim 31 2.6
Others 4 20.3
Highest Level of Education
Nursery 12 8.3
Primary 27 18.8
Junior High School 25 17.4
Senior High School 29 20.1
Tertiary 16 11.1
No formal Education 35 24.3
Occupational Status
Employed 85 57.8
Unemployed 62 42.2
Source of Drinking Water
Mostly Borehole 20 14.3
Mostly Pipe water 61 43.6
Mostly Sachet water 42 30
Others 17 12.1
Rearing of livestock
Rear livestock 52 36.9
Don’t rear livestock 89 63.1
Pork Consumption
Consume Pork 53 37.1
Don’t consume Pork 90 62.9
History of Blood Transfusion
No 95 67.4
Yes 46 32.6
History of Surgery
No 120 85.7
Yes 20 14.3
https://doi.org/10.1371/journal.pone.0203699.t002
Viruses stratified by clinical and socio-demographic characteristics
A stratification of infections by socio-demographic characteristics showed that age was signifi-
cantly associated with HBV and HEV but not HCV infection. Interestingly, being employed
(as opposed to unemployed) was significantly associated with HBV and HEV infection. Simi-
larly, there was significant association between HEV exposure and christian religion. No asso-
ciation was found between HEV exposure and rearing of livestock, consumption of pork or
drinking from specific water sources. Similarly, for HCV, there was no association between
any of the demographic variables and HCV infection. Table 5 shows the association between
the three commonest viruses and the socio-demographic variables.
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 7 / 14
Viral hepatitis in Ghana
Table 3. Clinical characteristics of subjects.
Variable Summary
Total 155
Hepatomegaly
No 95 (61.3)
Yes 60 (38.7)
Splenomegaly
No 139 (89.7)
Yes 16 (10.3)
Diagnosis
Acute liver disease 10 (7.2)
chronic liver disease 59 (42.8)
hepatic encephalopathy 9 (6.5)
Hepatocellular carcinoma 32 (23.2)
Liver cirrhosis 16 (11.6)
Others 12 (8.7)
Upper Gastrointestinal Bleeding
No 134 (86.5)
Yes 21 (13.5)
Respiratory rate
mean(SD) 28.1 (12.1)
Heart rate
mean(SD) 100.4 (22.8)
Clinical outcome
Died 5 (3.2)
Discharged 150 (96.8)
https://doi.org/10.1371/journal.pone.0203699.t003
We also compared the distribution of clinical parameters of patients to three hepatitis
viruses. Most patients infected with HBV seem to present mostly with chronic liver disease
(40.3%) and hepatocellular carcinoma (31.2%) as compared to those not infected with hepatitis
B (p = 0.006). However, among hepatocellular carcinoma patients, single HEV infection was
identified in two patients and co-infections of hepatitis B and hepatitis E was identified in 9
patients. A comparison of the liver and renal function tests for hepatitis B and C infected
patients to uninfected patients did not show any significant statistical difference (table not
Table 4. Frequency table of mono and co-infections.
Frequency Percentage Cumulative Percentage
Mono-infections Only HAV 1 0.6 0.6
Only HBV 48 31.0 31.6
Only HCV 5 3.2 34.8
Only HEV 11 7.1 41.9
Dual Infections HAV + HBV 1 0.6 42.6
HBV + HEV 29 18.7 61.3
HBV + HCV 2 1.3 62.6
HCV + HEV 7 4.5 67.1
Triple Infection HBV + HCV + HEV 4 2.6 69.7
All Negative Negative for all viruses 47 30.3 100.0
Total 155 100 100
https://doi.org/10.1371/journal.pone.0203699.t004
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 8 / 14
Viral hepatitis in Ghana
Table 5. Socio-demographic characteristics of study subjects stratified by hepatitis viruses.
Hepatitis B Positive Hepatitis C Positive Hepatitis E Positive
Total 84 18 51
Age of Subjects (years) p-value< 0.001 p-value = 0.314 p-value (<0.001)
< 18 11 (13.1) 3 (16.7) 4 (7.8)
19–40 43 (51.2) 7 (38.9) 17 (33.3)
41–79 30 (35.7) 8 (44.4) 30 (58.8)
Gender p-value = 0.064 p-value = 0.925 p-value = 0.438
Female 28 (33.3) 8 (44.4) 18 (35.3)
Male 56 (66.7) 10 (55.6) 33 (64.7)
Religion p-value = 0.737 p-value = 0.444 p-value = 0.032
Christian 62 (75.6) 13 (72.2) 33 (64.7)
Others 3 (3.7) 1 (5.6) 2 (3.9)
Muslim 17 (20.7) 4 (22.2) 16 (31.4)
Level of Education p-value< 0.001 p-value = 0.286 p-value = 0.139
No Formal Education 13 (17.3) 5 (35.7) 13 (28.3)
Nursery 2 (2.7) 1 (7.1) 0 (0)
Primary 12 (16) 3 (21.4) 9 (19.6)
JHS 20 (26.7) 0 (0) 6 (13)
SHS 15 (20) 2 (14.3) 11 (23.9)
Tertiary 13 (17.3) 3 (21.4) 7 (15.2)
Occupational status p-value = 0.005 p-value = 0.648 p-value = 0.005
Employed 54 (69.2) 10 (66.7) 38 (79.2)
Unemployed 24 (30.8) 5 (33.3) 10 (20.8)
https://doi.org/10.1371/journal.pone.0203699.t005
shown). For patients infected with HEV, the average creatinine level was higher (median =
71 μmol/l; IQR = 51–100.8) than those not infected (p = 0.023). Of the 155 patients, 5 died. Of
the 5, 1 was infected with HEV and three were infected with HBV infection.
To determine the independent risk factors associated with exposure to hepatitis viruses, all
variables with p-value below 0.2 were entered into three logistic regression models each for
hepatitis B, C and E virus exposures. Age and level of education were identified to be indepen-
dent risk factors associated with hepatitis B and E infections. No significant factors were asso-
ciated with hepatitis C virus exposures. Table 6 describes the independent risk factors
associated with hepatitis viruses.
Table 6. Independent risk factors of hepatitis virus exposure.
Virus Risk factor Crude OR (95%CI) Adj OR (95%CI) P- value
Hepatitis B Age Groups: Ref = (0–18 years)
19–40 9.87 (3.73,26.14) 7.79 (2.27,26.69) 0.001
41–79 5.73 (2.18,15.08) 8.34 (2.34,29.75) 0.001
Level of Education: Ref = SHS
Tertiary 3.73 (0.87,16.07) 3.6 (0.81,16.12) 0.093
Nursery 0.21 (0.04,1.13) 1.2 (0.16,9.1) 0.859
JHS 5.6 (1.35,23.23) 8.97 (1.81,44.33) 0.007
No formal education 0.47 (0.16,1.34) 0.89 (0.29,2.8) 0.848
Primary 0.86 (0.3,2.51) 2.92 (0.75,11.43) 0.124
Hepatitis E Age Groups: Ref = (0–18 years)
19–40 N/A 0.33 (0.1,1.12) 0.075
41–79 N/A 0.06 (0.02,0.21) <0.001
https://doi.org/10.1371/journal.pone.0203699.t006
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 9 / 14
Viral hepatitis in Ghana
Discussion
Viral hepatitis is a serious public health problem that continues to affect a majority of individu-
als living in sub-Saharan Africa. Epidemiological studies in diverse countries have reported
approximately 5–10% of adult populations as having chronic liver disease as a result of hepati-
tis viruses. Although there are some reports on the epidemiology of hepatitis viruses in Ghana
and other West African countries, most have focussed on blood donor populations and very
few have described the distribution of these viruses among patients presenting with clinical
jaundice. Knowledge of viruses in jaundiced patients gives a good estimate of the morbidity
and mortality associated with exposure to hepatitis viruses.
The present study identified approximately 70% of all jaundiced patients as having at least
one type of hepatitis virus infections with the predominant being HBV (54.2%). Varied pro-
portions of jaundiced patients having hepatitis viruses has been reported in literature[25, 26].
Percentages ranging from 29% [25] up 49% [26] has been reported depending on the type of
virus. Our results is not different from a related study conducted in Uganda among patients
with acute jaundice syndrome[26]. The reported prevalence in our study is however higher
compared to the estimates reported in the general population. A general HBV prevalence of
12.3% has been documented by Ofori-Asenso and Agyeman in a systematic review recently
conducted in Ghana [5]. The pooled prevalence was however extracted from studies mostly
conducted among healthy populations. Our results present a credible estimate of the burden of
HBV associated jaundice in a tertiary hospital and may indeed reflect the population of people
living with hepatitis related infections in Ghana. This finding highlights the need for a more
aggressive implementation of national policies targeted at reducing the transmission routes of
HBV infection. Interventions including childhood and adult vaccination, accurate screening
of donated blood, condom use and avoiding multiple sexual partners could all help reduce the
burden of HBV in Ghana. Our results also show that most cases of HBV (32.1%) were identi-
fied in HCC patients. High incidence of HCC has been reported in the West African sub-
region with incidence ranging from 30-50/100,000 population [27]. A review of autopsy rec-
ords in Ghana showed that liver cancer is the highest cause of mortality among males and the
fourth cause of mortality among females [28]. This calls for a more proactive approach in deal-
ing with hepatitis B challenges in Ghana.
Similar to HBV, HCV was the next most important blood borne virus identified in our
study cohort with a sero-prevalence of 11.6%. Our estimate is higher than the 5.6% reported in
a systematic review conducted in Ghana [29]. The difference was because most reviews and
reported estimates were from healthy individuals in the population as compared to our study
which was conducted among jaundiced patients. Both HBV and HCC have a common route
of transmission hence similar recommendations made about HBV virus exposures will need
to be applied to HCV as well. Well-structured national policies are needed to address the high
occurrence of these viruses in Ghana.
Our study also investigated the occurrence of two oro-faecal transmitted viruses often
associated with jaundice and liver related conditions. Few reports exist on the involvement
of oro-faecal transmission route viruses such as hepatitis E in the aetiology of clinical jaun-
dice. Hepatitis E was the most common oro-faecal transmitted virus identified among our
study patients with IgG prevalence of 32.9% and IgM prevalence of 1.9%. The detection of
acute cases of HEV (IgM positive) and a high prevalence of IgG together indicate the pres-
ence and possible circulation of the virus in the Ghanaian population. Our estimate falls
within the prevalence range of 5.8%–71.5% previously reported by Ofori-Asenso et al. [30].
Although most cases of HEV infections are thought to be self-limiting, severe cases could
also occur [13, 31]. Nine (9) of the 51 HEV cases occurred as HBV co-infections in patients
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 10 / 14
Viral hepatitis in Ghana
with hepatocellular carcinomas which suggests a higher risk for HEV infection among indi-
viduals with hepatitis B.
One of the 5 patients who died was positive for anti-hepatitis E IgM antibodies. Attempt to
isolate the virus RNA and characterise the strain proved futile. Similar observations have been
reported where HBV superinfection with hepatitis E infections could lead to clinical progres-
sion of liver disease [31]. A plausible explanation is that the patients infected with HBV may
show an altered immune response and thus become more susceptible to secondary infection
with HEV. The high prevalence of HEV could either be due to the poor hygienic conditions
which may facilitate oro-faecal transmission of the virus or having close contact with livestock
(especially swine) known to carry the virus. Eating of under-cooked meat from pigs could also
serve a route of virus transmission since pigs are probable reservoirs of the virus. Close contact
with swine has been associated with 9.1 odds of exposure to HEV [32]. Our study did not how-
ever identify any association between hepatitis E exposure and rearing livestock or consuming
pork. However, we found a significantly positive correlation with Christian versus Muslim reli-
gion, which provides a hint toward a possible association with pork consumption.
We also identified 2 cases of HAV among our study patients. The two cases were identified
in children less than 10 years; both having chronic liver disease with one occurring as a co-
infection with HBV and the other as a single infection. As established with HEV, HAV is also
self-limiting with less potential to cause liver damage. Minor cases could however be associated
with severe ailments as shown in our present study. Ghana and most developing countries are
either not implementing national policies on management and treatment options for HAV
infections widely enough or these policies are non-existent. Like hepatitis E, the virus is trans-
mitted through poor hygienic practices and dependence on contaminated water. The identifi-
cation of these viruses in children with chronic liver disease emphasizes the need for more
surveillance and advocacy for interventions that will reduce the burden of the disease.
The present study observed employment and older age as important factors associated with
hepatitis B and E infection. A cross-tabulation of age by employment showed that most unem-
ployed subjects were actually young students and children whereas those employed were older
subjects and hence mostly working. It was therefore not surprising to find low occurrence of
hepatitis B among younger or unemployed compared to older or employed subjects because
most of them had been part of Ghana’s expanded programme on immunisation which sought
to vaccinate newborns against hepatitis B. Similar observations has been reported elsewhere
[33, 34].
Our study comes with some limitations including ruling out other possible viral agents (yel-
low fever virus and other viral haemorrhagic fever viruses) that may contribute to liver inflam-
mation with the subsequent development of jaundice Additionally, lack of antibody testing for
HAV and the small sample size could underestimate our results. However, these limitations do
not invalidate our findings but emphasize the need for larger studies to fully describe the epi-
demiology of these viruses in Ghana and other developing countries.
Conclusion
Our study has brought to fore the importance of hepatitis viruses causing various forms of
hepatitis related conditions among jaundiced patients. Most importantly we have shown
that hepatitis E is quite prevalent among jaundiced patients and could occur often as co-infec-
tions with other hepatitis viruses. With the increase in urbanisation which goes with poor sani-
tation and certain lifestyle that fuel sexual transmission, there is a need for a more aggressive
approach to be adopted in order to reduce the morbidity and mortality associated with hepati-
tis causing viruses in Ghana and other developing countries.
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 11 / 14
Viral hepatitis in Ghana
Supporting information
S1 Table. STROBE statement.
(DOC)
Acknowledgments
We thank all study subjects, parents of children and staffs of the hospitals involved in the
study.
Author Contributions
Conceptualization: Michael Owusu, Ellis Owusu-Dabo, Christian Drosten, Yaw Adu-
Sarkodie.
Data curation: Michael Owusu, Joseph Kofi Bonney, Augustina Angelina Annan, Gifty
Mawuli, Kennedy Okyere, Mohamed Mutocheluh, Juliana Aryeequaye, Nicholas Kwabena
Adjei, Mary Afihene, Kathryn Spangenberg, Justice Sylverken.
Formal analysis: Michael Owusu.
Investigation: Michael Owusu, Joseph Kofi Bonney, Augustina Angelina Annan, Gifty
Mawuli, Kennedy Okyere, Mohamed Mutocheluh, Juliana Aryeequaye, Mary Afihene,
Kathryn Spangenberg, Justice Sylverken.
Methodology: Michael Owusu, Joseph Kofi Bonney, Augustina Angelina Annan, Kennedy
Okyere, Mohamed Mutocheluh, Nicholas Kwabena Adjei, Mary Afihene, Kathryn Span-
genberg, Justice Sylverken, Ellis Owusu-Dabo, Christian Drosten.
Resources: Kennedy Okyere.
Supervision: Christian Drosten, Yaw Adu-Sarkodie.
Validation: Nicholas Kwabena Adjei, Ellis Owusu-Dabo, Christian Drosten, Yaw Adu-
Sarkodie.
Writing – original draft: Joseph Kofi Bonney, Augustina Angelina Annan, Ellis Owusu-Dabo,
Christian Drosten, Yaw Adu-Sarkodie.
Writing – review & editing: Ellis Owusu-Dabo, Christian Drosten, Yaw Adu-Sarkodie.
References
1. Goldstein ST, Zhou F, Hadler SC, Bell BP, Mast EE, Margolis HS. A mathematical model to estimate
global hepatitis B disease burden and vaccination impact. Int J Epidemiol. 2005; 34(6):1329–39. Epub
2005/10/27. https://doi.org/10.1093/ije/dyi206 PMID: 16249217.
2. Organization. WH. Hepatitis B 2015 [01/10/2015]. http://www.who.int/mediacentre/factsheets/fs204/en/
(2015).
3. Messina JP, Humphreys I, Flaxman A, Brown A, Cooke GS, Pybus OG, et al. Global distribution and
prevalence of hepatitis C virus genotypes. Hepatology. 2015; 61(1):77–87. Epub 2014/07/30. https://
doi.org/10.1002/hep.27259 PMID: 25069599.
4. Rao VB, Johari N, Cros P, Messina J, Ford N, Cooke GS. Hepatitis C seroprevalence and HIV co-infec-
tion in sub-Saharan Africa: a systematic review and meta-analysis. The Lancet Infectious diseases.
2015; 15. https://doi.org/10.1016/s1473-3099(15)00006-7
5. Ofori-Asenso R, Agyeman AA. Hepatitis B in Ghana: a systematic review & meta-analysis of prevalence
studies (1995–2015). BMC infectious diseases. 2016; 16:130. https://doi.org/10.1186/s12879-016-
1467-5 PMID: 26987556
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 12 / 14
Viral hepatitis in Ghana
6. Di Bisceglie AM, Order SE, Klein JL, Waggoner JG, Sjogren MH, Kuo G, et al. The role of chronic viral
hepatitis in hepatocellular carcinoma in the United States. Am J Gastroenterol. 1991; 86(3):335–8.
Epub 1991/03/01. PMID: 1847790.
7. Kew MC. Epidemiology of chronic hepatitis B virus infection, hepatocellular carcinoma, and hepatitis B
virus-induced hepatocellular carcinoma. Pathologie-biologie. 2010; 58(4):273–7. Epub 2010/04/10.
https://doi.org/10.1016/j.patbio.2010.01.005 PMID: 20378277.
8. Skidmore S. Overview of Hepatitis E Virus. Current infectious disease reports. 2002; 4(2):118–23.
Epub 2002/04/03. PMID: 11927042.
9. Tsega E, Krawczynski K, Hansson BG, Nordenfelt E. Hepatitis E virus infection in pregnancy in Ethio-
pia. Ethiopian medical journal. 1993; 31(3):173–81. Epub 1993/07/01. PMID: 8404882.
10. Adjei AA, Tettey Y, Aviyase JT, Adu-Gyamfi C, Obed S, Mingle JAA, et al. Hepatitis E virus infection is
highly prevalent among pregnant women in Accra, Ghana. Virology journal. 2009; 6:108-. https://doi.
org/10.1186/1743-422X-6-108 PMID: 19619291
11. Ahmed JA, Moturi E, Spiegel P, Schilperoord M, Burton W, Kassim NH, et al. Hepatitis E outbreak,
Dadaab refugee camp, Kenya, 2012. Emerging infectious diseases. 2013; 19(6):1010–2. Epub 2013/
06/06. https://doi.org/10.3201/eid1906.130275 PMID: 23735820.
12. Franco E, Meleleo C, Serino L, Sorbara D, Zaratti L. Hepatitis A: Epidemiology and prevention in devel-
oping countries. World Journal of Hepatology. 2012; 4(3):68–73. https://doi.org/10.4254/wjh.v4.i3.68
PMID: 22489258
13. Bonney JHK, Kwame-Aryee RA, Obed S, Tamatey AA, Barnor JS, Armah NB, et al. Fatal hepatitis E
viral infection in pregnant women in Ghana: a case series. BMC research notes. 2012; 5:478-. https://
doi.org/10.1186/1756-0500-5-478 PMID: 22937872
14. WHO. The Global Prevalence of Hepatitis A Virus Infection and Susceptibility: A Systematic Review.
Worl Health Organisation. 2010.
15. Rein DB, Stevens GA, Theaker J, Wittenborn JS, Wiersma ST. The global burden of hepatitis E virus
genotypes 1 and 2 in 2005. Hepatology. 2012; 55(4):988–97. Epub 2011/11/29. https://doi.org/10.1002/
hep.25505 PMID: 22121109.
16. Bile K, Isse A, Mohamud O, Allebeck P, Nilsson L, Norder H, et al. Contrasting roles of rivers and
wells as sources of drinking water on attack and fatality rates in a hepatitis E epidemic in Somalia.
The American journal of tropical medicine and hygiene. 1994; 51(4):466–74. Epub 1994/10/01. PMID:
7943574.
17. Komfo Anokye Teaching Hospital. Annual Health Report. Komfo Anokye Teaching Hospital, 2015.
18. Hospital KAT. Annual Health Report of the Komfo Anokye Teaching Hospital. Kumasi, Ghana: Komfo
Anokye Teaching Hospital, 2015.
19. Ochwoto M, Kimotho JH, Oyugi J, Okoth F, Kioko H, Mining S, et al. Hepatitis B infection is highly preva-
lent among patients presenting with jaundice in Kenya. BMC infectious diseases. 2016; 16(1):101.
Epub 2016/03/05. https://doi.org/10.1186/s12879-016-1409-2 PMID: 26932656.
20. ABON Biopharm Co. L. ABON China2015 [cited 2015]. http://www.abon.com.cn.
21. Desbois D, Couturier E, Mackiewicz V, Graube A, Letort M-J, Dussaix E, et al. Epidemiology and
Genetic Characterization of Hepatitis A Virus Genotype IIA. Journal of clinical microbiology. 2010; 48
(9):3306–15. https://doi.org/10.1128/JCM.00667-10 PMID: 20592136
22. Drosten C, Weber M, Seifried E, Roth WK. Evaluation of a new PCR assay with competitive internal
control sequence for blood donor screening. Transfusion. 2000; 40(6):718–24. Epub 2000/06/24.
PMID: 10864995.
23. Sandres-Saune K, Deny P, Pasquier C, Thibaut V, Duverlie G, Izopet J. Determining hepatitis C geno-
type by analyzing the sequence of the NS5b region. Journal of virological methods. 2003; 109(2):187–
93. Epub 2003/04/25. PMID: 12711062.
24. Jothikumar N, Cromeans TL, Robertson BH, Meng XJ, Hill VR. A broadly reactive one-step real-time
RT-PCR assay for rapid and sensitive detection of hepatitis E virus. Journal of virological methods.
2006; 131(1):65–71. Epub 2005/08/30. https://doi.org/10.1016/j.jviromet.2005.07.004 PMID:
16125257.
25. Xu B, Yu H-B, Hui W, He J-L, Wei L-L, Wang Z, et al. Clinical features and risk factors of acute hepatitis
E with severe jaundice. World Journal of Gastroenterology: WJG. 2012; 18(48):7279–84. https://doi.
org/10.3748/wjg.v18.i48.7279 PMID: 23326133
26. Gerbi GB, Williams R, Bakamutumaho B, Liu S, Downing R, Drobeniuc J, et al. Hepatitis E as a Cause
of Acute Jaundice Syndrome in Northern Uganda, 2010–2012. The American journal of tropical medi-
cine and hygiene. 2015; 92(2):411–4. https://doi.org/10.4269/ajtmh.14-0196 PMID: 25448237
27. Nordenstedt H, White DL, El-Serag HB. The changing pattern of epidemiology in hepatocellular carci-
noma. Digestive and liver disease: official journal of the Italian Society of Gastroenterology and the
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 13 / 14
Viral hepatitis in Ghana
Italian Association for the Study of the Liver. 2010; 42 Suppl 3:S206–14. Epub 2010/06/25. https://doi.
org/10.1016/s1590-8658(10)60507-5 PMID: 20547305.
28. Wiredu EK, Armah HB. Cancer mortality patterns in Ghana: a 10-year review of autopsies and hospital
mortality. BMC public health. 2006; 6:159-. https://doi.org/10.1186/1471-2458-6-159 PMID: 16787544
29. Agyeman AA, Ofori-Asenso R, Mprah A, Ashiagbor G. Epidemiology of hepatitis C virus in Ghana: a
systematic review and meta-analysis. BMC infectious diseases. 2016; 16(1):391. https://doi.org/10.
1186/s12879-016-1708-7 PMID: 27507267
30. Ofori-Asenso R, Agyeman AA. Hepatitis E infection among Ghanaians: a systematic review. Infectious
Diseases of Poverty. 2017; 6:29. https://doi.org/10.1186/s40249-017-0239-9 PMID: 28162095
31. Hoan NX, Tong HV, Hecht N, Sy BT, Marcinek P, Meyer CG, et al. Hepatitis E Virus Superinfection and
Clinical Progression in Hepatitis B Patients. EBioMedicine. 2015; 2(12):2080–6. https://doi.org/10.
1016/j.ebiom.2015.11.020 PMID: 26844288
32. Adjei AA, Aviyase JT, Tettey Y, Adu-Gyamfi C, Mingle JA, Ayeh-Kumi PF, et al. Hepatitis E virus infec-
tion among pig handlers in Accra, Ghana. East African medical journal. 2009; 86(8):359–63. Epub
2010/06/26. PMID: 20575309.
33. Li X, Zheng Y, Liau A, Cai B, Ye D, Huang F, et al. Hepatitis B virus infections and risk factors among
the general population in Anhui Province, China: an epidemiological study. BMC public health. 2012;
12:272-. https://doi.org/10.1186/1471-2458-12-272 PMID: 22475135
34. Yang S, Yu C, Chen P, Deng M, Cao Q, Li Y, et al. Protective immune barrier against hepatitis B is
needed in individuals born before infant HBV vaccination program in China. Scientific Reports. 2015;
5:18334. https://doi.org/10.1038/srep18334 PMID: 26655735
PLOS ONE | https://doi.org/10.1371/journal.pone.0203699 September 12, 2018 14 / 14