University of Ghana http://ugspace.ug.edu.gh SCHOOL OF PUBLIC HEALTH COLLEGE OF HEALTH SCIENCES UNIVERSITY OF GHANA, LEGON INFLUENCE OF TEMPERATURE ON THE GROWTH, DEVELOPMENT AND SUSCEPTIBILITY OF ANOPHELES GAMBIAE (S.L.) MOSQUITOES TO PYRETHROIDS BY THOMAS PEPRAH AGYEKUM (10637332) THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON, IN PARTIAL FULFILMENT OF THE REQUIREMENT FOR THE AWARD OF DOCTOR OF PHILOSOPHY DEGREE IN PUBLIC HEALTH FEBRUARY, 2023 i University of Ghana http://ugspace.ug.edu.gh DECLARATION I, Thomas Peprah Agyekum, declare that, except for references to other people's work, which have been duly acknowledged, this thesis, submitted to the School of Public Health, University of Ghana, is the result of my original research, and that the thesis has not been presented for any degree elsewhere. This thesis write-up was done under the joint supervision of Professor Julius Fobil, Dr. John Arko-Mensah, Professor Jonathan Hogarh and Dr. Paul Kingsley Botwe. 24/02/2023 THOMAS PEPRAH AGYEKUM …………………. ………………… STUDENT (10637332) SIGNATURE DATE 24/02/2023 PROF. JULIUS FOBIL …………….…… ………………… (PRINCIPAL SUPERVISOR) SIGNATURE DATE 24/02/2023 DR. JOHN ARKO-MENSAH …………………. .……………….. (CO-SUPERVISOR) SIGNATURE DATE 24/02/2023 PROF. JONATHAN HOGARH …………………… ………………… (CO-SUPERVISOR) SIGNATURE DATE 24/02/2023 DR. PAUL KINGSLEY BOTWE …………………. ………………… (CO-SUPERVISOR) SIGNATURE DATE i University of Ghana http://ugspace.ug.edu.gh DEDICATION This work is dedicated to God Almighty for His guidance and protection through this academic journey. I also dedicate this work to my parents, Mr. Samuel Agyei Agyekum and Madam Comfort Boakyewaa, and my siblings for all the support. To my lovely wife, Abigail and our son, Nana Yaw, I appreciate all the sacrifices and understanding. ii University of Ghana http://ugspace.ug.edu.gh ACKNOWLEDGEMENT I am most grateful to the Almighty God for giving me life, strength and enablement to complete this research. I would like to express my sincere thanks to my supervisors, Prof. Julius Fobil, Dr. John Arko-Mensah, Prof. Jonathan Hogarh and Dr. Paul K. Botwe, for guiding and directing me throughout my entire program. I am grateful to Prof. Thomas Robins for his support while I was at the University of Michigan during my experiential learning. I also acknowledge the support and help I received from all the GEOHealth Project mentors and team members. I am deeply thankful for your support. I appreciate Professors Kwasi Obiri-Danso (Former Vice Chancellor, KNUST), Philip Antwi- Agyei and Bernard Fei-Baffoe (Department of Environmental Science, KNUST), Dr. Duah Dwomoh (University of Ghana), and Prof. Sam Newton (School of Public Health, KNUST) for their encouragement and support. I am most grateful to my wife and son for their love, support and understanding. My profound gratitude goes to my parents (Mr. Samuel Agyei Agyekum and Madam Comfort Akua Boakyewaah), siblings (Georgina, Beatrice, Peter and Lydia) and in-laws for their prayers and support. A special mention to the late Prof Evans Afriyie-Gyawu for all the support and advice. I am grateful to Dr. Maxwell K. Billah and Mrs. Racheal Nkrumah (both at Department of Animal Biology and Conservation Science, University of Ghana), Dr. Samuel K. Dadzie and Dr. Kwadwo Frimpong (both at Department of Parasitology, Noguchi Memorial Institute for Medical Research (NMIMR), University of Ghana), Mr. Issah Ibrahim, Mr. Julius Adde, Staff of Vestergaard Vector Lab, NMIMR, Mr. Ahokpossi Eudon-Marcus, and Mr. Sylvester Coleman for their great help in carrying out this research work. Finally, my enormous thanks go to Mr. Kwadwo Owusu Akomea, Mrs. Comfort Awuah, Rev. and Mrs. Arkhurst (Central Presbytery Chairperson, PCG), Jessica Afi Anyonam Ahiakpah, iii University of Ghana http://ugspace.ug.edu.gh Jane Oppong, Emmanuel Agyare Sackey, Derrick Owusu-Ansah, Raymond Opatah and all those who in one way or the other contributed to the successful completion of this thesis. I appreciate your efforts, support, and motivation. God richly bless you all. ACKNOWLEDGEMENT OF FUNDING This study was financed by the ½ West Africa-Michigan CHARTER in GEOHealth with funding from the United States National Institutes of Health/Fogarty International Center (US NIH/FIC) (paired grant No 1U2RTW010110-01/5U01TW010101) and Canada's International Development Research Center (IDRC) (grant No. 108121-001). iv University of Ghana http://ugspace.ug.edu.gh TABLE OF CONTENT CONTENTS PAGE DECLARATION......................................................................... .............................................i DEDICATION.......................................................................................................................... ii ACKNOWLEDGEMENT ..................................................................................................... iii TABLE OF CONTENT ........................................................................................................... v LIST OF TABLES ................................................................................................................ xiv LIST OF FIGURES .............................................................................................................. xvi LIST OF ABBREVIATIONS ........................................................................................... xviii OPERATIONAL DEFINITION OF TERMS ................................................................... xxii ABSTRACT ......................................................................................................................... xxiv PREFACE ......................................................................................................................... xxviii CHAPTER ONE ...................................................................................................................... 1 INTRODUCTION.................................................................................................................... 1 1.1 Background ...................................................................................................................... 1 1.2 Problem Statement ........................................................................................................... 3 1.3 Conceptual Framework .................................................................................................... 5 1.4 Justification ...................................................................................................................... 7 1.5 General Objective ............................................................................................................. 7 1.5.1 Specific Objectives .................................................................................................... 7 1.6 Research Questions .......................................................................................................... 8 1.7 Research Hypotheses........................................................................................................ 8 v University of Ghana http://ugspace.ug.edu.gh CHAPTER TWO ..................................................................................................................... 9 LITERATURE REVIEW ....................................................................................................... 9 2.1 Introduction ...................................................................................................................... 9 2.2 Biology of mosquitoes ..................................................................................................... 9 2.3 Life cycle of mosquitoes ................................................................................................ 11 2.3.1 Egg stage.................................................................................................................. 12 2.3.2 Larval stage .............................................................................................................. 13 2.3.3 Pupal stage ............................................................................................................... 14 2.3.4 Adult stage ............................................................................................................... 14 2.4 Common genera of mosquitoes ...................................................................................... 16 2.4.1 Anopheles mosquitoes ............................................................................................. 16 2.4.2 Aedes mosquitoes .................................................................................................... 19 2.4.3 Culex mosquitoes ..................................................................................................... 20 2.5 Anopheles and malaria transmission .............................................................................. 22 2.6 Control of mosquitoes .................................................................................................... 24 2.6.1 Use of mosquito bed nets......................................................................................... 24 2.6.2 Indoor Residual Spraying (IRS) .............................................................................. 25 2.6.3 Larval source management (LSM) .......................................................................... 26 2.7 Targets of stages of mosquito with insecticides ............................................................. 27 2.7.1 Larviciding............................................................................................................... 27 2.7.2 Adulticiding ............................................................................................................. 27 vi University of Ghana http://ugspace.ug.edu.gh 2.8 Class of insecticides and their targets ............................................................................ 28 2.8.1 Carbamate insecticides ............................................................................................ 29 2.8.2 Organochlorine (OC) insecticides ........................................................................... 29 2.8.3 Organophosphorus (OP) insecticides ...................................................................... 30 2.8.4 Pyrethroid insecticides ............................................................................................. 30 2.9 Mechanisms used by mosquitoes to develop an insecticide resistance phenotype ........ 31 2.9.1 Target site resistance ............................................................................................... 33 2.9.2 Cuticular resistance .................................................................................................. 34 2.9.3 Behavioral resistance ............................................................................................... 34 2.9.4 Metabolic resistance ................................................................................................ 35 2.10 Predominant insecticides in Ghana .............................................................................. 39 2.11 Effect of climate change and climate variability on insect vectors .............................. 40 2.12 Summary of reviewed literature on temperature, Anopheles mosquito growth, development and survival..................................................................................................... 42 2.12.1 Introduction ........................................................................................................... 42 2.12.2 Methods ................................................................................................................. 43 2.12.3 Synthesis of evidence and gaps in current literature on temperature, growth, development, and survival of Anopheles mosquito .......................................................... 45 2.12.4 Discussion .............................................................................................................. 61 2.12.5 Conclusion ............................................................................................................. 70 CHAPTER THREE ............................................................................................................... 73 METHODOLOGY ................................................................................................................ 73 vii University of Ghana http://ugspace.ug.edu.gh 3.1 Introduction .................................................................................................................... 73 3.2 Study design, temperature selection and maintenance ................................................... 73 3.3 Maintenance of Anopheles gambiae (s.l.) mosquito colony .......................................... 74 3.4 Molecular identification of An. gambiae (s.l.) mosquitoes (Tiassalé strain) ................. 76 3.4.1 DNA extraction from adult mosquitoes ................................................................... 76 3.4.2 Identification of Anopheles gambiae (s.l.) members by polymerase chain reaction (PCR) ................................................................................................................................ 76 3.5 Temperature, growth and development of immature An. gambiae (s.l.) mosquitoes .... 78 3.5.1 Developmental time of immature mosquitoes, larval survival, and mortality ........ 78 3.5.2 Time to pupation, pupation success, and mortality ................................................. 79 3.5.3 Larval and pupal weight and size ............................................................................ 80 3.5.4 The number of adults produced (production capacity) and sex ratio ...................... 81 3.6 Temperature and the growth and development of adult An. gambiae (s.l.) mosquitoes 81 3.6.1 Adult longevity ........................................................................................................ 81 3.6.2 Estimation of length of gonotrophic cycle, biting rate and fecundity ..................... 82 3.6.3 Body weight, size, and proboscis length ................................................................. 83 3.7 Insecticide susceptibility and metabolic enzyme level .................................................. 84 3.7.1 Insecticide susceptibility .......................................................................................... 84 3.7.2 Methods for measuring mosquito metabolic enzyme level ..................................... 85 3.8 Quality Control ............................................................................................................... 87 3.9 Statistical Analysis ......................................................................................................... 89 viii University of Ghana http://ugspace.ug.edu.gh 3.9.1 Temperature and the growth and development of immature An. gambiae (s.l.) mosquitoes ........................................................................................................................ 89 3.9.2 Temperature and the growth and development of adult An. gambiae (s.l.) mosquitoes .......................................................................................................................................... 90 3.9.3 Insecticide susceptibility and expression of metabolic enzyme levels .................... 91 3.10 Ethical Approval .......................................................................................................... 92 CHAPTER FOUR .................................................................................................................. 93 RESULTS ............................................................................................................................... 93 4.1 Introduction .................................................................................................................... 93 4.2 Composition of An. gambiae (s.l.) (Tiassalé strain) mosquitoes ................................... 93 4.3 Effects of temperature on the growth and development of immature An. gambiae (s.l.) mosquitoes ............................................................................................................................ 94 4.3.1 Developmental time of the immature stages ........................................................... 94 4.3.2 Determination of larval mortality and survival under different temperature regimes .......................................................................................................................................... 95 4.3.3 Measurement of time to pupation, pupation success, and mortality ....................... 96 4.3.4 Measurement of larval and pupal weight and size .................................................. 98 4.3.5 Temperature, number of adults produced, and sex ratio of An. gambiae (s.l.) mosquitoes ...................................................................................................................... 101 4.4 Effects of temperature and the growth and development of adult An. gambiae (s.l.) mosquitoes .......................................................................................................................... 102 4.4.1 Adult longevity ...................................................................................................... 102 ix University of Ghana http://ugspace.ug.edu.gh 4.4.2 Length of the gonotrophic cycle, biting rate and fecundity of An. gambiae (s.l.) mosquitoes ...................................................................................................................... 106 4.4.3 Measurement of body weight, size, and proboscis length of adult mosquitoes .... 107 4.5 Insecticide susceptibility and expression of metabolic enzyme levels ........................ 110 4.5.1 Mortality of An. gambiae (s.l.) mosquitoes after exposure to pyrethroid insecticides ........................................................................................................................................ 110 4.5.2 Knockdown resistance ratio (KRR) ....................................................................... 111 4.5.3 Influence of temperature and insecticide on the expression of metabolic enzyme113 CHAPTER FIVE ................................................................................................................. 119 DISCUSSION ....................................................................................................................... 119 5.1 Introduction .................................................................................................................. 119 5.2 Effects of temperature on the growth and development of immature An. gambiae (s.l.) mosquitoes .......................................................................................................................... 119 5.2.1 Hatching and development time of mosquitoes decreased with increasing temperature ..................................................................................................................... 119 5.2.2 Survival time of An. gambiae (s.l.) larvae decreased with increasing temperature ........................................................................................................................................ 120 5.2.3 Pupation success of mosquitoes decreased with increasing temperature .............. 121 5.2.4 Larval and pupal size decreased with increasing temperature .............................. 122 5.2.5 Number of adult mosquitoes produced decreased with increasing temperature ... 122 5.3 Effect of temperature on the growth and development of adult An. gambiae (s.l.) mosquitoes .......................................................................................................................... 123 x University of Ghana http://ugspace.ug.edu.gh 5.3.1 Longevity of mosquitoes decreased with increasing temperature ......................... 123 5.3.2 Gonotrophic cycle length and biting rate of mosquitoes were unaffected by increasing temperature .................................................................................................... 124 5.3.3 Fecundity of mosquitoes decreased with increasing temperature ......................... 125 5.3.4 Body size and proboscis length of mosquitoes decreased with increasing temperature ........................................................................................................................................ 126 5.4 Effects of temperature on insecticide susceptibility and metabolic enzyme expression ............................................................................................................................................ 126 5.4.1 Susceptibility of mosquitoes to pyrethroids decreased with increasing temperature ........................................................................................................................................ 126 5.4.2 Expression of metabolic enzymes in mosquitoes increased with increasing temperature ..................................................................................................................... 127 CHAPTER SIX .................................................................................................................... 129 CONCLUSION AND RECOMMENDATIONS ............................................................... 129 6.1 Conclusion .................................................................................................................... 129 6.2 Recommendations ........................................................................................................ 130 6.3 Strength and limitations ............................................................................................... 131 6.3.1 Strength .................................................................................................................. 131 6.3.2 Limitations ............................................................................................................. 131 6.4 Future research direction .............................................................................................. 131 6.5 Contribution to knowledge ........................................................................................... 132 REFERENCES ..................................................................................................................... 133 xi University of Ghana http://ugspace.ug.edu.gh APPENDICES ...................................................................................................................... 193 Appendix I: Search terms and search results from databases ............................................ 193 Appendix II: List of studies excluded with reasons ........................................................... 194 Appendix III: Risk of bias in included studies using the SYRCLE tool ............................ 195 Appendix IV: Ambient and rearing water conditions for each temperature regime .......... 197 Appendix V: Gel photographs of the PCR performed ....................................................... 198 Appendix VI: Ethical approval for the study ..................................................................... 200 Appendix VII: Pairwise comparisons of the development of the immature stages of An. gambiae (s.l.) mosquitoes................................................................................................... 201 Appendix VIII: Two-group comparisons and the overall trend of the effect of temperature on An. gambiae (s.l.) larval survival .................................................................................. 202 Appendix IX: Two-group comparisons and an overall trend of the effect of temperature on adult An. gambiae (s.l.) longevity ...................................................................................... 202 Appendix X: Comparison by sex across temperature and an overall trend of the effect of sex on adult An. gambiae (s.l.) longevity ................................................................................. 203 Appendix XI: Pairwise comparisons of gonotrophic cycle length, biting rate and fecundity ............................................................................................................................................ 203 Appendix XII: Mortality of An. gambiae (s.l.) mosquitoes exposed to pyrethroids .......... 204 Appendix XIII: Median levels of metabolic enzyme levels in An. gambiae (s.l.) mosquitoes reared at different temperature regimes ............................................................................. 205 Appendix XIV: Pairwise comparisons of enzyme levels in An. gambiae (s.l.) mosquitoes reared at different temperature regimes ............................................................................. 206 xii University of Ghana http://ugspace.ug.edu.gh Appendix XV: Mann-Whitney U Test between mosquitoes that were not exposed and those exposed to pyrethroids ....................................................................................................... 207 Appendix XVI: Measurements of An. gambiae (s.l.) mosquito body parts using Leica application Software ........................................................................................................... 208 Appendix XVII: Abstracts of publication related to this study .......................................... 209 xiii University of Ghana http://ugspace.ug.edu.gh LIST OF TABLES Table 1: Characteristics of included studies ............................................................................ 48 Table 2: Effects of temperature on immature stages of Anopheles mosquitoes ...................... 52 Table 3: Effects of temperature on the longevity of Anopheles mosquitoes ........................... 55 Table 4: Effects of temperature on the body size of Anopheles mosquitoes ........................... 56 Table 5: Effects of temperature on fecundity, length of the gonotrophic cycle, and biting rate of Anopheles mosquitoes ......................................................................................................... 58 Table 6: Effects of temperature on insecticide susceptibility, expression of enzymes and immune responses in Anopheles mosquitoes ........................................................................... 60 Table 7: List of primers used for molecular identification of Anopheles mosquitoes ............. 78 Table 8: Number of An. gambiae (s.l.) mosquitoes from each rearing temperature regime used for biochemical analysis of metabolic enzyme level ............................................................... 87 Table 9: Composition of An. gambiae (s.l.) mosquitoes ......................................................... 93 Table 10: Relationship between rearing temperature and development time of immature An. gambiae (s.l.) mosquitoes ........................................................................................................ 94 Table 11: Median survival times of An. gambiae (s.l.) larvae reared at different temperatures .................................................................................................................................................. 95 Table 12: Time to pupation, pupation success, and pupal mortality of An. gambiae (s.l.) mosquitoes reared at different temperature regimes ................................................................ 98 Table 13: An. gambiae (s.l.) larval and pupal weight and size at different temperature regimes .................................................................................................................................................. 99 Table 14: Relationship between temperature and An. gambiae (s.l.) larval and pupal measurements ......................................................................................................................... 100 Table 15: Number of adults produced, and sex ratios of An. gambiae (s.l.) mosquitoes reared at different temperature regimes ............................................................................................ 102 xiv University of Ghana http://ugspace.ug.edu.gh Table 16: Median longevity of adult An. gambiae (s.l.) mosquitoes reared at different temperatures ........................................................................................................................... 103 Table 17: Mean gonotrophic cycle length, biting rate, and fecundity of An. gambiae (s.l.) mosquitoes reared at different temperature regimes .............................................................. 107 Table 18: An. gambiae (s.l.) mosquito weight, size and proboscis length at different temperature regimes ................................................................................................................................... 108 Table 19: Relationship between temperature and adult An. gambiae (s.l.) mosquito weight, body size and proboscis length .............................................................................................. 109 Table 20: Knockdown resistance ratio of An. gambiae (s.l.) mosquitoes (Tiassalé strain) at different rearing temperature regimes .................................................................................... 112 xv University of Ghana http://ugspace.ug.edu.gh LIST OF FIGURES Figure 1: Conceptual framework showing the relationship between temperature and growth, development and susceptibility of mosquitoes to insecticides .................................................. 6 Figure 2: Life cycle of a mosquito ........................................................................................... 16 Figure 3: Adult Anopheles mosquito ....................................................................................... 18 Figure 4: Adult Aedes mosquito .............................................................................................. 20 Figure 5: Adult Culex mosquito ............................................................................................... 21 Figure 6: Summary of mechanisms used by mosquitoes to produce a resistance phenotype.. 33 Figure 7: PRISMA flow diagram of search phases with numbers of studies included/excluded at each stage ............................................................................................................................. 47 Figure 8: Climate control incubators (RTOP-1000D, Zhejiang, China) ................................. 74 Figure 9: Assessment of the developmental stages of the immature An. gambiae (s.l.) mosquitoes ............................................................................................................................... 79 Figure 10: Measurement of larval and pupal size using Leica EZ4 HD microscope ............. 80 Figure 11: Oviposition cups for fecundity assessment ............................................................ 83 Figure 12: Insecticide susceptibility test following WHO protocols (WHO, 2016a) .............. 85 Figure 13: Kaplan-Meier survival plots of An. gambiae (s.l.) larvae reared at different temperatures ............................................................................................................................. 96 Figure 14: Longevity of adult An. gambiae (s.l.) mosquitoes reared under different temperature regimes. .................................................................................................................................. 105 Figure 15: Insecticide susceptibility of Anopheles gambiae (s.l.) (Tiassalé strain) mosquitoes reared at different temperature regimes ................................................................................. 111 Figure 16: Median MFO level in An. gambiae (s.l.) mosquitoes reared at different temperature regimes. NB: No mosquito reared at 34 oC survived after being exposed to pyrethroids, hence, no enzyme level was measured .............................................................................................. 114 xvi University of Ghana http://ugspace.ug.edu.gh Figure 17: Median GST level in An. gambiae (s.l.) mosquitoes reared at different temperature regimes. NB: No mosquito reared at 34 oC survived after being exposed to pyrethroids, hence, no enzyme level was measured .............................................................................................. 115 Figure 18: Median α-esterase level in An. gambiae (s.l.) mosquitoes reared at different temperature regimes. NB: No mosquito reared at 34 oC survived after being exposed to pyrethroids, hence, no enzyme level was measured .............................................................. 117 Figure 19: Median β-esterase level in An. gambiae (s.l.) mosquitoes reared at different temperature regimes. NB: No mosquito reared at 34 oC survived after being exposed to pyrethroids, hence, no enzyme level was measured .............................................................. 118 xvii University of Ghana http://ugspace.ug.edu.gh LIST OF ABBREVIATIONS AAEP American Association of Equine Practitioners AChE Acetylcholinesterase ANOVA One-way analysis of variance ARPPIS African Regional Postgraduate Program in Insect Science CDC Centre for Disease Prevention and Control CDNB 1-chloro-2,4-dinitrobenzene CE Carboxylesterases CEC1 Cecropin CI Confidence interval CO2 Carbon Dioxide CTAB Cetyl Trimethyl Ammonium Bromide DDT Dichloro-diphenyl-trichloroethane DEF1 Defensin DFID Department for International Development DNA Deoxyribonucleic acid DTNB Dithio-bis2-nitrobenzoic acid ECDC European Centre for Disease Prevention and Control EFSA European Food Safety Authority EIP Extrinsic Incubation Period xviii University of Ghana http://ugspace.ug.edu.gh EPA Environmental Protection Agency FAO Food and Agriculture Organization GABA Gamma-Amino Butyric Acid GSTs Glutathione-S-Transferases H2O2 Hydrogen Peroxide HD High Definition IGS Intergenic spacer IPCC Intergovernmental Panel on Climate Change IQR Interquartile Range IRAC Insecticide Resistance Action Committee IRS Indoor Residual Spraying ITNs Insecticide Treated Nets JEV Japanese Encephalitis Virus K3PO4 Potassium Phosphate KDR Knockdown Resistance KDT Knockdown time KRR Knockdown Resistance Ratio LED Light Emitting Diode LLINs Long-lasting insecticidal nets MFO Mixed-Function Oxidases xix University of Ghana http://ugspace.ug.edu.gh MGSTs microsomal Glutathione-S-Transferases NMIMR Noguchi Memorial Institute for Medical Research NOS Nitric Oxide Synthase NSE Non-Specific Esterases OC Organochlorine OD Optical Density OLS Ordinary least square OP Organophosphorus PBO Piperonyl butoxide PCR Polymerase Chain Reaction PMI President's Malaria Initiative POPs Persistent Organic Pollutants PRISMA Preferred Reporting Items for Systematic Reviews and Meta-Analyses RDL Resistance to Dieldrin rDNA ribosomal DNA RoB Risk of Bias ROS Reactive Oxygen Species SD Standard Deviation SDG Sustainable Development Goal SINV Sindbis Virus xx University of Ghana http://ugspace.ug.edu.gh SYRCLE's Systematic Review Center for Laboratory Animal Experimentation's TMBZ Tetramethylbenzidine UG-IACUC University of Ghana Institutional Animal Care and Use Committee UNDP United Nations Development Program UNFCCC United Nations Framework Convention on Climate Change UNICEF United Nations International Children's Emergency Fund UV Ultra Violet VNVL Vestergaard Noguchi Memorial Institute for Medical Research Vector Labs WHO World Health Organization WMO World Meteorological Organization WNV West Nile Virus ZIKV Zika Virus xxi University of Ghana http://ugspace.ug.edu.gh OPERATIONAL DEFINITION OF TERMS Biting rate: The daily feeding rate of a vector on a host (Paaijmans et al., 2013a). Development time: It is the time (in days) from the hatching of mosquito eggs to adult emergence. Extrinsic incubation period: It describes the time it takes for parasites to develop in the mosquito from the point of ingestion via an infected blood meal through to the point at which sporozoites enter the salivary glands and the mosquito becomes infectious (Ohm et al., 2018). Fecundity: It is expressed as the number of eggs laid per female mosquito (Mamai et al., 2017). Gonotrophic cycle length: The average number of days that gravid mosquitoes took to oviposit after taking a blood meal (Mala et al., 2014). Immature mosquito: This consists of the egg, larval and pupal stages of mosquitoes. Larval source management: the management of aquatic habitats (water bodies) that are potential larval habitats for mosquitoes to prevent the completion of development of the immature stages (WHO, 2013a). Longevity: It is the number of days a mosquito lives after emergence. Metabolic enzymes: They are enzyme systems that insects have developed to help them naturally detoxify insecticides and other foreign compounds (FAO, 2012; Gatton et al., 2013). Number of adults produced: The number of adult mosquitoes emerged from the total number of larvae. Pupation success: It is the proportion of larvae that pupated from the larval stage. Resistant population: a population is considered resistant if its response to an insecticide in detection tests drops significantly below its normal response (Georghiou & Mellon, 1983). xxii University of Ghana http://ugspace.ug.edu.gh Susceptible population: a population that has not been subjected to insecticidal pressure and in which resistant individuals are either absent or rare (WHO, 2016a). Time to pupation: It is estimated as the time from egg hatching to the onset of pupation. xxiii University of Ghana http://ugspace.ug.edu.gh ABSTRACT Background: Anopheles mosquitoes are responsible for transmitting malaria and lymphatic filariasis. They are among the notable vector species for their crucial role in transmitting malaria. The survival of the vector is of great interest as it affects its ability to transmit diseases. The biology and ecology of mosquitoes are strongly dependent on ambient temperature. The mosquito's life cycle includes four stages: egg, larva, pupa and adult. Indeed, the rearing temperature of the immature stages (egg, larva, and pupa) can significantly impact the completion of the life cycle, the overall fitness of the adult, and ability to transmit disease. In recent years, global warming and possible future warmer climate have prompted many studies to focus on the effects of elevated temperatures on both the morphology and the biology of various species, including vectors. Despite the importance of temperature variability on An. gambiae (s.l.) mosquito's development and survival, there is still the need to explore how and whether or not elevated temperatures associated with climate change is likely to reduce or increase the vector's population dynamics by modifying the life cycle, reduce the efficacy of insecticides, and increase the expression of metabolic enzymes in An. gambiae (s.l.) mosquitoes. Objective: This study aimed to investigate the influence of elevated temperatures on the growth and development of An. gambiae (s.l.) mosquitoes, and the effectiveness of pyrethroid insecticides in such higher temperatures. Methods: Anopheles gambiae (s.l.) eggs were obtained from colonies established in the laboratory and were incubated, hatched and reared under eight temperature regimes (25, 28, 30, 32, 34, 36, 38 and 40 °C) using climate-controlled incubators (RTOP-1000D, Zhejiang, China), with photoperiod of 12:12 (L:D) and 80 ± 10% relative humidity. Larvae were fed 10 mg of TetraFin goldfish flakes (Tetra Werke, Melle, Germany). All adults were fed with a 10% xxiv University of Ghana http://ugspace.ug.edu.gh sugar solution soaked in cotton wool. In addition, female mosquitoes used to estimate fecundity and longevity were blood-fed using a guinea pig on day four (4) post-emergence. Larvae were monitored daily for development to the next stage. The time to pupation, pupation success, number of adults produced, and sex ratio of the newly emerged adult was recorded. Molecular identification of An. gambiae (s.l.) mosquitoes was done using polymerase chain reaction (PCR) to identify the composition of sibling species in the An. gambiae complex. Larval survival and adult longevity were monitored every 24 hours, and data were analyzed using Kaplan-Meier survival analysis. Furthermore, analysis of variance (ANOVA) was used to assess the relationship between temperature and development time, time to pupation, length of the gonotrophic cycle, biting rate and fecundity. Kruskal-Wallis test was also used to assess the relationship between temperature and pupation success, pupal mortality, the number of adults produced, and sex ratio. Digital images of larvae, pupae, adult wings and proboscis were captured using stereo microscope with inbuilt camera (Leica EZ4 HD, Leica Microsystems Limited, Switzerland) and body parts were measured using Leica Application Software, version 3.4.0 (Leica Microsystems Limited, Switzerland). Data on larval, and pupal weight and size, adult weight, size and proboscis length were log-transformed and analyzed using ordinary least square (OLS) regression with robust standard errors. In addition, three to five-day-old non-blood-fed An. gambiae (s.l.) mosquitoes were used for insecticide susceptibility test following the WHO bioassay protocol. Batches of 20 – 25 non-blood-fed female adult An. gambiae (s.l.) mosquitoes from each temperature regime (25 – 32 °C) were exposed to two pyrethroid insecticides (0.75% permethrin and 0.05% deltamethrin). The knockdown rate after 60 min and mortality at 24 h were recorded. The levels of four metabolic enzymes (MFO, GST, α-EST and β-EST) were examined in both mosquitoes that were not exposed and those exposed to pyrethroids. xxv University of Ghana http://ugspace.ug.edu.gh Results: An. gambiae (s.l.) mosquitoes used in this study consisted of An. gambiae (s.s.) and An. coluzzii. Development time of immature mosquitoes significantly decreased (F(5, 24) = 133.55, P < 0.001) with increasing temperature. Log-rank test showed that larval survival (X2(6) = 5353.12, P < 0.001) decreased with increasing temperature. In addition, Kruskal- Wallis test showed that the number of adults produced (X2(5) = 28.16, P < 0.001) decreased with increasing temperature, with male mosquitoes disproportionately produced at higher temperatures than females. Larval (βlarval size = 0.11, 95% CI; 0.14, 0.09, P < 0.001) and pupal (βpupal size = 0.12, 95% CI; 0.14, 0.10, P < 0.001) size significantly decreased with increasing temperature. Furthermore, longevity of both blood-fed (log-rank test; X2(4) = 904.15, P < 0.001) and non-blood-fed (log-rank test; X2(4) = 1163.60, P < 0.001) mosquitoes decreased with increasing temperature. The results further showed that the fecundity of mosquitoes significantly (F(2,57) = 3.46, P = 0.038) reduced with increasing temperature. Body size and proboscis length also decreased with increasing temperature. The mortality of An. gambiae (s.l.) mosquitoes to pyrethroids decreased at temperatures above 28 oC. Mosquitoes reared at higher temperatures were more resistant to the insecticides tested (deltamethrin and permethrin) and had more elevated enzyme levels than those reared at low temperatures (P < 0.05). Conclusion: Mosquitoes could not breed beyond temperatures at 36 oC. Therefore, if the ambient environmental temperatures rise to 36 oC, possibly as a consequence of climate change, it is likely to reduce or inhibit malaria transmission and perhaps its eradication in a future warmer temperature. In conclusion, warmer temperature is potentially hostile to a considerable proportion of emerging mosquitoes and may inhibit their survival such that the numbers of potential vectors may decrease. This study contributes to the knowledge on the relationship between temperature and growth and development of An. gambiae (s.l.) xxvi University of Ghana http://ugspace.ug.edu.gh mosquitoes and provides helpful information for modelling vector population dynamics in a future warmer climate. xxvii University of Ghana http://ugspace.ug.edu.gh PREFACE Publications related to this work Agyekum, T. P., Botwe, P. K., Arko-Mensah, J., Issah, I., Acquah, A. A., Hogarh, J. N., Dwomoh D., Robins T. G., & Fobil, J. N. (2021). A systematic review of the effects of temperature on Anopheles mosquito development and survival: implications for malaria control in a future warmer climate. International Journal of Environmental Research and Public Health, 18(14),7255. https://doi.org/10.3390/ijerph18147255. Agyekum, T. P., Arko-Mensah, J., Botwe, P. K., Hogarh, J. N., Issah, I., Dwomoh, D., . . . Fobil, J. N. (2022). Effects of elevated temperatures on the development of immature stages of Anopheles gambiae (s.l.) mosquitoes. Tropical medicine and international health, 27, 338– 346. https://doi.org/10.1111/tmi.13732. Agyekum, T. P., Arko-Mensah, J., Botwe, P. K., Hogarh, J. N., Issah, I., Dwomoh, D., . . . Fobil, J. N. (2022). Effects of Elevated Temperatures on the Growth and Development of Adult Anopheles gambiae (s.l.) (Diptera: Culicidae) Mosquitoes. Journal of Medical Entomology, 59(4), 1413-1420. https://doi.org/10.1093/jme/tjac046. Agyekum, T. P., Arko-Mensah, J., Botwe, P. K., Hogarh, J. N., Issah, I., Dadzie, S. K., . . . Fobil, J. N. (2022). Relationship between temperature and Anopheles gambiae sensu lato mosquitoes' susceptibility to pyrethroids and expression of metabolic enzymes. Parasites & vectors, 15(1), 163. https://doi.org/10.1186/s13071-022-05273-z. xxviii University of Ghana http://ugspace.ug.edu.gh CHAPTER ONE INTRODUCTION 1.1 Background Anopheles mosquitoes represent a major public health threat because of the diseases they transmit (Benelli, 2015), which overall, forms a significant part of all morbidity and mortality records (Brito et al., 2013). They are responsible for transmitting pathogens such as malaria parasites, arboviruses and filarial worms (Gendrin & Christophides, 2013). In Ghana, malaria is an endemic disease, and the prevalence of malaria still accounts for 38.0% of all outpatient visits with children under 5 years being the most vulnerable groups (Ejigu & Wencheko, 2021). The control of diseases transmitted by Anopheles mosquito through infective bites rely strongly on chemical insecticides; use of impregnated treated nets (ITNs), outdoor spraying and indoor residual spraying (IRS) (Nnko et al., 2017). In an attempt to control the vector, four main classes of insecticides – pyrethroids, organochlorines, carbamates, and organophosphates have been used historically (Liu et al., 2011; Baffour-Awuah et al., 2016). Of all these insecticides, the pyrethroid class has been widely used to control Anopheles mosquitoes in recent years. However, there have been reports of increasing resistance of the vector to the insecticide (Hunt et al., 2011; Ranson et al., 2011; Dadzie et al., 2017; Mouhamadou et al., 2019). Anopheles mosquitoes are poikilotherms (i.e. have to survive and adapt to environmental stress), therefore their growth and development characteristics rely on ambient temperatures (Reinhold et al., 2018). These characteristics comprise the length of gonotrophic cycles, biting rate, fecundity, survival and development of the immature mosquitoes (Vantaux et al., 2016). Consequently, any factor capable of modifying any of these characteristics can influence the 1 University of Ghana http://ugspace.ug.edu.gh potential of mosquitoes to transmit diseases. Temperature is a typical example of the factors that could affect the ecology and biology of Anopheles mosquitoes and their potential to transmit diseases (Alto & Bettinardi, 2013; Ezeakacha & Yee, 2019). Over the past two decades, atmospheric temperature has been increasing (UNFCCC, 2007), and this is projected to affect the development times and the vectorial capacity of Anopheles mosquitoes (Mohammed & Chadee, 2011). Climate parameters such as temperature, humidity, and rainfall not only can substantially affect the growth and development of mosquitoes, but also the sporogonic development of malaria parasites, Plasmodium spp. within their bodies (Guerra et al., 2010; Hay et al., 2010; Afrane et al., 2012). Regards to Anopheles mosquitoes, studies conducted on growth and development characteristics and temperature have focused mainly on the development of the immature (egg, larvae and pupae) stages (Christiansen-Jucht et al., 2014) with little attention paid to the adult. Temperature variations can stress the adult mosquito, and the stress can make them more susceptible to external stressors leading to death (Lafferty & Mordecai, 2016). This may seem to imply that insecticide exposure (stressor) could induce high mortality or may go a long way to increase insecticide resistance. On the contrary, temperature has been shown to affect the efficacy of insecticides against mosquito species such as An. arabiensis, An. funestus, An. gambiae (s.s.), and An. stephensi (Glunt et al., 2014; Oxborough et al., 2015; Glunt et al., 2018). It is unclear how rearing temperature may affect the efficacy of insecticides and the susceptibility of or resistance of Anopheles gambiae mosquitoes (the predominant malaria vector in Ghana) to insecticides. In addition, temperature affects the mosquito's immune system (Murdock et al., 2012a; Murdock et al., 2013), decreases molecular stability while increasing enzyme function and membrane permeability (Lafferty & Mordecai, 2016). Yet, it is still 2 University of Ghana http://ugspace.ug.edu.gh unclear how variations in rearing temperature affect the expression of metabolic enzymes in mosquitoes (Qin et al., 2014; Camara et al., 2018). A growing body of literature recognizes the importance of how temperature affects the development and survival of An. gambiae (s.l.) mosquito since the parasite's development and disease transmission depend on the survival of the vector (Rajatileka et al., 2011). In sub- Saharan Africa, An. gambiae (s.l.) mosquito is one of the most predominant and important malaria vectors (Baffour-Awuah et al., 2016; Riveron et al., 2016). Elevated temperatures associated with climate change are likely to influence population dynamics of mosquitoes, affect the efficacy of insecticides and expression of metabolic enzymes. 1.2 Problem Statement Temperature variations could directly affect the dynamics of vector‐borne diseases (Polgreen & Polgreen, 2017; Roberts et al., 2018) by modifying the risk of disease transmission, especially where the extrinsic incubation period (EIP) gets closer to the lifespan of the vector (Alto & Bettinardi, 2013). A projected increase in temperature in Africa (Sylla et al., 2016) is anticipated to affect malaria transmission by altering key growth and development characteristics of Anopheles mosquitoes (Davies et al., 2016). However, studies that have examined either the net effects of rearing or ambient temperature on the growth and development of both the immature stages and adult An. gambiae (s.l.) mosquitoes are rare (Christiansen-Jucht et al., 2014, 2015; Shapiro et al., 2017). Temperature affects the population growth rates of mosquitoes by altering traits that enable these adult insects to live successfully in their habitats (Lyons et al., 2013). As a result of the high thermal conductivity of rearing water coupled with the inability to escape adverse conditions, the immature stages of mosquitoes are mostly affected by temperature (Oliver & Brooke, 2017). This may affect the growth and development of the immature stages of An. 3 University of Ghana http://ugspace.ug.edu.gh gambiae (s.l.) mosquitoes (Afrane et al., 2012; Davies et al., 2016) and the overall fitness of the adult An. gambiae (s.l.) mosquito by altering key growth and development characteristics such as fecundity, body size, adult longevity, blood-feeding behavior, gonotrophic cycle length, and biting rate (Davies et al., 2016; Shapiro et al., 2017; Ezeakacha & Yee, 2019). These characteristics can affect mosquito survival and parasite development and influence disease transmission (Christiansen-Jucht et al., 2014). The control of mosquitoes have focused on mainly the adult mosquito; however, vector control measures have not achieved the expected results owing to challenges such as inadequate financing (Shretta et al., 2016; WHO, 2017), gaps in control management (Kokwaro, 2009), and vector resistance to insecticides (Badolo et al., 2012; Riveron et al., 2015; Yewhalaw & Kweka, 2016). The toxicity and bioaccumulation of insecticides are influenced by temperature (Lushchak et al., 2018) and an increase in temperature could worsen vector control measures by reducing the efficacy of the insecticides, further increasing resistance (Glunt et al., 2018). Furthermore, an increase in temperature could increase the expression of metabolic enzymes (Angilletta Jr et al., 2009). Increase in metabolic enzymes could increase the detoxification of insecticides in mosquitoes, reduce the effectiveness of the insecticide, and increase resistance of mosquitoes to insecticides (Nardini et al., 2012; Panini et al., 2016). This may present a significant threat to malaria control and affect the achievement of sustainable development goals, especially goal 3 (ensure healthy lives and promote wellbeing for all ages) (UNDP, 2015). Due to the sensitivity of mosquitoes to temperature, several studies have focused on the effects of temperature on mosquito and their ability to transmit diseases (Paaijmans et al., 2013a; Ciota et al., 2014). However, there are still data gaps regarding the effects of elevated temperatures on adult An. gambiae (s.l.) mosquitoes’ traits such as fecundity, gonotrophic cycle length and 4 University of Ghana http://ugspace.ug.edu.gh biting. For instance, few studies have considered the impact of temperature on gonotrophic cycle length and biting rate (Shapiro et al., 2017). Only a few studies; if any at all, have evaluated the effects of different rearing temperatures on the sex ratio of emerged adult An. gambiae (s.l.) mosquitoes. This provides significant information on the population dynamics of mosquitoes and could inform control interventions. Furthermore, there is little information on the effects of rearing temperatures on the susceptibility of adult An. gambiae (s.l.) mosquitoes to pyrethroid insecticides and the expression of metabolic enzyme levels (Kristan et al., 2018). 1.3 Conceptual Framework This study considered only the effects of temperature on An. gambiae (s.l.) mosquitoes. However, varying climate parameters such as temperature, rainfall and humidity could strongly affect the growth and development of mosquitoes (Abiodun et al., 2016). Temperature is considered one of the most significant factors that affects biological processes and physiological functions, including growth and reproduction in ectotherms such as mosquitoes (Ezeakacha & Yee, 2019). It also plays a vital role in the growth and development of mosquitoes (Oliver & Brooke, 2017) and could modify the completion of the entire life cycle. Temperature could affect the growth and development of both the immature (egg, larvae and pupae) and adult stages of mosquitoes. The conditions experienced at the immature stages could affect the overall fitness of the adult mosquito by affecting the longevity, fecundity, body size, length of the gonotrophic cycle and biting rate (Figure 1). Temperature could significantly affect the metabolism and survival rate of insects and the efficacy of insecticides (Jaleel et al., 2020). Expression of metabolic enzymes such as mixed- function oxidase (MFO), Glutathione-S-transferases (GSTs), acetylcholinesterase (AChE), and non-specific esterase (NSE) in mosquitoes could detoxify insecticides more rapidly and render 5 University of Ghana http://ugspace.ug.edu.gh the insecticides ineffective. This could lead to the resistance of mosquitoes to insecticides. Overall, the effects of temperature on the growth and development of both immature and adult mosquitoes, expression of metabolic enzymes and susceptibility of mosquitoes to insecticides could alter the vector's population dynamics and ultimately affect mosquito control efforts. Temperature variability Immature mosquito (egg, larvae and pupae) Adult mosquito Growth and Growth and Insecticide Expression of development development susceptibility metabolic enzymes (GST, MFO & NSE) Resistance to insecticides (phenotypic & biochemical) Figure 1: Conceptual framework showing the relationship between temperature and growth, development and susceptibility of mosquitoes to insecticides 6 University of Ghana http://ugspace.ug.edu.gh 1.4 Justification Malaria is still a major public health concern in Ghana, and vector control has been a major intervention to reduce malaria burden. Thus, climate change or increasing temperature threatens the current control measures and studies that will increase our knowledge to be better prepared in developing policies for control is needed. It is not clear how temperature may affect the susceptibility of An. gambiae (s.l.) mosquitoes to insecticides or expression of metabolic enzymes. Therefore, understanding how temperature affects the growth and development, and the susceptibility of An. gambiae (s.l.) mosquitoes to insecticides in elevated temperatures is critical. This will help policymakers put measures to mitigate the effects of temperature on the mosquito population. In addition, findings could guide mosquito control interventions and safeguard public health. 1.5 General Objective The general objective of the study was to investigate the influence of elevated temperatures on the growth and development, and susceptibility of An. gambiae (s.l.) mosquitoes to pyrethroid insecticides. 1.5.1 Specific Objectives The specific objectives were to; • Examine the influence of temperature on the developmental stages of An. gambiae (s.l.) mosquitoes. • Assess the relationship between temperature and the growth and development of adult An. gambiae (s.l.) mosquitoes. • Evaluate the effects of varying temperatures on the susceptibility of An. gambiae (s.l.) mosquitoes to pyrethroids and expression of metabolic enzymes. 7 University of Ghana http://ugspace.ug.edu.gh 1.6 Research Questions This research sought to answer the under listed questions; • Is there any relationship between temperature and the developmental stages of An. gambiae (s.l.) mosquitoes? • Is there any relationship between temperature and growth and development of adult An. gambiae (s.l.) mosquitoes? • What are the effects of temperature on An. gambiae (s.l.) mosquito's susceptibility to pyrethroids and expression of metabolic enzymes? 1.7 Research Hypotheses The underlisted hypotheses guided the study. • Increasing temperature will influence the developmental stages of An. gambiae (s.l.) mosquitoes. • Increasing temperature will influence the growth and development of adult An. gambiae (s.l.) mosquitoes. • Varying temperatures from 25 oC through to 40 oC will affect the susceptibility of An. gambiae (s.l.) mosquitoes to pyrethroids and expression of metabolic enzymes. 8 University of Ghana http://ugspace.ug.edu.gh CHAPTER TWO LITERATURE REVIEW 2.1 Introduction This chapter provides an overview of key terms and concepts relevant to this thesis. The chapter presents biology of mosquitoes, control measures, insecticides used to control mosquitoes and resistance mechanisms. The existing gaps and limitations in the literature are also highlighted by assembling and evaluating the available evidence of the relationship between temperature and the development as well as survival of Anopheles mosquitoes. Research articles published up to March 2021 were systematically retrieved from PubMed, Science Direct, Scopus, ProQuest, Web of Science, and Google Scholar databases. The search strategies used keywords such as Anopheles, mosquito, malaria, temperature, temp*, season*, survival, insecticide resistance/susceptibility, metabolic enzyme, and longevity. 2.2 Biology of mosquitoes Mosquitoes are regarded as the most important groups of arthropods, primarily because of their role in disease transmission (Do Nascimento et al., 2018). They belong to the family Culicidae and form the core of global entomological research because of their role as vectors in transmitting a wide array of debilitating parasitic and viral diseases that affect both humans and animals (Becker et al., 2010). Mosquitoes are slender insects with long legs, and are usually identified with scales on their bodies and their long proboscis (Harbach, 2007). About forty- one (41) genera of mosquitoes have been reported, and about 3500 species have already been reported from different parts of the world (Do Nascimento et al., 2018). These mosquitoes are grouped into two subfamilies of Anophelinae and Culicinae (Wilkerson et al., 2015; Foster et 9 University of Ghana http://ugspace.ug.edu.gh al., 2017). There are three best-known genera of mosquitoes: Anopheles, Aedes, and Culex (Wilkerson et al., 2015). Globally, mosquitoes are the most important insect pests that affect humans and animals (Gouge et al., 2016). They serve as vectors for several diseases, including malaria, dengue, lymphatic filariasis, and many other arboviral diseases, including Lassa and yellow fevers, which are accountable for hundreds of millions of morbidity and millions of deaths annually (WHO, 2019b). Projections by the World Health Organization (WHO) show that mosquito- borne diseases are the leading causes of morbidity and mortality in developing countries (WHO, 2005). However, not all mosquito species are of public health importance. From a medical perspective, the most important species belong to the following genera; Aedes, Anopheles, and Culex (ECDC, 2014). In addition to their impact on human health, mosquitoes play a crucial role in natural ecosystems. They serve as important pollinators and food sources for some animals such as amphibians, reptiles, birds, and mammals (Wong & Jim, 2016). Mosquitoes are very successful insects because they can acclimatize to a wide range of habitats (Becker et al., 2010). Aside the deserts and perpetually frozen areas, mosquitoes are ubiquitous, and found in humid tropics, subtropics, warm moist climates, and the temperate and cool regions (Do Nascimento et al., 2018). The activities of mosquitoes are, to some extent, species- specific. For instance, while some species are active at night or sunset, others are active during the daytime (Harbach, 2007). The flight habits of mosquitoes are also species dependent. Most local species linger around their breeding places whereas other species travel very far from their breeding habitats. Usually, the female mosquitoes cover a longer flight distance compared to the males. It has been reported that some mosquitoes move as far as 75 miles (about 121 km) from the breeding sites, though on the average they are mostly within a mile or 2 miles from their breeding habitat (AAEP, 2016). 10 University of Ghana http://ugspace.ug.edu.gh Generally, mosquitoes are highly attracted to humans and are well adapted to breeding places created by human activities. The use of water storage containers in animal husbandry and other farming activities such as fish ponds and irrigation systems offer suitable breeding conditions for anthropophilic mosquitoes (Egbuche et al., 2016). With regards to feeding, both the male and female mosquitoes depend on plant nectar and fruit sap for energy. However, the female counterparts require blood meal as an additional dietary requirement and source of protein for the development of their eggs (Silver, 2008). When it comes to blood meal sources, different species prefer different host animals. Whereas some feed on humans and birds, others prefer other animal hosts (Gouge et al., 2016). The geography of the mosquito reveals a wide global diversity, and in Ghana, the following species; Culex, Aedes, Anopheles, and Mansonia mosquitoes, have been reported across the country (Ughasi et al., 2012; Kudom, 2015; Kudom et al., 2015a; Owusu-Asenso, 2018). 2.3 Life cycle of mosquitoes The life cycle of mosquito (Figure 2) is a complete metamorphosis (Becker et al., 2010) which comprises four different stages: egg, larvae, pupae and adult, and the whole cycle requires almost two weeks (Tokachil et al., 2017). The adult stage is free-flying, while the first three stages are aquatic (Jackman & Olson, 2002). In addition, the first three stages are called the aquatic or immature stages. Only the adults are involved in disease transmission, although the dynamics of the immature stages (larvae and pupae) play a significant role in determining the fitness of the adult mosquito for disease transmission (Li, 2009). 11 University of Ghana http://ugspace.ug.edu.gh 2.3.1 Egg stage The eggs of mosquitoes differ significantly among the major groups of species and individual species (Eldridge, 2008). In order to find potential oviposition sites, gravid mosquitoes depend on olfactory and visual signals. As these mosquitoes come closer to a site, they use olfactory, visual, and tactile alerts to appraise the quality of the site for oviposition (Day, 2016). Mosquitoes oviposit one at a time, and they float on the surface of the water. The eggs are laid either singly (e.g., Anopheles and Aedes species) or stuck together in floating rafts (e.g. Culex species). Some species (e.g. Aedes) oviposit just above the water line or on wet mud (these eggs hatch only when inundated with water) while Culex and Anopheles species lay their eggs on water (Osman, 2010). Other species like the Mansonia lay eggs as submerged clusters attached to roots, stems, and leaves of aquatic vegetation (Day, 2016). In addition, adult females oviposit in numerous different ways depending on the species. Females lay between 100 to 300 eggs (Genoud et al., 2019) after a blood meal. The eggs are vulnerable to desiccation and hatch within the second or third day; however, hatching may take up to two to three weeks in colder climates (Coleman, 2009). Many mosquito species usually oviposit during the dawn and twilight periods (Day, 2016). Generally, when the mosquitoes oviposit, the eggs are white but grow dark within few hours (Farnesi et al., 2017). In general, mosquitoes can be grouped into two categories per their egg-laying behavior as well as whether or not their embryos undergo diapause (innately dogged resting period) or dormancy period (externally triggered resting period) (Becker et al., 2010). In the first category, called rapid hatch (Day, 2016), the embryos do not undergo diapause or dormancy and hatch after the embryonic development is completed. However, in the second category (delayed hatch), the eggs do not hatch right after oviposition (Becker et al., 2010) but later when conditions are favorable for the eggs to hatch. Under this category, the eggs are usually drought-resistant, stay alive for long periods outside the water, and hatch shortly after being re-flooded (Day, 2016). 12 University of Ghana http://ugspace.ug.edu.gh 2.3.2 Larval stage Mosquito larvae inhabit different water bodies, including temporary or permanent, extremely polluted or clean, stagnant or flowing, small or large (Becker et al., 2010). The larva has a well- developed head and a mouth with brushes to feed, a large thorax, and a fragmented abdomen (Pwalia, 2014). The larval stage is the longest of the three immature stages (Beck-Johnson et al., 2013) and the only stage where feeding occurs, making it vital for nutritional reserves accumulation to develop the adult in the pupal stage. The larval stage responses to fluctuating conditions are crucial in population size regulation and mosquito control (Owusu et al., 2017). Larvae progress into four instar stages before reaching the pupal stage (Madzlan et al., 2016). At each molt, the head capsule is amplified to the full-size features of the subsequent instar, though the body continues to grow. Thus, one can use how big the head capsule is as a correct morphometric pointer for the larval instar (Becker et al., 2010). The larvae feed on dissolved foods in the breeding sites during the first two instars. During the third and fourth instar, they mainly survive on bacteria, algae, and other microorganisms to hoard sufficient energy for the transformation and further developments that take place during the pupal phase (Barfi, 2015). In terms of appearance and morphology, there is a significant difference between the larvae and the adults. The larval stage survives in water, and their feeding behavior and breathing structures clearly show this. In general, it is easy to classify mosquitoes to species at the larval stage than using the adults (Eldridge, 2008). Except for Anopheles larvae that lay parallel to the water surface because of lack of respiratory siphon, most mosquito larvae have a respiratory siphon, which dangles from the water surface (Ponlawat & Harrington, 2009; Osman, 2010). The larvae (e.g., Ae. vexans) occasionally come together in particular places at the breeding sites to reduce the chance of predation of any single larva (Becker et al., 2010). 13 University of Ghana http://ugspace.ug.edu.gh 2.3.3 Pupal stage The pupal stage comes after the larval stage and it is the third stage of the mosquito's life cycle and also the final stage of the aquatic or immature stages (Kauffman et al., 2017). The mosquito pupae are also known as tumblers and present fewer characters beneficial for identification (Eldridge, 2008). The pupa looks like a comma shape with the head and thorax merged into a cephalothorax and the abdomen located below it. At this stage, key transformations occur, resulting in the metamorphosis of larval tissues into adult tissues (Coleman, 2009). Naturally, the pupal head and thorax are joined into a protuberant cephalothorax which possesses anterolaterally two respiratory trumpets. These are linked to the mesothoracic spiracles of the emerging adults to supply oxygen (Becker et al., 2010). In addition, the pupae have two big structures known as paddles that project from the tip of the abdomen (Eldridge, 2008). The pupal phase, a resting and non-feeding stage, is when the mosquito turns into an adult and usually takes about two days (Osman, 2010). 2.3.4 Adult stage This is the final stage of the mosquito's life cycle and the only stage which is not aquatic. This stage is finalized when gas is pushed through the pupal and the pharate adult cuticle and into its midgut. The newly emerged adult mosquito moves carefully to avoid dropping onto the water surface as its appendages linger partially in the exuvia (Becker et al., 2010). Upon its emergence, the adult mosquito seeks a safe hideout in the neighboring vegetation to enable its wings to develop fully (Agyekum, 2017). Like other insects, the adult mosquito has three different body regions: head, thorax, and abdomen (Eldridge, 2008). At emergence, the male mosquitoes are not sexually developed, as they have to spin their hypopygium via 180o before they are ready to mate with the female mosquitoes (usually takes about a day) (Becker et al., 2010). Because of this, the male mosquitoes emerge earlier (usually 14 University of Ghana http://ugspace.ug.edu.gh 1 – 2 days) than the females to reach sexual maturity at the same time as the incipient females (Genoud et al., 2019). The male mosquitoes mate with the females as soon as they emerge (Diabate & Tripet, 2015). After mating, the females hoard more sperm in their spermathecae (a receptacle in which sperm is stored after mating) to inseminate several egg batches without copulation (Becker et al., 2010). In terms of morphology, there are differences between male and female mosquitoes. The female mosquitoes possess short palpi and an extended stiletto-like proboscis that in most species has structures called stylets adapted for piercing the skin of their host for a blood meal. However, the male mosquitoes have long hairy palpi in addition to a long fleshy proboscis adapted for sucking plant nectar and other fluids from fruits and flowers (Eldridge, 2008). Mosquitoes feed on plant nectar and other fluids from fruits and flowers, but the female, in addition to this, requires a blood meal to develop its eggs (Nyasembe & Torto, 2014). In most mosquito species, the female needs a blood meal to complete oogenesis (production or development of an ovum). This has caused mosquitoes to develop an intricate host-seeking behavior to identify and feed on a potential host. Generally, this host-seeking distribution is dependent on the species, host accessibility, and season (Verdonschot & Besse-Lototskaya, 2014). Most species are non-autogenous, implying that after copulation, the female mosquitoes require a blood meal to complete the egg development (Becker et al., 2010). After the adult mosquitoes have emerged, they are ready to commence their life cycle all over again by feeding, mating, and laying eggs. 15 University of Ghana http://ugspace.ug.edu.gh Figure 2: Life cycle of a mosquito 2.4 Common genera of mosquitoes The well-known and medically essential genera of mosquitoes include Anopheles, Aedes, and Culex mosquitoes (Lebl et al., 2015). 2.4.1 Anopheles mosquitoes Anopheles mosquitoes belong to the order Diptera, sub-order Nematocera, family Culicidae and sub-family Anophelinae (Agyepong et al., 2012). Anopheles mosquitoes usually breed in transparent, sunny, temporal water bodies like swampy areas, mining sites, foot and hoof print, roadside puddles, drainage trenches, and edges of boreholes (Baffour-Awuah, 2012). In addition, Anopheles mosquitoes are not limited only to these habitats; they look out for different habitats for breeding. According to Mattah et al. (2017), these mosquitoes breed within the environs of deteriorating infrastructure like poorly maintained drains, culverts, broken water pipes, car tire imprints on unpaved roads, market gardens/urban agricultural sites, open tins/cans, pools at construction sites, low lying areas that are prone to flooding, among others. However, some Anopheles species breed even in polluted or contaminated water bodies. For 16 University of Ghana http://ugspace.ug.edu.gh instance, An. gambiae sensu lato (s.l.), also referred to as An. gambiae complex, has been found in swamp extremely polluted with organic matter (Sattler et al., 2005). This contradicts the conservative view that Anopheles mosquitoes breed only in clear or clean water habitats (Baffour-Awuah, 2012). Anopheles mosquitoes are the primary vectors responsible for the transmission of malaria in the world (Sokhna et al., 2013; Chabi et al., 2016; Huestis et al., 2017), and the vectors are continuously evolving (Sokhna et al., 2013). About 500 species of Anopheles has been described; however, only sixty (60) are reported to cause malaria (Sokhna et al., 2013). In addition to malaria-endemic areas, Anopheles mosquitoes that transmit malaria can also be found even in areas where malaria has been eradicated – these areas are always at risk of resurgence of the disease (Obacha, 2016). Many Anopheles species have been reported in the literature, and examples include but not limited to the An. gambiae complex, An. funestus group, An. nili group (Ossè et al., 2019), An. moucheti, An. vinckei (Paupy et al., 2013), An. minimus complex, An. dirus complex, and An. subpictus complex (Morgan et al., 2013). Most important malaria vectors in Africa belong to a species complex, and these species are sometimes difficult to differentiate morphologically. Previously, due to the complexities regarding this, sibling species in the complex have often been considered as a single unit, notwithstanding the significant differences among these sibling species (Wiebe et al., 2017). In sub-Saharan Africa, the An. gambiae complex and An. funestus groups are the main vectors responsible for causing malaria (Nnko et al., 2017; Gouignard et al., 2019). The An. gambiae complex, which is the focus of this study, was documented in the 1960s, and it has been reported to include the most important malaria vectors in sub-Saharan Africa, chiefly of the dangerous malaria parasite – Plasmodium falciparum (Bashir et al., 2018). The complex consists of nine (9) morphologically indistinguishable sibling species. They are An. gambiae 17 University of Ghana http://ugspace.ug.edu.gh sensu stricto (s.s.), An. arabiensis, An. quadriannulatus, An. melas, An. merus, An. bwambae, An. amharicus (Bass et al., 2007; Coetzee et al., 2013), An. coluzzii (Coetzee et al., 2013; Barron et al., 2018; Camara et al., 2018) and An. fontenillei (Barrón et al., 2019). In Ghana, some of the Anopheles species reported include An. gambiae (s.s.), An. funestus, An. coluzzii, An. pharaoensis, An. rufipes, An. melas and many more. The Anopheles species reported in the country are distributed based on ecological settings (Baffour-Awuah, 2012). For instance, An. gambiae (s.s.) and An. funestus – the most common species of Anopheles in the country, and An. coluzzii are found throughout the country (Baffour-Awuah et al., 2016). In most locations, An. coluzzii and An. gambiae (s.s.) sympatrically co-exist (Kudom, 2015). On the other hand, An. arabiensis predominates in the coastal savannah and northern regions. Anopheles rufipes and An. melas are also limited to the northern and coastal areas of the country, respectively (Baffoe-Wilmot et al., 2001; Yawson et al., 2004; De Souza et al., 2010). Figure 3: Adult Anopheles mosquito 18 University of Ghana http://ugspace.ug.edu.gh 2.4.2 Aedes mosquitoes Aedes is the most prominent tribe of mosquitoes with about 1256 species categorized into ten (10) genera (in descending order); Aedes sensu, Verrallina, Armigeres, Psorophora, Eretmapodites, Heizmannia, Haemagogus, Zeugnomyia, Udaya, and Opifex (Wilkerson et al., 2015). Many species of Aedes exist, and they include but not limited to A. albopictus, A. aegypti, A. polynesiensis, A. scutellaris complex (WHO, 2009a), A. taeniorhynchus, A. vexans, A. sollicitans, A. togoi, A. atropalpus, A. triseriatus, and A. hendersoni (Day, 2016). However, A. aegypti, and A. albopictus are of significant public health importance because of their role in transmitting diseases (Kraemer et al., 2015). Some notable diseases they transmit include dengue, yellow fever, chikungunya and Zika viruses (Kweka et al., 2018). Aedes species can be found in natural and artificial receptacles capable of holding clear and clean water (Dom et al., 2013a; Dom et al., 2013b; Madzlan et al., 2016). Among the preferred breeding sites are earthen jars, ant traps, flower pots, drums, coconut shells, concrete tanks, and discarded tires (Simard et al., 2005; García-Rivera & Rigau-Pérez, 2006; Paupy et al., 2009). In addition, larvae can be found in natural sites like tree holes and bromeliads (García- Rivera & Rigau-Pérez, 2006). According to Dom et al. (2013b), Aedes aegypti usually prefers indoor artificial containers, and A. albopictus are more used to natural water receptacles found outdoors. The feeding behavior of Aedes differs among species. For instance, while A. albopictus is opportunistic and has zoophilic feeding behavior, A. aegypti is (except in African populations) highly anthropophilic (Paupy et al., 2009). In addition, A. albopictus is primarily a daytime and exophagic (feeds outdoors) mosquito and prefers to bite in the early morning and late afternoon. However, several exemptions have been documented based on the region, human habitat, season, and host availability (Paupy et al., 2009). Though the A. aegypti mosquito is also a 19 University of Ghana http://ugspace.ug.edu.gh daytime feeder and bites mainly in the morning or late afternoon, they generally rest in dark, indoor places like under beds, closets (García-Rivera & Rigau-Pérez, 2006) and behind curtains. In Ghana, studies have reported Aedes species in all the ecological zones (Appawu et al., 2006; Ughasi et al., 2012; Owusu-Asenso, 2018). Some of them include A. aegypti, A. africanus, and A. luteocephalus. Figure 4: Adult Aedes mosquito 2.4.3 Culex mosquitoes Culex mosquitoes consist of more than a thousand species distributed globally (Mullen & Durden, 2009). They are also the most prevalent mosquito species across the African continent (Nchoutpouen et al., 2019), and are vectors of many important disease causing viruses, including; West Nile virus (WNV), Sindbis virus (SINV), Japanese encephalitis virus (JEV), and a range of nematodes (Mullen & Durden, 2009; Weaver & Lecuit, 2015; Gould et al., 2017). Culex species are highly opportunistic and feed on both humans and animals. This behavior enhances their ability to transmit zoonotic diseases, making them a significant threat to public 20 University of Ghana http://ugspace.ug.edu.gh health (Weissenböck et al., 2010). Unlike Anopheles, Culex mosquitoes usually breed in turbid water (Mahgoub et al., 2017); however, there are instances where Anopheles and Culex larvae have been found together in breeding sites even though their breeding ecology differs (Emidi et al., 2017). There are so many species of Culex, but Culex pipiens complex is the most important species. It comprises six members: Cx. pipiens Linneaus, Cx. australicus Dobrotworsky and Drummond, Cx. quinquefasciatus Say, Cx. globocoxitus Dobrotworsky, Cx. pallens Coquillet, and Cx. molestus Forskll (Nchoutpouen et al., 2019). In Ghana, Culex species such as Cx. quinquefasciatus Say, Cx. thallassius, Cx. decens, Cx. fuscocephala, and Cx. perexiguus have been identified in different parts of the country (Opoku & Ansa-Asare, 2007; Kudom et al., 2015a, 2015b). Figure 5: Adult Culex mosquito 21 University of Ghana http://ugspace.ug.edu.gh 2.5 Anopheles and malaria transmission Malaria remains a disease of public health concern in terms of morbidity and mortality caused by four species of the genus Plasmodium (P. falciparum, P. vivax, P. ovale and P. malariae). Malaria is a protozoan infection that attacks the red blood cells in the human body through the bite of an infected female anopheline mosquito (Wang et al., 2013). The incidence of malaria is approximately 300 – 500 million clinical cases, resulting in 1 million deaths each year, where children under 5 are the most affected (Traoré et al., 2020). In 2017, approximately 219 million cases of malaria were recorded, with 435 thousand deaths worldwide (WHO, 2019b). Vector control such as long-lasting insecticidal nets (LLINs) and indoor residual spraying (IRS) remain key elements in reducing the transmission and burden of malaria in Africa (Otten et al., 2009). There have been increased global efforts to control and eliminate malaria over the past two decades and this has prevented about 1.5 billion cases and 7.6 million deaths (WHO, 2021). Notwithstanding, malaria remains a major public health issue in Ghana. The country is one of the eleven high-burden countries accounting for over 70% of the global malaria cases and deaths (Ghosh & Rahi, 2019), and part of the two highest-burden countries in Africa reporting the highest absolute increase in malaria cases in 2018 (WHO, 2019a). Over the years, Ghana has made some progress in the prevention and control of malaria as there has been a significant decline (28 % in 2011 to 14 % in 2019) of nationwide parasite prevalence among children under five years (based on microscopy) (President’s Malaria Initiative, 2022). In Ghana, the dominant species responsible for the transmission of the disease are An. gambiae (s.s), An. coluzzii, An. funestus, and An. arabiensis (Chabi et al., 2016). The key feature that makes these species efficient malaria vectors are their resting behavior and blood source preference. These behavioral differences affect the vectorial capacity, suitability, and 22 University of Ghana http://ugspace.ug.edu.gh effectiveness of vector control interventions (Akuamoah-Boateng et al., 2021). Additionally, environmental factors (temperature, relative humidity, vegetation, rainfall, etc) influence the survival of mosquitoes (Kristan et al., 2018; Agyemang-Badu et al., 2023). For instance, the larval stages of all species of Anopheles require water, thus the presence of a water source is related to increased distribution and density of larvae and an increased incidence of adult mosquitoes and consequently malaria (Ma et al., 2016). Malaria is transmitted through the bite of an infectious female Anopheles mosquitoes (WHO, 2019b). When a female Anopheles mosquito feeds on a Plasmodium-infected individual, gametocytes are taken up with the blood meal into the midgut. Gametocytes produce gametes that, once fertilized, rapidly develop into motile ookinetes, which cross the mosquito midgut epithelium and settle on its basal side (within 16 – 30 h post-blood-feeding) (Kirchner & Waters, 2019). Ookinetes then transform into sessile oocysts, producing thousands of individual sporozoites within 10 – 14 days. After oocyst rupture, sporozoites migrate to the salivary glands where they reside, ready to start a new infection when the mosquito feeds on a host again (Kirchner & Waters, 2019). Despite the efforts made to eliminate malaria, the transmission of malaria continues to occur and remains a critical public health issue, especially in Africa (Degefa et al., 2021). Factors such as increased insecticide resistance due to target site mutations, enhanced metabolic detoxification (Nwankwo, 2021), and behavioral resistance due to the preference of malaria vectors to bite outdoors and in the early evenings when people are indoors but unprotected (Degefa et al., 2021) contributes to the continual transmission of malaria globally. 23 University of Ghana http://ugspace.ug.edu.gh 2.6 Control of mosquitoes Malaria vector control is the primary intervention for the global reduction and eradication of malaria (Kgoroebutswe et al., 2020). Vector control is measures of any kind against malaria- transmitting mosquitoes planned to limit the ability of mosquitoes to transmit disease (WHO, 2016b). The most common vector control measures include the use of insecticide-treated nets (ITN or LLIN) and indoor residual spraying (IRS) (WHO, 2017; Williams et al., 2018), with larval source management (LSM) as an additional control measure (Kgoroebutswe et al., 2020; McCann et al., 2021). 2.6.1 Use of mosquito bed nets One of the important tools of the Roll Back Malaria (RBM) strategy is the use of mosquito bed nets (insecticide-treated net (ITN) or long-lasting insecticidal nets (LLINs)) (Toé et al., 2009; Zöllner et al., 2015). An insecticide-treated net (ITN) is a bed net intended to provide a physical barrier against mosquitoes and also processed with residual insecticide to repel or kill mosquito vectors (Birget & Koella, 2015; Lindblade et al., 2015). On the other hand, long-lasting insecticidal nets (LLINs) - an effective alternative to insecticide-treated nets (ITNs), last longer than insecticide-treated bed nets (ITNs) and maintain their biological efficacy for about three (3) years (Sriwichai et al., 2016; Yang et al., 2018). The LLINs have insecticides coated around or incorporated into their fibers (Yang et al., 2018). The use of treated mosquito nets has had a great impact on reducing mosquito bites and in reducing malaria transmission (Mohammed, 2013; Castellanos et al., 2021). Policies aimed to promote universal access to bed nets (ITNs or LLINs) are developed in many malaria-endemic countries; however, the percentage of the people who slept under bed nets in 2015 in sub- Saharan Africa was estimated around 55 %, with most of them (about 68%) being children under-5 years old (WHO, 2015a). The usage of ITNs reduced malaria mortality rates in 24 University of Ghana http://ugspace.ug.edu.gh children under-5 years old by 55 % (Eisele et al., 2010; Admasie et al., 2018). Unfortunately, many households who received bed nets for free or subsidized prices do not use them (Baume & Franca-Koh, 2011). The low usage of bed nets has been attributed to fixing the bed net above the mat, house design, the feeling of suffocation and discomfort because of the relatively high temperatures in rooms (Toé et al., 2009). These reasons could grind down the achievements made in ITN use and reduce the effectiveness of malaria control programs. 2.6.2 Indoor Residual Spraying (IRS) Indoor residual spraying (IRS) of insecticides is a key method of reducing malaria vector transmission and has contributed to the decline in malaria prevalence globally (Tangena et al., 2020; Coleman et al., 2021). Indoor residual spraying (IRS) consists of applying a long-term, residual insecticide to potential mosquito hidden surfaces such as ceilings and interior walls of houses where mosquitoes might come into contact with the insecticide (WHO, 2013b). Indoor Residual Spraying (IRS) programs remain the most extensively used technique for controlling mosquitoes (Choi et al., 2019b) and are highly effective and can also significantly reduce malaria incidence and mortality (Gogue et al., 2020) on the condition that mosquito hide-outs in targeted communities are identified and sprayed (Agyekum, 2017). However, in recent years, IRS programs face challenges due to the increasing vector resistance to insecticides and the overall cost implications of the program implementation (WHO, 2020). The increased cost of IRS products has been linked to a reduction in IRS coverage throughout sub-Saharan Africa (Chaccour et al., 2021). This vector control method was introduced during the late 1940s when Dichloro-diphenyl- trichloroethane (DDT) was available and used to control mosquito vectors of malaria that entered houses (Van Den Berg et al., 2012). The success of house spraying for controlling 25 University of Ghana http://ugspace.ug.edu.gh malaria depends on applying an adequate and uniform dosage of insecticide on all potential resting places of the adult female mosquito (WHO, 2015b). Many sub-Saharan African countries have included IRS in their extensive malaria control plan in agreement with the Global Malaria Action Plan (GMAP) introduced by the WHO and Roll Back Malaria (RBM) Partnership. Globally, 185 million people (6 % of the global population at risk) were protected from malaria through the use of IRS in 2010 (WHO, 2011). However, in 2014, only 116 million (3.4 %) people were protected by IRS. There has been a reduction in the proportion of vulnerable population IRS protected (Cibulskis et al., 2016). 2.6.3 Larval source management (LSM) Larval source management (LSM) refers to managing mosquito breeding habitats to prevent the development of immature stages (eggs, larvae and pupae) or reduce the number of immature mosquitoes (WHO, 2013a; McCann et al., 2017). The goal of LSM is to reduce the number of adult mosquitoes that bite to prevent malaria transmission (Choi et al., 2019a). Four types of LSM exist, they include habitat modification (a permanent modification to the environment such as surface water drainage), habitat manipulation (a recurrent activity such as flushing of streams and water-level manipulation); larviciding (regular application of biological or chemical insecticides to water bodies); and biological control (introduction of natural predators into water bodies) (Fillinger & Lindsay, 2011; WHO, 2013a). It must be emphasized that larval source management (LSM) should not be considered a stand- alone intervention or replace core vector control interventions (using bed nets and IRS) but as an additional vector control measure (Fillinger & Lindsay, 2011; WHO, 2013a). Larval source management (LSM) provides the double benefits of reducing the numbers of house-entering mosquitoes and, importantly, those that bite outdoors (Fillinger & Lindsay, 2011). 26 University of Ghana http://ugspace.ug.edu.gh 2.7 Targets of stages of mosquito with insecticides 2.7.1 Larviciding Larviciding denotes the process of killing the larvae of an insect (Baffour-Awuah, 2012). Many compounds comprising surface and oil films, bacteria larvicides, insect growth regulators, synthetic organic chemicals, and spinosyns can be used as larvicides (WHO, 2013a). Microbial larvicides such as Bacillus sphaericus or Bacillus thuringiensis or a combination of the two have proven to be effective in the control of mosquito larvae in different areas (Fillinger et al., 2009; Geissbühler et al., 2009; Fillinger & Lindsay, 2011; Baffour-Awuah, 2012; Maheu- Giroux & Castro, 2013; Afrane et al., 2016). These larvicides present numerous modes of actions against mosquito larvae. For instance, insect growth regulators thwart the development of the larvae, monolayers cause suffocation of mosquito larvae, and botanical or synthetic toxins directly interfere with the metabolic activities of insects (Fillinger & Lindsay, 2011). Larval control targets the aquatic stage of the mosquito by reducing mosquito larval sites, thus killing both indoor and outdoor biting mosquitoes (Fillinger & Lindsay, 2011). The suppression of mosquito larvae using larvicides serves as an excellent add-on to current methods such as the use of long-lasting insecticidal nets (LLINs) and indoor residual spraying (IRS) (Antonio- Nkondjio et al., 2018). 2.7.2 Adulticiding Mosquito adulticide is a kind of insecticide used to eradicate adult mosquitoes (CDC, 2016). Adulticiding is just a word used to describe mosquito management activities targeted at adults. The control of the adult mosquito is the most common type of mosquito control (WHO, 2009b) and depend primarily on the use of long-lasting insecticidal nets (LLINs) and indoor residual spraying (IRS) (Steketee & Campbell, 2010; Alemayehu et al., 2017; Camara et al., 2018). These are the most powerful and primarily used interventions (WHO, 2009b). In addition, in 27 University of Ghana http://ugspace.ug.edu.gh sub-Saharan Africa and other developing countries, some households use mosquito repellents such as mosquito coils to control adult mosquitoes (Agyekum, 2017). 2.8 Class of insecticides and their targets One way of controlling malaria is to prevent the infective mosquito from biting individuals, and this is done using insecticides (bed nets and indoor residual spraying) (Agyekum, 2017). Efforts from international agencies such as the US President's Malaria Initiative (PMI), World Bank, United Nations International Children's Emergency Fund (UNICEF), and Department for International Development (DFID), among others, as well as home governments to reduce malaria burden in sub-Saharan Africa have resulted in scaling up vector control measures, and this has resulted in a decline in malaria cases (WHO, 2011). The current control programs are primarily dependent on pyrethroid-based insecticides, which are the only recommended insecticides by the WHO for insecticide-treated nets (ITNs) (WHO, 2006). All the interventions aimed at the adult mosquito mainly depend on chemical insecticides. For instance, chemical insecticides such as pyrethroids are used for making long- lasting insecticidal nets (LLINs) (Essandoh et al., 2013), indoor residual spraying (IRS) (Da Cruz et al., 2019), and most mosquito repellents (Vences-Mejía et al., 2012; Hogarh et al., 2018). Pyrethroid insecticides are the only insecticide endorsed by the WHO to be used in most indoor residual sprays and treated bed nets (WHO, 2017). Other insecticides such as carbamates, organochlorines and organophosphates have been used to control mosquitoes (Cuervo-Parra et al., 2016). The efficacy of these insecticides has been challenged as mosquitoes have developed resistance to some classes of insecticides (Annan et al., 2014; Baffour-Awuah et al., 2016; Antonio-Nkondjio et al., 2017). Any modifications in mosquitoes could worsen the effectiveness of insecticides in the control of mosquitoes. 28 University of Ghana http://ugspace.ug.edu.gh 2.8.1 Carbamate insecticides Carbamates are a class of insecticides structurally and mechanistically similar to organophosphate (OP) insecticides. Carbamates are N-methyl Carbamates derived from a carbamic acid and cause carboxylation of acetylcholinesterase at neuronal synapses and neuromuscular junctions (Silberman & Taylor, 2020). They are an important class of pesticides used worldwide in public health, among rural and urban settings. They include carboxyl (Sevin), aldicarb (Temik), and Propoxur (Baygon) (Adam & Lawson, 2010). Carbamate insecticides are synaptic poisons and bind to an enzyme found in the synapse called acetylcholinesterase. This enzyme is designed to stop a nerve impulse after it has crossed the synapse (Adam & Lawson, 2010). Carbamate insecticides bind to and cause reversible inhibition of the acetylcholinesterase enzyme. Elevated acetylcholine levels because of acetylcholinesterase (AChE) inhibition leads to increased neurotransmitter signaling (Silberman & Taylor, 2020). Therefore, the poisoned synapses cannot stop the nerve impulse leading to paralysis due to energy exhaustion (Ishak, 2014). 2.8.2 Organochlorine (OC) insecticides Organochlorines (OC) are a group of chlorinated compounds extensively used as pesticides. They belong to persistent organic pollutants (POPs) with high persistence in the environment (Jayaraj et al., 2016). Organochlorine (OC) insecticides have been used to control malaria and typhus; however, they are prohibited in most advanced countries because of their high persistence in the environment and their harmful effects (Karasali & Maragou, 2016). Organochlorine (OC) insecticides can be categorized into three groups: (a) Dichloro-diphenyl- trichloroethane (DDT) and its analogues; (b) lindane and the cyclodienes; and (c) mirex and chlordecone (Ray, 2010). Examples of OC insecticides include DDT, Aldrin, chlordane, toxaphene, lindane and dieldrin (Rhee & Aks, 2007). 29 University of Ghana http://ugspace.ug.edu.gh The mechanism of action differs slightly based on the type of organochlorine. For instance, DDT-type insecticides act on the peripheral nervous system. At the axon's sodium channel, they prevent gate closure after activation and membrane depolarization. Sodium ions leak through the nerve membrane and create a destabilizing negative "after potential" with hyperexcitability of the nerve. This leakage causes repeated discharges in the neuron spontaneously or after a single stimulus (Coats, 1990). On the other hand, the chlorinated cyclodienes type binds at the picrotoxinin site in the gamma-aminobutyric acid (GABA) chloride ionophore complex, which inhibits chloride flow into the nerve (Coats, 1990). 2.8.3 Organophosphorus (OP) insecticides Organophosphorus insecticides, often known as organophosphates (OPs), contain phosphorus/phosphoric acid esters or thiophosphoric acid esters (Adam & Lawson, 2010). Examples of organophosphates include malathion, diazinon, parathion, fenitrothion, dichlorvos, and chlorpyrifos (Ishak, 2014; Riches, 2015). Organophosphorus (OP) insecticides are slightly more toxic than carbamates, and this may be attributable to the fact that their binding to the receptor is irreversible, while that of carbamates is reversible (Sánchez-Bayo, 2012). Organophosphates kill insects by binding to and inhibiting the transmission of acetylcholinesterase (AChE) at the synaptic junction of the insect nervous system (Ishak, 2014). This results in the accumulation of acetylcholine in nerve tissue and effectors organs, with the main site of action being the peripheral nervous system (Adam & Lawson, 2010). 2.8.4 Pyrethroid insecticides Pyrethroids are a synthetic derivate of pyrethrins, natural organic insecticides produced from the flowers of Chrysanthemum cinerariaefolium and C. coccineum. They are used in many synthetic insecticides and are highly specific against insects (Gajendiran & Abraham, 2018). It 30 University of Ghana http://ugspace.ug.edu.gh is one of the major insecticides used in mosquito control programs (Nkya et al., 2013; Bowman et al., 2018). Pyrethroids act on either the central nervous system or peripheral nerves, such as sensory axons or motor axons at low concentrations. The action on peripheral nerves is exceptional to this class of insecticide and complicates studies on the mode of action because it is difficult to determine the site of action (central or peripheral) that might be vital in toxicity (Coats, 2012). Pyrethroids may be divided into two groups: type I and type II pyrethroids. Examples of type I pyrethroids include allethrin, permethrin, and lismethrin, while type II includes fenvarelate, deltamethrin, and cypermethrin (Adam & Lawson, 2010). Type I pyrethroids produce repetitive action potentials at the nerve function level due to the increase in depolarizing after- potential, but type II pyrethroids cause membrane depolarization resulting in discharges from sensory neurons (Narahashi, 2010). Pyrethroids are axonic poisons, which bind to a protein in nerves called the voltage-gated sodium channel. Usually, this protein opens, causing stimulation of the nerve and closes to terminate the nerve signal. Pyrethroids bind to this gate and prevent it from closing normally, which results in continuous nerve stimulation (Adam & Lawson, 2010). 2.9 Mechanisms used by mosquitoes to develop an insecticide resistance phenotype The prolonged use of pyrethroids and other insecticides has resulted in resistance against malaria vectors (WHO, 2016a). It is projected that the swift expansion of insecticide resistance in malaria vectors due to the repeated use of insecticides could affect malaria control efforts (Antonio-Nkondjio et al., 2017). Many resistance mechanisms exist in individual mosquito species (Liu, 2015). 31 University of Ghana http://ugspace.ug.edu.gh According to the Insecticide Resistance Action Committee (IRAC), resistance is "the selection of a heritable characteristic in an insect population resulting in the repeated failure of an insecticide product to provide the intended level of control when used as recommended" (IRAC, 2006). Resistance to insecticides arises when increased levels of an enzyme system cause it to detoxify the insecticide faster than usual, consequently averting it from reaching its site of action (WHO, 2012). There are four types of insecticide resistance mechanisms in the malaria vector: target site, metabolic, cuticular, and behavioral resistance (Corbel & N’Guessan, 2013; Kabula et al., 2014a; Kabula et al., 2014b; Matowo et al., 2014). Out of these four, the first two (target site and metabolic resistance) are the most common and extensively studied (Matowo et al., 2010; Ranson et al., 2011; Corbel & N’Guessan, 2013; Liu, 2015). Usually, these two mechanisms combine, resulting in complex cross-resistance and high resistance levels (Labbé et al., 2011). This study focused on metabolic resistance in An. gambiae (s.l.) mosquitoes. The four types of insecticide resistance mechanisms can be grouped into two major categories; (a) mechanisms that decrease the effective dose of the insecticides (metabolic, cuticular, and behavioral resistance) and (b) mechanisms that render the dose of insecticide ineffective (target site resistance) (Oliver, 2015). Figure 6 summarizes the mechanism of insecticide resistance. 32 University of Ghana http://ugspace.ug.edu.gh Figure 6: Summary of mechanisms used by mosquitoes to produce a resistance phenotype Resistance mechanisms are highlighted in red text. The mechanisms corresponding to the red region on the concentration gradient (altered behavior, decreased cuticular penetration and metabolic mechanisms) aim to reduce the efficacy of the insecticide. The remaining mechanisms, all resulting in target site insensitivity, are all targeted at rendering the dose of the insecticide inactive (Oliver, 2015). 2.9.1 Target site resistance Target site resistance results from modification in the structure or mutation (point mutation) of genes that encode target proteins interacting with insecticides (Casida & Durkin, 2013). It causes a mutation in the target that prevents the insecticide from binding to its target organ (Hardy, 2014), eliminating or significantly reducing the effectiveness of the insecticide (FAO, 2012). The main targets of insecticides are receptors or enzymes of the nervous system: acetylcholinesterase (AChE), the voltage-dependent sodium channel (CNaVdp), and the receptor of c-aminobutyric acid (Sokhna et al., 2013). For instance, after insecticides bind to the sodium channels, they cause the nervous system of the insect to repeatedly discharge and depolarize the insect's nerve membranes (Narahashi, 2002), which eventually leads to the death of the insect (Liu, 2015). According to Sokhna et al. (2013), mutation of these targets is a very effective resistance mechanism, inducing cross-resistance to all insecticides acting on the same 33 University of Ghana http://ugspace.ug.edu.gh target. Numerous insecticide target modifications have been studied: the voltage-dependent sodium channel encoded by the kdr gene, the synaptic acetylcholinesterase (AChE1) encoded by the ace-1 gene, as well as the gamma-aminobutyric acid (GABA Receptors) encoded by the RDL gene (Labbé et al., 2011; Ranson et al., 2011). 2.9.2 Cuticular resistance Cuticle thickening is a gene-regulated process that an insect goes through as it ages. The cuticle is placed in a circadian pattern, leading to growth rings of diurnal non-lamellate and nocturnal lamellate structure (Wood et al., 2010). The insect's body is shielded by a cuticle, a hard exoskeleton providing support and protection from ultraviolet radiation, dehydration, and fungal and bacterial pathogens. The cuticle comprises many layers, each having different physicochemical properties. The outermost waxy layer includes saturated and unsaturated hydrocarbons, free alcohols, free fatty acids, wax esters, sterol esters, glycerides, and aldehydes (Suarez et al., 2011). When insects are exposed to insecticides, the insecticides have to cross the insect's cuticle before reaching the target site to induce the effect. In this case, the cuticle functions as the first line of defense against insecticides. Cuticular barriers are developed in resistant insects by forming a thicker cuticle or changing the cuticular structure to lessen insecticide penetration into their body (Dang et al., 2017). Cuticular resistance has been linked with pyrethroid resistance in An. funestus and Triatoma infestans (Pedrini et al., 2009; Wood et al., 2010). 2.9.3 Behavioral resistance Behavioral resistance is any avoidance behavior that results in an increased chance of survival for an insect or its offspring (Pittendrigh et al., 2014). The definition of behavioral resistance has been contested as most cases of behavioral resistance to insecticides are just antipathy behaviors that are either learned or based on avoidance or simple repellency (Zalucki & 34 University of Ghana http://ugspace.ug.edu.gh Furlong, 2017). Behavioral avoidance is more preferred to behavioral resistance as “it is an innate and involuntary response to external stimuli rather than a permanent, genetically-based shift in behavior as the development of apparent fixed behavioral changes because of insecticide selective pressure has not been sufficiently documented to occur under natural conditions” (Chareonviriyaphap et al., 2013). Numerous types of behavioral resistance have been described in insects; some are connected with the mobility and others immobility of the insect. Both mechanisms allow the insect to evade contact with the toxic product or reduce the duration of the contact (Sokhna et al., 2013). Behavioral modifications have been reported in mosquitoes exposed to insecticides. These modifications include a shift from endophilic (i.e. resting in houses after blood meals) to exophilic (i.e. resting outdoors after blood meals) behavior, changes in the time of feeding, and host choice preference (Sokhna et al., 2013; Wamae et al., 2015). Behavioral resistance is less frequently observed than physiological resistance in which the insect comes into contact with the insecticide but is not killed (Russell et al., 2013). 2.9.4 Metabolic resistance Metabolic resistance is due to point mutations that affect protein activity (e.g. a change in binding affinity or a modified substrate specificity) or through modifications in the cis/trans- regulatory loci of the enzyme families (Ishak, 2014). It is most often found in insects and based on enzyme systems that the insects have developed to help them naturally detoxify insecticides and other foreign elements (FAO, 2012; Gatton et al., 2013). The common metabolic enzymes associated with resistance include; mixed-function oxidase (or monooxygenase), glutathione- S-transferases (GSTs), acetylcholinesterase (AChE), and non-specific esterase (NSE) (alpha- and beta-naphthyl acetate) (WHO, 2013b; Yahouédo et al., 2016; Camara et al., 2018; Leong et al., 2019). 35 University of Ghana http://ugspace.ug.edu.gh Upregulation of enzyme levels or an upsurge in the metabolism of insecticides indicates the potential involvement of a metabolic enzyme in resistance (Liu, 2015). High levels of metabolic enzymes, in general, have been reported in insecticide-resistant mosquitoes of several Anopheles species in Africa (Liu, 2015). For instance, Camara et al. (2018) quantified the mean levels of non-specific esterase (NSE) (alpha- and beta-naphthyl acetate), glutathione S-transferases (GST), and mixed-function oxidases (MFO) in An. gambiae (s.l.) from Côte d'Ivoire. Likewise, in north-eastern Tanzania, the levels of non-specific esterase and mixed- function oxidase levels in An. arabiensis have been reported (Matowo et al., 2010). 2.9.4.1 Metabolic enzymes 2.9.4.1.1 Cytochrome P450 monooxygenases Cytochrome P450, or CYP gene, is a major family of genes found in almost all living organisms such as animals, plants, bacteria, fungi, and protists. The role of the enzyme has been recorded in many physiological processes (Feyereisen, 2012). The Cytochrome P450 (CYP) superfamily comprises hemeproteins that play a crucial role in the breakdown of many endogenous (e.g. hormones) and xenobiotic compounds, including pyrethroids (Bebe & Panemangalore, 2005; Hardstone et al., 2007). Cytochrome P450 in insects is essential because of their role in both the bioactivation and detoxification of insecticides (Hardstone et al., 2007), and is the prominent enzyme family responsible for pyrethroid breakdown. Approximately, 111 P450 enzymes are found in An. gambiae (s.s.) mosquitoes (Ranson et al., 2011). Naming a cytochrome P450 gene always start with the core symbol "CYP", followed by an Arabic numeral indicating the CYP family (e.g. CYP3, CYP6), a capital letter M, N, and P represents the subfamily (e.g. CYP3M, CYP6P), and another Arabic numeral which demonstrates the individual gene/isozyme/isoform/isoenzyme (e.g. CYP6M2, CYP6P3) (Badyal & Dadhich, 2001). Specifically, five 'candidate' P450 genes are explicitly overexpressed in pyrethroid-resistant adult mosquitoes; CYP6Z1, CYP6Z2, CYP6M2, 36 University of Ghana http://ugspace.ug.edu.gh CYP325A3 (Müller et al., 2008), and CYP6P3 (Ranson et al., 2011). These genes encrypt enzymes that can cohere to pyrethroid insecticides; however, only two genes (i.e. CYP6P3 and CYP6M2) can break down the insecticide (Ranson et al., 2011). According to Yahouédo et al. (2016), there is a widespread overexpression of CYP6M2 and CYP6P3 in West Africa, especially in Ghana, Benin, and Nigeria. 2.9.4.1.2 Glutathione-S-transferases (GSTs) Glutathione S-transferases (EC2.5.1.18) are ubiquitous in both plant and animal species (Alias, 2016) and are essential in the detoxification of xenobiotic (e.g. herbicides, and insecticides) and endogenous compounds (Samra et al., 2012). In insects, GSTs may serve as a binding protein that sequesters pyrethroids before breaking down by enzymes such as cytochrome P450 and carboxylesterases (Samra et al., 2012). Glutathione S-transferases (GSTs) are a superfamily of versatile isoenzymes implicated in several intertwined cellular metabolisms, comprising detoxification of xenobiotic compounds (Gunasekaran et al., 2011). The nomenclature of the insect GSTs comprises three parts; the name of the species from which the enzyme was extracted, the class of the enzyme, and a number representing the specific genome organization or the order of discovery. For instance, AgGSTD5-5 is An. gambiae GST, letter D denotes the delta class of the enzyme, and the number "5-5" shows a homodimer enzyme (Che-Mendoza et al., 2009). In addition, GSTs are grouped based on their cellular localizations into three main families: cytosolic, microsomal, and mitochondrial/peroxisomal GSTs (Sookrung et al., 2018). The greater part of insects GSTs are cytosolic dimeric enzymes, which are grouped into six classes, namely; delta, sigma, epsilon, theta, zeta, and omega, depending on the specificity of the substrate, chromosomal location, and sequence similarity (Samra et al., 2012; Shou-Min, 2012; Sookrung et al., 2018). Glutathione S-transferases (GSTs) with more than 40% sequence identity are usually put in the same class (Samra et al., 37 University of Ghana http://ugspace.ug.edu.gh 2012). In mosquitoes, three microsomal GSTs (MGSTs) have been reported, but only cytosolic GSTs have been associated with insecticide resistance (Che-Mendoza et al., 2009). High levels of GST levels have been linked to insecticide resistance in various insects (Che-Mendoza et al., 2009). GST levels have been reported in insecticide-resistant mosquitoes, including some Anopheles and Aedes species (Liu, 2015). 2.9.4.1.3 Acetylcholinesterase (AChE) Acetylcholinesterase (AChE) (EC 3.1.1.7) is an important enzyme involved in the termination of nerve transmission at cholinergic synapses by hydrolyzing the neurotransmitter, acetylcholine (ACh) released from the presynaptic terminal, making it an effective target for organophosphate and carbamate insecticides (Shang et al., 2012). It belongs to the carboxylesterase family of enzymes and is responsible for hydrolyzing the acetylcholine at nerve synapses. In the absence of hydrolysis, there is a build-up of acetylcholine, resulting in the repeated firing of neurons and eventually death by enervation (Gunning & Moores, 2001). In vertebrates, ACh serves as an excitatory transmitter for voluntary muscle in the somatic nervous system. It also acts as both preganglionic and postganglionic transmitter in the parasympathetic nervous system and preganglionic transmitter in the sympathetic nervous system (Fulton & Key, 2001). Acetylcholinesterase is a widespread resistance mechanism in vector mosquitoes such as Aedes, Anopheles, and Culex (Polson et al., 2011; Scott & McAllister, 2012; Akiner, 2014). 2.9.4.1.4 Non-specific esterase (NSE) Non-specific esterase is one of the esterases' substrate specificity (Sood et al., 2016). Esterase is a major family of enzymes responsible for insecticide resistance in agricultural pests and disease vectors. Non-specific esterase plays a crucial role in the resistance of mosquitoes to carbamate, organophosphates (OPs), and pyrethroid insecticides (Prasad et al., 2017). 38 University of Ghana http://ugspace.ug.edu.gh The esterase family comprises many enzymes that catalyze the hydrolysis of esters. Esterases are associated with important physiological roles of insects such as development, behavior, reproduction, and insecticide resistance. Esterases can be categorized according to alpha- or beta-esterase based on their ability to hydrolyze the substrates alpha- and beta-naphthyl acetate, respectively (Dahan-Moss & Koekemoer, 2016). Resistant insects overproduce non-specific esterase or carboxylesterases by gene up-regulation to rapidly sequester the insecticides. This mechanism has been reported in many insect species such as mosquitoes, aphids, cattle ticks, cockroaches, Cimex hemipterus and Cimex lectularius (Matowo et al., 2010; Dang et al., 2017). 2.10 Predominant insecticides in Ghana In Ghana, the predominant insecticides for malaria control are pyrethroids, particularly the long-lasting insecticide-treated nets (LLINs) that are distributed for free to the public, and indoor residual spraying (IRS) (Kawada et al., 2014; Dadzie et al., 2017; Brake et al., 2022). Additionally, mosquito coils, though not part of the approved methods of mosquito control, are widely used in Ghana to control mosquitoes. Most of these mosquito coil products on the Ghanaian market are pyrethroid-based with active ingredients such as esbiothrin, dimefluthrin, allethrin, and meperfluthrin (Hogarh et al., 2018). Overall, the use of pyrethroids in both LLINs and IRS has been effective in reducing malaria transmission in Ghana, although there are concerns about the development of insecticide resistance and the need for continued vigilance in monitoring and adapting control strategies (Baffour-Awuah et al., 2016; Chabi et al., 2016; Amlalo et al., 2022; Owusu-Asenso et al., 2022). Temperature is a critical factor underlying insecticide toxicity and has been reported to affect the efficacy of public health insecticides against some malaria vector species (An. arabiensis and An. funestus) (Glunt et al., 2018). The influence of temperature on toxicity can be either positive or negative, which depends on the mode of action of the insecticide and the insect species in question in addition to the route of exposure (Gordon, 2005). For instance, a study 39 University of Ghana http://ugspace.ug.edu.gh conducted by Khan and Akram (2014) reported that the toxicity of deltamethrin decreased with increasing temperature with a negative temperature ratio (-2.42). 2.11 Effect of climate change and climate variability on insect vectors Climate change and climate variability are often used interchangeably; however, there is a distinction between the two terminologies. According to the Intergovernmental Panel on Climate Change (IPCC), climate change is a statistically significant variation in either the mean state of the climate or its variability, persisting for extended periods (Elbers et al., 2015). On the other hand, according to the World Meteorological Organization (WMO), climate variability is defined as variations in the mean state and other statistics of the climate on all temporal and spatial scales, beyond individual weather events (WMO, 2019). Climate change is no longer disputed; however, the controversy lies in the mechanisms liable for them (Beugnet & Chalvet-Monfray, 2013) and whether something should be done in response (Henderson et al., 2015). Climate change is projected to cause latitudinal and altitudinal temperature escalations. Projections by IPCC show that by the year 2100, global average surface temperature will rise by 1.1 – 6.4 °C. This increase is about 2 – 9 times higher than globally averaged warming within the past century (IPCC, 2007). In Africa, simulations of climate models under a range of possible emission scenarios propose that in all seasons, the median temperature upsurge lies within 3 and 4 °C, which is about one and half times the global mean (Herrero et al., 2010). Such a rise in temperature could modify the ecology and biology of many mosquito vectors and their transmission dynamics (Afrane et al., 2012). Climate change or climate variability has direct effects on vectors (e.g. longevity, abundance, and distribution), hosts (e.g. distribution, abundance, and behavior), pathogens (e.g. lineage, incubation period, and replication), as well as their interactions (Tabachnick, 2010; Roiz et al., 2014). Due to the strong influence of temperature on insect's life cycle, they are expected to 40 University of Ghana http://ugspace.ug.edu.gh react to climate change (Wilson & Maclean, 2011), and the variations in global climate will affect arthropod vectors such as mosquitoes by modifying their distribution patterns and ability to transmit diseases (Tabachnick, 2010). In Africa, climate change or climate variability pose a significant threat to sustainable growth and development. The continent is the least contributor to climate change, yet to a larger extent, it is susceptible to climate change (Ampadu et al., 2018). In Ghana, climate change is experienced through decreased rainfall levels and increased temperatures (EPA, 2011; Mattah et al., 2018). Most climate studies in Ghana have focused on household's vulnerability (Antwi- Agyei et al., 2013; Antwi-Agyei et al., 2014), adaptation strategies (Fosu-Mensah et al., 2012; Antwi-Agyei et al., 2015), food systems/security (Armah et al., 2011; Codjoe & Owusu, 2011). Unfortunately, studies have not investigated the impacts of climate change or climate variability on mosquito's development, especially the An. gambiae (s.l.) species, which is the vector responsible for malaria. According to WHO (2009a), climate change directly affects the biology of vectors, thus their abundance and distribution, which is a crucial factor of vector-borne disease outbreak. The climate parameter of interest in this research is temperature. It is considered as one of the essential abiotic environmental factors that affect physiological functions and biological processes as well as growth, reproduction, and locomotion in ectotherms (Ezeakacha & Yee, 2019). Furthermore, the temperature-dependencies are different for the four stages of the life cycle of the mosquito, and this leads to irregularities in population responses to temperature (Bayoh & Lindsay, 2003, 2004; Gilioli & Mariani, 2011; Lebl et al., 2013). 41 University of Ghana http://ugspace.ug.edu.gh 2.12 Summary of reviewed literature on temperature, Anopheles mosquito growth, development and survival 2.12.1 Introduction Climate change is one of the most significant global challenges in the twenty-first century (Bulkeley, 2013). It is a global phenomenon (De Lima-Camara & Honorio, 2016; Sánchez García & Díez Sanz, 2018; Smith & Mayer, 2018), largely caused by anthropogenic activities and poses significant risks to a broad range of human and natural systems (National Research Council, 2011). Climate change is being experienced through an increase in global temperatures, sea-level rise, shrinking ice sheets, warming oceans, Arctic sea ice decline, glacial retreat, increasing extreme events, ocean acidification, and decreased snow cover (Dantas-Torres, 2015). Climate change may affect human health in many ways, including affecting livelihood and food security (Antwi-Agyei et al., 2014; Ampadu et al., 2018). In addition, climate change could directly influence the patterns of infectious diseases and vector- borne diseases (McIntyre et al., 2017) and modify vector distribution and the extension of geographical ranges of mosquitoes such as the malaria vector (Elbers et al., 2015). Anopheles mosquitoes are poikilotherms with growth and development characteristics strongly dependent on the ambient temperature. These characteristics include the length of the gonotrophic cycle, fecundity, biting rate, longevity, and development of immature mosquitoes (Ciota et al., 2014). Thus, any factor that alters these characteristics can potentially affect the ability of mosquitoes to transmit diseases. Climate parameters such as temperature, humidity, and rainfall noticeably influence both the growth, development and survival as well as the sporogonic development of parasites in the host (Guerra et al., 2010; Hay et al., 2010; Afrane et al., 2012). Temperature also affects the immune system of mosquitoes (Murdock et al., 2012a; Murdock et al., 2012b; Murdock et al., 2013). Whereas the interventions aimed at controlling Anopheles mosquito employ insecticides, the efficacy of these insecticides is not only a function of the active ingredient, ambient temperatures also play a unique role in 42 University of Ghana http://ugspace.ug.edu.gh determining the overall effectiveness of insecticide application for insect control (Glunt et al., 2014; Oxborough et al., 2015; Glunt et al., 2018). Studies have considered the effects of temperature on different growth and development characteristics of mosquitoes, including development time, survival, body size, fecundity, and longevity (Mohammed & Chadee, 2011; Lyons et al., 2012; Carrington et al., 2013; Christiansen-Jucht et al., 2014; Ciota et al., 2014; Christiansen-Jucht et al., 2015; Oliver & Brooke, 2017; Ezeakacha & Yee, 2019). For instance, Ezeakacha and Yee (2019) investigated the role of temperature in affecting the carry-over effects and larval competition in A. albopictus mosquitoes and found that the development time of immature stages of mosquitoes and fecundity of adult mosquitoes decreased with increasing temperatures. The conditions at the immature stages of mosquitoes influence the quality of adult life (Mpho et al., 2002) as well as the determination of the age structure of the adult population (Beck-Johnson et al., 2013). No study has systematically synthesized the evidence linking temperature to the growth and development of Anopheles mosquitoes. 2.12.2 Methods The findings of the systematic review were reported following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines (Liberati et al., 2009). The systematic review has also been registered with PROSPERO (https://www.crd.york.ac.uk/prospero/display_record.php?ID=CRD42020196407 (accessed on 24 June 2021)) and had the registration number CRD42020196407 assigned to it. 2.12.2.1 Eligibility criteria To assess the effects of temperature on Anopheles mosquito development and survival, original studies that considered either the immature or the adult Anopheles mosquitoes irrespective of the complex were included. In addition, the review included studies that considered either field 43 University of Ghana http://ugspace.ug.edu.gh studies, laboratory studies, or both. Studies that evaluated any of the following outcomes: development rate, longevity, fecundity, length of the gonotrophic cycle, biting rate, susceptibility to insecticides, and the expression of enzymes and genes were also included. However, studies that did not focus on Anopheles mosquitoes and any of the listed outcomes were excluded. Studies not written in English were also excluded. In addition, review papers, books, opinions, scientific reports and perspectives, and duplicate records were all excluded. 2.12.2.2 Search Strategy and Selection Criteria An initial search was conducted to identify keywords and synonyms. Research articles published up to March 2021 were systematically retrieved from PubMed, Science Direct, Scopus, ProQuest, Web of Science, and Google Scholar databases. This search was conducted in September 2020 and updated in March 2021 to retrieve any current articles. A detailed search strategy (Appendix I) was developed and used in the article searching stage of the systematic review. The search strategies used terms such as Anopheles mosquito, malaria, temperature, temp*, season*, survival, longevity, among others. Combinations of different search strings and search terms were employed for each electronic database to enhance the search's sensitivity and specificity. Articles were exported into EndNote reference manager (version X9). Three independent reviewers screened the titles and abstract of search results to assess potentially eligible studies. Full-text articles were then retrieved and reviewed to obtain the final set of articles included in the review. Disagreements in the screening and selection of articles were resolved by dialogue, and a consensus was reached at all stages. 2.12.2.3 Data Extraction A data-extraction form was pretested and later revised to include author details, study type, study location, Anopheles species considered, the rearing conditions, and the outcome of interest. Data from the included studies were first extracted and reviewed by three reviewers 44 University of Ghana http://ugspace.ug.edu.gh independently and later jointly to resolve disagreements. Where it became necessary, corresponding authors of some of the included studies were contacted for further information. 2.12.2.4 Risk of Bias Assessment Three reviewers independently assessed the risk of bias of included studies. Disagreements were resolved through discussion and involvement of a fourth person where necessary. The risk of bias was assessed using the Systematic Review Center for Laboratory Animal Experimentation's (SYRCLE's) tool for animal studies (Hooijmans et al., 2014). The tool comprises ten (10) domains with six (6) types of bias: selection bias, performance bias, detection bias, attrition bias, reporting bias, and others. The ten (10) items are structured in sub- sections in question forms that require a “Yes (low risk),” “No (high risk),” or “Unclear (unclear risk)” answer. 2.12.2.5 Data Analysis A narrative synthesis of all the included studies was performed based on the outcome of interest, and the findings were reported in tabular form for easy interpretation and understanding. All the included studies were quantitative; however, this review did not include a meta-analysis. 2.12.3 Synthesis of evidence and gaps in current literature on temperature, growth, development, and survival of Anopheles mosquito 2.12.3.1 Search results From the search, 8130, 5926, 1403, 1156, 850, and 17 records were retrieved from Google Scholar, Scopus, Science Direct, PubMed, ProQuest, and Web of Science databases, respectively (Appendix I). Four (4) additional articles were obtained through contacts with experts in the field and screening the reference lists of included studies. After removing duplicates and screening titles and abstracts, 65 records were included for full-text assessment. Thirty-six (36) articles were excluded with reasons (Appendix II), while 29 articles (Wallace 45 University of Ghana http://ugspace.ug.edu.gh & Merritt, 1999; Bayoh & Lindsay, 2003, 2004; Rúa et al., 2005; Impoinvil et al., 2007; Aytekin et al., 2009; Kirby & Lindsay, 2009; Olayemi et al., 2011; Phasomkusolsil et al., 2011; Charlwood & Bragança, 2012; Lyons et al., 2012; Murdock et al., 2012a; Lyons et al., 2013; Murdock et al., 2013; Paaijmans et al., 2013a; Paaijmans et al., 2013b; Christiansen-Jucht et al., 2014; Glunt et al., 2014; Mala et al., 2014; Murdock et al., 2014; Christiansen-Jucht et al., 2015; Davies et al., 2016; Barreaux et al., 2016b; Faiman et al., 2017; Oliver & Brooke, 2017; Shapiro et al., 2017; Barreaux et al., 2018; Glunt et al., 2018; Mamai et al., 2018) fully met the inclusion criteria (Figure 7). 46 University of Ghana http://ugspace.ug.edu.gh Records identified through database searching (n = 17,482) Google Scholar: 8130; Scopus: 5926; Additional records identified Science Direct: 1403; PubMed: 1156 through other sources ProQuest: 850; Web of Science: 17 (n = 4) Records after duplicates removed (n = 15370) Records screened Records excluded (n = 15370) (n = 15305) Full-text articles excluded, with reasons Full-text articles assessed for (n = 36) eligibility (n = 65) n = 21 studies used mathematical models n = 8 studies were opinions/letters/scientific reports Studies included in qualitative synthesis n = 3 studies did not report on (n = 29) any of the outcomes of interest n = 4 studies were not available Studies included in quantitative synthesis (meta-analysis) (n = 0) Figure 7: PRISMA flow diagram of search phases with numbers of studies included/excluded at each stage 47 Included Eligibility Screening Identification University of Ghana http://ugspace.ug.edu.gh 2.12.3.2 Study Characteristics The included studies consisted of twenty-six (26) laboratory-based studies, two (2) field-based studies, and one (1) study that employed both study designs. Different species of Anopheles mosquitoes were reported in the included studies. Most of the included studies were conducted in Africa (9), North America (9), Europe (8), and Asia (2). However, one study did not indicate the study location. About 12 different Anopheles species were reported in the 29 studies, and the majority of these species were An. gambiae (s.s.) (9), An. arabiensis (8), An. stephensi (7), and An. funestus (5) (Table 1). Table 1: Characteristics of included studies Study Characteristics Frequency (N = 29) Percentage (%) Study design employed Laboratory-based 26 89.66 Field-based 2 6.90 Laboratory- & Field-based 1 3.45 Study location North America 9 31.03 Africa 9 31.03 Europe 8 27.59 Asia 2 6.90 Anopheles species studied An. gambiae (s.s) 9 31.03 An. arabiensis 8 27.59 An. stephensi 7 24.14 An. funestus 5 17.24 An. quadrinnulatus 2 6.90 An. superpictus 1 3.45 An. coluzzii 1 3.45 An. pharaoensis 1 3.45 An. coustani 1 3.45 An. dirus 1 3.45 An. sawadwongporni 1 3.45 An. albimanus 1 3.45 48 University of Ghana http://ugspace.ug.edu.gh 2.12.3.3 Risk of bias (RoB) assessment 2.12.3.3.1 Selection bias Except for one study (Mala et al., 2014), which was at low risk, all 28 studies reviewed were at high risk of sequence generation. With baseline characteristics, only two studies (Olayemi et al., 2011; Charlwood & Bragança, 2012) had unclear risk. Additionally, the remaining 27 had low risk. Concerning allocation concealment, the risk was unclear in twelve (12) studies (Bayoh & Lindsay, 2003, 2004; Impoinvil et al., 2007; Aytekin et al., 2009; Kirby & Lindsay, 2009; Charlwood & Bragança, 2012; Christiansen-Jucht et al., 2014, 2015; Davies et al., 2016; Barreaux et al., 2016b; Faiman et al., 2017; Barreaux et al., 2018), while the remaining fifteen (17) studies were at high risk. However, the absence of sequence generation and allocation concealment is unlikely to influence the findings (Appendix III). 2.12.3.3.2 Blinding and randomization (Performance and Detection Bias) Unlike drug trials, where it is easy to blind investigators from the intervention being administered, the investigator is not usually blinded to the treatments in most insect studies. Blinding and randomization were not applicable to the systematic review. 2.12.3.3.3 Bias (Attrition and Reporting) All the 29 studies had a low risk of attrition and reporting bias. The studies presented a detailed and consistent reporting of all outcomes pre-specified in the methods section (Appendix III). 2.12.3.3.4 Other Sources of Bias (Funding Source and Rearing of Mosquitoes) Except for eight (8) studies (Rúa et al., 2005; Aytekin et al., 2009; Kirby & Lindsay, 2009; Olayemi et al., 2011; Phasomkusolsil et al., 2011; Charlwood & Bragança, 2012; Paaijmans et al., 2013a; Barreaux et al., 2016b) that failed to disclose funding sources, the majority of the studies (20) declared the source of funding and funders did not influence the results. However, one study (Shapiro et al., 2017) had an unclear risk. Although the study indicated that funding was acquired, it did not state or provide enough information to judge funding sources. 49 University of Ghana http://ugspace.ug.edu.gh In assessing how temperature affects Anopheles mosquitoes, most of the studies reared the mosquitoes in incubators from either the egg or larval stage to adult. Rearing mosquitoes in incubators from the egg or larval to the adult stages may better assess the effect of temperature on the mosquito. Nine (9) studies (Olayemi et al., 2011; Charlwood & Bragança, 2012; Lyons et al., 2012; Murdock et al., 2012a; Murdock et al., 2013; Glunt et al., 2014; Mala et al., 2014; Murdock et al., 2014; Glunt et al., 2018) were at high risk of bias based on mosquito rearing conditions (Appendix III). In some of these studies, adult mosquitoes were only exposed to the selected temperature regimes before outcome assessment, which may affect the study's outcome. 2.11.3.4 Effects of temperature on immature stages of mosquitoes Sixteen (16) studies assessed the effects of temperature on different Anopheles species (Table 2). These studies considered larval and pupal development and survival, as well as egg hatchability. The way temperature affected the immature stages of mosquitoes differed from species to species, even among the same complex. The immature stages of An. arabiensis were more tolerant (in terms of survival) to a higher temperature than An. funestus (Lyons et al., 2012), and An. quadriannulatus (Davies et al., 2016). In addition, An. arabiensis showed faster development rates (in days) compared to An. funestus (Lyons et al., 2013) and An. quadriannulatus (Davies et al., 2016). The minimum and maximum temperatures from these studies were 10 and 40 °C, respectively. One study (Christiansen-Jucht et al., 2015) indicated that higher temperatures (23 to 31 °C) resulted in smaller larval sizes and slowed the development from hatching to adult emergence. However, most studies (Bayoh & Lindsay, 2003; Aytekin et al., 2009; Kirby & Lindsay, 2009; Phasomkusolsil et al., 2011; Paaijmans et al., 2013b; Oliver & Brooke, 2017) observed that increasing temperature reduced the development time (in days) of the immature stages. For instance, Phasomkusolsil et al. (2011) observed that An. dirus and An. sawadwongporni larvae 50 University of Ghana http://ugspace.ug.edu.gh reared at 30 °C displayed a significantly shorter developmental time (approximately 7 – 8 days) than those reared at 23 °C (12 – 14 days) (P < 0.05). Higher temperatures (30 and 35 °C) significantly increased larval development rates in two An. arabiensis strains–SENN DDT (one-way ANOVA: F = 15.1; P < 0.01) and SENN (one-way ANOVA: F = 12.4; P < 0.01) relative to their respective 25 °C control cohorts (Oliver & Brooke, 2017). An increase in temperature significantly decreased the time to pupation of An. gambiae (s.s.) larvae from 9.2 ± 0.05 days at 21 °C to 8.3 ± 0.04 days at 25 °C and 7.8 ± 0.05 days at 29 °C (Barreaux et al., 2018), and increased larval mortality (Bayoh & Lindsay, 2004; Christiansen-Jucht et al., 2014). Christiansen-Jucht et al. (2014) reported that, an increase in temperature at varying intervals of 4 °C (from 23 °C to 27 °C, P < 0.001), 8 °C (from 27 °C to 35 °C, P < 0.001), and 12 °C (from 23 °C to 35 °C, P < 0.001) significantly decreased larval survival. Increasing temperature decreased the time to hatch but not the hatching rate of Anopheles eggs. For instance, hatching of An. arabiensis eggs were fastest at 27 °C and slowest at 22 °C; nevertheless, most of the eggs hatched within two days irrespective of the water temperature (Mamai et al., 2018). There was no significant difference (P > 0.05) between the mean hatching rate of An. dirus and An. sawadwongporni eggs reared at 23 °C and 30 °C (Phasomkusolsil et al., 2011). However, extremely high temperatures can affect the hatchability of eggs. Impoinvil et al. (2007) observed that incubating eggs at 42 °C for a day resulted in a low mean hatching count relative to the other temperatures. There was no hatching of eggs when the incubation period was extended to 3, 7, and 10 days. 51 University of Ghana http://ugspace.ug.edu.gh Table 2: Effects of temperature on immature stages of Anopheles mosquitoes Species Author, Year Study Type Study Location Conditions Outcome Considered Considered 23, 27, 31, and 35 ± 1 °C • Egg hatching time ** Christiansen-Jucht et Laboratory-based United Kingdom An. gambiae (s.s.) 12:12 (L:D) photoperiod • Development time * al. (2015) RH 75% ± 5% • Larval size ** An. arabiensis 25, 20–30, and 18–35 °C • Egg hatching time ** Davies et al. (2016) Laboratory-based South Africa An. 12:12 (L:D) photoperiod • Development time ** quadriannulatus RH 80% • Larval survival ** Immature: 30–35 °C • Egg hatching count * Impoinvil et al. (2007) Laboratory-based Kenya An. gambiae (s.s.) Adult: 22–27 °C RH 80–90% 22 ± 1 °C, 22–27 ± 1 °C, 27 ± • Egg hatching time ** 1 °C Mamai et al. (2018) Laboratory-based Austria An. arabiensis • Pupation success 12:12 (L:D) photoperiod RH 80% An. dirus Phasomkusolsil et al. • Egg hatching time Laboratory-based Thailand An. 23 and 30 °C (2011) • Development time * sawadwongporni 15, 20, 25, 27, 30, and 35 °C, • Egg hatching count Aytekin et al. (2009) Laboratory-based Turkey An. superpictus 12:12 (L:D) photoperiod • Development time ** RH 65% ± 5% • Larval survival 10 to 40 °C (±1 °C), with 2 °C Bayoh and Lindsay increments • Development time ** Laboratory-based United Kingdom An. gambiae (s.s.) (2003) 12:12 (L:D) photoperiod • Adult emergence ** RH 80% ± 10% Kirby and Lindsay An. gambiae (s.s.) • Development time ** Laboratory-based United Kingdom 25, 30, or 35 °C (2009) An. arabiensis • Larval survival ** 15, 18, 20, 22, 25, 28, 30, 32 • Development time ** An. arabiensis 35, 15 °C–35, and 20–30 °C Lyons et al. (2013) Laboratory-based South Africa • Survival of immature An. funestus 12:12 (L:D) photoperiod stages RH 80% Outcomes with a single asterisk (*) indicate that higher temperatures generally increased the outcomes; Outcomes with a double asterisk (**) indicate that higher temperatures generally decreased those outcomes; Outcomes with no asterisk indicate no significant effect of temperature. 52 University of Ghana http://ugspace.ug.edu.gh Table 2 continued Species Author, Year Study Type Study Location Conditions Outcome Considered Considered Oliver and Brooke 25, 30, and 35 °C Laboratory-based South Africa An. arabiensis • Development time ** (2017) RH 80% ± 5% Paaijmans et al. United States of 16 to 36 °C, with 2 °C • Development time ** Laboratory-based An. stephensi (2013b) America increments • Larval survival ** Wallace and Merritt Field and United States of An. 18, 23, and 28 °C • Larval survival ** (1999) Laboratory-based America quadrimaculatus 20, 25, and 30 °C An. funestus Lyons et al. (2012) Laboratory-based South Africa 12:12 (L:D) photoperiod • Larval survival ** An. arabiensis RH 80% 10 to 40 °C (±1 °C), with 2 °C Bayoh and Lindsay increments Laboratory-based United Kingdom An. gambiae (s.s.) • Larval survival ** (2004) 12:12 (L:D) photoperiod RH 80 ± 10% 23, 27, 31, and 35 ± 1 °C Christiansen-Jucht et Laboratory-based United Kingdom An. gambiae (s.s.) 12:12 (L:D) photoperiod • Larval survival ** al. (2014) RH 75% ± 5% 21, 25, and 29 °C • Time to pupation** Barreaux et al. (2018) Laboratory-based Switzerland An. gambiae (s.s.) 12:12 (L:D) photoperiod RH 70% ± 5% Outcomes with a single asterisk (*) indicate that higher temperatures generally increased the outcomes; Outcomes with a double asterisk (**) indicate that higher temperatures generally decreased those outcomes; Outcomes with no asterisk indicate no significant effect of temperature. 53 University of Ghana http://ugspace.ug.edu.gh 2.11.3.5 Effects of temperature on the growth and development of adult mosquitoes 2.11.3.5.1 Longevity Five (5) studies (Aytekin et al., 2009; Olayemi et al., 2011; Faiman et al., 2017; Oliver & Brooke, 2017; Barreaux et al., 2018) assessed the longevity of different Anopheles mosquitoes from either field or laboratory populations (Table 3). Olayemi et al. (2011) reported that the longevity and survival rate of An. gambiae (s.l.) mosquitoes were higher in the rainy season (17.48 ± 2.92 days and 84.5 % ± 10.46 %, respectively) than in the dry season (7.29 ± 2.82 days and 57.47 % ± 14.9 %, respectively). The rainy season is associated with cooler temperatures and the dry season with hotter temperatures. In addition, Faiman et al. (2017) observed that the longevity of An. coluzzii increased at a lower temperature; however, the main effect of temperature was not statistically significant (P = 0.072). They detected higher longevity at a lower temperature in each experiment and between 22 °C and 23.5 °C (P < 0.001) but not between experiments at 27 °C (P = 0.072). Similar trends were reported by Aytekin et al. (2009) and Barreaux et al. (2018). More adult An. gambiae (s.s.) died with every increase in temperature compared to the baseline temperature (i.e., 23 °C). All the p-values were statistically significant (P < 0.001) for comparisons of 27 °C vs. 23 °C, 31 °C vs. 27 °C, and 31 °C vs. 23 °C (Christiansen-Jucht et al., 2014). 54 University of Ghana http://ugspace.ug.edu.gh Table 3: Effects of temperature on the longevity of Anopheles mosquitoes Study Species Outcome Author, Year Study Type Conditions Location Considered Considered 15, 20, 25, 27, 30, and 35 °C, Aytekin et al. Laboratory- Turkey An. superpictus 12:12 (L:D) • Longevity ** (2009) based photoperiod RH 65% ± 5% 21, 25, and 29 °C Barreaux et al. Laboratory- Switzerland An. gambiae (s.s.) 12:12 (L:D) • Longevity ** (2018) based photoperiod RH 70% ± 5% 22, 23.5, and 27 °C, 2:12 or Faiman et al. Laboratory- United States 11:13 L:D An. coluzzii • Longevity ** (2017) based of America photoperiod RH 85% and 50% Seasons Dry: 31.12 ± 1.09 °C, RH Field and Olayemi et al. 44.01 ± 7.02% Laboratory- Nigeria An. gambiae (s.l.) • Longevity ** (2011) Rainy: 27.67 ± based 1.27 °C, RH 69.51% ± 12.44% 25, 30, and 35 Oliver and Brooke Laboratory- South Africa An. arabiensis °C • Longevity ** (2017) based RH 80% ± 5% Outcomes with a single asterisk (*) indicate that higher temperatures generally increased the outcomes; Outcomes with a double asterisk (**) indicate that higher temperatures generally decreased those outcomes; Outcomes with no asterisk indicate no significant effect of temperature. 2.11.3.5.2 Body size In most mosquito studies, wing length has been used as a proxy to measure mosquito body size. All the seven (7) studies (Aytekin et al., 2009; Kirby & Lindsay, 2009; Phasomkusolsil et al., 2011; Charlwood & Bragança, 2012; Christiansen-Jucht et al., 2015; Barreaux et al., 2016b; Barreaux et al., 2018) reported on body size showed a decrease in wing length and body weight with increasing temperature (Table 4). For instance, An. dirus and An. sawadwongporni mosquitoes reared at 23 °C were significantly heavier and longer than those reared at 30 °C (P < 0.05) (Phasomkusolsil et al., 2011). Barreaux et al. (2018) also observed that the wing length of An. gambiae (s.s.) mosquitoes decreased significantly (F(2, 181) = 35.7, P < 0.0001) with 55 University of Ghana http://ugspace.ug.edu.gh increasing temperature from 3.27 mm at 21 °C to 3.23 mm at 25 °C and 3.02 mm at 29 °C. Except for Charlwood and Bragança (2012), who measured body sizes of field-collected mosquitoes; all the remaining studies measured the body size of adult mosquitoes reared from the egg stage through to adult. Only Christiansen-Jucht et al. (2015) measured the size of the larvae in addition to the adult mosquitoes. Table 4: Effects of temperature on the body size of Anopheles mosquitoes Study Species Outcome Author, Year Study Type Conditions Location Considered Considered 15, 20, 25, 27, 30, and 35 °C, Aytekin et al. Laboratory- Turkey An. superpictus 12:12 (L:D) • Body size ** (2009) based photoperiod RH 65% ± 5% Barreaux et al. Laboratory- An. gambiae 21 °C, 25 °C, Switzerland • Body size ** (2016b) based (s.s.) and 29 °C 21, 25, and 29 °C Barreaux et al. Laboratory- An. gambiae Switzerland 12:12 (L:D) • Body size ** (2018) based (s.s.) photoperiod RH 70% ± 5% Charlwood and Field-based Mozambique An. funestus 17 to 33 °C • Body size ** Bragança (2012) 23, 27, 31, and 35 ± 1°C Laboratory- United An. gambiae 12:12 (L:D) • Body size ** based Kingdom (s.s.) photoperiod RH 75% ± 5% An. gambiae Kirby and Lindsay Laboratory- United (s.s.) 25, 30 or 35 °C • Body size ** (2009) based Kingdom An. arabiensis An. dirus Phasomkusolsil et Laboratory- Thailand An. 23 and 30 °C • Body size ** al. (2011) based sawadwongporni The double asterisk (**) indicates that higher temperatures generally decreased those outcomes. 2.11.3.5.3 Fecundity, length of the gonotrophic cycle, and biting rate Four (4) studies (Aytekin et al., 2009; Phasomkusolsil et al., 2011; Mala et al., 2014; Christiansen-Jucht et al., 2015) assessed the effects of temperature on fecundity. Similarly, four studies (Rúa et al., 2005; Paaijmans et al., 2013a; Mala et al., 2014; Shapiro et al., 2017) also assessed the effects of temperature on gonotrophic cycle length, with only one study (Shapiro 56 University of Ghana http://ugspace.ug.edu.gh et al., 2017) considering biting rate (Table 5). Three studies reported on fecundity (Aytekin et al., 2009; Phasomkusolsil et al., 2011; Christiansen-Jucht et al., 2015) showed a decrease in fecundity with increasing temperature. For example, the mean number of eggs laid by An. dirus and An. sawadwongporni mosquitoes reared at 23 °C was significantly higher than those reared at 30 °C (P < 0.05) (Phasomkusolsil et al., 2011). However, according to Mala et al. (2014), significantly fewer Anopheles mosquitoes laid eggs during the dry season (38.2 %) than during the wet season (61.8 %) (t = 8.85, df = 1, P < 0.05). In addition, none of the adult mosquitoes emerged from a larval temperature of 20, 30, and 35 °C laid eggs (Aytekin et al., 2009). All the studies reported on the gonotrophic cycle showed a decrease in gonotrophic cycle length with increasing temperature. The duration of the gonotrophic cycle was significantly different (X2(2) = 96.68, P < 0.001) between the two seasons, as the duration of the first and second cycles was longer in the wet season (4.1 and 2.9 days, respectively) than in the dry season (3.0 and 2.2 days, respectively) (Mala et al., 2014). In contrast, the temperature of the adult environment did not influence the probability of An. gambiae (s.s.) female mosquitoes laying eggs after their first or third blood meal. However, after the second blood meal, an increase from 23 to 31 °C, and 27 to 31 °C led to a significantly lower possibility of laying eggs (0.72 vs. 0.46, P = 0.002, and 0.65 vs. 0.46, P = 0.022, respectively) (Christiansen-Jucht et al., 2015). Shapiro et al. (2017) also observed that the proportion of An. stephensi mosquitoes laying eggs was lower during the second gonotrophic cycle than the first; however, there was no noticeable effect of temperature on the probability of egg-laying in either cycle. Shapiro et al. (2017) discovered that the biting rates of An. stephensi increased with increasing temperature. From their results, biting rates almost doubled when the temperature increased from 21 to 32 °C. The biting rate was estimated in their study as the inverse of the length of the gonotrophic cycle. 57 University of Ghana http://ugspace.ug.edu.gh Table 5: Effects of temperature on fecundity, length of the gonotrophic cycle, and biting rate of Anopheles mosquitoes Study Species Outcome Author, Year Study Type Conditions Location Considered Considered 15, 20, 25, 27, 30, and 35 °C, Aytekin et al. Laboratory- Turkey An. superpictus 12:12 (L:D) • Fecundity ** (2009) based photoperiod RH 65% ± 5% 23, 27, 31, and 35 ± 1 °C Christiansen- Laboratory- United An. gambiae 12:12 (L:D) • Fecundity ** Jucht et al. (2015) based Kingdom (s.s.) photoperiod RH 75% ± 5% An. dirus Phasomkusolsil et Laboratory- Thailand An. 23 and 30 °C • Fecundity ** al. (2011) based sawadwongporni Indoor Temp Dry season (28.22 ± 1.1 °C) An. arabiensis Rainy season • Fecundity * An. pharaoensis (27.12 ± 1.2 °C) Mala et al. (2014) Field-based Kenya • Gonotrophic An. coustani Outdoor Temp cycle length ** An. funestus Dry season (26.32 ± 0.33 °C) Rainy season (24.82 ± 0.33 °C) 22, 24, and 26 °C United Paaijmans et al. Laboratory- 12:12 (L:D) • Gonotrophic States of An. stephensi (2013a) based photoperiod cycle length ** America RH 90% ± 5% Laboratory- • Gonotrophic Rúa et al. (2005) An. albimanus 24, 27, and 30 °C based cycle length ** United • Gonotrophic Shapiro et al. Laboratory- 21, 24, 27, 30, 32, States of An. stephensi cycle length ** (2017) based and 34 °C America • Biting rate * Single asterisk (*) indicates that higher temperatures generally increased the outcomes; Double asterisk (**) indicates that higher temperatures generally decreased those outcomes. 2.11.3.6 Effects of temperature on the expression of enzymes and susceptibility to insecticides Four (4) studies (Murdock et al., 2012a; Murdock et al., 2013; Murdock et al., 2014; Oliver & Brooke, 2017) assessed the effects of temperature on enzyme expression and immune responses in Anopheles mosquitoes (Table 6). Temperature significantly affected immune responses such as humoral melanization, defensin (DEF1), cecropin (CEC1), phagocytosis, and nitric oxide synthase (NOS) in An. stephensi mosquitoes. For instance, NOS expression peaked 58 University of Ghana http://ugspace.ug.edu.gh at later sampling time points in mosquitoes kept at cooler temperatures (18 °C: 24 h; 22 °C: 18 h) compared to those held at optimal or warmer temperatures (26 – 34 °C: 12 h) (Murdock et al., 2012a). A study conducted by Murdock et al. (2014) also found that NOS significantly increased at warmer temperatures (28 °C) compared to colder temperatures (20 °C vs. 28 °C, P = 0.002; 24 °C vs. 28 °C, P = 0.001). Oliver and Brooke (2017) noted no significant increase in detoxification enzyme (cytochrome P450 and general esterases) systems of An. arabiensis mosquitoes at 25 and 37 °C. Increasing temperature reduced the efficacy of insecticides in all three studies (Glunt et al., 2014; Oliver & Brooke, 2017; Glunt et al., 2018) that considered insecticide susceptibility (Table 6). Higher rearing temperatures and short-term exposure to 37 and 39 °C as adults increased pyrethroid resistance in adults of the An. arabiensis SENN DDT strain, and increased pyrethroid tolerance in the An. arabiensis SENN strain. There was a decrease in the toxicity of deltamethrin insecticide in the unselected SENN strain as the temperature increased. Likewise, increasing temperatures increased the resistance of the susceptible An. arabiensis strain to deltamethrin (Glunt et al., 2018). However, one study (Oliver & Brooke, 2017) observed no significant difference in mortality induced at either 37 or 39 °C for lambda-cyhalothrin (two- sample t-test: t = 0.47, P = 0.64) and permethrin (two-sample t-test: t = −0.63, P = 0.55). 59 University of Ghana http://ugspace.ug.edu.gh Table 6: Effects of temperature on insecticide susceptibility, expression of enzymes and immune responses in Anopheles mosquitoes Study Species Author, Year Study Location Conditions Outcome Considered Type Considered 18 °C, 25 °C, and An. funestus 30 °C • Insecticide Glunt et al. Laboratory- susceptibility South Africa RH 70% for 18 °C (2018) based An. (deltamethrin, arabiensis and 30 °C bendiocarb, RH 80% for 25 °C synergist PBO) ** • Insecticide Glunt et al. Laboratory-United States of 12, 18, 22, and 26 An. stephensi susceptibility (2014) based America °C (malathion, permethrin) Oliver and Laboratory- An. 25, 30, and 35 °C • Insecticide Brooke South Africa susceptibility based arabiensis (2017) RH 80% ± 5% • Detoxification enzyme activity 20, 22, 24, 26, and 28 ± 0.5 °C Murdock et Laboratory-United States of An. stephensi 12:12 (L:D) • Nitric oxide al. (2014) based America photoperiod synthase * RH 80% ± 5% 16, 26, 32 ± 0.5 °C; 16, 26, 32 ± 6 °C • Defensin Murdock et Laboratory-United States of An. stephensi 12:12 (L:D) • Cecropin al. (2013) based America photoperiod • Nitric oxide synthase RH 80% ± 5% 12, 18, 24, 28, and • Humoral 34 + 0.5 °C melanization Murdock et Laboratory-United States of • Cecropin An. stephensi 12:12 (L:D) al. (2012a) based America • Phagocytosis** photoperiod • Defensin RH 80% ± 5% • Nitric oxide synthase * Outcomes with a single asterisk (*) indicate that higher temperatures generally increased the outcomes; Outcomes with a double asterisk (**) indicate that higher temperatures generally decreased those outcomes; Outcomes with no asterisk indicate no significant effect of temperature. 60 University of Ghana http://ugspace.ug.edu.gh 2.12.4 Discussion This study reviewed and assessed literature for evidence of the effects of temperature on the growth and development of Anopheles mosquitoes, expression of enzymes and genes, and susceptibility to insecticides. The life cycle of mosquitoes is interdependent; thus, environmental conditions and individual characteristics in one life stage affect the other life stages (Green & McCormick, 2005; McCormick & Gagliano, 2008). An increase in temperature may have long-term repercussions on future generations (Green & McCormick, 2005). The sensitivities of adult mosquitoes to temperature differ from those of the juvenile stages (Beck-Johnson et al., 2013). Some of the included studies reared mosquitoes at a constant temperature and only exposed them to different temperature regimes prior to outcome assessment. These studies might have missed the early effects of temperature on mosquitoes; hence, the outcome of interest could be affected. The effects of rearing temperature on the immature stages can affect the growth and development of the adult mosquito and its overall fitness (Carrington et al., 2013; Ukubuiwe et al., 2018; Ezeakacha & Yee, 2019). 2.12.3.1 Effects of temperature on immature stages of mosquitoes The immature stages of mosquitoes play a critical role in determining vector-borne disease dynamics. For instance, the variations in mosquito population size are determined primarily by changes that occur during larval development and growth, directly affecting the transmission of vector-borne diseases. Moreover, the larval stage's carry-over effects can affect vectorial capacity traits such as fecundity, longevity, biting behavior, and vector competence (Barreaux et al., 2018). From the review, the time to pupation An. gambiae (s.s.) mosquitoes was mentioned to significantly decrease with increased temperature (Barreaux et al., 2018). There is consistency 61 University of Ghana http://ugspace.ug.edu.gh in the existing literature that the rate of development of the immature stages of mosquitoes is temperature-dependent (Protopopoff et al., 2009; Afrane et al., 2012). However, there were few inconsistencies in the effects of temperature on development times. It is unclear what could have accounted for differences in the results; further studies are needed to clarify these discrepancies. High temperatures are generally associated with faster development rates and have diverse effects on the insect's juvenile stages (Kingsolver & Huey, 2008; Kirby & Lindsay, 2009). However, extremely high (≥ 34 °C) temperatures delay larval development time and can induce high mortalities (Bayoh & Lindsay, 2003; Afrane et al., 2012). Some studies (Christiansen-Jucht et al., 2014, 2015) observed that no Anopheles larvae survived at 35 °C. The physiological explanation underlying this is unclear; however, one of the attributable reasons is that when fourth instar larvae are developing at a faster rate, they are unable to adjust to the associated nutrient consumption, metabolism, or accumulation, which is needed for the intricate physiological process in the change from larvae to pupa (Bayoh & Lindsay, 2003). In addition, thermal stress could affect the survival of immature mosquitoes (Ukubuiwe et al., 2018). The immature stages are sensitive to temperature because they usually live in small, isolated pools and cannot easily escape unfavorable environments (Amer et al., 2021). To overcome the thermal stress experienced, mosquitoes may have to increase their metabolic rates, resulting in higher energy expenditure (Shah et al., 2020). This could exceed oxygen supply from the environment leading to decreased performance, lowered tolerance to thermal stress (Pörtner et al., 2017), and the death of the mosquito. The review showed that higher temperatures (23 to 31 °C) resulted in smaller larval sizes. This confirms the findings of Dodson et al. (2012), who reported that increasing temperature resulted in smaller body sizes for Cx. tarsalis. The mosquito's size, especially the female, influences many epidemiologically important physiognomies, such as longevity, gonotrophic cycle length, biting rate, immunocompetence, and intensity of infection (Christiansen-Jucht et 62 University of Ghana http://ugspace.ug.edu.gh al., 2014). These physiognomies thus affect parasite development (Churcher et al., 2013) and mosquito survival (Dawes et al., 2009). This could explain why increasing temperature significantly increased larval mortality (Barreaux et al., 2018). It was noted that the way temperature affected the immature stages of mosquitoes differed from species to species, even among the same complex. However, the trend of increasing temperature with a small larval size did not change. Only one study assessed the effects of temperature on the number of adults produced. The number of adults produced from the immature stages provides useful information in determining the population dynamics. Further studies are needed to assess how temperature influences the overall productivity (number of adults produced) of the immature stages. Furthermore, none of the studies evaluated the effects of temperature on the sex ratio of the emerged adults. The number of male and female mosquitoes emerging from the immature stages is critical in controlling mosquito populations as more males could increase the mosquito population due to increased mating probability (Mohammed & Chadee, 2011). 2.12.3.2 Effects of temperature on adult mosquitoes 2.12.3.2.1 Growth and development characteristics The life expectancy of adult mosquitoes is sometimes shorter than the time required for the parasite to develop in the mosquito. Therefore, the longevity of the adult female mosquito is a significant factor in transmitting the parasite (Beck-Johnson et al., 2013). For example, malaria and other diseases such as dengue and filariasis require a minimum extrinsic incubation period (EIP) of 10 days before the female mosquito can be infective (Rajatileka et al., 2011). Before parasite transmission, the female mosquito must live longer to acquire the pathogen via a blood meal, survive beyond the extrinsic incubation period (EIP), and transmit the pathogen to a host during successive blood-feeding (Rajatileka et al., 2011). The review showed that increasing 63 University of Ghana http://ugspace.ug.edu.gh temperature and seasonal temperature variations decreased the longevity and increased the mortality of Anopheles mosquitoes. In addition, newly emerged adult mosquitoes thrived better with elevated temperatures than older mosquitoes (Lyons et al., 2012). The longevity and survival rate of An. gambiae (s.l.) showed significant seasonal variations, with much higher values observed in the rainy season (low temperature) than in the dry season (high temperature) (Olayemi et al., 2011). Likewise, as temperatures increased from 15 to 35 °C, the longevity of Anopheles mosquitoes decreased. This is similar to other studies (Swain et al., 2008; Marinho et al., 2016; Bhuju et al., 2018) that reported that mosquito longevity and mortality are negatively affected at higher temperatures. Increasing temperature decreased the longevity of mosquitoes and increased mosquito mortalities (Marinho et al., 2016; Onyango et al., 2020). The relationship between temperature and longevity can be explained in two ways. First, higher temperatures may decrease the longevity by speeding the reaction rate of various metabolic processes that affect the growth and development of the mosquito. Second, higher temperatures might heighten the damage caused by the by-products of metabolism, such as reactive oxygen species (ROS) (Keil et al., 2015). This could make mosquitoes weak and induce high mortalities hence, decreasing the longevity of mosquitoes. The review also revealed that increasing temperature reduced the body size of Anopheles mosquitoes. This is in agreement with the findings of Dodson et al. (2012), who reported that increasing larval rearing temperature resulted in smaller body size for Cx. tarsalis. The conditions in the larval environment can affect the size of the larvae and consequently the size of the adult mosquito (Lehmann et al., 2006). Generally, mosquitoes with large body sizes have more teneral reserves carried over from the juvenile stages; hence, they live longer than those with small body sizes (Barreaux et al., 2018). The size of mosquitoes affects many epidemiologically important traits, such as longevity, gonotrophic cycle length, biting rate, immunocompetence, and infection intensity (Christiansen-Jucht et al., 2014). Thus, these traits 64 University of Ghana http://ugspace.ug.edu.gh affected parasite development (Churcher et al., 2013) and the vector's survival (Dawes et al., 2009). Furthermore, mosquito size may affect the flight range as larger mosquitoes may have a better flight range than smaller ones (Yeap et al., 2013). In this sense, increasing temperatures may reduce the spread of mosquitoes within a locality. It was revealed that higher temperatures decreased the fecundity of Anopheles mosquitoes. This corroborates data in the literature, suggesting that higher temperatures reduce mosquito fecundity (Carrington et al., 2013; Marinho et al., 2016; Ezeakacha & Yee, 2019). However, one study (Mala et al., 2014) reported otherwise. The temperature difference between the two seasons reported in the study (Mala et al., 2014) was less than 2 °C (Table 5). Mala et al. (2014) findings may not only be attributed to seasonal variation as the mosquitoes used in their study might have come from a diverse population with different genetic compositions. Furthermore, the failure of adult mosquitoes emerged from a larval temperature of 20, 30, and 35 °C to lay eggs agrees with the findings of Ezeakacha and Yee (2019), who recorded no eggs laid by A. albopictus at the adult temperature of 20 °C in all the larval rearing temperatures used. The inability of mosquitoes to lay eggs at these temperatures could be that females were unmated, therefore, unable to produce mature eggs (Ezeakacha & Yee, 2019). These studies did not check the spermathecae of females or the mating status of mosquitoes. It is possible that mosquito mating may be affected by temperature. It would be of great interest for future studies to explore the effects of temperature on the mating success of Anopheles mosquitoes. This could provide useful information in controlling Anopheles mosquitoes in a future warmer climate. Usually, higher temperatures may accelerate the digestion of blood meals, reduce the gonotrophic cycle's length, and modify mosquito fecundity (Afrane et al., 2006). The review supports this as increasing temperature reduced the length of the gonotrophic cycle of 65 University of Ghana http://ugspace.ug.edu.gh Anopheles mosquitoes. An increase in temperature could fast-track blood meal digestion and lessen the gonotrophic cycle length (Mala et al., 2014). Lardeux et al. (2008) observed that an increase in temperature from 15 to 31 °C drastically reduced the length of the gonotrophic cycle of An. pseudopunctipennis from approximately nine to two days. Naturally, a relatively small number of female mosquitoes survive for quite a long period to complete more than two gonotrophic cycles (Sy et al., 2014). Therefore, any decrease in the gonotrophic cycle length can boost malaria incidence due to the increased frequency of egg-laying and biting rates of mosquitoes (Mala et al., 2014). Only one study reported the relationship between temperature and biting rate (Shapiro et al., 2017). They observed that increasing the temperature from 21 to 32 °C increased the biting rates of An. stephensi mosquitoes. This may be attributed to the effects of temperature on a blood meal. Increasing temperature speeds blood meal digestion, leading to increased host biting rates (Afrane et al., 2012). The female mosquito bites its host to acquire a blood meal, which is needed to develop its eggs (Nature Education, 2014). Blood feeding and egg production are closely related, and blood-feeding is crucial for the female mosquito to acquire the malaria parasite and transfer it to its host (Shaw et al., 2021). Thus, any factor that affects the biting rate has a detrimental effect on mosquito's ability to produce eggs and transmit diseases. An increase in mosquito biting rate implies that the vector may feed more frequently on its host and increase its potential to transmit diseases (Afrane et al., 2012). 2.12.3.2.2 Expression of enzymes and susceptibility to insecticides High temperatures modify biochemical processes, increase metabolic rates (Oliver & Brooke, 2017), and affect the mosquito's immune system (Murdock et al., 2012a; Murdock et al., 2012b; Murdock et al., 2013). It has been shown that temperature can have a striking and diverse qualitative and quantitative effect on mosquito's immune responses by affecting the immune 66 University of Ghana http://ugspace.ug.edu.gh challenge time and nature (Murdock et al., 2012a). The review on the expression of immune responses suggested that there were complex interactions between time, temperature, and the type of immune challenge. Most of the immune responses studied by Murdock et al. (2012a) were more robust at low temperature (18 °C) than high temperature. This is consistent with the findings of Suwanchaichinda and Paskewitz (1998), who reported that the percentage of female An. gambiae (s.l.) heavily melanizing beads were highest when held at 24 °C compared to 27 and 30 °C. In addition to innate immunity, melanin production plays a crucial role in physiological processes such as cuticular tanning and egg hardening, explaining the fast rate of humoral melanization at lower or cooler temperatures (Murdock et al., 2012a). In addition, NOS expression significantly increased at warmer temperatures (i.e., 28 °C) relative to colder temperatures (Murdock et al., 2014), which is consistent with similar studies (Murdock et al., 2012a; Murdock et al., 2013). According to Shapiro et al. (2017), their model suggested 29 °C as the optimum temperature required for malaria transmission. Therefore, an increase in NOS expression at higher temperatures could be an essential mosquito defense that could hinder parasite development (Murdock et al., 2012a). Only one of the studies reviewed (Oliver & Brooke, 2017) assessed the effects of temperature on detoxification enzyme activity (cytochrome P450 and general esterases). It showed that the detoxification enzyme systems of the mosquitoes were not significantly affected by an increase in temperature. It is unclear what could have accounted for the lack of significant effect of temperature on detoxification enzyme expression. Further studies are needed to investigate the effects of rearing temperatures on the expression of detoxification enzymes in Anopheles mosquitoes. Temperature affects mosquito nervous system sensitivity, immune responses, and metabolic activities, consequently influencing the efficacy of insecticides (Kristan et al., 2018). None of the studies considered the effects of temperature on target site resistance–one of the most common and well-studied forms of insecticide resistance (Matowo et al., 2010; Ranson 67 University of Ghana http://ugspace.ug.edu.gh et al., 2011; Corbel & N’Guessan, 2013; Liu, 2015). Generally, metabolic and target site resistance can co-occur in the same population (Ochomo et al., 2013) and can lead to complex cross-resistance and high resistance levels (Labbé et al., 2011). It is unclear how higher or warmer temperatures will shift metabolic rates and target site insensitivity in mosquitoes, especially Anopheles species. For susceptibility, it was revealed that higher temperatures reduced insecticide toxicity in An. funestus and An. arabiensis mosquitoes. The reduced toxicity at high temperatures might be due to higher enzymatic activities, which could increase detoxification of the insecticide (Matzrafi, 2019). In addition, how temperature affected the toxicity of deltamethrin differed from that of bendiocarb. However, the synergistic PBO completely restored pyrethroid susceptibility irrespective of the temperature. The difference in the toxicity of the two insecticides could be attributed to the differences in the mode of action. Bendiocarb, which belongs to carbamates, are nerve poisons that work by inhibiting acetylcholinesterase. On the other hand, deltamethrin belonging to pyrethroids alters the normal function of insect nerves by modifying the kinetics of voltage-sensitive sodium channels (Casida & Durkin, 2013). This review further revealed that the mosquito strain played a critical role in how temperature affected the toxicity of deltamethrin, and its temperature coefficient was not always positive or negative (Glunt et al., 2018). This is consistent with the findings of Hodjati and Curtis (1999), who also found that the toxicity of 0.25% permethrin on resistant An. stephensi exhibited a slight negative temperature coefficient (between 16 °C and 28 °C) and a strongly positive temperature coefficient (between 28 °C and 37 °C). Many mechanisms have been ascribed to the reduced efficacy of insecticides at elevated temperatures. For instance, pyrethroid insecticides are axonic poisons and control sodium ions' movement during nerve impulse movement. Generally, neuron sensitivity declines between temperatures of 30 to 35 °C, which 68 University of Ghana http://ugspace.ug.edu.gh influences the efficacy of insecticides. In addition, at low temperatures, neurons exposed to pyrethroid insecticides receive a high concentration of the insecticide due to reduced biotransformation. This makes the neuron more sensitive to the resulting stimulus because of a prolonged duration of steady-state resting potential (Khan & Akram, 2014). It needs to be emphasized that mosquito rearing temperature is critical, as it may influence the quality of the adult mosquito (Mpho et al., 2002) and its susceptibility to insecticides. The rearing, exposure, and post exposure temperatures can influence mosquito susceptibility to insecticides (Glunt et al., 2014). Besides, the association between temperature and insecticide efficacy differs based on the mode of action of an insecticide, method of application, target species, and quantity of insecticide contacted or ingested by the target species (Amarasekare & Edelson, 2004). 2.12.3.3 Implications of findings for malaria control in a future warmer climate Climate change is anticipated to shift the distribution of vector-borne diseases such as malaria (Ngarakana-Gwasira et al., 2016). Both the malaria vector and the parasite itself are sensitive to climate parameters, particularly temperature and rainfall (Ngarakana-Gwasira et al., 2016). Studies have reported that variations in climate parameters profoundly affect the development of malaria parasites and mosquito longevity, which ultimately affects malaria transmission (Hoshen & Morse, 2004). Both extreme low and high temperatures affect mosquito development and survival (Lyons et al., 2013). Studies have reported the effects of extreme low and high temperatures on the development of the malaria parasite. For instance, Mordecai et al. (2013) indicated that both insect and parasite physiology limit malaria transmission to temperatures between 17 and 34 °C. At a temperature of 25 °C, the malaria parasite needs only 12 days to complete its development; however, over 30 days is required for the parasite to develop and become 69 University of Ghana http://ugspace.ug.edu.gh infectious when the temperature is 20 °C (Stresman, 2010). This is very important for malaria control because if parasite development takes a longer time, then the likelihood that a mosquito will survive longer for the parasite to transmit the disease will decrease drastically (Ikemoto, 2008). On the other hand, the development of An. gambiae (s.l.) is greatly impeded when temperatures are low, and its larvae are unable to develop and die at temperatures below 16 and 14 °C, respectively (Afrane et al., 2012). The fate of malaria control in a future warmer climate can be seen from two directions. First, in a future warmer climate, areas that are currently cold (below 17 °C) and do not support the survival of malaria vectors and parasites to complete their development could provide suitable conditions for their survival and development due to an increase in temperature. The second direction that may be considered as the great news is that if the mosquitoes and the parasite fail to adapt to increasing temperatures, especially in currently warmer areas (temperatures above 34 °C), such as sub-Saharan Africa, then these areas could start experiencing a reduction in malaria cases. Ultimately, these countries can eradicate the disease because mosquitoes may not survive long to complete the parasite incubation period at temperatures higher than 34 °C (Bayoh & Lindsay, 2003; Christiansen-Jucht et al., 2014). It is noteworthy that factors such as plasticity, adaptation, thermal regulation, and daily, monthly, and seasonal climatic variations, and microclimates (Paaijmans et al., 2013b; Lefevre et al., 2018) may influence malaria transmission. However, these factors were not included in this review. 2.12.5 Conclusion The growth and development characteristics (development time, larval survival, and pupation success) of immature stages of Anopheles mosquitoes are adversely affected by increasing temperature. However, information on these characteristics alone may not be sufficient to predict the population dynamics of mosquitoes. Production capacity (number of adults 70 University of Ghana http://ugspace.ug.edu.gh produced) which plays a vital role in estimating the number of adult populations produced from the immature stages is understudied. In addition, previous studies have not considered the impact of increasing temperature on the sex ratio (proportion of male to female) of An. gambiae (s.l.) mosquitoes. There is evidence that the availability of female mosquitoes plays a crucial role in determining population dynamics and disease transmission. Only three (3) studies have demonstrated a link between temperature and sex ratio; however, these studies were done on Aedes rather than Anopheles gambiae (s.l.) mosquitoes. With regards to the adult mosquito, previous studies have established the effects of increasing temperature on the longevity, fecundity, gonotrophic cycle length, biting rate and body size of Anopheles mosquitoes. However, these studies focused more on species such as An. stephensi, An. pharaoensis, An. coustani, An. albimanus, An. dirus, An. sawadwongporni, and An. superpictus with less attention on species such as An. coluzzii (one of the malaria vectors in Ghana). Finally, a search of the literature revealed three (3) studies which examined the effects of temperature on the susceptibility of An. funestus, An. arabiensis, and An. stephensi but not on An. gambiae (s.l.) mosquitoes (most predominant malaria vector in Ghana). In addition, only one study examined the levels of expression of metabolic enzymes (cytochrome P450, α- esterase, and β-esterase) in mosquitoes (An. arabiensis) that were exposed to deltamethrin and malathion insecticides and those that were not exposed to any insecticides. Even though these enzymes are useful in determining the metabolic resistance mechanism of mosquitoes to insecticides, they do not provide a holistic assessment of this mechanism. Available scientific evidence has reported high levels of other metabolic enzymes such as GST and AChE in mosquitoes exposed to insecticides. However, the effects of temperature on the levels of expression of GST and AChE in An. gambiae (s.l.) mosquitoes have not been investigated yet. 71 University of Ghana http://ugspace.ug.edu.gh Therefore, I intend to conduct a primary study to investigate the influence of elevated temperatures on the growth, development and susceptibility of An. gambiae (s.l.) mosquitoes to pyrethroid insecticides. 72 University of Ghana http://ugspace.ug.edu.gh CHAPTER THREE METHODOLOGY 3.1 Introduction This chapter presents the materials and methods used in this study. The chapter describes temperature selection and maintenance, rearing of mosquito colonies, species identification, assessment of growth and development characteristics, the procedure used to conduct insecticide susceptibility test and biochemical analysis. A succinct description of quality control measures, statistical analysis and ethical considerations is provided. 3.2 Study design, temperature selection and maintenance This study is an experimental study design. The experiment was carried out at the insectary of the African Regional Postgraduate Program in Insect Science (ARPPIS), University of Ghana, under eight temperature regimes (25, 28, 30, 32, 34, 36, 38 and 40 °C) in climate-controlled incubators (RTOP-1000D, Zhejiang, China) under constant relative humidity and photoperiod (Figure 8). Ghana has an average annual temperature ranging from 25 to 30 °C (Asante & Amuakwa-Mensah, 2015), so three temperatures were initially selected within this range; 25, 28 and 30 °C. A considerable warming across Africa is anticipated to reach 1.5 °C and is amplified at the 2 °C world, surpassing the mean global warming rate (Nangombe et al., 2019). Thus, to evaluate the effects of elevated temperatures on immature An. gambiae (s.l.) mosquitoes, a 2 °C increment at interval (Bayoh & Lindsay, 2004) from 30 °C was added to the selected temperatures until 40 °C maximum temperature was reached. The climate incubators, RTOP-1000D, were programmed to have a photoperiod of 12:12 (light:dark) hours and relative humidity of 80 ± 10%. A HOBO MX1102 CO2 logger (Onset Computer Corp., Cape Cod, MA, USA) was placed in each incubator and the insectary to 73 University of Ghana http://ugspace.ug.edu.gh monitor the daily temperature and relative humidity (Shapiro et al., 2017). In addition, the temperature of the rearing water in each incubator was monitored using HOBO Pendant Temperature (UA-001-08) loggers (Onset Computer Corporation, Pocasset, MA) (Chadee & Martinez, 2016). Data were downloaded daily between 10:00 and 11:00 am to ensure that temperature and humidity remained stable throughout the experiment. Ambient and rearing water conditions for each temperature regime are listed in Appendix IV. Figure 8: Climate control incubators (RTOP-1000D, Zhejiang, China) 3.3 Maintenance of Anopheles gambiae (s.l.) mosquito colony This study used two laboratory strains of An. gambiae (s.l.) mosquitoes; Tiassalé and Kisumu strains. The Tiassalé strain (a mixture of An. gambiae (s.s.) and An. coluzzii) is resistant to four classes of insecticides (pyrethroids, organochlorines, carbamates, organophosphates) available for malaria control (Edi et al., 2012). It initially originated from Tiassalé, Cote d'Ivoire (Edi et al., 2012) and maintained in the Vestergaard – Noguchi Memorial Institute for Medical 74 University of Ghana http://ugspace.ug.edu.gh Research Vector Labs (VNVL) insectary since 2010 (Chabi et al., 2019). The Kisumu strain is a susceptible reference strain from Kisumu, Kenya and has no history of insecticide resistance (Machani et al., 2020; Osoro et al., 2021). For the immature and adult mosquito experiments, An. gambiae (s.l.) (Tiassalé strain) was used. Both Tiassalé (as test group) and Kisumu (as reference group) strains were used for the insecticide susceptibility test and biochemical analysis. The eggs of both strains were obtained from the insectary of Vestergaard – Noguchi Memorial Institute for Medical Research Vector Labs (VNVL). The eggs on wet filter paper were placed in round plastic bowls (28 cm top diameter, 18 cm bottom diameter, 9 cm height) with 1 liter of dechlorinated tap water and 1.5 ml of yeast to induce hatching (Farnesi et al., 2017). Yeast contains hatching inducing compound (HIC) which is able to trigger egg hatching (Ng et al., 2021). The bowls were lined with A4 white paper to prevent eggs from sticking to the walls of the bowls and drying out. Enough fresh dechlorinated water kept at the respective temperatures was added daily to each bowl to maintain a volume of 1 liter due to evaporation. Upon hatching, larvae were fed daily on 10 mg of TetraFin goldfish flakes (Tetra Werke, Melle, Germany). All adults were provided with 10% sugar solution soaked in cotton wool. However, in addition to the sugar solution, some adult mosquitoes used to estimate fecundity and longevity of blood-fed mosquitoes were allowed to feed on a guinea pig for twenty (20) minutes on day four (4). The position of the cages was rotated daily to control for the effects of position within the chamber. Guinea pigs used for the test were not given any anaesthesia, however, they were housed at the Noguchi Memorial Institute for Medical Research Animal House and a Veterinary Officer assessed and treated them on weekly basis. 75 University of Ghana http://ugspace.ug.edu.gh 3.4 Molecular identification of An. gambiae (s.l.) mosquitoes (Tiassalé strain) 3.4.1 DNA extraction from adult mosquitoes To ensure that mosquitoes used in this study were truly An. gambiae (s.l.), one hundred adult female mosquitoes (3 – 5 days old non-blood-fed) were randomly selected for molecular analysis. DNA was extracted from the sampled mosquitoes using the Cetyl Trimethyl Ammonium Bromide (CTAB) method of extraction following the procedures described by Mouhamadou et al. (2019). Each mosquito was homogenized in 200 μl of 2% CTAB, and the mixture was incubated at 65 oC for 5 min. Next, 200 μl of chloroform was added to each sample and mixed by inversion, then centrifuged at 12,000 rpm for 5 min at room temperature. The aqueous phase was transferred to new vials (1.5 ml), 200μl of isopropanol was added and mixed by inversion. The samples were centrifuged at room temperature (27 oC) at 12,000 rpm for 15 min. The isopropanol was removed, 200 µl of 70 % ethanol was added, and centrifuged at 12000 rpm for 5 minutes at room temperature. The ethanol was then decanted, and the pellets containing the DNA were dried by inverting the tubes overnight. The extracted DNA was reconstituted in 20 μl DNase-free water before storage at room temperature. 3.4.2 Identification of Anopheles gambiae (s.l.) members by polymerase chain reaction (PCR) Two different polymerase chain reaction (PCR) procedures were performed to identify the mosquito colony used in this study. The first method identified members of the An. gambiae (s.l.) using multiplex PCR. This is a PCR-based amplification of specific DNA nucleotide differences in the intergenic spacer (IGS) of the ribosomal DNA (rDNA). The PCR uses species-specific primers to amplify DNA sequences of interest, which are of a diagnostic size when visualized under UV light after agarose gel electrophoresis. This allows simultaneous detection of the two main malaria vectors (An. gambiae (s.s.) and An. arabiensis) from the secondary and non-vector sibling species (An. quadriannulatus/merus/melas/bwambae). 76 University of Ghana http://ugspace.ug.edu.gh Amplification was conducted with primers targeting the rDNA gene (IGS). The primer pair used has been presented in Table 7. Reactions were made in 25 μl volume containing 0.5 μl DNA template, 2× GoTaq® Green Master Mix (Promega, Madison, WI, USA) 12.5 μl, 10 μM of each primer in 0.1 μl (Eurofins Genomic). The volume was adjusted with DNase-free water (11.6 μl). The temperature profile involved an initial denaturation step at 95 oC for 3 min, 35 cycles of 95 oC for 30 s, 54 oC for 30 s, and 72 oC for 1 min, followed by a final extension at 72 oC for 5 min. An aliquot of 5 μl of each PCR product was subjected to electrophoresis on a 2 % agarose gel stained with gel red and photographed with a BioDoc-it Imaging System (UVP, Upland, CA, USA). A 2 % agarose gel is commonly used for analyzing PCR products because it provides good resolution for fragments in the range of approximately 100 to 2000 base pairs (Thermo Fisher Scientific Inc, 2012). This study used 2% agarose gel because the 315 and 390 bp fragments are on the lower end of the size range for a 2% gel, while the 464 bp fragment is close to the middle of the range. The species was determined by the size of the PCR product (390 bp for An. gambiae (s.s.); 315 bp for An. arabiensis; and 464bp for An. melas). A second procedure using Sine PCR (Santolamazza et al., 2008) was used to identify An. coluzzii and An. gambiae (s.s.) mosquitoes. The PCR reactions were performed in a 25 μl reaction, which contained 0.4 μM of each of the following primer: F6.1a of sequence 5′- TCGCCTTAGACCTTGCGTTA-3′ used to identify An. coluzzii (An. gambiae M molecular form) and the R6.1b of sequence 5′-CGCTTCAAGAATTCGAGATAC-3′ for An. gambiae (s.s.) (An. gambiae S molecular form). The other reagents included 2× GoTaq® Green Master Mix (Promega, Madison, WI, USA) 12.5 μl, and 4 μl of DNA template extracted from individual mosquitoes. The volume was adjusted with DNase-free water (6.5 μl). The amplifications were done in a thermocycler (Alpha Cycler, UK) and programmed as follows: 94 °C for 5 min followed by 35 cycles of 94 °C for 30 s, 59 °C for 30 s, and 72 °C for 1min. At the end of amplification, the mixture was subjected to a final extension at 72 °C for 10 min. 77 University of Ghana http://ugspace.ug.edu.gh The PCR products were allowed to migrate on 2 % agarose gels stained with gel red. The species expected band profile was 249 bp for An. gambiae (s.s.), 479 bp for An. coluzzii, and 249, 479 bp for hybrid (An. gambiae M and S forms) after visualization with a BioDoc-it Imaging System (UVP, Upland, CA, USA). Appendix V shows gel photographs of the PCR performed. Table 7: List of primers used for molecular identification of Anopheles mosquitoes Primer name Primer symbol Primer sequence (5' – 3') Universal UN GTGTGCCGCTTCCTCGATGT An. gambiae AG CTGGTTTGGTCGGCACGTTT An. arabiensis AR/AA AAGTGTCCTTCTCCATCCTA An. melas AM/ME GTGACCAACCCACTCCCTTGA NB: The UN is the forward primer for the Anopheles gambiae complex. 3.5 Temperature, growth and development of immature An. gambiae (s.l.) mosquitoes This describes the procedures used to assess the effects of temperature on the following: development time, larval mortality and survival, larval weight and size, time to pupation, pupation success, pupal mortality, larval weight and size, number of adults produced, and sex ratio of emerged adults. All experiments were repeated five times. 3.5.1 Developmental time of immature mosquitoes, larval survival, and mortality The eggs were collected on wet filter paper and placed in larval bowls with de-chlorinated tap water at each temperature regime. On hatching, one hundred and sixty (160) first instar larvae from each egg tray were distributed into larval bowls containing de-chlorinated tap water and observed from larval stage through to pupal stage to the adult stage. The same egg bowls were used as larval bowls, except that the paper lining was removed. The developing larvae were checked daily for mortality, and dead larvae were enumerated, and discarded. Larvae that did not move after being touched with pipette tip were recorded as dead. Larval mortality was 78 University of Ghana http://ugspace.ug.edu.gh defined as death during the larval stage. The number of daily larval mortality was then used to estimate larval survival curves. In addition, the time from hatching to adult emergence was recorded as the development time (in days) of An. gambiae (s.l.) mosquitoes. Figure 9: Assessment of the developmental stages of the immature An. gambiae (s.l.) mosquitoes 3.5.2 Time to pupation, pupation success, and mortality Pupae were collected daily using a Pasteur pipette, enumerated, and placed into plastic cups with water (in mosquito cages) at various temperature regimes until the adults emerged. The plastic cups were labelled with the temperature at which the pupae were maintained in them. The number of larvae that pupated daily was enumerated. At the end of the development period, the time to pupation was estimated as the time of hatching to the onset of pupation. Pupation success (percentage of larvae that emerged as pupae) was also computed for each temperature regime as the number of larvae that pupated from the total number of larvae expressed as percentage. Pupal mortality was also assessed daily for each temperature regime. Any pupae that did not move when touched repeatedly with the pipette tip was considered dead, and any moribund pupae were added to the dead pupae to compute pupal mortality. 79 University of Ghana http://ugspace.ug.edu.gh 3.5.3 Larval and pupal weight and size Fifty (50) of the fourth instar larvae and fifty (50) pupae were randomly selected from each temperature regime. The larvae and pupae were immobilized at a fridge temperature of 4 °C, blot dried on a tissue paper towel and weighed using an XS104 ultra-micro balance (Mettler Toledo Inc., Columbus, Ohio). In addition, a stereo microscope with LED and HD inbuilt camera (Leica EZ4 HD, Leica Microsystems Limited, Switzerland) connected to a laptop was used to capture digital images of the pupae and larvae at a magnification of 16X. Body parts were measured using the Leica Application Software, version 3.4.0 (Leica Microsystems Limited, Switzerland). Measurements included larval length (a proxy for larval size) from the distal tip of the head (without considering the feeding brush, antennae, and caudal hair) to the end of the anal segment (Manoukis et al., 2006), length of the cephalothorax of the pupae, and used as a proxy for pupal size (Koenraadt, 2008; Sasmita et al., 2019). Figure 10: Measurement of larval and pupal size using Leica EZ4 HD microscope 80 University of Ghana http://ugspace.ug.edu.gh 3.5.4 The number of adults produced (production capacity) and sex ratio The number of adults produced (production capacity) was calculated for each regime as the number of emerged adults divided by the total larvae (expressed as percentages). In addition, the sex ratio of adults from each temperature regime was determined as the ratio of adult males to adult females (Mohammed & Chadee, 2011; Ukubuiwe et al., 2016). 3.6 Temperature and the growth and development of adult An. gambiae (s.l.) mosquitoes This section describes the methods used to investigate the effects of elevated temperature on adult longevity, length of gonotrophic cycle, biting rate, fecundity, body weight and size, and proboscis length. 3.6.1 Adult longevity The longevity of mosquitoes was measured as the time of adult emergence to the time of death, which was assessed daily between 9:00 – 10:00 am. One hundred (50 males and 50 females) newly emerged mosquitoes were assigned to each temperature regime to monitor daily mortality and longevity. Any mosquito that had lost its wings and could no longer fly was considered moribund and recorded dead (WHO, 2016a; Agyekum, 2017; Ononamadu et al., 2020). Dead mosquitoes were removed, observed, identified for sex allocation, and enumerated. This experiment was repeated five times under all temperature regimes, and longevity was estimated for blood-fed and non-blood-fed mosquitoes. Taking blood meal is a realistic behavior of female mosquitoes. In addition, one of the important factors in malaria transmission is how long a mosquito can live after a potential infectious blood meal (Barreaux et al., 2018), hence, the rational for measuring longevity of blood-fed mosquitoes. Adult mosquitoes kept at 25 oC and 28 oC were blood-fed three times (day 4, 8 and 14); those kept at 30 oC were also blood-fed twice (day 4 and 8). However, mosquitoes kept at 32 oC and 34 oC were blood-fed only once (day 4) because of high mortalities that resulted in fewer females for 81 University of Ghana http://ugspace.ug.edu.gh which reason the mosquitoes could not be fed 3 times as those reared under 25 and 28 oC temperature regimes. 3.6.2 Estimation of length of gonotrophic cycle, biting rate and fecundity One hundred (3 – 5 days old) adult mosquitoes (50 males and females) were placed in a cage to estimate the gonotrophic cycle length. The mosquitoes were blood-fed on two (2) occasions. The number of days taken for mosquitoes to lay eggs after the first and second feeding with blood meal was recorded, and from the mean value, the length of the gonotrophic cycle was calculated. When the females failed to lay a second batch, the number of days to lay the first batch was considered to be the length of the gonotrophic cycle. The biting rate of mosquitoes was estimated as the reciprocal of the mean gonotrophic cycle for each temperature regime (Moller-Jacobs et al., 2014; Shapiro et al., 2017). These experiments were repeated five times for all colonies reared under the different temperature regimes. In estimating fecundity, first day after the blood meal, twenty (20) fully engorged mosquitoes were randomly selected from each temperature regime and transferred individually into oviposition cups with 10% sugar solution. In each of the cup, five males were added to ensure that females were mated. Whatman filter paper on wet cotton wool was placed in each oviposition cup to provide oviposition substrate, and mosquitoes observed for egg-laying (a measure of fecundity). The filter paper was removed daily and checked for eggs, and the number of eggs on the filter paper under each temperature regime was enumerated. Fecundity was estimated from only the first batch of eggs laid by the mosquitoes, which, according to Costa et al. (2010), is a prognosis of total fecundity. 82 University of Ghana http://ugspace.ug.edu.gh Figure 11: Oviposition cups for fecundity assessment 3.6.3 Body weight, size, and proboscis length Fifty (50) of the four (4) days old adults (25 males, 25 females) that were not fed with a blood meal were randomly selected for each temperature regime, freeze-killed, and body weights were measured using an XS104 ultra-micro balance (Mettler Toledo Inc., Columbus, Ohio). Mosquitoes were weighed three times, and the average weight was used as the body weight of the mosquito. Measurement of body size and proboscis length were performed on the same mosquitoes that were used for weight measurements. A stereo microscope with LED and HD inbuilt camera (Leica EZ4 HD, Leica Microsystems Limited, Switzerland) connected to a laptop was used to capture digital images of wings and head of mosquitoes at a magnification of 20X. Mosquito wing length was used as a proxy for body size (Barreaux et al., 2018; Phasomkusolsil et al., 2018). The Leica Application Software, version 3.4.0 (Leica Microsystems Limited, Switzerland), was used to measure the proboscis length from the labial basal setae to the labella's apex (Harbach, 2010). Wings were also measured from the tip to the distal end of the alula (excluding the fringe) (Barreaux et al., 2016a). The mean length of the two wings was used in the analyses; however, only one was used when a wing was missing. 83 University of Ghana http://ugspace.ug.edu.gh 3.7 Insecticide susceptibility and metabolic enzyme level 3.7.1 Insecticide susceptibility Two pyrethroid insecticide impregnated papers (0.75% permethrin and 0.05% deltamethrin) obtained from Universiti Sains Malaysia, Malaysia, were used to test the susceptibility of An. gambiae (s.l.) mosquitoes (Tiassalé strain) raised at 25, 28, 30, 32 and 34 °C. The quality of insecticide impregnated papers was tested against susceptible An. gambiae (s.s.) (Kisumu strain) (Pwalia et al., 2019). Permethrin and deltamethrin were selected because they were the most common insecticides used in malaria control programs (Monahan, 2017). Insecticide susceptibility tests were performed at a constant temperature of 27 ± 2 °C following the standard WHO protocol (WHO, 2016a). For each mosquito strain, 20 – 25 female mosquitoes (aged 3 – 5 days), which were not fed with a blood meal were aspirated into six plain paper-lined WHO holding tubes; two tubes labelled as control replicates and four as insecticide-exposed replicates (WHO, 2016a) and observed under each temperature regime. Mosquitoes were gently put into exposure tubes and observed for 1 hour. The knockdown time (KDT) of females was recorded at 10-, 15-, 20-, 30- , 40-, 50- and 60-minutes’ exposure period. After exposure, mosquitoes were transferred into holding tubes and provided with a 10% sugar solution soaked in cotton wool. Mortality was recorded 24 hours post-exposure (WHO, 2016a). 84 University of Ghana http://ugspace.ug.edu.gh Figure 12: Insecticide susceptibility test following WHO protocols (WHO, 2016a) 3.7.2 Methods for measuring mosquito metabolic enzyme level 3.7.2.1 Biochemical assays The levels of four metabolic enzymes (MFO, GST, alpha- and beta-esterase) were measured in mosquitoes reared at different temperature regimes (25, 28, 30, 32 and 34 oC) and were not exposed to insecticides. In addition, the enzyme levels were measured in mosquitoes reared at temperature regimes of 25, 28, 30, and 32 oC who survived exposure to pyrethroid insecticides (deltamethrin and permethrin). For measurement of enzyme levels of individual adult female An. gambiae (s.l.) (Tiassalé), biochemical assays were performed using the microplate enzyme system as described by Hemingway and Brogdon (1998) with minor modifications. Briefly, the mosquitoes were frozen in Eppendorf tubes at -80 °C in the laboratory until analysis. Mosquitoes reared under each temperature regime (25, 28, 30, 32 and 34 oC) were individually homogenized in 1500 µl of potassium phosphate buffer (on ice). The homogenate was centrifuged at 14,000×rpm at 4 °C for 1 min, and the supernatant was used as an enzyme source for all the enzyme assays. All assays were done in duplicates using 96-well microplates. The absorbance values were measured using the SpectraMAX 340 PC (Molecular Devices, Sunnyvale, CA). The assays for the four enzymes are explained as described below. 85 University of Ghana http://ugspace.ug.edu.gh 3.7.2.1.1 Mixed-function oxidase (MFO) Duplicate wells containing 100 µl of supernatant were prepared, and 200 µl of 3,3,5,5- tetramethylbenzidine (TMBZ) (with methanol as the solvent), and 25 µl of 3% hydrogen peroxide (H2O2) was added. The mixture was incubated for 5 min, and the OD value was measured at 620 nm. The mixed-function oxidase (MFO) level was estimated using the standard curve of absorbance for known cytochrome C concentrations. The enzyme level was expressed as equivalent units per mole of cytochrome P450/min/mg protein. 3.7.2.1.2 Glutathione S-Transferases (GSTs) assay First, duplicate plates of 100 µl of supernatant were prepared, and 100 µl of 1-chloro-2,4- dinitrobenzene (cDNB) and reduced glutathione were added one after the other. The OD values were read immediately after adding the GST solution (To) at 340 nm. The plate was incubated for 5 min, and the OD values were measured again at the same wavelength. The Beer's law (A = εlc) was used to calculate GST level, expressed as a mole of cDNB/min/mg protein. With the extinction coefficient (ε) of 4.39 mM−1cm-1, the OD values (absorbance) were converted into mole cDNB conjugates. The path length was 0.94 cm. 3.7.2.1.3 Non-specific esterase (NSE) assay Mosquito homogenates were prepared, and supernatant poured into duplicate wells of 100 µl. To one set of the wells, 100 µl of 30 mM α-naphthyl acetate was added, while to the other, 100 µl of 30 mM β-naphthyl acetate was added. The plate was incubated at room temperature for 10 min. After incubation, 100 µl of dianisidine was added to each well, and the mixture was allowed to incubate for another 2 min, after which the OD values were measured at 620 nm. Depending on the standard curves of absorbance for known concentrations of α-naphthol or β- naphthol, the esterase level for each substrate was calculated. The enzyme level was expressed as mole of α-naphthol or β-naphthol/min/mg protein. 86 University of Ghana http://ugspace.ug.edu.gh 3.7.2.1.4 Protein assay Owing to size differences in individual mosquitoes, correction in the analyses of all enzyme levels was done using the protein concentration as a standard correction factor. A commercial protein assay kit (Coomassie Plus, USA) was used to obtain the bovine serum albumin standard curve. After that, the protein concentration was transformed and calculated based on the same curve. The protein assay was conducted by mixing 200 µl of Coomassie plus dye reagent with 20 µl of mosquito homogenate and 80 µl of the potassium phosphate (K3PO4) buffer, and the plate was read at 620 nm. Table 8: Number of An. gambiae (s.l.) mosquitoes from each rearing temperature regime used for biochemical analysis of metabolic enzyme level Temperature regime (oC) Mosquitoes that were not Mosquitoes that were exposed to pyrethroids exposed to pyrethroids 25 50 40 28 50 46 30 50 28 32 50 40 34 40 - Note: Few mosquitoes survived after exposure to pyrethroids resulting in the unequal number of mosquitoes that were exposed to pyrethroids; all mosquitoes exposed to pyrethroids at 34 oC died; hence there were no live mosquitoes to test for enzymes. 3.8 Quality Control During the rearing of mosquitoes and laboratory analysis of samples, quality control measures were followed to ensure accurate results. Species identification was conducted to ascertain the composition of An. gambiae (s.l.) mosquitoes used in the study. A HOBO MX1102 CO2 logger (Onset Computer Corp., Cape Cod, MA, USA) was placed in each incubator and the insectary to monitor the daily temperature and relative humidity to ensure that incubators were working efficiently. In addition, assessment of the growth and development of mosquitoes was repeated 87 University of Ghana http://ugspace.ug.edu.gh 5 times, and the instrument used for body weight measurement was calibrated to ensure they worked correctly. Measurement was repeated three (3) times, and the averages reported. For DNA extraction, the negative control for the DNA extraction was an empty tube (no mosquito sample) which was taken through the extraction process alongside the main samples. This was tested during the PCR procedure to confirm its status. DNAse free water was used as a negative control for the PCR and a previously confirmed sample was used as a positive control. The test was conducted following the standard operating procedures for species identification and all equipment were calibrated. The susceptibility test followed the WHO protocol, and the test was done in replicates of four (4) for each insecticide and two (2) control replicates (WHO, 2016a). In addition, the WHO susceptibility test was also conducted using a reference strain (An. gambiae (s.l.) Kisumu strain) to ensure that insecticides papers were effective. In cases where mortality in control treatments was between 5 – 20 %, mortalities were corrected using Abbott's formula. Samples for biochemical analysis were stored in the -80 oC freezer to avoid the degradation of enzymes. During the test, mosquito samples were run in duplicates. Alpha naphthol and beta naphthol were used as controls for the alpha- and beta-esterase. Bovine Serum Albumin (BSA) was used as a positive control for protein assays and cytochrome C for the oxidase. Assays were run with serial dilutions of the positive controls (standard) following the protocol used for the main assay. The readings from this were used to draw curves/lines. The concentration range (best 7 consecutive concentrations) with at least R2 of 0.8 (0.8 and above) was selected and used as controls for the main assay. The blank (a pair of empty wells) served as the negative control in both the standard and main assay. 88 University of Ghana http://ugspace.ug.edu.gh 3.9 Statistical Analysis Data generated were entered into Microsoft Excel (Version 2016) and then exported into Stata version 15.1 (StataCorp LLC, Texas, USA) for analysis. GraphPad Prism v8.4.2 was used to generate some graphs. The assumptions of normality and homogeneity of variances were assessed using Shapiro-Wilk and Bartlett's tests, respectively. Continuous variables with normal distribution were presented as mean (standard deviation [SD]), and non-normally distributed variables were reported as median (interquartile range [IQR]). Unless otherwise stated, in all statistical analyses, a p-value of less than 0.05 was considered significant. Data were presented in tables and figures. The statistical methods employed in the analysis of each specific objective are elaborated below. 3.9.1 Temperature and the growth and development of immature An. gambiae (s.l.) mosquitoes Data on development time and time to pupation were normally distributed. Therefore, a one- way analysis of variance (ANOVA) was used to explore the relationship between temperature and development time and time to pupation. In cases where the overall model showed statistically significant differences, the Tukey post hoc test was further used to determine where the differences existed. Pupation success, pupal mortality, number of adults produced, sex ratio, larval and pupal measurements failed to meet the normality criteria. A Kruskal-Wallis test with Dunn's multiple range test was used to assess the effect of temperature on pupation success, pupal mortality, number of adults produced, and sex ratio of emerged mosquitoes. Larval and pupal measurements were not normally distributed, hence log-transformed for the analysis. Ordinary least square (OLS) regression analysis with robust standard errors was used to determine whether any significant differences existed among the different temperature 89 University of Ghana http://ugspace.ug.edu.gh regimes. Sensitivity analysis was further conducted using quantile and robust regression methods to determine how the regression coefficients and their respective standard errors change with respect to using different statistical models to assess the effects of temperature on larval and pupal weights and length. With regards to larval survival data, survival analyses were performed using Kaplan-Meier survival analysis. Log-rank test and cox proportional hazard model were used to test the null hypothesis that larval survival did not change across the different rearing temperatures. The log-rank test compared the overall survival trend for the different temperature regimes, while the cox proportional hazard model was used for two-sample comparisons at one temperature against survival at the baseline temperature (25 oC). Median survival time with 95% confidence intervals was estimated for each of the temperature regimes. 3.9.2 Temperature and the growth and development of adult An. gambiae (s.l.) mosquitoes Gonotrophic cycle length, biting rate, and fecundity data were normally distributed. Analysis of variance (ANOVA) was used to explore the relationship between temperature and gonotrophic cycle length, biting rate, and fecundity. In cases where the overall model showed statistically significant differences, a post hoc analysis using the Tukey test was further used to identify where the differences existed. On the other hand, adult weight, body size (wing length) and proboscis length were not normally distributed and were log-transformed. Ordinary least square (OLS) regression analysis with robust standard errors was used to determine whether any significant differences existed among the different temperature regimes. Sensitivity analysis was further conducted using quantile and robust regression methods to determine how the regression coefficients and their respective standard errors change with respect to using 90 University of Ghana http://ugspace.ug.edu.gh different statistical models to assess the effects of temperature on adult weight, body size (wing length) and proboscis length. Concerning adult longevity data, a non-parametric (Kaplan-Meier) survival analysis was performed to determine the effects of temperature and blood meal on the longevity of adult mosquitoes. The log-rank test compared the overall longevity trend for the five temperature regimes and blood meal effect on longevity. The cox proportional hazard model was used for two-sample comparisons at one temperature against the longevity at the baseline temperature (25 oC). Median longevity with 95% confidence intervals was estimated for each of the temperature regimes. In the results, Pall values represent p values for both blood-fed and non- blood-fed mosquitoes. 3.9.3 Insecticide susceptibility and expression of metabolic enzyme levels 3.9.3.1 Insecticide susceptibility Insecticide susceptibility data were interpreted following WHO criteria: An. gambiae (s.l.) mosquitoes were defined as susceptible if mortality was greater than 98%; mortality between 90 – 98% indicates suspected resistance with more investigations needed; and mortality less than 90% suggests confirmation of the existence of resistant genes (WHO, 2016a). Mortalities in some of the control treatments exceeded 5 %: therefore, mortalities were corrected using Abbott's formula (Abbott, 1987) as follows; 𝑀𝑜𝑟𝑡𝑎𝑙𝑖𝑡𝑦 𝑖𝑛 𝑡𝑟𝑒𝑎𝑡𝑚𝑒𝑛𝑡 (%) − 𝑀𝑜𝑟𝑡𝑎𝑙𝑖𝑡𝑦 𝑖𝑛 𝑐𝑜𝑛𝑡𝑟𝑜𝑙(%) Corrected mortality (%) = × 100 100 − 𝑀𝑜𝑟𝑡𝑎𝑙𝑖𝑡𝑦 𝑖𝑛 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 (%) Probit analysis was used to estimate KDT50 and mosquito's susceptibility status to permethrin and deltamethrin insecticides. The KDT50 is the time at which 50 % of the mosquitoes were knocked down. Using IBM SPSS Statistics software (version 23.0), the number of knocked- down mosquitoes was considered response frequency, the total number of mosquitoes per test 91 University of Ghana http://ugspace.ug.edu.gh was regarded as the total number observed, and time was considered a covariate. Log base ten response was calculated from the data (Nnko et al., 2017). The knockdown time 50 (KDT50) was used to calculate the knockdown resistance ratio (KRR50) by dividing the KDT50 of the test mosquitoes (An. gambiae (s.l.) Tiassalé strain) by that of the An. gambiae (s.l.) Kisumu reference susceptible strain in all four temperature regimes (Nwane et al., 2009; Dhiman et al., 2014). The KRR50 was scaled as follows: KRR50 < 1 = susceptible, 1 – 10 = low resistance, 11 – 30 = moderate resistance, 31 – 100 = high resistance, and KRR50 > 100 = very high resistance (Goindin et al., 2017). 3.9.3.2 Expression of metabolic enzyme level The mean absorbance values of duplicate wells for each tested mosquito were converted into enzyme level and divided by the protein values. In addition, the median enzyme levels were estimated for each temperature regime. The quantities/levels of MFO, GSTs and non-specific esterase (alpha and beta) levels were not normally distributed and were analyzed using the non- parametric Kruskal-Wallis test. In cases where the overall model showed statistically significant differences, Dunn's multiple range test was further used to determine where the differences existed. A Mann-Whitney U test was used to compare the enzyme levels in mosquitoes that were exposed and those that were not exposed to pyrethroids. 3.10 Ethical Approval The guinea pigs used in this study were housed at the Animal Experimentation Department, Noguchi Memorial Institute for Medical Research (NMIMR). Ethical approval for the use of guinea pigs to blood feed female An. gambiae (s.l.) mosquitoes was obtained from the University of Ghana Institutional Animal Care and Use Committee (UG-IACUC) with permit number UG-IACUC 001/20-21 (Appendix VI). 92 University of Ghana http://ugspace.ug.edu.gh CHAPTER FOUR RESULTS 4.1 Introduction This chapter is divided into three main sections, each of which presents the results relating to the specific objectives. The first section of this chapter presents the results of the effects of temperature on the growth and development of immature stages of An. gambiae (s.l.) mosquitoes, while the second section highlights the effects of temperature on the growth and development of the adult An. gambiae (s.l.) mosquito. In the last section, the result of insecticide susceptibility and expression of metabolic enzyme in An. gambiae (s.l.) mosquitoes are presented. 4.2 Composition of An. gambiae (s.l.) (Tiassalé strain) mosquitoes Molecular analysis of mosquitoes was conducted to identify the composition of An. gambiae (s.l.) mosquitoes used in the study. The results showed that An. gambiae (s.l.) samples used in this study consisted of two species; An. gambiae (s.s.) (26.53 %) and An. coluzzii (23.47 %). A hybrid of the two species constituted 50.00 % (Table 9). Table 9: Composition of An. gambiae (s.l.) mosquitoes Anopheles gambiae (s.l.) Frequency (N) Percentage (%) An. gambiae (s.s.) (S form) 26 26.53 An. coluzzii (M form) 23 23.47 M/S hybrids 49 50.00 Total 98 100.00 93 University of Ghana http://ugspace.ug.edu.gh 4.3 Effects of temperature on the growth and development of immature An. gambiae (s.l.) mosquitoes 4.3.1 Developmental time of the immature stages To assess the relationship between temperature variability and development time of immature stages of mosquitoes, the mosquitoes were reared at different temperature regimes (25, 28, 30, 32, 34, 36, 38 and 40 oC). Eggs incubated at 40 oC failed to hatch even after seven (7) days, and those that hatched at 38 oC died before pupation. Therefore, the development times at temperatures 38 and 40 oC could not be calculated. The results showed that mean development time (time it takes eggs to hatch into adults) of mosquitoes decreased with increasing temperatures; 36 oC [9.6 (± 0.55) days], 34 oC [13.01 (± 0.61) days], 32 oC [14.54 (± 0.38) days], 30 oC [16.08 (± 1.03) days], and 28 oC [18.4 (± 0.89) days] compared to 25 °C [20.17 (± 0.75) days] (Table 10). When the temperature was increased from 25 to 36 °C, mean development time decreased by 10.57 days. One-way ANOVA showed a statistically significant difference (F(5, 24) = 133.55, P < 0.001) in development time of mosquitoes among the different temperature regimes. Further analysis using the Tukey post hoc test showed there were significant differences in the development time among the various temperature comparisons (Appendix VII). Table 10: Relationship between rearing temperature and development time of immature An. gambiae (s.l.) mosquitoes Temperature regime (oC) Development time (in days) Mean (±SD) 25 20.17 (±0.75) 28 18.40 (±0.89) 30 16.08 (±1.03) 32 14.54 (±0.38) 34 13.01 (±0.61) 36 9.60 (±0.55) 38 - 40 - NB: Larvae at 38 oC died before pupating and eggs kept at 40 oC did not hatch; SD = Standard deviation 94 University of Ghana http://ugspace.ug.edu.gh 4.3.2 Determination of larval mortality and survival under different temperature regimes Eggs kept at 40 oC failed to hatch; therefore, larval mortality and survival were only estimated at seven (7) temperature regimes (25, 28, 30, 32, 34, 36, and 38 oC). Mortality was defined as death that occurred during the larval stage. Overall, larval mortality increased at temperatures above 28 oC. Larvae kept at 25 oC had the longest median survival time of 20 days, while those maintained at 38 oC recorded the least median survival time of 8 days (Table 11). Table 11: Median survival times of An. gambiae (s.l.) larvae reared at different temperatures Temperature regime Number of Number of Median survival (days) (°C) mosquitoes deaths (95% CI) 25 800 373 20 (16, 22) 28 800 196 19 (16, 21) 30 800 527 17 (14, 19) 32 800 576 14 (12, 17) 34 800 606 13 (11, 14) 36 800 621 10 (9, 10) 38 800 800 8 (7, 8) Total 5600 3699 95% CI means 95% Confidence interval Furthermore, survival curves were plotted and presented as Kaplan-Meier plots based on the number of larvae that died before pupating (n = 3699). From the results, larval survival decreased with increasing rearing temperature (Figure 13). Log-rank test showed that temperature regimes had significantly different survival functions (X2(6) = 5353.12, P < 0.001). Cox proportional hazard model showed that larvae kept at 28°C had 35% increased risk of death compared to those kept at 25°C (HR = 1.35, 95% CI; 1.13, 1.61, P = 0.001). Similar trends were observed at 30 °C (HR = 2.63, 95% CI; 2.26, 3.06, P < 0.001), 32 °C (HR = 5.62, 95% CI; 4.79, 6.59, P < 0.001), 34 °C (HR = 11.37, 95% CI; 9.61, 13.45, P < 0.001), 36 °C (HR = 51.07, 95% CI; 42.33, 61.61, P < 0.001) and 38 °C (HR = 215.85, 95% CI; 175.45, 265.54, P < 0.001) (Appendix VIII). 95 University of Ghana http://ugspace.ug.edu.gh Figure 13: Kaplan-Meier survival plots of An. gambiae (s.l.) larvae reared at different temperatures 25 °C (blue) was set as baseline against which survival at other temperatures were compared; 28 °C (red), 30 °C (green), 32 °C (orange), 34 °C (black), 36 °C (pink), 38 °C (brown). 4.3.3 Measurement of time to pupation, pupation success, and mortality The time to pupation, pupation success and mortality were estimated for larvae raised at 25, 28, 30, 32, 34 and 36 °C. Eggs incubated at 40 oC failed to hatch, and those that hatched at 38 oC died before pupation. The results showed that the mean time to pupation (time from hatching of eggs to the onset of pupation) decreased with increasing temperature, 25 to 36 °C. At 25 °C, larvae started pupating 12.80 (±1.30) days post-hatching and those in 28 °C pupated on day 11.80 (±1.10). Larvae raised at 30, 32, 34 and 36 °C pupated on day 11.00 (±0.71), 9.20 (±0.45), 8.80 (±0.84) and 7.40 (±0.55), respectively (Table 12). One-way ANOVA showed a statistically significant difference (F(5, 24) = 27.07, P < 0.001) in time to pupation among the temperature regimes. Further statistical tests using Tukey post hoc test revealed that except for 25 vs. 28 (P = 0.481), 28 vs. 30 (P = 0.701), and 32 vs. 34 (P = 0.977), there were significant differences in the time to pupation of mosquitoes in the remaining temperature comparisons (Appendix VII). 96 University of Ghana http://ugspace.ug.edu.gh The results further showed that the highest median pupation success was recorded at 28 °C [75 (IQR, 0.63) %] and the lowest at 36 °C [22.5 (IQR, 3.12) %] (Table 12). A Kruskal-Wallis test was conducted to determine if pupation success differed among the temperature regimes. It was revealed that, there was statistically significant difference (X2(5) = 27.23, P < 0.001) in pupation success among the temperature regimes. Post hoc analysis using Dunn's multiple range test revealed statistically significant differences only between 25 vs. 34 °C (P = 0.002), 25 vs. 36 °C (P < 0.001), 28 vs. 32 °C (P = 0.003), 28 vs. 34 °C (P < 0.001), and 28 vs. 36 °C (P < 0.001) (Appendix VII). With regards to pupal mortality, the highest pupal mortality was recorded at 36 °C [59.52 (IQR, 14.04) %], followed by 25 °C [21.69 (IQR, 0.84) %], 34 °C [17.95 (IQR, 2.39) %], 32 °C [16.28 (IQR, 1.78) %] and 30 °C [15.09 (IQR, 2.36) %]. The lowest pupal mortality was recorded at 28 °C [13.56 (IQR, 2.73) %] (Table 12). Overall, a Kruskal-Wallis test showed a statistically significant difference (X2(5) = 23.15, P < 0.001) in pupal mortality among the temperature regimes. Dunn's multiple range test showed statistically significant differences in only pupae kept at 25 vs. 28 °C (P = 0.001), 28 vs. 36 °C (P < 0.001), 30 vs. 36 °C (P < 0.001), and 32 vs. 36 °C (P = 0.002) (Appendix VII). 97 University of Ghana http://ugspace.ug.edu.gh Table 12: Time to pupation, pupation success, and pupal mortality of An. gambiae (s.l.) mosquitoes reared at different temperature regimes Temperature Time to pupation (in days) Pupation success (%) Pupal mortality regime (oC) Mean (±SD) Median (IQR) Median (IQR) 25 12.80 (±1.30) 53.75 (3.12) 21.69 (0.84) 28 11.80 (±1.10) 75.00 (0.63) 13.56 (2.73) 30 11.00 (±0.71) 34.38 (1.87) 15.09 (2.36) 32 9.20 (±0.45) 28.13 (2.50) 16.28 (1.78) 34 8.80 (±0.84) 24.38 (1.88) 17.95 (2.39) 36 7.40 (±0.55) 22.50 (3.12) 59.52 (14.04) SD = Standard deviation; IQR = Interquartile range. 4.3.4 Measurement of larval and pupal weight and size Larval and pupal weight and size were calculated for An. gambiae (s.l.) mosquitoes reared at 25, 28, 30, 32, 34, and 36 °C. The results showed that the median larval weight decreased with increasing temperature from 25 °C [2.1 (IQR, 0.6) mg] to 36 °C [1.1 (IQR, 0.3) mg]. Similar trends were observed for larval size, with larger larvae being recorded at 25 °C [4.94 (IQR, 0.39) mm] (Table 13). In addition, the median pupal weight decreased with increasing temperature, from 25 °C to 36 °C; 2.1 (IQR, 0.7) to 1.5 (IQR, 0.1) mg respectively. Similarly, pupal size decreased with increasing temperature. At 25 °C, pupal size was 1.73 (IQR, 0.10) mm but decreased as temperature increased to 28°C [1.65 (IQR, 0.14) mm], 30 °C [1.68 (IQR, 0.08) mm], 32 °C [1.61 (IQR, 0.06) mm], and 34 °C [1.59 (IQR, 0.08) mm], and 36 °C [1.52 (IQR, 0.17) mm] (Table 13). Further statistical test using ordinary least square regression with robust standard errors showed that a change in temperature from 25 to 28 oC significantly decreased larval weight by 0.15 (95% CI; 0.26, 0.05, P = 0.001). Furthermore, increasing temperature from 25 to 36 oC significantly decreased larval size (βlarval size = 0.11, 95% CI; 0.14, 0.09, P < 0.001), pupal weight (βpupal weight = 0.34, 95% CI; 0.40, 0.28, P < 0.001) and pupal size (βpupal size = 0.12, 95% 98 University of Ghana http://ugspace.ug.edu.gh CI; 0.14, 0.10, P < 0.001). Overall, sensitivity analysis using quantile and robust regressions showed consistent coefficients with the ordinary least square regression (Table 14). Table 13: An. gambiae (s.l.) larval and pupal weight and size at different temperature regimes Temperature Larval weight (mg) Larval size (mm) Pupal weight (mg) Pupal size (mm) regime (oC) Median (IQR) Median (IQR) Median (IQR) Median (IQR) 25 2.10 (0.60) 4.94 (0.39) 2.10 (0.70) 1.73 (0.10) 28 1.60 (0.50) 4.59 (0.61) 2.00 (0.40) 1.65 (0.14) 30 1.50 (0.50) 4.72 (0.36) 1.80 (0.30) 1.68 (0.08) 32 1.50 (0.40) 4.71 (0.48) 1.70 (0.50) 1.61 (0.06) 34 1.30 (0.30) 4.63 (0.38) 1.70 (0.50) 1.59 (0.08) 36 1.10 (0.30) 4.42 (0.44) 1.50 (0.10) 1.52 (0.17) IQR = Interquartile range. 99 University of Ghana http://ugspace.ug.edu.gh Table 14: Relationship between temperature and An. gambiae (s.l.) larval and pupal measurements Ordinary Least Square regression with Sensitivity Analysis Temperature regime Outcome robust standard errors o Quantile regression Robust regression ( C) β [95% CI] β [95% CI] β [95% CI] 25 Ref Ref Ref 28 -0.15 [-0.26, -0.05]** -0.27 [-0.38, -0.16] *** -0.21 [-0.31, -0.12] *** 30 -0.26 [-0.36, -0.15] *** -0.34 [-0.45, -0.22] *** -0.31 [-0.40, -0.22] *** Larval weight 32 -0.27 [-0.36, -0.18] *** -0.34 [-0.45, -0.22] *** -0.32 [-0.41, -0.23] *** 34 -0.35 [-0.45, -0.25] *** -0.48 [-0.59, -0.37] *** -0.41 [-0.50, -0.32] *** 36 -0.52 [-0.61, -0.42] *** -0.65 [-0.76, -0.54] *** -0.57 [-0.66, -0.48] *** 25 Ref Ref Ref 28 -0.10 [-0.17, -0.03] ** -0.05 [-0.15, 0.05] -0.09 [-0.17, -0.02] ** 30 -0.17 [-0.24, -0.10] *** -0.15 [-0.25, -0.05] ** -0.17 [-0.24, -0.10] *** Pupal weight 32 -0.20 [-0.27, -0.12] *** -0.21 [-0.31, -0.11] *** -0.19 [-0.26, -0.12] *** 34 -0.22 [-0.30, -0.15] *** -0.21 [-0.31, -0.11] *** -0.23 [-0.30, -0.16] *** 36 -0.34 [-0.40, -0.28] *** -0.34 [-0.43, -0.24] *** -0.34 [-0.40, -0.28] *** 25 Ref Ref Ref 28 -0.04 [-0.08, -0.01]* -0.07 [-0.11, -0.04] *** -0.06 [-0.09, -0.03] *** 30 -0.04 [-0.07, -0.02] *** -0.04 [-0.08, -0.01] * -0.04 [-0.07, -0.01] ** Larval size 32 -0.05 [-0.08, -0.02] *** -0.05 [-0.08, -0.01] * -0.05 [-0.08, -0.02] ** 34 -0.07 [-0.09, -0.04] *** -0.07 [-0.10, -0.03] *** -0.07 [-0.10, -0.04] *** 36 -0.11 [-0.14, -0.09] *** -0.11 [-0.15, -0.07] *** 25 Ref Ref Ref 28 -0.02 [-0.04, -0.00] * -0.04 [-0.06, -0.02] *** -0.03 [-0.05, -0.02] *** Pupal size 30 -0.03 [-0.05, -0.02] *** -0.03 [-0.05, -0.01] ** -0.03 [-0.05, -0.02] *** 32 -0.06 [-0.08, -0.05] *** -0.07 [-0.09, -0.05] *** -0.07 [-0.09, -0.05] *** 34 -0.08 [-0.10, -0.07] *** -0.08 [-0.10, -0.06] *** -0.09 [0-.10, -0.07] *** 36 -0.12 [-0.14, -0.10] *** -0.12 [-0.15, -0.10] *** -0.13 [-0.15, -0.11] *** Larval weight, pupal weight, larval size, and pupal size were log-transformed; single asterisk (*) represents significant difference at P < 0.05; double asterisk (**) means P < 0.01; triple asterisk (***) means P < 0.001; Ref means Reference. β means regression coefficients, 95% CI means 95% Confidence interval; p-values were generated using OLS with robust standard errors. 100 University of Ghana http://ugspace.ug.edu.gh 4.3.5 Temperature, number of adults produced, and sex ratio of An. gambiae (s.l.) mosquitoes The number of adults produced (proportion of larvae that emerged as adults), and sex ratio of mosquitoes were estimated at 25, 28, 30, 32, 34 and 36 °C. Mosquitoes failed to develop at temperatures above 36 °C. The results showed that there was a decrease in the number of adults produced as temperature increased from 28 °C [66.25 (IQR, 3.13) %] to 30 °C [28.75 (IQR, 2.50) %], 32 °C [23.13 (IQR, 2.50) %], 34 °C [20.00 (IQR, 1.88) %] and 36 °C [10.63 (IQR, 3.13) %] (Table 15). A Kruskal-Wallis test revealed a statistically significant difference (X2(5) = 28.16, P < 0.001) in the number of adults produced among the temperature regimes. Post hoc analysis using Dunn's test showed significant differences in 25 vs 36 °C (P = 0.002), 28 vs 32 °C (P = 0.003), 28 vs 34°C (P < 0.001) and 28 vs 36 °C (P < 0.001) (Appendix VII). Furthermore, increasing temperature increased the number of male adult mosquitoes produced. The median sex ratio of male/female (M/F) ranged from 0.89 (IQR, 0.04) at 25 °C to 2.60 (IQR, 0.60) at 36 °C (Table 15). There was a statistically significant difference (Kruskal-Wallis test; X2(5) = 28.07, P < 0.001) in the sex ratio of mosquitoes among the temperature regimes, with few females emerging at higher temperatures. Dunn's comparison test showed that sex ratio differed at 25 vs 34 °C (P < 0.001), 25 vs 36 °C (P < 0.001), and 28 vs 36 °C (P < 0.001) (Appendix VII). 101 University of Ghana http://ugspace.ug.edu.gh Table 15: Number of adults produced, and sex ratios of An. gambiae (s.l.) mosquitoes reared at different temperature regimes Temperature regime (oC) Adults produced (%) Sex ratio (M/F) Median (IQR) Median (IQR) 25 41.88 (1.87) 0.89 (0.04) 28 66.25 (3.13) 1.08 (0.04) 30 28.75 (2.50) 1.88 (0.00) 32 23.13 (2.50) 2.08 (0.00) 34 20.00 (1.88) 2.20 (0.02) 36 10.63 (3.13) 2.60 (0.60) IQR = Interquartile range. 4.4 Effects of temperature and the growth and development of adult An. gambiae (s.l.) mosquitoes 4.4.1 Adult longevity This section of the study assessed the effects of temperature on the longevity of adult mosquitoes. Although adult mosquitoes emerged at 36 °C, they died within 24 hours. Therefore, longevity was estimated for only mosquitoes reared at 25, 28, 30, 32 and 34 °C. The results showed that the median adult longevity decreased with increasing temperature and differed between blood-fed and non-blood-fed mosquitoes. The difference in the median longevity of non-blood-fed and blood-fed mosquitoes was eight (8) days at 25 °C and two (2) days at 34 °C, respectively (Table 16). 102 University of Ghana http://ugspace.ug.edu.gh Table 16: Median longevity of adult An. gambiae (s.l.) mosquitoes reared at different temperatures Median Longevity (days) (95% CI.) Temperature regime (°C) Blood-fed mosquitoes Non-blood-fed mosquitoes 25 10 (6, 15) 18 (15, 22) 28 10 (5, 14) 12 (8, 16) 30 6 (3, 10) 9 (6, 12) 32 4 (2, 6) 6 (3, 8) 34 2 (2, 4) 4 (2, 7) Total 5 (3, 10) 9 (5, 14) 95% CI means 95% Confidence interval Among blood-fed mosquitoes, Kaplan-Meier plots showed that longevity decreased with increasing temperature from 25 °C (22 days) to 28 °C (19 days), 30 °C (14 days), 32 °C (9 days) and 34 °C (5 days) (Figure 14A). A similar trend was observed in the longevity of non- blood-fed mosquitoes, although non-blood-fed mosquitoes lived longer than blood-fed mosquitoes (Figure 14B). Log-rank test showed that longevity of mosquitoes significantly differed among the different temperature regimes (X2(4) = 904.15, P < 0.001 for blood-fed group, X2(4) = 1163.60, P < 0.001; non-blood-fed group) (Appendix IX). The cox proportional hazard model was further used for two-sample comparisons at each of the temperature regimes (28, 30, 32, and 34 °C) against the longevity at the baseline temperature (25 oC). Cox proportional hazard model showed that non-blood-fed and blood-fed adult mosquitoes kept at 28°C had 189% (HR = 2.89, 95% CI; 2.43, 3.44, P < 0.001) and 26% (HR = 1.26, 95% CI; 1.07, 1.49, P = 0.005) increased risk of death, respectively, compared to those kept at 25°C. Similar trends were observed at 30 °C (HR = 6.86, 95% CI; 5.62, 8.37, P < 0.001 for non-blood-fed group, HR = 2.71, 95% CI; 2.28, 3.23, P < 0.001 for blood-fed group), 32 °C (HR = 16.46, 95% CI; 13.28, 20.40, P < 0.001 for non-blood-fed group, HR = 5.27, 95% CI; 4.37, 6.36, P < 0.001 for blood-fed group) and 34 °C (HR = 22.65, 95% CI; 103 University of Ghana http://ugspace.ug.edu.gh 18.15, 28.26, P < 0.001 for non-blood-fed group, HR = 11.16, 95% CI; 9.11, 13.67, P < 0.001 for blood-fed group). In addition, blood meal significantly (log-rank test; X2(1) = 217.63, P < 0.001) reduced the longevity of adult mosquitoes in all the temperature regimes (Appendix IX). The longevity of female and male mosquitoes was also compared to determine if differences existed. Overall, the longevity of female mosquitoes was significantly higher (log-rank test; X2(9) = 925.98, P < 0.001 for blood-fed group, X2(9) = 1198.52, P < 0.001 for non-blood-fed group) than that of the male mosquitoes irrespective of whether the mosquitoes were blood-fed or not (Figure 14C & D, Appendix X). However, log-rank test showed no statistically significant difference in the longevity of male and female mosquitoes reared at 25 oC (X2(1) = 3.36 P = 0.067) and 32 oC (X2(1) = 1.20, P = 0.274) in the blood-fed group (Appendix X). 104 University of Ghana http://ugspace.ug.edu.gh Figure 14: Longevity of adult An. gambiae (s.l.) mosquitoes reared under different temperature regimes. A – longevity of blood-fed mosquitoes; B – longevity of non-blood-fed mosquitoes; C – longevity of male & female mosquitoes in the blood-fed group; D – longevity of male & female mosquitoes in the non-blood-fed group. The 25 °C temperature (blue) was set as the baseline against which longevity at different temperature was compared; 28 °C (red); 30 °C (green); 32 °C (pink); 34 °C (black); M & F represent Male & Female respectively. 105 University of Ghana http://ugspace.ug.edu.gh 4.4.2 Length of the gonotrophic cycle, biting rate and fecundity of An. gambiae (s.l.) mosquitoes The length of gonotrophic cycle, biting rate and fecundity of mosquitoes were estimated at only three temperature regimes, 25, 28 and 30 °C because eggs kept at 40 °C failed to hatch, and larvae were unable to develop at 38 °C. In addition, adult mosquitoes that emerged at 36 °C died within the first day and adult mosquitoes that emerged from larvae at either 32 or 34 °C did not lay eggs. The results showed that the gonotrophic cycle length was similar at 25 and 28 °C (both had 3.20 days) but reduced at 30 °C (2.90 days) (Table 17). One-way ANOVA showed no statistically significant difference (F(2,12) = 1.00, P = 0.397) in the gonotrophic cycle length among the various temperature regimes. With biting rate, increasing temperature from 25 to 30 °C increased the biting rate from 0.31 (±0.03) to 0.35 (±0.03) day-1 (Table 17). However, one- way ANOVA showed no statistically significant difference (F(2,12) = 0.83, P = 0.460) in biting rates among the various temperature regimes. In addition, the average number of eggs laid per female mosquito ranged from 75.68 at 25 °C to 55.43 at 30 °C (Table 17). One-way ANOVA showed that the mean fecundity significantly differed (F(2,57) = 3.46, P = 0.038) among the various temperature regimes. Further statistical test using Tukey post hoc test revealed a significant difference in fecundity only between 25 and 30 °C (P = 0.027) (Appendix XI). 106 University of Ghana http://ugspace.ug.edu.gh Table 17: Mean gonotrophic cycle length, biting rate, and fecundity of An. gambiae (s.l.) mosquitoes reared at different temperature regimes Temperature Gonotrophic cycle length (in Biting rate (day-1) Fecundity Mean regime (oC) days) Mean (±SD) (±SD) Mean (±SD) 25 3.20 (±0.27) 0.31 (±0.03) 75.68 (±21.69) 28 3.20 (±0.57) 0.32 (±0.06) 65.57 (±28.61) 30 2.90 (±0.22) 0.35 (±0.03) 55.43 (±22.06) 32 - - - 34 - - - SD = Standard Deviation; Mosquitoes at 32 and 34 did not lay eggs 4.4.3 Measurement of body weight, size, and proboscis length of adult mosquitoes The body weight, size and proboscis length of adult mosquitoes were estimated at 25, 28, 30, 32 and 34 °C because eggs kept at 40 °C failed to hatch. Larvae were unable to develop at 38 °C and adult mosquitoes that emerged at 36 °C died within the first day. The results showed that body weight, size and proboscis length of adult mosquitoes decreased with increasing temperature. Adult weight decreased as temperature increased from 1.10 (IQR, 0.30) mg at 25 oC to 0.90 (IQR, 0.40) mg at 32 and 34 oC (Table 18). Further analysis using ordinary least square regression with robust standard errors showed that a change in temperature from 25 to 34 oC resulted in a statistically significant decrease in adult weight by 0.13 (95% CI, 0.24, 0.01, P = 0.031) (Table 19). With regards to the body size of mosquitoes, it decreased with increasing rearing temperature from 25 oC [3.03 (IQR, 0.26) mm] to 34 oC [2.62 (IQR, 0.15) mm] (Table 18). Compared to 25 oC, body size significantly decreased with increasing temperature by 0.06 (95% CI, 0.08, 0.03, P < 0.001) at 28 oC, 0.07 (95% CI, 0.10, 0.05, P < 0.001) at 30 oC, 0.10 (95% CI, 0.12, 0.08, P < 0.001) at 32 oC, and 0.14 (95% CI, 0.16, 0.12, P < 0.001) at 34 oC (Table 19). On the other hand, proboscis length decreased with increasing temperature from 2.18 (IQR, 0.32) 107 University of Ghana http://ugspace.ug.edu.gh mm at 25 oC to 1.84 (IQR, 0.36) mm at 34 oC (Table 18). Generally, proboscis length significantly decreased with an increase in temperature from the baseline (25 oC) to 30, 32 and 34 oC by 0.05 (95% CI, 0.09, 0.01, P = 0.011), 0.11 (95% CI, 0.15, 0.06, P < 0.001), and 0.13 (95% CI, 0.17, 0.09, P < 0.001), respectively. Sensitivity analysis using quantile and robust regressions showed consistent coefficients with the ordinary least square (OLS) regression (Table 19). Table 18: An. gambiae (s.l.) mosquito weight, size and proboscis length at different temperature regimes Temperature Adult weight (mg) Adult size (mm) Proboscis length (mm) regime (oC) Median (IQR) Median (IQR) Median (IQR) 25 1.10 (0.30) 3.03 (0.26) 2.18 (0.32) 28 1.00 (0.40) 2.85 (0.17) 2.09 (0.37) 30 0.95 (0.50) 2.79 (0.19) 2.03 (0.29) 32 0.90 (0.40) 2.73 (0.15) 1.92 (0.39) 34 0.90 (0.40) 2.62 (0.15) 1.84 (0.36) IQR = Interquartile range. 108 University of Ghana http://ugspace.ug.edu.gh Table 19: Relationship between temperature and adult An. gambiae (s.l.) mosquito weight, body size and proboscis length OLS regression with robust Sensitivity Analysis Temperature Outcome standard errors Quantile regression Robust regression regime (oC) β [95% CI] β [95% CI] β [95% CI] 25 Ref Ref Ref 28 -0.05 [-0.15, 0.05] -0.10 [-0.24, 0.05] -0.04 [-0.16, 0.07] Adult weight 30 -0.06 [-0.16, 0.03] -0.10 [-0.24, 0.05] -0.08 [-0.20, 0.03] 32 -0.09 [-0.19, 0.01] -0.20 [-0.35, -0.05]** -0.10 [-0.21, 0.01] 34 -0.13 [-0.24, -0.01]* -0.20 [-0.35, -0.05]** -0.08 [-0.19, 0.03] 25 Ref Ref Ref 28 -0.06 [-0.08, -0.03]*** -0.06 [-0.09, -0.04] *** -0.06 [-0.08, -0.04] *** Adult size 30 -0.07 [-0.10, -0.05] *** -0.08 [-0.10, -0.05] *** -0.07 [-0.09, -0.05] *** 32 -0.10 [-0.12, -0.08] *** -0.10 [-0.13, -0.08] *** -0.10 [-0.12, -0.08] *** 34 -0.14 [-0.16, -0.12] *** -0.14 [-0.17, -0.12] *** -0.14 [-0.16, -0.12] *** 25 Ref Ref Ref 28 -0.04 [-0.08, 0.00] -0.03 [-0.11, 0.05] -0.04 [-0.09, 0.00] Proboscis length 30 -0.05 [-0.09, -0.01]* -0.05 [-0.13, 0.02] -0.05 [-0.10, -0.01]* 32 -0.11 [-0.15, -0.06] *** -0.10 [-0.18, -0.03] ** -0.11 [-0.15, -0.07] *** 34 -0.13 [-0.17, -0.09] *** -0.14 [-0.22, -0.06] *** -0.13 [-0.17, -0.09] *** Adult weight, adult size, and proboscis length were log-transformed; OLS means Ordinary Least Square; single asterisk (*) represents significant difference at P < 0.05; double asterisk (**) means P < 0.01; triple asterisk (***) means P < 0.001; Ref means Reference; β means regression coefficients, 95% CI means 95% Confidence interval; p-values were generated using OLS with robust standard errors. 109 University of Ghana http://ugspace.ug.edu.gh 4.5 Insecticide susceptibility and expression of metabolic enzyme levels Susceptibility of mosquitoes to two pyrethroid insecticides (permethrin and deltamethrin) were assessed under different rearing temperature regimes (25, 28, 30, 32 and 34 oC). All mosquitoes reared at 34 oC died and mortality in control replicates exceeded 20 % (43.9 %) (Appendix XII), therefore results were excluded in final analysis. Metabolic enzyme levels in live mosquitoes were measured in both female mosquitoes that were exposed and those that were not exposed to pyrethroids. 4.5.1 Mortality of An. gambiae (s.l.) mosquitoes after exposure to pyrethroid insecticides The results of insecticide susceptibility of An. gambiae (s.l.) (Tiassalé) to deltamethrin and permethrin insecticides are presented in Figure 15. Mortality in the control replicates at 32 oC exceeded 5 %, therefore mortalities were corrected consistent with prescribed guidelines using Abbott's formula (Abbott, 1987). Overall, deltamethrin insecticides induced higher mortality compared to permethrin insecticides irrespective of the temperature regime. Female mosquitoes showed high mortality (100 %) to deltamethrin at 28 oC and mortality decreased at temperature above 28 oC (Figure 15). Upon exposure to permethrin, mortality of An. gambiae (s.l.) (Tiassalé) mosquitoes decreased with increasing temperature from 28 °C (81.61 %) to 32 °C (43.06 %). All susceptible An. gambiae (s.l.) (Kisumu) mosquitoes exposed to permethrin and deltamethrin insecticides died irrespective of the rearing temperature (Appendix XII). 110 University of Ghana http://ugspace.ug.edu.gh Deltamethrin Permethrin 150 100 50 0 25 28 30 32 Temperature regimes (oC) Figure 15: Insecticide susceptibility of Anopheles gambiae (s.l.) (Tiassalé strain) mosquitoes reared at different temperature regimes 4.5.2 Knockdown resistance ratio (KRR) The time at which 50 % of the mosquitoes were knocked down (KDT50) after exposure to insecticides was assessed under different temperature regimes, 25, 28, 30, 32 and 32 oC. The KDT50 of An. gambiae (s.l.) (Tiassalé) mosquitoes exposed to both permethrin and deltamethrin insecticides decreased with increasing temperature from 25 to 34 oC. For mosquitoes raised at 25 oC and exposed to permethrin insecticides, the KDT50 was higher (888.70 minutes) than the other temperature regimes (Table 20). Furthermore, the knockdown resistance ratio based on KDT50 for deltamethrin decreased with increasing temperature from 25 to 32 oC. With permethrin, the resistance ratio was highest at 25 oC (51.31), followed by 32 oC (4.12), 28 oC (3.87) and 30 oC (3.59) (Table 20). Generally, all the mosquitoes in this study had developed a certain level of resistance to permethrin and deltamethrin insecticides, which enabled them to survive the knockdown effect for some time. 111 Mortality (%) University of Ghana http://ugspace.ug.edu.gh Table 20: Knockdown resistance ratio of An. gambiae (s.l.) mosquitoes (Tiassalé strain) at different rearing temperature regimes Insecticide Temperature Test population (Tiassalé) Reference strain (Kisumu) KRR Resistance status regime (oC) KDT50 [95% CI] KDT50 [95% CI] 25 40.18 [38.22, 42.23] 16.02 [15.12, 16.94] 2.51 low resistance 28 32.33 [30.76, 33.88] 16.35 [15.45, 17.27] 1.98 low resistance Deltamethrin 30 28.02 [24.84, 31.36] 15.68 [14.63, 16.71] 1.79 low resistance 32 22.85 [21.37, 24.36] 15.44 [14.33, 16.52] 1.48 low resistance 25 888.70 [224.30, 7113093.45] 17.32 [15.83, 17.92] 51.31 high resistance 28 63.26 [56.06, 74.90] 16.34 [15.47, 17.23] 3.87 low resistance Permethrin 30 60.57 [55.03, 69.18] 16.88 [17.71, 20.26] 3.59 low resistance 32 59.29 [52.81, 69.25] 14.39 [13.47, 15.29] 4.12 low resistance KDT = Knockdown time; KRR = Knockdown resistance ratio, CI = Confidence Interval; KDT50 and 95% CI were obtained using probit analysis; KRR50 < 1 = susceptible, 1 – 10 = low resistance, 11 – 30 = moderate resistance, 31 – 100 = high resistance, and KRR50 > 100 = very high resistance 112 University of Ghana http://ugspace.ug.edu.gh 4.5.3 Influence of temperature and insecticide on the expression of metabolic enzyme 4.5.3.1 Mixed-function oxidase (MFO) level The level of mixed-function oxidase was assessed in mosquitoes reared at 25, 28, 30, 32 and 34 oC and were not exposed to pyrethroids. The results showed that MFO level was more elevated in mosquitoes reared at 32 oC [4.55×10-9 (IQR, 4.13×10-9) mol cytochrome P450/min/mg protein] compared to those reared at 34 oC [1.94×10-9 (IQR, 3.80×10-10)], 30 oC [1.49×10-9 (IQR, 2.26×10-9)], 28 oC [8.85×10-10 (IQR, 1.50×10-10)], and 25 oC [7.21×10-10 (IQR, 1.43×10-10) mol cytochrome P450/min/mg protein] (Appendix XIII). The levels decreased in the order of 32 > 34 > 30 > 28 > 25 (Figure 16). Generally, levels of oxidase differed significantly (Kruskal-Wallis test; X2(4) = 144.42, P < 0.001) among the various temperature regimes. Dunn's multiple range test showed that all but 28 vs 30 °C (P = 0.113) and 30 vs 34 °C (P = 0.010) showed a statistically significant difference in oxidase level (Appendix XIV). The effect of rearing temperature on MFO level was also assessed in mosquitoes that survived after being exposed to pyrethroids. Mosquitoes reared at 30 oC had higher [3.15×10-9 (IQR, 6.40×10-10) mol cytochrome P450/min/mg protein] levels compared to those reared at 32 oC [2.40×10-9 (IQR, 1.07×10-9)], 25 oC [2.07×10-9 (IQR, 7.50×10-10)], and 28 oC [1.34×10-9 (IQR, 2.50×10-10) mol cytochrome P450/min/mg protein] (Figure 16). There was a significant difference (Kruskal-Wallis test; X2(3) = 68.18, P < 0.001) in mixed-function oxidase level amongst the different temperature regimes. Further test using Dunn's multiple range test showed a significant difference (P < 0.008) in the various temperature regime comparisons (Appendix XIV). With the exception of mosquitoes reared at 32 oC, mixed-function oxidase level in mosquitoes reared at 25, 28, and 30 oC and exposed to pyrethroids were higher compared to those that were 113 University of Ghana http://ugspace.ug.edu.gh not exposed to pyrethroids (Figure 16). A Mann-Whitney U test showed a statistically significant difference in mixed-function oxidase level observed among mosquitoes that were not exposed and those exposed to pyrethroids at 25 oC (z = -7.72, P < 0.001), 28 oC (z = -5.33, P < 0.001), 30 oC (z = -4.68, P < 0.001), and 32 oC (z = 5.12, P < 0.001) (Appendix XV). Unexposed to pyrethroids Exposed to pyrethroids 8×10 -9 6×10 -9 4×10 -9 2×10 -9 0 25 28 30 32 34 Temperature regimes (oC) Figure 16: Median MFO level in An. gambiae (s.l.) mosquitoes reared at different temperature regimes. NB: No mosquito reared at 34 oC survived after being exposed to pyrethroids, hence, no enzyme level was measured 4.5.3.2 Glutathione S-Transferases (GSTs) level The level of GST enzyme was assessed in mosquitoes reared at 25, 28, 30, 32 and 34 oC and were not exposed to pyrethroids. The results showed that GST enzyme level followed a trend (32 > 34 > 30 > 28 > 25) similar to that of MFO level (Figure 17). A Kruskal-Wallis test revealed a statistically significant difference (X2(4) = 89.06, P < 0.001) in GST level of mosquitoes among the different temperature regimes. However, further analysis using Dunn's multiple range test showed statistically significant differences between 25 vs 32 °C (P < 0.001), 25 vs 34 °C (P = 0.002), 28 vs 32 °C (P < 0.001), 30 vs 32 °C (P < 0.001) and 32 vs 34 °C (P < 0.001) (Appendix XIV). 114 Median MFO (mol of cytochrome P450/min/mg protein) University of Ghana http://ugspace.ug.edu.gh With mosquitoes that were exposed to pyrethroids, the level of GST was highest at 32 °C [3.55×10-3 (IQR, 2.63×10-3)], followed by 25 °C [2.72×10-3 (IQR, 1.56×10-3)], 30 °C [2.62×10- 3 (IQR, 1.69×10-3)] with the lowest recorded at 28 °C [1.35×10-3 (IQR, 6.59×10-4) mol cDNB/min/mg protein] (Appendix XIII). There was a statistically significant difference (Kruskal-Wallis test; X2(3) = 18.26, P < 0.001) in GST level of mosquitoes among the different temperature regimes. Further statistical tests using Dunn's multiple range test showed statistically significant differences between 25 vs 28 °C (P = 0.002), 28 vs 32 °C (P < 0.001), and 30 vs 32 °C (P = 0.005) (Appendix XIV). In addition, mosquitoes in the temperature regimes exposed to pyrethroids (except for those reared at 32 °C) had higher GST levels compared to those that were not exposed to pyrethroids (Figure 17). However, a Mann-Whitney U test showed that all but mosquitoes reared at 28 °C (z = -0.52, P = 0.605) showed a statistically significant difference (P < 0.05) in GST level (Appendix XV). Unexposed to pyrethroids Exposed to pyrethroids 0.020 0.015 0.010 0.005 0.000 25 28 30 32 34 Temperature regimes (oC) Figure 17: Median GST level in An. gambiae (s.l.) mosquitoes reared at different temperature regimes. NB: No mosquito reared at 34 oC survived after being exposed to pyrethroids, hence, no enzyme level was measured 115 Median GST ( (mol of cDNB/min/mg protein) University of Ghana http://ugspace.ug.edu.gh 4.5.3.3 Alpha-esterase level The level of α-esterase enzyme was assessed in mosquitoes reared at 25, 28, 30, 32 and 34 oC and were not exposed to pyrethroids. The highest median α-esterase level was recorded at 32 oC [1.32×10-6 (IQR, 9.41×10-7)], followed by 34 oC [4.04×10-7 (IQR, 1.56×10-7)], 28 oC [2.83×10-7 (IQR, 4.32×10-7)], 25 oC [2.52×10-7 (IQR, 7.30×10-8)] and 30 oC [2.12×10-7 (IQR, 4.10×10-7) mol α-naphthol/min/mg protein] (Appendix XIII). Median α-esterase level did not increase with increasing rearing temperature; however, a Kruskal-Wallis test revealed a statistically significant difference (X2(4) = 99.46, P < 0.001) in α-esterase level of mosquitoes among the different temperature regimes. Further statistical tests using Dunn's multiple range test showed a statistically significant difference between 25 vs 32 °C (P < 0.001), 25 vs 34 °C (P < 0.001), 28 vs 32 °C (P < 0.001), 30 vs 32 °C (P < 0.001), 30 vs 34 °C (P < 0.001), and 32 vs 34 °C (P < 0.001) (Appendix XIV). The level of α-esterase level in mosquitoes that were exposed to pyrethroids was also assessed. The results showed that α-esterase level was highest at 32 °C [3.13×10-7 (1.81×10-7)] and lowest at 28 °C [1.44×10-7 (2.40×10-7) mol α-naphthol/min/mg protein] (Appendix XIII). There was a significant difference (Kruskal-Wallis test; X2(3) = 11.31, P = 0.010) in α-esterase level of mosquitoes among the different temperature regimes. According to Dunn's multiple range tests, a statistical difference existed only between 28 vs 30 °C (P = 0.003), and 28 vs 32 (P = 0.001) oC (Appendix XIV). Overall, mosquitoes that were not exposed to pyrethroids had higher α-esterase level than those exposed to pyrethroids (Figure 18). A Mann-Whitney U test showed that all but mosquitoes reared at 30 °C (z = -1.53, P = 0.127) showed a statistically significant difference (P < 0.05) in α-esterase level (Appendix XV). 116 University of Ghana http://ugspace.ug.edu.gh Unexposed to pyrethroids Exposed to pyrethroids 2×10 -6 1.5×10 -6 1×10 -6 5×10 -7 0 25 28 30 32 34 Temperature regimes (oC) Figure 18: Median α-esterase level in An. gambiae (s.l.) mosquitoes reared at different temperature regimes. NB: No mosquito reared at 34 oC survived after being exposed to pyrethroids, hence, no enzyme level was measured 4.5.3.4 Beta-esterase level The level of β-esterase enzyme was assessed in mosquitoes reared at 25, 28, 30, 32 and 34 oC and were not exposed to pyrethroids. The level decreased in the order of 34 oC [3.56×10-7 (IQR, 1.54×10-7)] > 32 oC [2.87×10-7 (IQR, 3.21×10-7)] > 28 oC [1.38×10-7 (IQR, 1.82×10-7)] > 25 oC [1.36×10-7 (IQR, 6.10×10-8)] > 30 oC [1.30×10-7 (IQR, 2.93×10-7) mol β-naphthol/min/mg protein] (Appendix XIII). Generally, there was a statistically significant difference (Kruskal- Wallis test; X2(4) = 48.28, P < 0.001) in β-esterase level in mosquitoes among the various temperature regimes. However, post hoc analysis using Dunn's multiple range test showed a statistically significant difference between 25 vs 32 °C (P = 0.001), 25 vs 34 °C (P < 0.001), 28 vs 34 °C (P < 0.001), 30 vs 34 °C (P < 0.001), and 32 vs 34 °C (P = 0.003) (Appendix XIV). 117 Median α-esterase (mol of α-naphthol/min/mg protein) University of Ghana http://ugspace.ug.edu.gh With regards to mosquitoes that were exposed to pyrethroids, β-esterase level ranged from 1.11×10-7 (6.85×10-8) at 28 °C to 2.64×10-7 (1.63×10-7) mol β-naphthol/min/mg protein at 32 °C (Appendix XIII). A Kruskal-Wallis test showed a statistically significant difference (X2(3) = 37.91, P = 0.001) in β-esterase level in mosquitoes raised at different temperatures. Multiple comparison using Dunn's test showed statistically significant differences between 25 vs 28 °C (P < 0.001), 28 vs 30 °C (P < 0.001), 28 vs 32 °C (P < 0.001), and 30 vs 32 °C (P = 0.007) (Appendix XIV). In addition, β-esterase level in mosquitoes reared at 25 and 30 °C and were exposed to pyrethroids was higher than in those that were not exposed to pyrethroids. On the other hand, β-esterase level in mosquitoes that were not exposed to pyrethroids was higher than in those that were raised at 28 and 32 °C and were exposed to pyrethroids (Figure 19). However, a Mann-Whitney U test showed that only mosquitoes reared at 25 °C showed a statistically significant difference (z = -6.03, P < 0.001) in β-esterase level (Appendix XV). Unexposed to pyrethroids Exposed to pyrethroids 6×10 -7 4×10 -7 2×10 -7 0 25 28 30 32 34 Temperature regimes (oC) Figure 19: Median β-esterase level in An. gambiae (s.l.) mosquitoes reared at different temperature regimes. NB: No mosquito reared at 34 oC survived after being exposed to pyrethroids, hence, no enzyme level was measured 118 Median β-esterase (mol of β-naphthol/min/mg protein) University of Ghana http://ugspace.ug.edu.gh CHAPTER FIVE DISCUSSION 5.1 Introduction The chapter is organized into three main sub-sections. The first section highlights the key findings on the relationship between temperature variability and growth and development of immature An. gambiae (s.l.) mosquitoes, while the second section focuses on the salient findings related to the growth and development of the adult mosquito. The final section focused on the effects of rearing temperature on An. gambiae (s.l.) mosquito's susceptibility to pyrethroid insecticides and expression of metabolic enzymes (MFO, GSTs and NSE). 5.2 Effects of temperature on the growth and development of immature An. gambiae (s.l.) mosquitoes 5.2.1 Hatching and development time of mosquitoes decreased with increasing temperature The current study found that hatching time of eggs reduced with increasing temperature (30 – 38 oC). However, eggs did not hatch at the highest temperature of 40 oC. The failure of eggs to hatch at 40 oC could be attributed to the interruption of embryogenesis because of the physiological stress experienced by eggs at higher temperatures (Sukiato et al., 2019). Previous studies (Delatte et al., 2009; Sukiato et al., 2019) also reported similar findings of decreased hatching time with increasing temperature. The reduced hatching time of mosquitoes at higher temperatures is of great importance when exploring An. gambiae (s.l.) mosquito's success in breeding in temporary habitats where water availability is reduced by evaporation, e.g., stagnant water in footprints. On the question of development time, this study found that development time of mosquitoes, like hatching time, decreased with increasing temperature. However, it was observed that larval 119 University of Ghana http://ugspace.ug.edu.gh development differed among the four larval instars – the fourth instar had the longest developmental time. The observed decrease in development time with increasing temperature is probably due to a rise in mosquito body temperature, which increases respiration and metabolism rates and causes mosquitoes to develop faster, thereby shortening the development time (Sasmita et al., 2019). This observation is consistent with previous studies (Bayoh & Lindsay, 2003; Kirby & Lindsay, 2009; Ciota et al., 2014; Couret et al., 2014) where development times of immature mosquitoes decreased with increasing temperature. The fourth instar had the longest developmental time, and probably unsurprising, since this stage precedes the pupal stage, and likely possesses significant amount of nutrient reserves needed to transition to adulthood (Araújo et al., 2012). This observation is in agreement with findings of Loetti et al. (2011) where they observed differences in the development times for the immature stages of Culex eduardoi, with the fourth having the longest development time. Similar observations have been made with regards to development times for Aedes albopictus, where the fourth instar took the longest time to develop, accounting for 25 – 36% of total development time (Neven, 2000). The fact that temperatures are predicted to rise in future means time to completion of mosquito life cycle could reduce, as mosquitoes are likely to develop at a faster rate. 5.2.2 Survival time of An. gambiae (s.l.) larvae decreased with increasing temperature The survival of mosquito larvae decreased with increasing temperature. A possible explanation for the decreased larval survival at higher temperatures might be due to denaturation of proteins, interactions with oxygen supply, increased metabolic rate, disruption of membrane structure, and dehydration (Neven, 2000; Klose & Robertson, 2004; Chown & Terblanche, 2006). Mosquito larvae likely increase their metabolic rates to overcome any thermal stress experienced in the breeding habitat, resulting in higher energy expenditure (Ukubuiwe et al., 2018; Shah et al., 2020). The increased metabolic rates could exceed oxygen supply from the 120 University of Ghana http://ugspace.ug.edu.gh environment leading to reduced performance, lowered tolerance to thermal stress (Pörtner et al., 2017), and the death of the larvae. Other studies have linked high larval mortalities and reduced larval survival time with increasing temperatures in other mosquito species such as An. gambiae (s.s.) (Bayoh & Lindsay, 2003; Christiansen-Jucht et al., 2014), An. arabiensis and An. quadriannulatus (Davies et al., 2016), Culex quinquefasciatus (Ukubuiwe et al., 2018), and Aedes aegypti (Carrington et al., 2013). In a future warmer temperature, it is possible that larval populations could decrease because of high larval mortalities. Estimating the effects of higher temperatures on larval survival could provide critical information in controlling larval populations in future warmer temperatures. 5.2.3 Pupation success of mosquitoes decreased with increasing temperature Pupation success, which is the proportion of larvae that pupated from the total number of larvae, decreased with increasing temperature. According to Clements (1992), it is a prerequisite for mosquitoes and other holometabolous insects to reach a certain critical body mass in the course of larval development before they can pupate, and this mass decreases with increasing temperature (Chambers & Klowden, 1990). In this current study, the highest pupation success was recorded at 28 oC, a finding similar to that of Mamai et al. (2018), who reported higher pupation success of An. arabiensis mosquitoes at 27 ± 1oC. The failed metamorphosis of larvae to pupae and adults could be attributed to the fact that higher temperatures increase development rate, therefore, resulting in rapid uptake of nutrients and faster metabolism (Davies et al., 2016). This requirement may be physiologically demanding, leading to insufficient body mass needed for eclosion (emergence of the adult from the pupal stage) (Chambers & Klowden, 1990). 121 University of Ghana http://ugspace.ug.edu.gh 5.2.4 Larval and pupal size decreased with increasing temperature Larval and pupal size decreased with increasing temperatures. This could possibly be due to the short duration in development of immature stages; there is reduced food intake by the larvae (Calkins & Parker, 2005) resulting in decreased larval size and consequently pupal size. These are similar to observation of Christiansen-Jucht et al. (2015) and Sasmita et al. (2019), in which rearing temperature significantly influenced larval and pupal size, with lower temperatures resulting in larger larvae and pupae and vice versa. According to Keena and Moore (2010), temperature has an influence on larval weight therefore the ability of the larvae to pupate. In addition, the effect of temperature goes beyond the immature stages into adult stage. For example, previous studies have also reported a link between high temperatures and small larval size which consequently resulted in small adults (Joy et al., 2010; Phasomkusolsil et al., 2011; Yeap et al., 2013; Bond et al., 2017). This could suggest that the temperature of the larval environment may have a profound impact on the adult stage. It is possible that in a future warmer temperature, the size of mosquitoes could reduce, and this can affect almost all aspects of its physiology, performance, morphology, and fitness (Kingsolver & Huey, 2008; Barreaux et al., 2018). 5.2.5 Number of adult mosquitoes produced decreased with increasing temperature The number of adults produced (production capacity) decreased with increasing temperature, with fewer female mosquitoes emerging at high temperatures, compared to males. These results are consistent with those of Bayoh and Lindsay (2003) who reported that the number of An. gambiae (s.s.) mosquitoes produced decreased with increasing temperature. In addition, the findings on sex ratio are in agreement with the findings of Monteiro et al. (2007), where there was an equilibrated male-female ratio at 25 °C. However, at 30 °C, the production of males was about two (2) times that of females. It is possible that a high proportion of female larvae and pupae were killed before becoming adults, leading to the production of few female 122 University of Ghana http://ugspace.ug.edu.gh mosquitoes at high temperatures. Further investigations are needed to provide greater insight into the mechanism underlying the production of few female mosquitoes at higher temperatures. It is likely that in a future warmer temperature, mosquito populations could reduce because there would be few female mosquitoes available for mating and egg-laying. 5.3 Effect of temperature on the growth and development of adult An. gambiae (s.l.) mosquitoes 5.3.1 Longevity of mosquitoes decreased with increasing temperature Longevity of mosquitoes decreased with increasing temperature. This observation could be attributed to teneral reserves acquired from the immature stages in progressing to adulthood. Teneral reserves determine the amount of energy accessible for most adult life traits such as longevity, body size, vitellogenesis, and flight (Ukubuiwe et al., 2019). Larger mosquitoes (those that emerge at low temperatures) usually have more reserves and are likely to survive longer than smaller mosquitoes (those that emerge at high temperatures) (Barreaux et al., 2018). Another possible explanation for the reduced longevity at high temperatures is the fast depletion of energy reserves because of the prolonged periods of high metabolic rates (Storey & Storey, 2004). Higher temperatures may accelerate the reaction rate of various metabolic processes that affect the growth and development of the mosquito. The increased reaction rate could amplify the damage caused by the by-products of metabolism, such as reactive oxygen species (ROS) (Keil et al., 2015), leading to the death of the mosquito. Adult longevity influences the number of gonotrophic cycles and may limit disease transmission (Menge et al., 2005). These results support those of previous studies that have reported a decrease in longevity of An. coluzzii (Faiman et al., 2017) and A. aegypti (Marinho et al., 2016) with increasing temperatures. The study also assessed the effect of blood meal on longevity of mosquitoes and found that mosquitoes fed on blood meal in addition to sugar solution had shorter longevity than those not 123 University of Ghana http://ugspace.ug.edu.gh fed with blood (these were fed on sugar only) in all the temperature regimes. The decreased longevity among blood-fed mosquitoes may be attributed to the intensity of oviposition, which requires much energy and is likely to decrease longevity (Marinho et al., 2016). A blood meal provides the female mosquitoes with the protein needed to synthesize yolk and develop their eggs (Nikbakhtzadeh et al., 2016). In a future warmer temperature, it is possible that adult mosquitoes may not be able to survive longer to reproduce and transmit diseases. This could help in the eradication of the vector and the disease it transmits. 5.3.2 Gonotrophic cycle length and biting rate of mosquitoes were unaffected by increasing temperature The associations between gonotrophic cycle length and biting rate of An. gambiae (s.l.) mosquitoes did not statistically change with increasing temperature. Previous studies have reported a significant decrease in the gonotrophic cycle length of Anopheles mosquitoes with increasing temperature (Paaijmans et al., 2013a; Christiansen-Jucht et al., 2015; Shapiro et al., 2017). Also, Shapiro et al. (2017) found that biting rate significantly increased with increasing temperature. It is entirely possible that the difference in the findings between this study and previous studies may be attributable to the type of blood meal used to feed mosquitoes. In the studies above, mosquitoes were allowed to feed on human blood, compared to the above where mosquitoes were fed on guinea pigs. It has been reported that host blood source as food for mosquitoes could affect the fecundity and gonotrophic cycle length of mosquitoes (Shehata, 2018). In this regards, high temperatures was found to speed up digestion of blood meals and reduce the gonotrophic cycle length (Afrane et al., 2006). Increased biting rate and reduced gonotrophic cycle length of An. gambiae (s.l.) mosquitoes could suggest that mosquitoes may feed more frequently, increasing egg-laying frequency and increasing their ability to transmit diseases (Afrane et al., 2012; Mala et al., 2014). 124 University of Ghana http://ugspace.ug.edu.gh 5.3.3 Fecundity of mosquitoes decreased with increasing temperature Fecundity, which is the number of eggs laid per female mosquito, decreased with increasing temperature. However, mosquitoes kept at 32 and 34 oC failed to lay eggs. The reason for the decreased fecundity is not clear but it may have something to do with the size of mosquitoes as higher temperatures result in smaller adult mosquitoes. Temperature affects mosquito body size, which consequently influences mosquito's first meal choice. Smaller mosquitoes are more likely to take sugar meals than blood meals (Barreaux et al., 2018). Another possible reason for the inability of mosquitoes to lay eggs at 32 and 34 oC could be that small mosquitoes (those that emerged at higher temperatures) were pre-gravid; that is, mosquitoes need at least two blood meals to complete the first gonotrophic cycle (Lyimo & Takken, 1993) and such mosquitoes are not likely to live long enough. The findings are in line with those of previous studies (Aytekin et al., 2009; Phasomkusolsil et al., 2011; Christiansen-Jucht et al., 2015; Ezeakacha & Yee, 2019) that have reported a decrease in mosquito fecundity with increasing temperature. According to Christiansen-Jucht et al. (2015), when higher temperature affects mosquitoes fecundity, it also decreases the probability of mosquitoes to lay eggs. At high temperatures (32 and 34 oC), the few mosquitoes that took blood meal even died within two days' post-feeding. It is possible that eggs may be present in the ovaries, just that mosquitoes did not live long enough to lay eggs (Ezeakacha & Yee, 2019). However, this study did not dissect ovaries of dead mosquitoes to check insemination and egg development. These findings suggest that in a future warmer temperature, it is possible that the number of potential vectors may decrease (Charlwood & Bragança, 2012) because of reduced fecundity of mosquitoes. 125 University of Ghana http://ugspace.ug.edu.gh 5.3.4 Body size and proboscis length of mosquitoes decreased with increasing temperature The effects of temperature on adult size and proboscis length could be attributed to the conditions experienced during larval development. Larval rearing temperature plays a significant role in shaping the overall size of adult mosquitoes (Ezeakacha & Yee, 2019). The reduced body size of mosquitoes may have negative effects on fitness components such as reproduction, competition and stress tolerance (Kingsolver & Huey, 2008; Chidawanyika & Terblanche, 2011). The results are in agreement with previous studies (Aytekin et al., 2009; Phasomkusolsil et al., 2011; Charlwood & Bragança, 2012; Christiansen-Jucht et al., 2015; Barreaux et al., 2016b; Barreaux et al., 2018) that reported reduced body size of Anopheles mosquitoes with increasing temperature. This current study did not investigate how temperature affected the ability of mosquitoes to insert proboscis into the host. It will be interesting for further studies to consider whether mosquitoes with the short proboscis (those kept at high temperatures) can reach the blood vessels of its host and acquire blood meal for egg development. 5.4 Effects of temperature on insecticide susceptibility and metabolic enzyme expression 5.4.1 Susceptibility of mosquitoes to pyrethroids decreased with increasing temperature Susceptibility of mosquitoes to pyrethroids decreased with increasing temperature. This may be attributed to higher expression of enzymes at high temperatures (Matzrafi, 2019). At high temperatures, the metabolism of insects is significantly faster (Canola Council of Canada, 2015), leading to rapid breakdown of insecticides, thereby making them relatively ineffective. Finding is in agreement with that of Oliver and Brooke (2017), in which the susceptibility of An. arabiensis (SENN DDT strains) to pyrethroids decreased with increasing temperatures. Another important finding was that deltamethrin induced higher mortality of mosquitoes than permethrin, indicating that mosquitoes were resistant to permethrin based on WHO criteria (WHO, 2016a). These findings are likely to be linked to the chemistry of the insecticides; 126 University of Ghana http://ugspace.ug.edu.gh deltamethrin belongs to the group of type II pyrethroids, which are more toxic than type I pyrethroids such as permethrin (Dalefield, 2017). This could explain the high mortalities of mosquitoes to deltamethrin insecticides across all the temperature regimes. This finding is in agreement with the findings of Dadzie et al. (2017) which showed that An. gambiae (s.l.) mosquitoes were more susceptible to deltamethrin than permethrin. With projections of warmer temperatures in coming years, especially in sub-Saharan Africa, high resistance to pyrethroids with increasing temperatures could affect the effectiveness of malaria control programs using pyrethroids (Ochomo et al., 2013). In Ghana, most mosquito control programs rely mostly on pyrethroid insecticides (Agyekum, 2017), and any future resistance will not bode well. 5.4.2 Expression of metabolic enzymes in mosquitoes increased with increasing temperature Metabolic enzyme (mixed-function oxidases (MFO) and Glutathione S-transferases (GSTs)) levels in mosquitoes that were not exposed to insecticides (pyrethroids) increased with increasing temperature from 25 to 32 oC, On the other hand, enzyme expression levels decreased at 34 oC, suggesting that enzyme expression may be impaired above a certain optimum temperature range (Tripathi et al., 2011). In addition, very high temperatures could disrupt the shape of the active site of an enzyme, hence reducing enzyme level by preventing its formation (BBC, 2021). When insects are faced with harsh conditions such as heat stress, there is an increase in the expression of enzymes such as GST and catalase in order to overcome the stress (González-Tokman et al., 2020). This could be a possible explanation for the increased enzyme levels at high temperatures observed in this study. These findings are corroborated by that of Kristensen and colleagues who reported increased expression of proteasomal proteins (proteins involved in repair and degradation of oxidatively damaged proteins) in Drosophila melanogaster adapted to high temperatures than those acclimatized to low temperatures (Kristensen et al., 2016). The elevated levels of enzyme associated with 127 University of Ghana http://ugspace.ug.edu.gh higher temperatures could provide a useful understanding of the role that future warmer temperatures could play in the evolution of insecticide resistance (Polson et al., 2012). Comparing the enzyme levels of mosquitoes that were not exposed and those exposed to pyrethroids, MFO, GST, α-esterase and β-esterase were higher in those exposed to pyrethroids than in those that were not exposed, especially at 25 and 30 oC. The high resistance of mosquitoes to insecticides might have involved metabolic detoxification due to the elevated enzyme expression in mosquitoes exposed to pyrethroids (Ochomo et al., 2013). Findings are consistent with the results of Ochomo et al. (2013), who observed that the level of MFO, GST, and β-esterase in An. gambiae (s.s.) mosquitoes exposed to permethrin insecticides were higher than in mosquitoes that were not exposed to insecticides. The study further revealed that MFO levels were the least expressed enzyme in mosquitoes. The findings are in agreement with Alemayehu et al. (2017), who observed higher levels of GSTs in An. arabiensis mosquitoes than the levels of MFO. However, the findings of this current study are contrary to those reported by Leong et al. (2019), who found more elevated MFO levels in A. aegypti mosquitoes than α-esterase, β-esterase and AChE levels. These findings raise the possibility that the levels of metabolic enzymes may differ among mosquito species (Farouk et al., 2021). Therefore, understanding the relationship between temperature and expression of metabolic enzymes in a future warmer temperature would be of great contribution to ascertain the different metabolic enzymes involved in detoxification of insecticides. 128 University of Ghana http://ugspace.ug.edu.gh CHAPTER SIX CONCLUSION AND RECOMMENDATIONS 6.1 Conclusion Understanding how temperature variability affects the biology of mosquitoes is key to understanding many aspects of the diseases it transmits and the control of those diseases, especially in a future warmer temperature. This study investigated the influence of elevated temperatures on the growth, development and susceptibility of An. gambiae (s.l.) mosquitoes to pyrethroids. Lower temperatures (< 30 oC) prolonged the hatching of Anopheles gambiae (s.l.) eggs than higher temperatures (30 – 38 oC), but no egg hatched at 40 oC. However, mosquitoes could not breed beyond temperatures at 36 oC. So, if the ambient environmental temperatures rise (or are elevated) to 36 oC as a consequence of climate change, it is likely malaria transmission will be inhibited, which may therefore result in its suppression and potential eradication in future warmer temperatures. High temperatures reduced the susceptibility of An. gambiae (s.l.) mosquitoes to deltamethrin and permethrin and increased resistance of mosquitoes to these insecticides. In addition, metabolic enzyme levels were elevated at a higher temperature than lower temperatures. The high levels of metabolic enzymes at high temperatures could pose a significant threat to malaria control interventions. However, in a future warmer temperature, it is possible that a considerable proportion of emerging mosquitoes may not survive longer, and numbers of potential vectors may decrease. These results supplement the limited studies examining the 129 University of Ghana http://ugspace.ug.edu.gh effects of environmental temperature on the development and growth of the adult An. gambiae (s.l.) mosquitoes. 6.2 Recommendations The following are recommended based on the findings of the study; • Ghana Health Service through the national vector control program under the Public Health Division should aim at reducing the larval population at breeding sites to significantly reduce vector population before becoming adults. This can reduce the population of mosquitoes and make vector control effective. • Ghana Health Service and the Media should intensify public education on environmental sanitation to reduce the breeding sites of mosquitoes, and the proper use of insecticides to reduce mosquitoes’ resistance to insecticides. • Beyond temperature, future studies should consider varying other climate parameters simultaneously to determine the overall effects on the development of An. gambiae (s.l.) mosquitoes. • Future studies should explore the effects of temperature on the mating success of An. gambiae (s.l.) mosquitoes. 130 University of Ghana http://ugspace.ug.edu.gh 6.3 Strength and limitations 6.3.1 Strength • This is one of the first studies that have assessed the effects of different rearing temperatures on the susceptibility of An. gambiae (s.l.) mosquitoes to insecticides and the expression of metabolic enzyme activities. • One of the strengths of this study is that it represents a comprehensive assessment of the growth and development of both the immature and adult An. gambiae (s.l.) mosquitoes. 6.3.2 Limitations • The data reported in this thesis refer to just two sibling species (An. gambiae (s.s) and An. coluzzii) in the An. gambiae complex, and the possibility that the impact of temperature on development may vary between populations within the An. gambiae complex cannot be excluded. • This study did not take into account temperature fluctuations or differences in humidity that would affect mosquito development and survival in the field. • The study only considered the effects of temperature on phenotypic and biochemical resistance of mosquitoes and did not consider target site resistance. 6.4 Future research direction • The effects of temperature on An. gambiae (s.l.) mosquitoes reported in this study could result from plasticity. It is essential to establish whether there could be a genetic modification in An. gambiae (s.l.) mosquitoes due to temperature variability by assessing the effects of elevated temperatures on mosquitoes over generations and conducting genotypic analysis to ascertain the differences. 131 University of Ghana http://ugspace.ug.edu.gh • This study assessed the effects of different rearing temperatures on the susceptibility of An. gambiae (s.l.) mosquitoes to only deltamethrin and permethrin (both pyrethroid insecticides). This can be expanded to include other insecticide classes and products used for malaria control, including mosquito coils. Though mosquito coils are not officially part of malaria control interventions, they are highly patronized in many African countries. • Future studies should assess the influence of elevated temperatures on the dynamics of the malaria parasite. An increase or decrease in the time before a mosquito becomes infectious is key to malaria transmission. 6.5 Contribution to knowledge This study has provided information that could guide the design of malaria control interventions in a future warmer temperature. The study also contributes to the knowledge on the relationship between temperature and An. gambiae (s.l.) mosquitoes and provides valuable information to guide vector control in a future warmer climate. To the best of my knowledge, this study could be the first study to evaluate the effects of different rearing temperatures on metabolic enzymes levels in An. gambiae (s.l.) mosquitoes that were exposed and those that were not exposed to pyrethroid insecticides. 132 University of Ghana http://ugspace.ug.edu.gh REFERENCES AAEP. (2016). External Parasite and Vector Control Guidelines. American Association of Equine Practitioners, Lexington, KY 40511, USA. (1st Edition ed.). Abbott, W. S. (1987). A method of computing the effectiveness of an insecticide. Journal of the American Mosquito Control Association, 3, 302-303. Abiodun, G. J., Maharaj, R., Witbooi, P., & Okosun, K. O. (2016). Modelling the influence of temperature and rainfall on the population dynamics of Anopheles arabiensis. Malaria Journal, 15(1), 364. https://doi.org/10.1186/s12936-016-1411-6. Abiodun, G. J., Witbooi, P., & Okosun, K. O. (2017). Modeling and analyzing the impact of temperature and rainfall on mosquito population dynamics over Kwazulu-Natal, South Africa. International Journal of Biomathematics, 10(4). https://doi.org/10.1142/S1793524517500553. Abiodun, G. J., Witbooi, P., & Okosun, K. O. (2018). Modelling the impact of climatic variables on malaria transmission. Hacettepe Journal of Mathematics and Statistics, 47(2), 219-235. https://doi.org/10.15672/HJMS.2017.452. Adam, I. J., & Lawson, B. W. L. (2010). Environmental toxicology of insecticides and pest management: Institute of Distance Learning. Kwame Nkrumah University of Science and Technology. Admasie, A., Zemba, A., & Paulos, W. (2018). Insecticide-treated nets utilization and associated factors among under-5 years old children in Mirab-Abaya District, Gamo- Gofa Zone, Ethiopia. Frontiers in Public Health, 6(7). https://doi.org/10.3389/fpubh.2018.00007. Afrane, Y. A., Githeko, A. K., & Yan, G. (2012). The ecology of Anopheles mosquitoes under climate change: Case studies from the effects of environmental changes in east Africa highlands. Annals of the New York Academy of Sciences, 1249, 204. https://doi.org/10.1111/j.1749-6632.2011.06432.x. 133 University of Ghana http://ugspace.ug.edu.gh Afrane, Y. A., Mweresa, N. G., Wanjala, C. L., Gilbreath Iii, T. M., Zhou, G., Lee, M.-C., . . . Yan, G. (2016). Evaluation of long-lasting microbial larvicide for malaria vector control in Kenya. Malaria Journal, 15(1), 577. https://doi.org/10.1186/s12936-016- 1626-6. Afrane, Y. A., Zhou, G., Lawson, B. W., Githeko, A. K., & Yan, G. (2006). Effects of microclimatic changes caused by deforestation on the survivorship and reproductive fitness of Anopheles gambiae in Western Kenya highlands. The American journal of tropical medicine and hygiene, 74(5), 772-778. https://doi.org/10.4269/ajtmh.2006.74.772. Agusto, F., Gumel, A., & Parham, P. (2015). Qualitative assessment of the role of temperature variations on malaria transmission dynamics. Journal of Biological Systems, 23(04), 1550030. Agyekum, T. P. (2017). Gaseous pollutant emissions and mosquito susceptibility from the use of mosquito coils in the indoor environment. (Masters Dissertation), Kwame Nkrumah University of Science and Technology, Kumasi. Retrieved from http://ir.knust.edu.gh/xmlui/handle/123456789/10147. Agyemang-Badu, S. Y., Awuah, E., Oduro-Kwarteng, S., Dzamesi, J. Y. W., Dom, N. C., & Kanno, G. G. (2023). Environmental Management and Sanitation as a Malaria Vector Control Strategy: A Qualitative Cross-Sectional Study Among Stakeholders, Sunyani Municipality, Ghana. Environ Health Insights, 17, 11786302221146890. https://doi.org/10.1177/11786302221146890 Agyepong, N., Mak-Mensah, E., & Brown, C. (2012). Prevalence of Anopheles gambiae S. S and their pyrethroid knock down resistance pattern in five selected communities in Kumasi metropolis using polymerase chain reaction (PCR). European Journal of Experimental Biology, 2(2), 304 - 310. 134 University of Ghana http://ugspace.ug.edu.gh Akiner, M. M. (2014). Malathion and propoxur resistance in Turkish populations of the Anopheles maculipennis Meigen (Diptera: Culicidae) and relation to the insensitive acetylcholinesterase. Türkiye Parazitolojii Dergisi, 38(2), 111. https://doi.org/10.5152/tpd.2014.3388. Akuamoah-Boateng, Y., Brenyah, R. C., Kwarteng, S. A., Obuam, P., Owusu-Frimpong, I., Agyapong, A. K., & Badu, K. (2021). Malaria Transmission, Vector Diversity, and Insecticide Resistance at a Peri-Urban Site in the Forest Zone of Ghana. Frontiers in Tropical Diseases, 2. https://doi.org/10.3389/fitd.2021.739771 Alemayehu, E., Asale, A., Eba, K., Getahun, K., Tushune, K., Bryon, A., . . . Duchateau, L. (2017). Mapping insecticide resistance and characterization of resistance mechanisms in Anopheles arabiensis (Diptera: Culicidae) in Ethiopia. Parasites and vectors, 10(1), 407. https://doi.org/10.1186/s13071-017-2342-y. Alias, Z. (2016). The role of Glutathione Transferases in the development of insecticide resistance. Insecticides Resistance, 315. https://doi.org/10.5772/61972. Alto, B. W., & Bettinardi, D. (2013). Temperature and dengue virus infection in mosquitoes: independent effects on the immature and adult stages. The American journal of tropical medicine and hygiene, 88(3), 497-505. https://doi.org/10.4269/ajtmh.12-0421. Amarasekare, K. G., & Edelson, J. V. (2004). Effect of temperature on efficacy of insecticides to differential grasshopper (Orthoptera: Acrididae). Journal of economic entomology, 97(5), 1595-1602. https://doi.org/10.1603/0022-0493-97.5.1595. Amer, K., Saavedra-Rodriguez, K., Black, W. C., & Gray, E. M. (2021). Effect of selection for pyrethroid resistance on abiotic stress tolerance in Aedes aegypti from Merida, Yucatan, Mexico. Insects, 12(2). https://doi.org/10.3390/insects12020124. Amlalo, G. K., Akorli, J., Etornam Akyea-Bobi, N., Sowa Akporh, S., Aqua-Baidoo, D., Opoku, M., . . . Dadzie, S. K. (2022). Evidence of High Frequencies of Insecticide 135 University of Ghana http://ugspace.ug.edu.gh Resistance Mutations in Aedes aegypti (Culicidae) Mosquitoes in Urban Accra, Ghana: Implications for Insecticide-based Vector Control of Aedes-borne Arboviral Diseases. Journal of Medical Entomology, 59(6), 2090-2101. https://doi.org/10.1093/jme/tjac120 Ampadu, B., Boateng, E. F., & Abassa, M. A. (2018). Assessing adaptation strategies to the impacts of climate change: a case study of Pungu–Upper East region, Ghana. Environment and Ecology Research, 6(1), 33-44. https://doi.org/10.13189/eer.2018.060103. Angilletta Jr, M. J., Huey, R. B., & Frazier, M. R. (2009). Thermodynamic effects on organismal performance: is hotter better? Physiological and Biochemical Zoology, 83(2), 197-206. https://doi.org/10.1086/648567. Annan, A. A., Owusu-Dabo, E., Baffour-Awuah, S., Nartey, R., Sarpong, N., Ayimbire, A. G., . . . Ohene, B. K. (2014). Insecticide resistance in malaria vector mosquitoes at 5 selected districts in Ghana, West Africa. East African Journal of Public Health, 11(4), 830-839. Antonio-Nkondjio, C., Sandjo, N. N., Awono-Ambene, P., & Wondji, C. S. (2018). Implementing a larviciding efficacy or effectiveness control intervention against malaria vectors: key parameters for success. Parasites and vectors, 11(1), 57. https://doi.org/10.1186/s13071-018-2627-9. Antonio-Nkondjio, C., Sonhafouo-Chiana, N., Ngadjeu, C. S., Doumbe-Belisse, P., Talipouo, A., Djamouko-Djonkam, L., . . . Wondji, C. S. (2017). Review of the evolution of insecticide resistance in main malaria vectors in Cameroon from 1990 to 2017. Parasites and vectors, 10(1), 472. https://doi.org/10.1186/s13071-017-2417-9. Antwi-Agyei, P., Dougill, A. J., Fraser, E. D., & Stringer, L. C. (2013). Characterising the nature of household vulnerability to climate variability: empirical evidence from two 136 University of Ghana http://ugspace.ug.edu.gh regions of Ghana. Environment, Development and Sustainability, 15(4), 903-926. https://doi.org/10.1007/s10668-012-9418-9. Antwi-Agyei, P., Dougill, A. J., & Stringer, L. C. (2015). Barriers to climate change adaptation: evidence from northeast Ghana in the context of a systematic literature review. Climate and Development, 7(4), 297-309. https://doi.org/10.1080/17565529.2014.951013. Antwi-Agyei, P., Stringer, L. C., & Dougill, A. J. (2014). Livelihood adaptations to climate variability: insights from farming households in Ghana. Regional Environmental Change, 14(4), 1615-1626. https://doi.org/10.1007/s10113-014-0597-9. Appawu, M., Dadzie, S., Abdul, H., Asmah, H., Boakye, D., Wilson, M., & Ofori-Adjei, D. (2006). Surveillance of viral haemorrhagic fevers in Ghana: entomological assessment of the risk of transmission in the northern regions. Ghana medical journal, 40(3). https://doi.org/10.4314/gmj.v40i3.55269. Araújo, M. d.-S., Gil, L. H. S., & e-Silva, A. d.-A. (2012). Larval food quantity affects development time, survival and adult biological traits that influence the vectorial capacity of Anopheles darlingi under laboratory conditions. Malaria Journal, 11(1), 261. https://doi.org/10.1186/1475-2875-11-261. Armah, F. A., Odoi, J. O., Yengoh, G. T., Obiri, S., Yawson, D. O., & Afrifa, E. K. (2011). Food security and climate change in drought-sensitive savanna zones of Ghana. Mitigation and Adaptation Strategies for Global Change, 16(3), 291-306. https://doi.org/10.1007/s11027-010-9263-9. Asante, F., & Amuakwa-Mensah, F. (2015). Climate change and variability in Ghana: Stocktaking. Climate, 3(1), 78-99. https://doi.org/10.3390/cli3010078. Aytekin, S., Aytekin, A. M., & Alten, B. (2009). Effect of different larval rearing temperatures on the productivity (Ro) and morphology of the malaria vector Anopheles superpictus 137 University of Ghana http://ugspace.ug.edu.gh Grassi (Diptera: Culicidae) using geometric morphometrics. Journal of vector ecology, 34(1), 32-42. https://doi.org/10.3376/038.034.0105. Badolo, A., Traore, A., Jones, C. M., Sanou, A., Flood, L., Guelbeogo, W. M., . . . Sagnon, N. F. (2012). Three years of insecticide resistance monitoring in Anopheles gambiae in Burkina Faso: resistance on the rise? Malaria Journal, 11(1), 232. https://doi.org/10.1186/1475-2875-11-232. Badyal, D., & Dadhich, A. (2001). Cytochrome P450 and drug interactions. Indian Journal of Pharmacology, 33(4), 248-259. Baffoe-Wilmot, A., Koram, K., Appawu, M., Dunyo, S., Nkrumah, F., & Afari, E. (2001). Malaria vector studies in two ecological zones in southern Ghana. African Entomology, 9(1), 59-65. Baffour-Awuah, S. (2012). The effectiveness of Bacillus sphaericus formulation for malaria vector control in Kumasi. (Masters Dessertation), Kwame Nkrumah University of Science and Technology, Kumasi. Baffour-Awuah, S., Annan, A. A., Maiga-Ascofare, O., Dieudonné, S. D., Adjei-Kusi, P., Owusu-Dabo, E., & Obiri-Danso, K. (2016). Insecticide resistance in malaria vectors in Kumasi, Ghana. Parasites and vectors, 9(1), 633. https://doi.org/10.1186/s13071- 016-1923-5. Barfi, E. (2015). Comparative Biology and Reproductive Behaviour of a Laboratory-Adapted Redco Strain of Anopheles gambiae Giles (Diptera; Culicidae) and Wild Populations of the same Species. (Masters dessertation), University of Ghana, Accra. Retrieved from http://ugspace.ug.edu.gh/handle/123456789/8030. Barreaux, A. M. G., Barreaux, P., & Koella, J. C. (2016a). Overloading the immunity of the mosquito Anopheles gambiae with multiple immune challenges. Parasites & vectors, 9(1), 210. https://doi.org/10.1186/s13071-016-1491-8. 138 University of Ghana http://ugspace.ug.edu.gh Barreaux, A. M. G., Barreaux, P., Thievent, K., & Koella, J. C. (2016b). Larval environment influences vector competence of the malaria mosquito Anopheles gambiae. Malaria World Journal, 7(8), 1-6. Barreaux, A. M. G., Stone, C. M., Barreaux, P., & Koella, J. C. (2018). The relationship between size and longevity of the malaria vector Anopheles gambiae (s.s.) depends on the larval environment. Parasites and vectors, 11(1), 485. https://doi.org/10.1186/s13071-018-3058-3. Barron, M. G., Paupy, C., Rahola, N., Akone-Ella, O., Ngangue, M. F., Wilson-Bahun, T. A., . . . Simard, F. (2018). A new species in the Anopheles gambiae complex reveals new evolutionary relationships between vector and non-vector species. bioRxiv, 460667. https://doi.org/10.1101/460667. Barrón, M. G., Paupy, C., Rahola, N., Akone-Ella, O., Ngangue, M. F., Wilson-Bahun, T. A., . . . Ayala, D. (2019). A new species in the major malaria vector complex sheds light on reticulated species evolution. Scientific reports, 9(1), 14753. https://doi.org/10.1038/s41598-019-49065-5 Bashir, B., Abdussalam, Y., & Zainab, T. (2018). The intensity of malaria transmisson and efficacy of Alphacypermethrin as an indoor residual insecticide against malaria vectors in Kadawa, Kano. Bayero Journal of Pure and Applied Sciences, 11(1), 195-200. https://doi.org/10.4314/bajopas.v11i1.32S. Bass, C., Williamson, M. S., Wilding, C. S., Donnelly, M. J., & Field, L. M. (2007). Identification of the main malaria vectors in the Anopheles gambiae species complex using a TaqMan real-time PCR assay. Malaria Journal, 6(1), 155. https://doi.org/10.1186/1475-2875-6-155. Baume, C. A., & Franca-Koh, A. C. (2011). Predictors of mosquito net use in Ghana. Malaria Journal, 10(1), 265. https://doi.org/10.1186/1475-2875-10-265. 139 University of Ghana http://ugspace.ug.edu.gh Bayoh, M. N., & Lindsay, S. W. (2003). Effect of temperature on the development of the aquatic stages of Anopheles gambiae sensu stricto (Diptera: Culicidae). Bulletin of entomological research, 93(5), 375-381. https://doi.org/10.1079/BER2003259. Bayoh, M. N., & Lindsay, S. W. (2004). Temperature‐related duration of aquatic stages of the Afrotropical malaria vector mosquito Anopheles gambiae in the laboratory. Medical and Veterinary Entomology, 18(2), 174-179. https://doi.org/10.1111/j.0269- 283X.2004.00495.x. BBC. (2021). Factors affecting enzyme action. https://www.bbc.co.uk/bitesize/guides/zgp2v9q/revision/2 [Accessed on July 11, 2021]. Bebe, F. N., & Panemangalore, M. (2005). Pesticides and essential minerals modify endogenous antioxidants and Cytochrome P450 in tissues of rats. Journal of Environmental Science and Health, Part B, 40(5), 769-784. https://doi.org/10.1080/03601230500189709. Beck-Johnson, L. M. (2013). Temperature impacts on mosquito population dynamics and malaria transmission. Beck-Johnson, L. M., Nelson, W. A., Paaijmans, K. P., Read, A., Thomas, M. B., & Bjørnstad, O. N. (2017). The importance of temperature fluctuations in understanding mosquito population dynamics and malaria risk. Royal Society open science, 4(3). https://doi.org/10.1098/rsos.160969. Beck-Johnson, L. M., Nelson, W. A., Paaijmans, K. P., Read, A. F., Thomas, M. B., & Bjørnstad, O. N. (2013). The effect of temperature on Anopheles mosquito population dynamics and the potential for malaria transmission. PLOS one, 8(11), e79276. https://doi.org/10.1371/journal.pone.0079276. 140 University of Ghana http://ugspace.ug.edu.gh Becker, N., Petrić, D., Zgomba, M., Boase, C., Madon, M., Dahl, C., & Kaiser, A. (2010). Mosquitoes and their control (2nd ed.): Springer. Benelli, G. (2015). Research in mosquito control: current challenges for a brighter future. Parasitology research, 114(8), 2801-2805. https://doi.org/10.1007/s00436-015-4586- 9. Beugnet, F., & Chalvet-Monfray, K. (2013). Impact of climate change in the epidemiology of vector-borne diseases in domestic carnivores. Comparative Immunology, Microbiology and Infectious Diseases, 36(6), 559-566. https://doi.org/10.1016/j.cimid.2013.07.003. Bhuju, G., Phaijoo, G. R., & Gurung, D. B. (2018). Mathematical study on impact of temperature in malaria disease transmission dynamics. Advances in Computer Sciences, 1(2), 107. https://doi.org/10.31021/acs.20181107. Birget, P. L., & Koella, J. C. (2015). An epidemiological model of the effects of insecticide- treated bed nets on malaria transmission. PLOS one, 10(12), e0144173. https://doi.org/10.1371/journal.pone.0144173. Blanford, J. I., Blanford, S., Crane, R. G., Mann, M. E., Paaijmans, K. P., Schreiber, K. V., & Thomas, M. B. (2013). Implications of temperature variation for malaria parasite development across Africa. Scientific reports, 3(1), 1-11. Bond, J. G., Ramírez-Osorio, A., Marina, C. F., Fernández-Salas, I., Liedo, P., Dor, A., & Williams, T. (2017). Efficiency of two larval diets for mass-rearing of the mosquito Aedes aegypti. PLOS one, 12(11), e0187420. https://doi.org/10.1371/journal.pone.0187420. Bowman, N. M., Akialis, K., Cave, G., Barrera, R., Apperson, C. S., & Meshnick, S. R. (2018). Pyrethroid insecticides maintain repellent effect on knock-down resistant populations of Aedes aegypti mosquitoes. PLOS one, 13(5), e0196410. https://doi.org/10.1371/journal.pone.0196410. 141 University of Ghana http://ugspace.ug.edu.gh Brake, S., Gomez-Maldonado, D., Hummel, M., Zohdy, S., & Peresin, M. S. (2022). Understanding the current state-of-the-art of long-lasting insecticide nets and potential for sustainable alternatives. Current Research in Parasitology & Vector-Borne Diseases, 2, 100101. https://doi.org/https://doi.org/10.1016/j.crpvbd.2022.100101 Brito, L. P., Linss, J. G., Lima-Camara, T. N., Belinato, T. A., Peixoto, A. A., Lima, J. B. P., . . . Martins, A. J. (2013). Assessing the effects of Aedes aegypti kdr mutations on pyrethroid resistance and its fitness cost. PLOS one, 8(4), e60878. https://doi.org/10.1371/journal.pone.0060878. Bulkeley, H. (2013). Cities and climate change: Routledge. Calkins, C., & Parker, A. (2005). Sterile insect quality Sterile insect technique (pp. 269-296): Springer. Camara, S., Koffi, A. A., Alou, L. P. A., Koffi, K., Kabran, J.-P. K., Koné, A., . . . Pennetier, C. (2018). Mapping insecticide resistance in Anopheles gambiae (sl) from Côte d’Ivoire. Parasites and vectors, 11(1), 19. https://doi.org/10.1186/s13071-017-2546-1. Canola Council of Canada. (2015). Hot weather can reduce insecticide performance., from https://www.canolacouncil.org/canola-watch/2015/06/10/hot-weather-can-reduce- insecticide-performance/. Accessed 29 Apr 2021. Carrington, L. B., Armijos, M. V., Lambrechts, L., Barker, C. M., & Scott, T. W. (2013). Effects of fluctuating daily temperatures at critical thermal extremes on Aedes aegypti life-history traits. PLOS one, 8(3), e58824. https://doi.org/10.1371/journal.pone.0058824. Casida, J. E., & Durkin, K. A. (2013). Neuroactive insecticides: targets, selectivity, resistance, and secondary effects. Annual review of entomology, 58, 99-117. https://doi.org/10.1146/annurev-ento-120811-153645. 142 University of Ghana http://ugspace.ug.edu.gh Castellanos, M. E., Rodas, S., Juárez, J. G., Lol, J. C., Chanquin, S., Morales, Z., . . . Padilla, N. (2021). Evaluation of the durability of long‐lasting insecticidal nets in Guatemala. Malaria Journal, 20(1), 219. https://doi.org/10.1186/s12936-021-03722-1. CDC. (2016). Mosquito control: what you need to know about using adulticides. Retrieved from https://www.cdc.gov/zika/pdfs/Adulticide-FactSheet.pdf [Accessed on October 2, 2019]. Chabi, J., Baidoo, P. K., Datsomor, A. K., Okyere, D., Ablorde, A., Iddrisu, A., . . . Diclaro, J. W. (2016). Insecticide susceptibility of natural populations of Anopheles coluzzii and Anopheles gambiae (sensu stricto) from Okyereko irrigation site, Ghana, West Africa. Parasites and vectors, 9(1), 182. https://doi.org/10.1186/s13071-016-1462-0. Chabi, J., Van’t Hof, A., N’dri, L. K., Datsomor, A., Okyere, D., Njoroge, H., . . . Jamet, H. P. (2019). Rapid high throughput SYBR green assay for identifying the malaria vectors Anopheles arabiensis, Anopheles coluzzii and Anopheles gambiae s.s. Giles. PLOS one, 14(4), e0215669. https://doi.org/10.1371/journal.pone.0215669. Chaccour, C., Zulliger, R., Wagman, J., Casellas, A., Nacima, A., Elobolobo, E., . . . Saute, F. (2021). Incremental impact on malaria incidence following indoor residual spraying in a highly endemic area with high standard ITN access in Mozambique: results from a cluster‐randomized study. Malaria Journal, 20(1), 84. https://doi.org/10.1186/s12936- 021-03611-7. Chadee, D. D., & Martinez, R. (2016). Aedes aegypti (L.) in Latin American and Caribbean region: With growing evidence for vector adaptation to climate change? Acta tropica, 156, 137-143. https://doi.org/10.1016/j.actatropica.2015.12.022. Chambers, G., & Klowden, M. (1990). Correlation of nutritional reserves with a critical weight for pupation in larval Aedes aegypti mosquitoes. Journal of the American Mosquito Control Association, 6(3), 394-399. 143 University of Ghana http://ugspace.ug.edu.gh Chareonviriyaphap, T., Bangs, M. J., Suwonkerd, W., Kongmee, M., Corbel, V., & Ngoen- Klan, R. (2013). Review of insecticide resistance and behavioral avoidance of vectors of human diseases in Thailand. Parasites & vectors, 6(1), 280. https://doi.org/10.1186/1756-3305-6-280. Charlwood, J. D., & Bragança, M. (2012). Some like it cool: the effect of ambient temperature on the size of Anopheles funestus from southern Mozambique. Journal of Medical Entomology, 49(5), 1154-1158. https://doi.org/10.1603/ME11247 Charlwood, J. D., & Bragança, M. (2012b). The effect of rainstorms on adult Anopheles funestus behavior and survival. Journal of vector ecology, 37(1), 252-256. Che-Mendoza, A., Penilla, R. P., & Rodríguez, D. A. (2009). Insecticide resistance and glutathione S-transferases in mosquitoes: a review. African Journal of Biotechnology, 8(8). Chidawanyika, F., & Terblanche, J. S. (2011). Rapid thermal responses and thermal tolerance in adult codling moth Cydia pomonella (Lepidoptera: Tortricidae). Journal of Insect Physiology, 57(1), 108-117. https://doi.org/https://doi.org/10.1016/j.jinsphys.2010.09.013 Choi, L., Majambere, S., & Wilson, A. L. (2019a). Larviciding to prevent malaria transmission. Cochrane Database of Systematic Reviews(8). https://doi.org/10.1002/14651858.CD012736.pub2. Choi, L., McIntyre, S., & Furnival-Adams, J. (2019b). Indoor residual spraying for preventing malaria (Protocol). Cochrane Database of Systematic Reviews, 3, CD013300. https://doi.org/10.1002/14651858.CD013300. Chown, S. L., & Terblanche, J. S. (2006). Physiological diversity in insects: ecological and evolutionary contexts. In S. J. Simpson (Ed.), Advances in insect physiology (Vol. 33, pp. 50-152): Academic Press. 144 University of Ghana http://ugspace.ug.edu.gh Christiansen-Jucht, C. D., Erguler, K., Shek, C. Y., Basáñez, M. G., & Parham, P. E. (2015b). Modelling Anopheles gambiae ss population dynamics with temperature-and age- dependent survival. International journal of environmental research public health, 12(6), 5975-6005. https://doi.org/10.3390/ijerph120605975. Christiansen-Jucht, C. D., Parham, P. E., Saddler, A., Koella, J. C., & Basáñez, M. G. (2014). Temperature during larval development and adult maintenance influences the survival of Anopheles gambiae s.s. Parasites and vectors, 7(1), 489. https://doi.org/10.1186/s13071-014-0489-3. Christiansen-Jucht, C. D., Parham, P. E., Saddler, A., Koella, J. C., & Basáñez, M. G. (2015). Larval and adult environmental temperatures influence the adult reproductive traits of Anopheles gambiae s.s. Parasites and vectors, 8(1), 456. https://doi.org/10.1186/s13071-015-1053-5. Churcher, T. S., Bousema, T., Walker, M., Drakeley, C., Schneider, P., Ouédraogo, A. L., & Basáñez, M.-G. (2013). Predicting mosquito infection from Plasmodium falciparum gametocyte density and estimating the reservoir of infection. elife, 2, e00626. https://doi.org/10.7554/eLife.00626.001. Cibulskis, R. E., Alonso, P., Aponte, J., Aregawi, M., Barrette, A., Bergeron, L., . . . Williams, R. (2016). Malaria: Global progress 2000 – 2015 and future challenges. Infectious Diseases of Poverty, 5(1), 61. https://doi.org/10.1186/s40249-016-0151-8. Ciota, A. T., Matacchiero, A. C., Kilpatrick, A. M., & Kramer, L. D. (2014). The effect of temperature on life history traits of Culex mosquitoes. Journal of Medical Entomology, 51(1), 55-62. https://doi.org/10.1603/ME13003. Clements, A. N. (1992). The biology of mosquitoes: development, nutrition and reproduction (Vol. 1): Chapman & Hall London. 145 University of Ghana http://ugspace.ug.edu.gh Coats, J. R. (1990). Mechanisms of toxic action and structure-activity relationships for organochlorine and synthetic pyrethroid insecticides. Environmental health perspectives, 87, 255-262. https://doi.org/10.1289/ehp.9087255. Coats, J. R. (2012). Insecticide mode of action: Academic Press. Codjoe, S. N. A., & Owusu, G. (2011). Climate change/variability and food systems: evidence from the Afram Plains, Ghana. Regional Environmental Change, 11(4), 753-765. Coetzee, M., Hunt, R. H., Wilkerson, R., Della Torre, A., Coulibaly, M. B., & Besansky, N. J. (2013). Anopheles coluzzii and Anopheles amharicus, new members of the Anopheles gambiae complex. Zootaxa, 3619(3), 246-274. https://doi.org/10.11646/zootaxa.3619.3.2. Coleman, S. (2009). Studies of Entomological Parameters and Perception of Malaria Transmission on the Kwame Nkrumah University of Science and Technology campus, in the Ashanti. (Masters Dissertation), Kwame Nkrumah University of Science and Technology, Kumasi. Retrieved from http://ir.knust.edu.gh/xmlui/handle/123456789/1414. Coleman, S., Yihdego, Y., Sherrard-Smith, E., Thomas, C. S., Dengela, D., Oxborough, R. M., . . . Obiri-Danso, K. (2021). Partial indoor residual spraying with pirimiphos-methyl as an effective and cost-saving measure for the control of Anopheles gambiae sl in northern Ghana. Scientific reports, 11(1), 1-16. Corbel, V., & N’Guessan, R. (2013). Distribution, mechanisms, impact and management of insecticide resistance in malaria vectors: a pragmatic review Anopheles mosquitoes- new insights into malaria vectors: IntechOpen. Costa, E. A. P. d. A., Santos, E. M. d. M., Correia, J. C., & Albuquerque, C. M. R. d. (2010). Impact of small variations in temperature and humidity on the reproductive activity and 146 University of Ghana http://ugspace.ug.edu.gh survival of Aedes aegypti (Diptera, Culicidae). Revista Brasileira de Entomologia, 54(3), 488-493. Couret, J., Dotson, E., & Benedict, M. Q. (2014). Temperature, larval diet, and density effects on development rate and survival of Aedes aegypti (Diptera: Culicidae). PLOS one, 9(2), e87468. https://doi.org/10.1371/journal.pone.0087468. Cuervo-Parra, J. A., Cortés, T. R., & Ramirez-Lepe, M. (2016). Mosquito-borne diseases, pesticides used for mosquito control, and development of resistance to insecticides. Insecticides resistance. Rijeka: InTechOpen, 111-134. https://doi.org/10.5772/61510. Culler, L. E., Ayres, M. P., & Virginia, R. A. (2015). In a warmer Arctic, mosquitoes avoid increased mortality from predators by growing faster. Proceedings of the Royal Society B: Biological Sciences, 282(1815), 20151549. Da Cruz, D. L., Paiva, M. H. S., Guedes, D. R. D., Alves, J., Gómez, L. F., & Ayres, C. F. J. (2019). Detection of alleles associated with resistance to chemical insecticide in the malaria vector Anopheles arabiensis in Santiago, Cabo Verde. Malaria Journal, 18(1), 120. https://doi.org/10.1186/s12936-019-2757-3. Dadzie, S. K., Chabi, J., Asafu-Adjaye, A., Owusu-Akrofi, O., Baffoe-Wilmot, A., Malm, K., . . . Boakye, D. A. (2017). Evaluation of piperonyl butoxide in enhancing the efficacy of pyrethroid insecticides against resistant Anopheles gambiae s.l. in Ghana. Malaria Journal, 16(1), 342. https://doi.org/10.1186/s12936-017-1960-3. Dahan-Moss, Y. L., & Koekemoer, L. L. (2016). Analysis of esterase enzyme activity in adults of the major malaria vector Anopheles funestus. Parasites & vectors, 9(1), 110. https://doi.org/10.1186/s13071-016-1379-7. Dalefield, R. (2017). Insecticides and acaricides. In R. Dalefield (Ed.), Veterinary toxicology for Australia and New Zealand (pp. 87-109). Oxford: Elsevier. 147 University of Ghana http://ugspace.ug.edu.gh Dang, K., Doggett, S. L., Veera Singham, G., & Lee, C.-Y. (2017). Insecticide resistance and resistance mechanisms in bed bugs, Cimex spp. (Hemiptera: Cimicidae). Parasites & vectors, 10(1), 318. https://doi.org/10.1186/s13071-017-2232-3. Dantas-Torres, F. (2015). Climate change, biodiversity, ticks and tick-borne diseases: The butterfly effect. International Journal for Parasitology: Parasites and Wildlife, 4(3), 452-461. https://doi.org/10.1016/j.ijppaw.2015.07.001. Davies, C., Coetzee, M., & Lyons, C. L. (2016). Effect of stable and fluctuating temperatures on the life history traits of Anopheles arabiensis and An. quadriannulatus under conditions of inter- and intra-specific competition. Parasites & vectors, 9(1), 342. https://doi.org/10.1186/s13071-016-1630-2. Dawes, E. J., Churcher, T. S., Zhuang, S., Sinden, R. E., & Basáñez, M.-G. (2009). Anopheles mortality is both age- and Plasmodium-density dependent: implications for malaria transmission. Malaria Journal, 8(1), 228. https://doi.org/10.1186/1475-2875-8-228. Day, J. F. (2016). Mosquito oviposition behavior and vector control. Insects, 7(4), 65. https://doi.org/10.3390/insects7040065. De Lima-Camara, T. N., & Honorio, N. A. (2016). Climate change and its effect on urban mosquitoes in South America. Climate change impacts on urban pests, 10, 127. https://doi.org/10.1079/9781780645377.0127. De Souza, D., Kelly-Hope, L., Lawson, B., Wilson, M., & Boakye, D. (2010). Environmental factors associated with the distribution of Anopheles gambiae s.s in Ghana; an important vector of Lymphatic Filariasis and Malaria. PLOS one, 5(3), e9927. https://doi.org/10.1371/journal.pone.0009927. Degefa, T., Githeko, A. K., Lee, M.-C., Yan, G., & Yewhalaw, D. (2021). Patterns of human exposure to early evening and outdoor biting mosquitoes and residual malaria 148 University of Ghana http://ugspace.ug.edu.gh transmission in Ethiopia. Acta tropica, 216, 105837. https://doi.org/10.1016/j.actatropica.2021.105837. Delatte, H., Gimonneau, G., Triboire, A., & Fontenille, D. (2009). Influence of temperature on immature development, survival, longevity, fecundity, and gonotrophic cycles of Aedes albopictus, vector of chikungunya and dengue in the Indian Ocean. Journal of Medical Entomology, 46(1), 33-41. https://doi.org/10.1603/033.046.0105. Dhiman, S., Rabha, B., Yadav, K., Baruah, I., & veer, V. (2014). Insecticide susceptibility and dengue vector status of wild Stegomyia albopicta in a strategically important area of Assam, India. Parasites and vectors, 7(1), 295. https://doi.org/10.1186/1756-3305-7- 295. Diabate, A., & Tripet, F. (2015). Targeting male mosquito mating behaviour for malaria control. Parasites & vectors, 8(1), 347. https://doi.org/10.1186/s13071-015-0961-8. Do Nascimento, J. M. C., Keppler, R. L. F., & Hamada, N. (2018). Family Culicidae Thorp and Covich's Freshwater Invertebrates (pp. 723-745): Elsevier. Dodson, B. L., Kramer, L. D., & Rasgon, J. L. (2012). Effects of larval rearing temperature on immature development and West Nile virus vector competence of Culex tarsalis. Parasites and vectors, 5(1), 199. https://doi.org/10.1186/1756-3305-5-199. Dom, N. C., Ahmad, A. H., Ishak, A. R., & Ismail, R. (2013a). Assessing the risk of dengue fever based on the epidemiological, environmental and entomological variables. Procedia - Social and Behavioral Sciences, 105, 183-194. https://doi.org/10.1016/j.sbspro.2013.11.019. Dom, N. C., Ahmad, A. H., & Ismail, R. (2013b). Habitat characterization of Aedes sp. breeding in urban hotspot area. Procedia - Social and Behavioral Sciences, 85, 100- 109. https://doi.org/10.1016/j.sbspro.2013.08.342. 149 University of Ghana http://ugspace.ug.edu.gh ECDC. (2014). Guidelines for the surveillance of native mosquitoes in Europe. European Centre for Disease Prevention and Control. Stockholm. Edi, C. V., Koudou, B. G., Jones, C. M., Weetman, D., & Ranson, H. (2012). Multiple- insecticide resistance in Anopheles gambiae mosquitoes, Southern Côte d’Ivoire. Emerging infectious diseases, 18(9), 1508. https://doi.org/10.3201/eid1809.120262. Egbuche, C., Ezihe, C., Aribodor, D., & Ukonze, C. (2016). Survey of mosquitoes in open and closed larval habitats in Aguleri, Anambra East Local Government Area of Anambra State, South eastern Nigeria. Journal of Mosquito Research, 6. https://doi.org/10.5376/jmr.2016.06.0017. Eisele, T. P., Larsen, D., & Steketee, R. W. (2010). Protective efficacy of interventions for preventing malaria mortality in children in Plasmodium falciparum endemic areas. International journal of epidemiology, 39(suppl_1), i88-i101. https://doi.org/10.1093/ije/dyq026. Ejigu, B. A., & Wencheko, E. (2021). Spatial Prevalence and Determinants of Malaria among under-five Children in Ghana. medRxiv, 2021.2003.2012.21253436. https://doi.org/10.1101/2021.03.12.21253436 Elbers, A., Koenraadt, C., & Meiswinkel, R. (2015). Mosquitoes and Culicoides biting midges: vector range and the influence of climate change. Scientific and Technical Review of the Office International des Epizooties (Paris), 34(1), 123-137. Eldridge, B. F. (2008). Biology and control of mosquitoes. Vector-Borne Disease Section Center for Infectious Diseases. Sacramento: California Department of Public Health, 120. Emidi, B., Kisinza, W. N., Mmbando, B. P., Malima, R., & Mosha, F. W. (2017). Effect of physicochemical parameters on Anopheles and Culex mosquito larvae abundance in 150 University of Ghana http://ugspace.ug.edu.gh different breeding sites in a rural setting of Muheza, Tanzania. Parasites and vectors, 10(1), 304. https://doi.org/10.1186/s13071-017-2238-x. EPA. (2011). Ghana’s Second National Communication (GSNC) to the UNFCCC, United Nations Development Programme. Environmental Protection Agency, Ghana. Essandoh, J., Yawson, A. E., & Weetman, D. (2013). Acetylcholinesterase (Ace-1) target site mutation 119S is strongly diagnostic of carbamate and organophosphate resistance in Anopheles gambiae s.s. and Anopheles coluzzii across southern Ghana. Malaria Journal, 12(1), 404. https://doi.org/10.1186/1475-2875-12-404. Ewing, D. A., Cobbold, C. A., Purse, B., Nunn, M., & White, S. M. (2016). Modelling the effect of temperature on the seasonal population dynamics of temperate mosquitoes. Journal of theoretical biology, 400, 65-79. Ezeakacha, N. F., & Yee, D. A. (2019). The role of temperature in affecting carry-over effects and larval competition in the globally invasive mosquito Aedes albopictus. Parasites and vectors, 12(1), 123. https://doi.org/10.1186/s13071-019-3391-1. Faiman, R., Solon-Biet, S., Sullivan, M., Huestis, D. L., & Lehmann, T. (2017). The contribution of dietary restriction to extended longevity in the malaria vector Anopheles coluzzii. Parasites & vectors, 10(1), 156. https://doi.org/10.1186/s13071-017-2088-6. FAO. (2012). Guidelines on prevention and management of pesticide resistance. Food and Agriculture Organization. Farnesi, L. C., Vargas, H. C. M., Valle, D., & Rezende, G. L. (2017). Darker eggs of mosquitoes resist more to dry conditions: Melanin enhances serosal cuticle contribution in egg resistance to desiccation in Aedes, Anopheles and Culex vectors. PLoS neglected tropical diseases, 11(10), e0006063. https://doi.org/10.1371/journal.pntd.0006063. Farouk, S. A., Barahim, N., & Hamzah, S. N. (2021). The detoxification enzymes activity profile in susceptible Aedes and Culex mosquitoes. IOP Conference Series: Earth and 151 University of Ghana http://ugspace.ug.edu.gh Environmental Science, 711(1), 012014. https://doi.org/10.1088/1755- 1315/711/1/012014. Feyereisen, R. (2012). Insect CYP Genes and P450 Enzymes. In L. I. Gilbert (Ed.), Insect Molecular Biology and Biochemistry (pp. 236-316). San Diego: Academic Press. Fillinger, U., & Lindsay, S. W. (2011). Larval source management for malaria control in Africa: myths and reality. Malaria Journal, 10(1), 353. https://doi.org/10.1186/1475- 2875-10-353. Fillinger, U., Ndenga, B., Githeko, A., & Lindsay, S. W. (2009). Integrated malaria vector control with microbial larvicides and insecticide-treated nets in western Kenya: a controlled trial. Bulletin of the World Health Organization, 87, 655-665. https://doi.org/10.2471/BLT.08.055632. Foster, P. G., de Oliveira, T. M. P., Bergo, E. S., Conn, J. E., Sant’Ana, D. C., Nagaki, S. S., . . . Moreira, C. C. (2017). Phylogeny of Anophelinae using mitochondrial protein coding genes. Royal Society open science, 4(11), 170758. https://doi.org/10.1098/rsos.170758. Fosu-Mensah, B. Y., Vlek, P. L., & MacCarthy, D. S. (2012). Farmers’ perception and adaptation to climate change: a case study of Sekyedumase district in Ghana. Environment, Development and Sustainability, 14(4), 495-505. Fulton, M. H., & Key, P. B. (2001). Acetylcholinesterase inhibition in estuarine fish and invertebrates as an indicator of organophosphorus insecticide exposure and effects. Environmental Toxicology and Chemistry, 20(1), 37-45. https://doi.org/10.1002/etc.5620200104. Gajendiran, A., & Abraham, J. (2018). An overview of pyrethroid insecticides. Frontiers in Biology, 13(2), 79-90. https://doi.org/10.1007/s11515-018-1489-z. García-Rivera, E. J., & Rigau-Pérez, J. G. (2006). Dengue virus Congenital and perinatal infections (pp. 187-197): Springer. 152 University of Ghana http://ugspace.ug.edu.gh Gatton, M. L., Chitnis, N., Churcher, T., Donnelly, M. J., Ghani, A. C., Godfray, H. C. J., . . . Ranson, H. (2013). The importance of mosquito behavioural adaptations to malaria control in Africa. Evolution: international journal of organic evolution, 67(4), 1218- 1230. https://doi.org/10.1111/evo.12063. Geissbühler, Y., Kannady, K., Chaki, P. P., Emidi, B., Govella, N. J., Mayagaya, V., . . . Killeen, G. F. (2009). Microbial larvicide application by a large-scale, community- based program reduces malaria infection prevalence in urban Dar Es Salaam, Tanzania. PLOS one, 4(3), e5107. https://doi.org/10.1371/journal.pone.0005107. Gendrin, M., & Christophides, G. K. (2013). The Anopheles mosquito microbiota and their impact on pathogen transmission. In M. Sylvie (Ed.), Anopheles mosquitoes (pp. Ch. 17). Rijeka: IntechOpen. Genoud, A. P., Gao, Y., Williams, G. M., & Thomas, B. P. (2019). Identification of gravid mosquitoes from changes in spectral and polarimetric backscatter cross sections. Journal of biophotonics, 0(0), e201900123. https://doi.org/10.1002/jbio.201900123. Georghiou, G. P., & Mellon, R. B. (1983). Pesticide resistance in time and space Pest resistance to pesticides (pp. 1-46): Springer. Ghosh, S., & Rahi, M. (2019). Malaria elimination in India; The way forward. Journal of vector borne diseases, 56(1), 32-40. https://doi.org/10.4103/0972-9062.257771 Gilioli, G., & Mariani, L. (2011). Sensitivity of Anopheles gambiae population dynamics to meteo-hydrological variability: a mechanistic approach. Malaria Journal, 10(1), 294. https://doi.org/10.1186/1475-2875-10-294. Glunt, K. D., Blanford, J. I., & Paaijmans, K. P. (2013). Chemicals, climate, and control: increasing the effectiveness of malaria vector control tools by considering relevant temperatures. PLOS Pathogens, 9(10), e1003602. https://doi.org/10.1371/journal.ppat.1003602. 153 University of Ghana http://ugspace.ug.edu.gh Glunt, K. D., Oliver, S. V., Hunt, R. H., & Paaijmans, K. P. (2018). The impact of temperature on insecticide toxicity against the malaria vectors Anopheles arabiensis and Anopheles funestus. Malar J., 17(1), 131. https://doi.org/10.1186/s12936-018-2250-4. Glunt, K. D., Paaijmans, K. P., Read, A. F., & Thomas, M. B. (2014). Environmental temperatures significantly change the impact of insecticides measured using WHOPES protocols. Malar J., 13(1), 350. https://doi.org/10.1186/1475-2875-13-350. Gogue, C., Wagman, J., Tynuv, K., Saibu, A., Yihdego, Y., Malm, K., . . . Robertson, M. (2020). An observational analysis of the impact of indoor residual spraying in Northern, Upper East, and Upper West Regions of Ghana: 2014 through 2017. Malaria Journal, 19(1), 242. https://doi.org/10.1186/s12936-020-03318-1. Goindin, D., Delannay, C., Gelasse, A., Ramdini, C., Gaude, T., Faucon, F., . . . Fouque, F. (2017). Levels of insecticide resistance to deltamethrin, malathion, and temephos, and associated mechanisms in Aedes aegypti mosquitoes from the Guadeloupe and Saint Martin islands (French West Indies). Infect. Dis. Poverty, 6(1), 38. https://doi.org/10.1186/s40249-017-0254-x. Gonçalvez De Carvalho, S. C., De Jesus Martins Jr, A., Pereira Lima, J. B., & Valle, D. (2002). Temperature influence on embryonic development of Anopheles albitarsis and Anopheles aquasalis. Memorias do Instituto Oswaldo Cruz, 97(8), 1117-1120. https://doi.org/10.1590/s0074-02762002000800009. González-Tokman, D., Córdoba-Aguilar, A., Dáttilo, W., Lira-Noriega, A., Sánchez-Guillén, R. A., & Villalobos, F. (2020). Insect responses to heat: physiological mechanisms, evolution and ecological implications in a warming world. Biol. Rev., 95(3), 802-821. https://doi.org/https://doi.org/10.1111/brv.12588 Gordon, C. J. (2005). Temperature and toxicology: an integrative, comparative, and environmental approach: CRC press. 154 University of Ghana http://ugspace.ug.edu.gh Gouge, D. H., Li, S., Walker, K., Sumner, C., Nair, S., & Olson, C. (2016). Mosquitoes: biology and integrated mosquito management: College of Agriculture, University of Arizona (Tucson, AZ). Gouignard, N., Cherrier, F., Brito-Fravallo, E., Pain, A., Zmarlak, N. M., Cailliau, K., . . . Mitri, C. (2019). Dual role of the Anopheles coluzzii Venus Kinase Receptor in both larval growth and immunity. Sci. Rep., 9(1), 3615. Gould, E., Pettersson, J., Higgs, S., Charrel, R., & Ddae Lamballerie, X. (2017). Emerging arboviruses: Why today? One Health, 4, 1-13. https://doi.org/10.1016/j.onehlt.2017.06.001. Green, B. S., & McCormick, M. I. (2005). Maternal and paternal effects determine size, growth and performance in larvae of a tropical reef fish. Marine Ecology Progress Series, 289, 263-272. Guerra, C., Howes, R., Patil, A., Gething, P., & Van Boeckel, T. (2010). The International Limits and Population at Risk of Plasmodium vivax transmission in 2009. PLoS neglected tropical diseases, 4(8), e774. https://doi.org/10.1371/journal.pntd.0000774. Gunasekaran, K., Muthukumaravel, S., Sahu, S. S., Vijayakumar, T., & Jambulingam, P. (2011). Glutathione S Transferase activity in Indian vectors of malaria: a defense mechanism against DDT. Journal of Medical Entomology, 48(3), 561-569. https://doi.org/10.1603/ME10194. Gunning, R. V., & Moores, G. D. (2001). Insensitive acetylcholinesterase as sites for resistance to organophosphates and carbamates in insects: insensitive acetylcholinesterase confers resistance in Lepidoptera Biochemical Sites of Insecticide Action and Resistance (pp. 221-238): Springer. 155 University of Ghana http://ugspace.ug.edu.gh Harbach, R. (2010). Mosquito taxonomic inventory: proboscis length. Retrieved from http://mosquito-taxonomic-inventory.info/proboscis-length [Accessed on January 9, 2021]. Harbach, R. E. (2007). The Culicidae (Diptera): a review of taxonomy, classification and phylogeny. Zootaxa, 1668(1), 591-638. Hardstone, M. C., Leichter, C., Harrington, L. C., Kasai, S., Tomita, T., & Scott, J. G. (2007). Cytochrome P450 monooxygenase-mediated permethrin resistance confers limited and larval specific cross-resistance in the southern house mosquito, Culex pipiens quinquefasciatus. Pesticide Biochemistry and Physiology, 89(3), 175-184. https://doi.org/10.1016/j.pestbp.2007.06.006. Hardy, M. (2014). Resistance is not futile: It shapes insecticide discovery. Insects, 5(1), 227- 242. https://doi.org/10.3390/insects5010227. Hay, S. I., Okiro, E. A., Gething, P. W., Patil, A. P., Tatem, A. J., Guerra, C. A., & Snow, R. W. (2010). Estimating the global clinical burden of Plasmodium falciparum malaria in 2007. PLoS medicine, 7(6), e1000290. Hemingway, J., & Brogdon, W. (1998). Techniques to detect insecticide resistance mechanisms. Henderson, R. M., Reinert, S. A., Dekhtyar, P., & Migdal, A. (2015). Climate Change in 2018: Implications for Business. Risk, 1. Herrero, M. T., Ringler, C., Steeg, J. V. D., Thornton, P. K., Zhu, T., Bryan, E., . . . Notenbaert, A. M. O. (2010). Climate variability and climate change and their impacts on Kenya’s agricultural sector. Hodjati, M., & Curtis, C. (1999). Effects of permethrin at different temperatures on pyrethroid‐ resistant and susceptible strains of Anopheles. Medical and Veterinary Entomology, 13(4), 415-422. https://doi.org/10.1046/j.1365-2915.1999.00198.x. 156 University of Ghana http://ugspace.ug.edu.gh Hogarh, J. N., Agyekum, T. P., Bempah, C. K., Owusu-Ansah, E. D. J., Avicor, S. W., Awandare, G. A., . . . Obiri-Danso, K. (2018). Environmental health risks and benefits of the use of mosquito coils as malaria prevention and control strategy. Malaria Journal, 17(1), 265. https://doi.org/10.1186/s12936-018-2412-4. Hooijmans, C. R., Rovers, M. M., De Vries, R. B., Leenaars, M., Ritskes-Hoitinga, M., & Langendam, M. W. (2014). SYRCLE’s risk of bias tool for animal studies. BMC medical research methodology, 14(1), 43. Hoshen, M. B., & Morse, A. P. (2004). A weather-driven model of malaria transmission. Malaria Journal, 3(1), 32. https://doi.org/10.1186/1475-2875-3-32. Huestis, D. L., Artis, M. L., Armbruster, P. A., & Lehmann, T. (2017). Photoperiodic responses of Sahelian malaria mosquitoes Anopheles coluzzii and An. arabiensis. Parasites and vectors, 10(1), 621. https://doi.org/10.1186/s13071-017-2556-z. Hunt, R. H., Fuseini, G., Knowles, S., Stiles-Ocran, J., Verster, R., Kaiser, M. L., . . . Coetzee, M. (2011). Insecticide resistance in malaria vector mosquitoes at four localities in Ghana, West Africa. Parasites and vectors, 4(1), 107. https://doi.org/10.1186/1756- 3305-4-107. Ikemoto, T. (2008). Tropical malaria does not mean hot environments. Journal of Medical Entomology, 45(6), 963-969. https://doi.org/10.1093/jmedent/45.6.963. Impoinvil, D. E., Cardenas, G. A., Gihture, J. I., Mbogo, C. M., & Beier, J. C. (2007). Constant temperature and time period effects on Anopheles gambiae egg hatching. Journal of the American Mosquito Control Association, 23(2), 124. https://doi.org/10.2987/8756- 971x(2007)23[124:ctatpe]2.0.co;2. IPCC. (2007). Climate change 2007-impacts, adaptation and vulnerability: Working group II contribution to the fourth assessment report of the Intergovernmental Panel on Climate Change (IPCC). (Vol. 4): Cambridge University Press. 157 University of Ghana http://ugspace.ug.edu.gh IRAC. (2006). Prevention and management of insecticide resistance in vectors of public health importance. Insecticide Resistance Action Committee. (pp. 14-16). Ishak, I. (2014). Characterisation of mechanisms of insecticide resistance in Malaysian populations of the arbovirus vectors Aedes aegypti and Aedes albopictus. University of Liverpool. Jackman, J. A., & Olson, J. K. (2002). Mosquitoes and the diseases they transmit. Texas FARMER Collections. Jaleel, W., Saeed, S., Naqqash, M. N., Sial, M. U., Ali, M., Zaka, S. M., . . . Ghramh, H. A. (2020). Effects of temperature on baseline susceptibility and stability of insecticide resistance against Plutella xylostella (Lepidoptera: Plutellidae) in the absence of selection pressure. Saudi Journal of Biological Sciences, 27(1), 1-5. https://doi.org/10.1016/j.sjbs.2019.03.004. Jayaraj, R., Megha, P., & Sreedev, P. (2016). Organochlorine pesticides, their toxic effects on living organisms and their fate in the environment. Interdisciplinary toxicology, 9(3-4), 90. https://doi.org/10.1515/intox-2016-0012. Joy, T. K., Arik, A. J., Corby-Harris, V., Johnson, A. A., & Riehle, M. A. (2010). The impact of larval and adult dietary restriction on lifespan, reproduction and growth in the mosquito Aedes aegypti. Experimental Gerontology, 45(9), 685-690. https://doi.org/10.1016/j.exger.2010.04.009. Kabula, B. I., Kisinza, W., Tungu, P., Ndege, C., Batengana, B., Kollo, D., . . . Magesa, S. (2014a). Co-occurrence and distribution of East (L1014S) and West (L1014F) African knock-down resistance in Anopheles gambiae sensu lato population of Tanzania. Tropical medicine and international health, 19(3), 331-341. https://doi.org/10.1111/tmi.12248. 158 University of Ghana http://ugspace.ug.edu.gh Kabula, B. I., Tungu, P., Malima, R., Rowland, M., Minja, J., Wililo, R., . . . Kisinza, W. (2014b). Distribution and spread of pyrethroid and DDT resistance among the Anopheles gambiae complex in Tanzania. Medical and Veterinary Entomology, 28(3), 244-252. https://doi.org/10.1111/mve.12036. Karasali, H., & Maragou, N. (2016). Pesticides and herbicides: types of pesticide. In B. Caballero, P. M. Finglas & F. Toldrá (Eds.), Encyclopedia of Food and Health (pp. 319-325). Oxford: Academic Press. Kauffman, E., Payne, A., Franke, M. A., Schmid, M. A., Harris, E., & Kramer, L. D. (2017). Rearing of Culex spp. and Aedes spp. mosquitoes. Bio-protocol, 7(17), e2542. https://doi.org/10.21769/BioProtoc.2542. Kawada, H., Ohashi, K., Dida, G. O., Sonye, G., Njenga, S. M., Mwandawiro, C., & Minakawa, N. (2014). Insecticidal and repellent activities of pyrethroids to the three major pyrethroid-resistant malaria vectors in western Kenya. Parasites & vectors, 7(1), 208. https://doi.org/10.1186/1756-3305-7-208 Keena, M. A., & Moore, P. M. (2010). Effects of temperature on Anoplophora glabripennis (Coleoptera: Cerambycidae) larvae and pupae. Environmental Entomology, 39(4), 1323-1335. https://doi.org/10.1603/EN09369. Keil, G., Cummings, E., & De Magalhães, J. P. (2015). Being cool: how body temperature influences ageing and longevity. Biogerontology, 16(4), 383-397. https://doi.org/10.1007/s10522-015-9571-2. Kgoroebutswe, T. K., Makate, N., Fillinger, U., Mpho, M., Segoea, G., Sangoro, P. O., . . . Nkya, T. E. (2020). Vector control for malaria elimination in Botswana: progress, gaps and opportunities. Malaria Journal, 19(1), 301. https://doi.org/10.1186/s12936-020- 03375-6. 159 University of Ghana http://ugspace.ug.edu.gh Khan, H. A. A., & Akram, W. (2014). The effect of temperature on the toxicity of insecticides against Musca domestica L.: Implications for the effective management of Diarrhea. PLOS one, 9(4), e95636. https://doi.org/10.1371/journal.pone.0095636. Kingsolver, J. G., & Huey, R. B. (2008). Size, temperature, and fitness: three rules. Evolutionary Ecology Research, 10(2), 251-268. Kirby, M. J., & Lindsay, S. W. (2009). Effect of temperature and inter-specific competition on the development and survival of Anopheles gambiae sensu stricto and An. arabiensis larvae. Acta tropica, 109(2), 118-123. https://doi.org/10.1016/j.actatropica.2008.09.025. Kirchner, S., & Waters, A. P. (2019). Coalition politics: linking malaria transmission to mosquito reproduction. Trends in parasitology, 35(7), 486-489. https://doi.org/10.1016/j.pt.2019.05.003. Klose, M. K., & Robertson, R. M. (2004). Stress-induced thermoprotection of neuromuscular transmission. Integrative and Comparative Biology, 44(1), 14-20. https://doi.org/10.1093/icb/44.1.14. Koenraadt, C. J. M. (2008). Pupal dimensions as predictors of adult size in fitness studies of Aedes aegypti (Diptera: Culicidae). Journal of Medical Entomology, 45(2), 331-336. https://doi.org/10.1093/jmedent/45.2.331. Kokwaro, G. (2009). Ongoing challenges in the management of malaria. Malaria Journal, 8(1), S2. https://doi.org/10.1186/1475-2875-8-S1-S2. Kraemer, M. U., Sinka, M. E., Duda, K. A., Mylne, A. Q., Shearer, F. M., Barker, C. M., . . . Van Bortel, W. (2015). The global distribution of the arbovirus vectors Aedes aegypti and Ae. albopictus. elife, 4, e08347. https://doi.org/10.7554/eLife.08347. 160 University of Ghana http://ugspace.ug.edu.gh Kristan, M., Abeku, T. A., & Lines, J. (2018). Effect of environmental variables and kdr resistance genotype on survival probability and infection rates in Anopheles gambiae (ss). Parasites Vectors, 11(1), 560. https://doi.org/10.1186/s13071-018-3150-8. Kristensen, T. N., Kjeldal, H., Schou, M. F., & Nielsen, J. L. (2016). Proteomic data reveal a physiological basis for costs and benefits associated with thermal acclimation. J. Exp. Biol., 219(7), 969-976. https://doi.org/10.1242/jeb.132696. Kudom, A. A. (2015). Larval ecology of Anopheles coluzzii in Cape Coast, Ghana: water quality, nature of habitat and implication for larval control. Malaria Journal, 14(1), 447. https://doi.org/10.1186/s12936-015-0989-4. Kudom, A. A., Mensah, B. A., Froeschl, G., Rinder, H., & Boakye, D. (2015a). Preliminary assessment of the potential role of urbanization in the distribution of carbamate and organophosphate resistant populations of Culex species in Ghana. Parasites and vectors, 8(1), 8. https://doi.org/10.1186/s13071-014-0621-4. Kudom, A. A., Mensah, B. A., Froeschl, G., Rinder, H., & Boakye, D. (2015b). DDT and pyrethroid resistance status and laboratory evaluation of bio-efficacy of long lasting insecticide treated nets against Culex quinquefasciatus and Culex decens in Ghana. Acta tropica, 150, 122-130. https://doi.org/10.1016/j.actatropica.2015.07.009. Kweka, E. J., Baraka, V., Mathias, L., Mwang’onde, B., Baraka, G., Lyaruu, L., & Mahande, A. M. (2018). Ecology of Aedes mosquitoes, the major vectors of arboviruses in human population Dengue Fever-A resilient threat in the face of innovation: IntechOpen. Labbé, P., Alout, H., Djogbénou, L., Pasteur, N., & Weill, M. (2011). Evolution of Resistance to Insecticide in Disease Vectors. In M. Tibayrenc (Ed.), Genetics and Evolution of Infectious Disease (pp. 363-409). London: Elsevier. Lafferty, K. D., & Mordecai, E. A. (2016). The rise and fall of infectious disease in a warmer world. F1000Research, 5. https://doi.org/10.12688/f1000research.8766.1. 161 University of Ghana http://ugspace.ug.edu.gh Lardeux, F. J., Tejerina, R. H., Quispe, V., & Chavez, T. K. (2008). A physiological time analysis of the duration of the gonotrophic cycle of Anopheles pseudopunctipennis and its implications for malaria transmission in Bolivia. Malaria Journal, 7(1), 141. https://doi.org/10.1186/1475-2875-7-141. Lebl, K., Brugger, K., & Rubel, F. (2013). Predicting Culex pipiens/restuans population dynamics by interval lagged weather data. Parasites & vectors, 6(1), 129. https://doi.org/10.1186/1756-3305-6-129. Lebl, K., Zittra, C., Silbermayr, K., Obwaller, A., Berer, D., Brugger, K., . . . Rubel, F. (2015). Mosquitoes (Diptera: Culicidae) and their relevance as disease vectors in the city of Vienna, Austria. Parasitology research, 114(2), 707-713. https://doi.org/10.1007/s00436-014-4237-6. Lefevre, T., Ohm, J., Dabiré, K. R., Cohuet, A., Choisy, M., Thomas, M. B., & Cator, L. (2018). Transmission traits of malaria parasites within the mosquito: Genetic variation, phenotypic plasticity, and consequences for control. 11(4), 456-469. https://doi.org/10.1111/eva.12571. Lehmann, T., Dalton, R., Kim, E. H., Dahl, E., Diabate, A., Dabire, R., & Dujardin, J. P. (2006). Genetic contribution to variation in larval development time, adult size, and longevity of starved adults of Anopheles gambiae. Infection, Genetics and Evolution, 6(5), 410- 416. https://doi.org/10.1016/j.meegid.2006.01.007. Leong, C.-S., Vythilingam, I., Liew, J. W.-K., Wong, M.-L., Wan-Yusoff, W. S., & Lau, Y.- L. (2019). Enzymatic and molecular characterization of insecticide resistance mechanisms in field populations of Aedes aegypti from Selangor, Malaysia. Parasites Vectors, 12(1), 236. https://doi.org/10.1186/s13071-019-3472-1. 162 University of Ghana http://ugspace.ug.edu.gh Li, J. (2009). Simple stage-structured models for wild and transgenic mosquito populations. Journal of Difference Equations and Applications, 15(4), 327-347. https://doi.org/10.1080/10236190802566491. Liberati, A., Altman, D. G., Tetzlaff, J., Mulrow, C., Gøtzsche, P. C., Ioannidis, J. P., . . . Moher, D. (2009). The PRISMA statement for reporting systematic reviews and meta- analyses of studies that evaluate health care interventions: explanation and elaboration. Journal of clinical epidemiology, 62(10), e1-e34. Lindblade, K. A., Mwandama, D., Mzilahowa, T., Steinhardt, L., Gimnig, J., Shah, M., . . . Mathanga, D. P. (2015). A cohort study of the effectiveness of insecticide-treated bed nets to prevent malaria in an area of moderate pyrethroid resistance, Malawi. Malaria Journal, 14(1), 31. https://doi.org/10.1186/s12936-015-0554-1. Lindsay, S. W., Wilkins, H. A., Zieler, H. A., Daly, R. J., Petrarca, V., & Byass, P. (1991). Ability of Anopheles gambiae mosquitoes to transmit malaria during the dry and wet seasons in an area of irrigated rice cultivation in The Gambia. Journal of Tropical Medicine and Hygiene, 94(5), 313-324. Liu, N. (2015). Insecticide resistance in mosquitoes: impact, mechanisms, and research directions. Annu. Rev. Entomol., 60, 537-559. https://doi.org/10.1146/annurev-ento- 010814-020828. Liu, Y., Zhang, H., Qiao, C., Lu, X., & Cui, F. (2011). Correlation between carboxylesterase alleles and insecticide resistance in Culex pipiens complex from China. Parasites and vectors, 4(1), 236. https://doi.org/10.1186/1756-3305-4-236. Loetti, V., Schweigmann, N., & Burroni, N. (2011). Temperature effects on the immature development time of Culex eduardoi Casal & García (Diptera: Culicidae). Neotropical Entomology, 40, 138-142. 163 University of Ghana http://ugspace.ug.edu.gh Lunde, T. M., Bayoh, M. N., & Lindtjørn, B. (2013). How malaria models relate temperature to malaria transmission. Parasites and vectors, 6(1), 1-10. Lushchak, V. I., Matviishyn, T. M., Husak, V. V., Storey, J. M., & Storey, K. B. (2018). Pesticide toxicity: a mechanistic approach. EXCLI journal, 17, 1101. https://doi.org/10.17179/excli2018-1710. Lyimo, E. O., & Takken, W. (1993). Effects of adult body size on fecundity and the pre-gravid rate of Anopheles gambiae females in Tanzania. Medical and Veterinary Entomology, 7(4), 328-332. https://doi.org/10.1111/j.1365-2915.1993.tb00700.x. Lyons, C. L., Coetzee, M., & Chown, S. L. (2013). Stable and fluctuating temperature effects on the development rate and survival of two malaria vectors, Anopheles arabiensis and Anopheles funestus. Parasites and vectors, 6(1), 104. https://doi.org/10.1186/1756- 3305-6-104. Lyons, C. L., Coetzee, M., Terblanche, J. S., & Chown, S. L. (2012). Thermal limits of wild and laboratory strains of two African malaria vector species, Anopheles arabiensis and Anopheles funestus. Malar J, 11(1), 226. https://doi.org/10.1186/1475-2875-11-226. Lyons, C. L., Coetzee, M., Terblanche, J. S., & Chown, S. L. (2014). Desiccation tolerance as a function of age, sex, humidity and temperature in adults of the African malaria vectors Anopheles arabiensis and Anopheles funestus. Journal of Experimental Biology, 217(21), 3823-3833. https://doi.org/10.1242/jeb.104638. Ma, M., Huang, M., & Leng, P. (2016). Abundance and distribution of immature mosquitoes in urban rivers proximate to their larval habitats. Acta tropica, 163, 121-129. https://doi.org/https://doi.org/10.1016/j.actatropica.2016.08.010 Machani, M. G., Ochomo, E., Zhong, D., Zhou, G., Wang, X., Githeko, A. K., . . . Afrane, Y. A. (2020). Phenotypic, genotypic and biochemical changes during pyrethroid resistance 164 University of Ghana http://ugspace.ug.edu.gh selection in Anopheles gambiae mosquitoes. Scientific reports, 10(1), 19063. https://doi.org/10.1038/s41598-020-75865-1. Madzlan, F., Dom, N. C., Tiong, C. S., & Zakaria, N. (2016). Breeding characteristics of Aedes mosquitoes in dengue risk area. Procedia - Social and Behavioral Sciences, 234, 164- 172. https://doi.org/10.1016/j.sbspro.2016.10.231. Maheu-Giroux, M., & Castro, M. C. (2013). Impact of community-based larviciding on the prevalence of malaria infection in Dar es Salaam, Tanzania. PLOS one, 8(8), e71638. https://doi.org/10.1371/journal.pone.0071638. Mahgoub, M. M., Kweka, E. J., & Himeidan, Y. E. (2017). Characterisation of larval habitats, species composition and factors associated with the seasonal abundance of mosquito fauna in Gezira, Sudan. Infectious Diseases of Poverty, 6(1), 23. https://doi.org/10.1186/s40249-017-0242-1. Mala, A. O., Irungu, L. W., Mitaki, E. K., Shililu, J. I., Mbogo, C. M., Njagi, J. K., & Githure, J. I. (2014). Gonotrophic cycle duration, fecundity and parity of Anopheles gambiae complex mosquitoes during an extended period of dry weather in a semi arid area in Baringo County, Kenya. International Journal of Mosquito Research, 1(2), 28-34. Mamai, W., Bimbile-Somda, N. S., Maiga, H., Juarez, J. G., Muosa, Z. A. I., Ali, A. B., . . . Gilles, J. R. L. (2017). Optimization of mosquito egg production under mass rearing setting: effects of cage volume, blood meal source and adult population density for the malaria vector, Anopheles arabiensis. Malaria Journal, 16(1), 41. https://doi.org/10.1186/s12936-017-1685-3. Mamai, W., Lobb, L. N., Bimbilé Somda, N. S., Maiga, H., Yamada, H., Lees, R. S., . . . Gilles, J. R. L. (2018). Optimization of mass-rearing methods for Anopheles arabiensis larval stages: Effects of rearing water temperature and larval density on mosquito life-history 165 University of Ghana http://ugspace.ug.edu.gh traits. Journal of economic entomology, 111(5), 2383-2390. https://doi.org/10.1093/jee/toy213. Manoukis, N. C., Touré, M. B., Sissoko, I., Doumbia, S., Traoré, S. F., Diuk-wasser Maria, A., & Taylor, C. E. (2006). Is vector body size the key to reduced malaria transmission in the irrigated region of Niono, Mali? Journal of Medical Entomology, 43(5), 820-827. https://doi.org/10.1093/jmedent/43.5.820. Marinho, R. A., Beserra, E. B., Bezerra‐Gusmão, M. A., Porto, V. d. S., Olinda, R. A., & dos Santos, C. A. (2016). Effects of temperature on the life cycle, expansion, and dispersion of Aedes aegypti (Diptera: Culicidae) in three cities in Paraiba, Brazil. Journal of vector ecology, 41(1), 1-10. https://doi.org/10.1111/jvec.12187. Matowo, J., Jones, C. M., Kabula, B., Ranson, H., Steen, K., Mosha, F., . . . Weetman, D. (2014). Genetic basis of pyrethroid resistance in a population of Anopheles arabiensis, the primary malaria vector in Lower Moshi, north-eastern Tanzania. Parasites and vectors, 7(1), 274. https://doi.org/10.1186/1756-3305-7-274. Matowo, J., Kulkarni, M. A., Mosha, F. W., Oxborough, R. M., Kitau, J. A., Tenu, F., & Rowland, M. (2010). Biochemical basis of permethrin resistance in Anopheles arabiensis from Lower Moshi, north-eastern Tanzania. Malaria Journal, 9(1), 193. https://doi.org/10.1186/1475-2875-9-193. Mattah, P. A. D., Futagbi, G., Amekudzi, L. K., Mattah, M. M., de Souza, D. K., Kartey- Attipoe, W. D., . . . Wilson, M. D. (2017). Diversity in breeding sites and distribution of Anopheles mosquitoes in selected urban areas of southern Ghana. Parasit and Vectors, 10(1), 25. https://doi.org/10.1186/s13071-016-1941-3. Mattah, P. A. D., Futagbi, G., & Mattah, M. M. (2018). Awareness of environmental change, climate variability, and their role in prevalence of mosquitoes among urban dwellers in 166 University of Ghana http://ugspace.ug.edu.gh Southern Ghana. Journal of Environmental and Public Health, 2018. https://doi.org/10.1155/2018/5342624. Matzrafi, M. (2019). Climate change exacerbates pest damage through reduced pesticide efficacy. Pest Manag. Sci., 75(1), 9-13. https://doi.org/10.1002/ps.5121. McCann, R. S., Kabaghe, A. N., Moraga, P., Gowelo, S., Mburu, M. M., Tizifa, T., . . . Phiri, K. S. (2021). The effect of community-driven larval source management and house improvement on malaria transmission when added to the standard malaria control strategies in Malawi: a cluster-randomized controlled trial. Malaria Journal, 20(1), 232. https://doi.org/10.1186/s12936-021-03769-0. McCann, R. S., van den Berg, H., Diggle, P. J., van Vugt, M., Terlouw, D. J., Phiri, K. S., . . . Takken, W. (2017). Assessment of the effect of larval source management and house improvement on malaria transmission when added to standard malaria control strategies in southern Malawi: study protocol for a cluster-randomised controlled trial. BMC Infectious Diseases, 17(1), 639. https://doi.org/10.1186/s12879-017-2749-2. McCormick, M., & Gagliano, M. (2008). Carry-over effects-the importance of a good start. Paper presented at the Proceedings of the 11 th International Coral Reef Symposium, Ft. Lauderdale, FL Session. McIntyre, K. M., Setzkorn, C., Hepworth, P. J., Morand, S., Morse, A. P., & Baylis, M. (2017). Systematic assessment of the climate sensitivity of important human and domestic animals pathogens in Europe. Scientific reports, 7(1), 7134. https://doi.org/10.1038/s41598-017-06948-9. Menge, D. M., Guda, T., Zhong, D., Pai, A., Zhou, G., Beier, J. C., . . . Yan, G. (2005). Fitness consequences of Anopheles gambiae population hybridization. Malaria Journal, 4(1), 44. https://doi.org/10.1186/1475-2875-4-44. 167 University of Ghana http://ugspace.ug.edu.gh Mohammed, A., & Chadee, D. D. (2011). Effects of different temperature regimens on the development of Aedes aegypti (L.)(Diptera: Culicidae) mosquitoes. Acta tropica, 119(1), 38-43. https://doi.org/10.1016/j.actatropica.2011.04.004. Mohammed, A. T. (2013). An assessment of malaria control activities in Kassenanankana District. (Masters dissertation), Kwame Nkrumah University of Science and Technology, Kumasi. Moller-Jacobs, L. L., Murdock, C. C., & Thomas, M. B. (2014). Capacity of mosquitoes to transmit malaria depends on larval environment. Parasites & vectors, 7(1), 593. https://doi.org/10.1186/s13071-014-0593-4 Monahan, E. A. (2017). Evaluating the effectiveness of deltamethrin and permethrin in insecticide treated nets. Duke University. Monteiro, L. C., De Souza, J. R., & De Albuquerque, C. M. (2007). Eclosion rate, development and survivorship of Aedes albopictus (Skuse) (Diptera: Culicidae) under different water temperatures. Neotropical Entomology, 36(6), 966-971. Mordecai, E. A., Paaijmans, K. P., Johnson, L. R., Balzer, C., Ben‐Horin, T., de Moor, E., . . . Smith, T. C. (2013). Optimal temperature for malaria transmission is dramatically lower than previously predicted. Ecology letters, 16(1), 22-30. https://doi.org/10.1111/ele.12015. Morgan, K., Somboon, P., & Walton, C. (2013). Understanding Anopheles diversity in Southeast Asia and its applications for malaria control. Anopheles mosquitoes-new insights into malaria vectors, 327, 355. https://doi.org/10.5772/55709. Mouhamadou, C. S., de Souza, S. S., Fodjo, B. K., Zoh, M. G., Bli, N. K., & Koudou, B. G. (2019). Evidence of insecticide resistance selection in wild Anopheles coluzzii mosquitoes due to agricultural pesticide use. Infect. Dis. Poverty, 8(1), 64. https://doi.org/10.1186/s40249-019-0572-2. 168 University of Ghana http://ugspace.ug.edu.gh Mpho, M., Callaghan, A., & Holloway, G. J. (2002). Temperature and genotypic effects on life history and fluctuating asymmetry in a field strain of Culex pipiens. Heredity, 88(4), 307-312. https://doi.org/10.1038/sj.hdy.6800045. Mukhtar, A. Y. A., Munyakazi, J. B., & Ouifki, R. (2019). Assessing the role of climate factors on malaria transmission dynamics in South Sudan. Mathematical Biosciences, 310, 13- 23. https://doi.org/10.1016/j.mbs.2019.01.002. Mullen, G. R., & Durden, L. A. (2009). Medical and veterinary entomology: Academic press. Müller, P., Warr, E., Stevenson, B. J., Pignatelli, P. M., Morgan, J. C., Steven, A., . . . Donnelly, M. J. (2008). Field-caught permethrin-resistant Anopheles gambiae overexpress CYP6P3, a P450 that metabolises pyrethroids. PLOS Genetics, 4(11), e1000286. https://doi.org/10.1371/journal.pgen.1000286. Murdock, C., Sternberg, E., & Thomas, M. (2016). Malaria transmission potential could be reduced with current and future climate change. Scientific reports, 6(1), 1-7. https://doi.org/10.1038/srep27771. Murdock, C. C., Blanford, S., Luckhart, S., & Thomas, M. B. (2014). Ambient temperature and dietary supplementation interact to shape mosquito vector competence for malaria. Journal of Insect Physiology, 67, 37-44. https://doi.org/10.1016/j.jinsphys.2014.05.020. Murdock, C. C., Moller-Jacobs, L. L., & Thomas, M. B. (2013). Complex environmental drivers of immunity and resistance in malaria mosquitoes. Proc. R. Soc. B: Biol. Sci., 280(1770), 20132030. https://doi.org/10.1098/rspb.2013.2030. Murdock, C. C., Paaijmans, K. P., Bell, A. S., King, J. G., Hillyer, J. F., Read, A. F., & Thomas, M. B. (2012a). Complex effects of temperature on mosquito immune function. Proc. R. Soc. B: Biol. Sci., 279(1741), 3357-3366. https://doi.org/10.1098/rspb.2012.0638. 169 University of Ghana http://ugspace.ug.edu.gh Murdock, C. C., Paaijmans, K. P., Cox-Foster, D., Read, A. F., & Thomas, M. B. (2012b). Rethinking vector immunology: the role of environmental temperature in shaping resistance. Nat. Rev. Microbiol., 10(12), 869. https://doi.org/10.1038/nrmicro2900. Nangombe, S. S., Zhou, T., Zhang, W., Zou, L., & Li, D. (2019). High-Temperature Extreme Events Over Africa Under 1.5 and 2 °C of Global Warming. Journal of Geophysical Research: Atmospheres, 124(8), 4413-4428. https://doi.org/https://doi.org/10.1029/2018JD029747 Narahashi, T. (2002). Nerve membrane ion channels as the target site of insecticides. Mini Rreviews in Medicinal Chemistry, 2(4), 419-432. https://doi.org/10.2174/1389557023405927. Narahashi, T. (2010). Neurophysiological Effects of Insecticides. In R. Krieger (Ed.), Hayes' Handbook of Pesticide Toxicology (Third Edition) (pp. 799-817). New York: Academic Press. Nardini, L., Christian, R. N., Coetzer, N., Ranson, H., Coetzee, M., & Koekemoer, L. L. (2012). Detoxification enzymes associated with insecticide resistance in laboratory strains of Anopheles arabiensis of different geographic origin. Parasites & vectors, 5(1), 113. https://doi.org/10.1186/1756-3305-5-113. National Research Council. (2011). Advancing the science of climate change. Washington DC, USA: National Academies Press. Nature Education. (2014). Dengue Transmission. Retrieved from https://www.nature.com/scitable/topicpage/dengue-transmission-22399758/ [Accessed on June 14, 2021]. Nchoutpouen, E., Talipouo, A., Djiappi-Tchamen, B., Djamouko-Djonkam, L., Kopya, E., Ngadjeu, C. S., . . . Antonio-Nkondjio, C. (2019). Culex species diversity, susceptibility to insecticides and role as potential vector of Lymphatic filariasis in the city of 170 University of Ghana http://ugspace.ug.edu.gh Yaoundé, Cameroon. PLoS neglected tropical diseases, 13(4), e0007229. https://doi.org/10.1371/journal.pntd.0007229. Neven, L. G. (2000). Physiological responses of insects to heat. Postharvest Biology and Technology, 21(1), 103-111. https://doi.org/https://doi.org/10.1016/S0925- 5214(00)00169-1 Ng, S. H., Zhang, H., Goh, F. G., Ng, L.-C., Ji, L., & Cai, Y. (2021). Induced Hatching of Quiescent Aedes aegypti (Diptera: Culicidae) Eggs by Labile Glutathione-Stabilizable Compounds From Yeast Extract. Journal of Medical Entomology, 58(2), 956-960. https://doi.org/10.1093/jme/tjaa210 Ngarakana-Gwasira, E., Bhunu, C., Masocha, M., & Mashonjowa, E. (2016). Assessing the role of climate change in malaria transmission in Africa. Malaria research treatment, 2016, 1–7, 7104291. https://doi.org/10.1155/2016/7104291. Nikbakhtzadeh, M. R., Buss, G. K., & Leal, W. S. (2016). Toxic effect of blood feeding in male mosquitoes. Frontiers in Physiology, 7, 4. https://doi.org/10.3389/fphys.2016.00004. Nkya, T. E., Akhouayri, I., Kisinza, W., & David, J.-P. (2013). Impact of environment on mosquito response to pyrethroid insecticides: Facts, evidences and prospects. Insect biochemistry and molecular biology, 43(4), 407-416. https://doi.org/10.1016/j.ibmb.2012.10.006. Nnko, E. J., Kihamia, C., Tenu, F., Premji, Z., & Kweka, E. (2017). Insecticide use pattern and phenotypic susceptibility of Anopheles gambiae sensu lato to commonly used insecticides in Lower Moshi, northern Tanzania. BMC Res. Notes, 10(1), 443. https://doi.org/10.1186/s13104-017-2793-4. Nwane, P., Etang, J., Chouaibou, M., Toto, J. C., Kerah-Hinzoumbé, C., Mimpfoundi, R., . . . Simard, F. (2009). Trends in DDT and pyrethroid resistance in Anopheles gambiae s.s. 171 University of Ghana http://ugspace.ug.edu.gh populations from urban and agro-industrial settings in southern Cameroon. BMC Infect. Dis., 9(1), 163. https://doi.org/10.1186/1471-2334-9-163. Nwankwo, A. (2021). Quantifying the impact of insecticide resistance in the transmission dynamics of malaria. Chaos, Solitons & Fractals, 142, 110481. https://doi.org/10.1016/j.chaos.2020.110481. Nyasembe, V. O., & Torto, B. (2014). Volatile phytochemicals as mosquito semiochemicals. Phytochemistry Letters, 8, 196-201. https://doi.org/10.1016/j.phytol.2013.10.003. Obacha, A. (2016). Malaria Transmission Dynamics and Insecticide Resistance Status of Anopheles funestus (Diptera: Culicidae) during four years of Indoor Residual Spraying in Northern Ghana. (Masters Dessertation), University of Ghana, Legon, Accra. Retrieved from http://ugspace.ug.edu.gh/handle/123456789/22961. Ochomo, E., Bayoh, M., Brogdon, W., Gimnig, J., Ouma, C., Vulule, J., & Walker, E. (2013). Pyrethroid resistance in Anopheles gambiae ss and Anopheles arabiensis in western Kenya: phenotypic, metabolic and target site characterizations of three populations. Med. Vet. Entomol., 27(2), 156-164. https://doi.org/10.1111/j.1365- 2915.2012.01039.x. Ohm, J. R., Baldini, F., Barreaux, P., Lefevre, T., Lynch, P. A., Suh, E., . . . Thomas, M. B. (2018). Rethinking the extrinsic incubation period of malaria parasites. Parasites & vectors, 11(1), 178. https://doi.org/10.1186/s13071-018-2761-4. Okechukwu, R., Okereke, J., Ezejiofor, T., Obasi, K., & Ebere, G. (2011). Relationship between malaria vector densities in artificial container habitats, land-use changes and temperature. Nigerian Journal of Parasitology, 32(2). Okuneye, K., Eikenberry, S. E., & Gumel, A. B. (2019). Weather-driven malaria transmission model with gonotrophic and sporogonic cycles. Journal of biological dynamics, 13(sup1), 288-324. 172 University of Ghana http://ugspace.ug.edu.gh Olayemi, I., Danlami, G., Isah, B., Odeyemi, O., Ukubuiwe, A., & OM, M. (2011). Indoor behaviour responses of the principal malaria vector, Anopheles gambiae (Diptera: Culicidae), in relation to micro-climatic conditions in Minna, North Central Nigeria. Research Journal of Parasitology, 6, 109-115. https://doi.org/10.3923/jp.2011.109.115. Oliver, S. (2015). The effect of environmental and metabolic stress on the expression of insecticide resistance phenotype and longevity in the Southern African malaria vectors Anopheles arabiensis and Anopheles funestus. Oliver, S. V., & Brooke, B. D. (2017). The effect of elevated temperatures on the life history and insecticide resistance phenotype of the major malaria vector Anopheles arabiensis (Diptera: Culicidae). Malar J., 16(1), 1-13. https://doi.org/10.1186/s12936-017-1720- 4. Ononamadu, C. J., Datit, J. T., & Imam, A. A. (2020). Insecticide Resistance Profile of Anopheles gambiae Mosquitoes: A Study of a Residential and Industrial Breeding Sites in Kano Metropolis, Nigeria. Environ Health Insights, 14, 1178630219897272. https://doi.org/10.1177/1178630219897272 Onyango, M. G., Bialosuknia, S. M., Payne, A. F., Mathias, N., Kuo, L., Vigneron, A., . . . Kramer, L. D. (2020). Increased temperatures reduce the vectorial capacity of Aedes mosquitoes for Zika virus. Emerging Microbes & Infections, 9(1), 67-77. https://doi.org/10.1080/22221751.2019.1707125. Opoku, A., & Ansa-Asare, O. (2007). The occurrences and habitat characteristics of mosquitoes in Accra, Ghana. West African Journal of Applied Ecology, 11(1). Osman, T. (2010). Species Identification and Infectivity rate of Malaria Vector in two endemic malaria areas in Sudan. Egyptian academic journal of biological sciences, 2(1), 1 - 15. 173 University of Ghana http://ugspace.ug.edu.gh Osoro, J. K., Machani, M. G., Ochomo, E., Wanjala, C., Omukunda, E., Munga, S., . . . Afrane, Y. A. (2021). Insecticide resistance exerts significant fitness costs in immature stages of Anopheles gambiae in western Kenya. Malaria Journal, 20(1), 259. https://doi.org/10.1186/s12936-021-03798-9. Ossè, R. A., Tokponnon, F., Padonou, G. G., Sidick, A., Aïkpon, R., Fassinou, A., . . . Akogbéto, M. C. (2019). Involvement of Anopheles nili in Plasmodium falciparum transmission in North Benin. Malaria Journal, 18(1), 152. https://doi.org/10.1186/s12936-019-2792-0. Otten, M., Aregawi, M., Were, W., Karema, C., Medin, A., Bekele, W., . . . Korenromp, E. (2009). Initial evidence of reduction of malaria cases and deaths in Rwanda and Ethiopia due to rapid scale-up of malaria prevention and treatment. Malaria Journal, 8(1), 1-8. Owiti, Y. J., & Christopher, M. J. J. J. o. B. S. (2017). Effect of Temperature and pH on Egg Viability and Pupation of Anopheles arabiensis Patton (Diptera: Culicidae): Prospect for Optimizing Colony Reproduction Procedures. 10(1). Owusu-Asenso, C. M. (2018). Spatio-temporal distribution and insecticide resistance status of Aedes mosquitoes in Ghana. (Masters Dissertation), University Of Ghana, Legon, Accra. Retrieved from http://ugspace.ug.edu.gh/handle/123456789/25985. Owusu-Asenso, C. M., Mingle, J. A. A., Weetman, D., & Afrane, Y. A. (2022). Spatiotemporal distribution and insecticide resistance status of Aedes aegypti in Ghana. Parasit Vectors, 15(1), 61. https://doi.org/10.1186/s13071-022-05179-w Owusu, H. F., Chitnis, N., & Müller, P. (2017). Insecticide susceptibility of Anopheles mosquitoes changes in response to variations in the larval environment. Scientific reports, 7(1), 3667. https://doi.org/10.1038/s41598-017-03918-z. 174 University of Ghana http://ugspace.ug.edu.gh Oxborough, R. M., N’Guessan, R., Jones, R., Kitau, J., Ngufor, C., Malone, D., . . . Rowland, M. W. (2015). The activity of the pyrrole insecticide chlorfenapyr in mosquito bioassay: towards a more rational testing and screening of non-neurotoxic insecticides for malaria vector control. Malaria Journal, 14(1), 124. https://doi.org/10.1186/s12936-015-0639- x. Paaijmans, K. P., Blanford, S., Chan, B. H. K., & Thomas, M. B. (2012). Warmer temperatures reduce the vectorial capacity of malaria mosquitoes. Biology Letters, 8(3), 465-468. https://doi.org/10.1098/rsbl.2011.1075. Paaijmans, K. P., Cator, L. J., & Thomas, M. B. (2013a). Temperature-dependent pre- bloodmeal period and temperature-driven asynchrony between parasite development and mosquito biting rate reduce malaria transmission intensity. PLOS one, 8(1), e55777. https://doi.org/10.1371/journal.pone.0055777. Paaijmans, K. P., Heinig, R. L., Seliga, R. A., Blanford, J. I., Blanford, S., Murdock, C. C., & Thomas, M. B. (2013b). Temperature variation makes ectotherms more sensitive to climate change. Global Change Biology, 19(8), 2373-2380. https://doi.org/10.1111/gcb.12240. Paaijmans, K. P., Imbahale, S. S., Thomas, M. B., & Takken, W. (2010). Relevant microclimate for determining the development rate of malaria mosquitoes and possible implications of climate change. Malaria Journal, 9(1). https://doi.org/10.1186/1475-2875-9-196. Paaijmans, K. P., Read, A. F., & Thomas, M. B. (2009). Understanding the link between malaria risk and climate. Proceedings of the National Academy of Sciences of the United States of America, 106(33), 13844-13849. https://doi.org/10.1073/pnas.0903423106. 175 University of Ghana http://ugspace.ug.edu.gh Panini, M., Manicardi, G. C., Moores, G., & Mazzoni, E. (2016). An overview of the main pathways of metabolic resistance in insects. Invertebrate Survival Journal, 13(1), 326- 335. https://doi.org/10.25431/1824-307X/isj.v13i1.326-335. Parham, P. E., & Michael, E. (2010a). Modeling the effects of weather and climate change on malaria transmission. Environmental health perspectives, 118(5), 620-626. Parham, P. E., & Michael, E. (2010b) Modelling climate change and malaria transmission. Vol. 673. Advances in Experimental Medicine and Biology (pp. 184-199). Parham, P. E., Pople, D., Christiansen-Jucht, C., Lindsay, S., Hinsley, W., & Michael, E. (2012). Modeling the role of environmental variables on the population dynamics of the malaria vector Anopheles gambiae sensu stricto. Malaria Journal, 11. https://doi.org/10.1186/1475-2875-11-271 Paupy, C., Delatte, H., Bagny, L., Corbel, V., & Fontenille, D. (2009). Aedes albopictus, an arbovirus vector: From the darkness to the light. Microbes and Infection, 11(14), 1177- 1185. https://doi.org/10.1016/j.micinf.2009.05.005. Paupy, C., Makanga, B., Ollomo, B., Rahola, N., Durand, P., Magnus, J., . . . Prugnolle, F. (2013). Anopheles moucheti and Anopheles vinckei are candidate vectors of Ape Plasmodium parasites, including Plasmodium praefalciparum in Gabon. PLOS one, 8(2), e57294. https://doi.org/10.1371/journal.pone.0057294. Pedrini, N., Mijailovsky, S. J., Girotti, J. R., Stariolo, R., Cardozo, R. M., Gentile, A., & Juárez, M. P. (2009). Control of pyrethroid-resistant Chagas disease vectors with entomopathogenic fungi. PLoS neglected tropical diseases, 3(5), e434. https://doi.org/10.1371/journal.pntd.0000434. Phasomkusolsil, S., Lerdthusnee, K., Khuntirat, B., Kongtak, W., Pantuwatana, K., & Murphy, J. R. (2011). Effect of temperature on laboratory reared Anopheles dirus Peyton and 176 University of Ghana http://ugspace.ug.edu.gh Harrison and Anopheles sawadwongporni Rattanarithikul and Green. The Southeast Asian journal of tropical medicine and public health, 42(1), 63-70. Phasomkusolsil, S., Pantuwatana, K., Tawong, J., Kertmanee, Y., Monkanna, N., Wanja, E. W., & Davidson, S. A. (2018). Evaluation of a new device for measuring the appropriate food quantity required for optimal developmental time, adult body size, and reduced mortality in insectary-reared Anopheles mosquitoes. International Journal of Mosquito Research, 5(6), 43-50. Pittendrigh, B. R., Margam, V. M., Walters, K. R., Steele, L. D., Olds, B. P., Sun, L., . . . Clark, J. M. (2014). Understanding resistance and induced responses of insects to xenobiotics and insecticides in the age of “omics” and systems biology. In D. W. Onstad (Ed.), Insect Resistance Management (Second Edition) (pp. 55-98). San Diego: Academic Press. Polgreen, P. M., & Polgreen, E. L. (2017). Infectious diseases, weather, and climate. Clinical Infectious Diseases, 66(6), 815-817. https://doi.org/10.1093/cid/cix1105. Polson, K. A., Brogdon, W. G., Rawlins, S. C., & Chadee, D. D. (2011). Characterization of insecticide resistance in Trinidadian strains of Aedes aegypti mosquitoes. Acta tropica, 117(1), 31-38. https://doi.org/10.1016/j.actatropica.2010.09.005. Polson, K. A., Brogdon, W. G., Rawlins, S. C., & Chadee, D. D. (2012). Impact of environmental temperatures on resistance to organophosphate insecticides in Aedes aegypti from Trinidad. Rev. Panam. Salud Pública, 32, 1-8. Ponlawat, A., & Harrington, L. C. (2009). Factors associated with male mating success of the dengue vector mosquito, Aedes aegypti. The American journal of tropical medicine and hygiene, 80(3), 395-400. https://doi.org/10.4269/ajtmh.2009.80.395. 177 University of Ghana http://ugspace.ug.edu.gh Pörtner, H.-O., Bock, C., & Mark, F. C. (2017). Oxygen- and capacity-limited thermal tolerance: bridging ecology and physiology. Journal of Experimental Biology, 220(15), 2685-2696. https://doi.org/10.1242/jeb.134585. Prasad, K. M., Raghavendra, K., Verma, V., Velamuri, P. S., & Pande, V. (2017). Esterases are responsible for malathion resistance in Anopheles stephensi: A proof using biochemical and insecticide inhibition studies. Journal of vector borne diseases, 54(3), 226. https://doi.org/10.4103/0972-9062.217613. President’s Malaria Initiative. (2022). Ghana malaria profile. Retrieved from https://d1u4sg1s9ptc4z.cloudfront.net/uploads/2023/01/Ghana-Malaria-Profile-1.pdf [Accessed on February 19, 2023]. Protopopoff, N., Van Bortel, W., Speybroeck, N., Van Geertruyden, J.-P., Baza, D., D'Alessandro, U., & Coosemans, M. (2009). Ranking malaria risk factors to guide malaria control efforts in African highlands. PLOS one, 4(11), e8022. https://doi.org/10.1371/journal.pone.0008022. Pwalia, R. (2014). Insecticide susceptibility, characterization of breeding sites and community perceptions on malaria vector control interventions on KNUST Campus. Retrieved from http://hdl.handle.net/123456789/6504. Pwalia, R., Joannides, J., Iddrisu, A., Addae, C., Acquah-Baidoo, D., Obuobi, D., . . . Chabi, J. (2019). High insecticide resistance intensity of Anopheles gambiae (s.l.) and low efficacy of pyrethroid LLINs in Accra, Ghana. Parasites & vectors, 12(1), 299. https://doi.org/10.1186/s13071-019-3556-y. Qin, Q., Li, Y., Zhong, D., Zhou, N., Chang, X., Li, C., . . . Chen, X.-G. (2014). Insecticide resistance of Anopheles sinensis and An. vagus in Hainan Island, a malaria-endemic area of China. Parasites Vectors, 7(1), 92. https://doi.org/10.1186/1756-3305-7-92. 178 University of Ghana http://ugspace.ug.edu.gh Rajatileka, S., Burhani, J., & Ranson, H. (2011). Mosquito age and susceptibility to insecticides. Transactions of the Royal Society of Tropical Medicine and Hygiene, 105(5), 247-253. https://doi.org/10.1016/j.trstmh.2011.01.009. Ranson, H., N’Guessan, R., Lines, J., Moiroux, N., Nkuni, Z., & Corbel, V. (2011). Pyrethroid resistance in African anopheline mosquitoes: what are the implications for malaria control? Trends in parasitology, 27(2), 91-98. https://doi.org/10.1016/j.pt.2010.08.004. Ray, D. (2010). Organochlorine and Pyrethroid Insecticides. In C. A. McQueen (Ed.), Comprehensive Toxicology (Second Edition) (pp. 445-457). Oxford: Elsevier. Reinhold, J., Lazzari, C., & Lahondère, C. (2018). Effects of the environmental temperature on Aedes aegypti and Aedes albopictus mosquitoes: a review. Insects, 9(4), 158. https://doi.org/10.3390/insects9040158. Rhee, J. W., & Aks, S. E. (2007). Organochlorine insecticides Haddad and Winchester's clinical management of poisoning and drug overdose (pp. 1231-1236): Elsevier. Riches, J. (2015). Analysis of Organophosphorus Chemicals. In C. M. Timperley (Ed.), Best Synthetic Methods (pp. 721-752). Oxford: Academic Press. Riveron, J. M., Chiumia, M., Menze, B. D., Barnes, K. G., Irving, H., Ibrahim, S. S., . . . Wondji, C. S. (2015). Rise of multiple insecticide resistance in Anopheles funestus in Malawi: a major concern for malaria vector control. Malaria Journal, 14(1), 344. https://doi.org/10.1186/s12936-015-0877-y. Riveron, J. M., Osae, M., Egyir-Yawson, A., Irving, H., Ibrahim, S. S., & Wondji, C. S. (2016). Multiple insecticide resistance in the major malaria vector Anopheles funestus in southern Ghana: implications for malaria control. Parasit and Vectors, 9(1), 504. https://doi.org/10.1186/s13071-016-1787-8. 179 University of Ghana http://ugspace.ug.edu.gh Roberts, K. E., Hadfield, J. D., Sharma, M. D., & Longdon, B. (2018). Changes in temperature alter the potential outcomes of virus host shifts. PLOS Pathogens, 14(10), e1007185. https://doi.org/10.1371/journal.ppat.1007185. Roiz, D., Ruiz, S., Soriguer, R., & Figuerola, J. (2014). Climatic effects on mosquito abundance in Mediterranean wetlands. Parasites and vectors, 7(1), 333. https://doi.org/10.1186/1756-3305-7-333. Rúa, G. L., Quiñones, M. L., Vélez, I. D., Zuluaga, J. S., Rojas, W., Poveda, G., & Ruiz, D. (2005). Laboratory estimation of the effects of increasing temperatures on the duration of gonotrophic cycle of Anopheles albimanus (Diptera: Culicidae). Memorias do Instituto Oswaldo Cruz, 100(5), 515-520. https://doi.org/10.1590/S0074- 02762005000500011. Russell, T. L., Beebe, N. W., Cooper, R. D., Lobo, N. F., & Burkot, T. R. (2013). Successful malaria elimination strategies require interventions that target changing vector behaviours. Malaria Journal, 12(1), 56. https://doi.org/10.1186/1475-2875-12-56. Samra, A. I., Kamita, S. G., Yao, H.-W., Cornel, A. J., & Hammock, B. D. (2012). Cloning and characterization of two glutathione S-transferases from pyrethroid-resistant Culex pipiens. Pest management science, 68(5), 764-772. https://doi.org/10.1002/ps.2324. Sánchez-Bayo, F. (2012). Insecticides mode of action in relation to their toxicity to non-target organisms. Journal of Environmental and Analytical Toxicology, 4, S4-002. https://doi.org/10.4172/2161-0525.S4-002. Sánchez García, J. L., & Díez Sanz, J. M. (2018). Climate change, ethics and sustainability: An innovative approach. Journal of Innovation & Knowledge, 3(2), 70-75. https://doi.org/10.1016/j.jik.2017.12.002. Santolamazza, F., Mancini, E., Simard, F., Qi, Y., Tu, Z., & della Torre, A. (2008). Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles 180 University of Ghana http://ugspace.ug.edu.gh gambiae molecular forms. Malar J., 7(1), 163. https://doi.org/10.1186/1475-2875-7- 163. Sasmita, H. I., Tu, W.-C., Bong, L.-J., & Neoh, K.-B. (2019). Effects of larval diets and temperature regimes on life history traits, energy reserves and temperature tolerance of male Aedes aegypti (Diptera: Culicidae): optimizing rearing techniques for the sterile insect programmes. Parasites & vectors, 12(1), 578. https://doi.org/10.1186/s13071- 019-3830-z. Sattler, M. A., Mtasiwa, D., Kiama, M., Premji, Z., Tanner, M., Killeen, G. F., & Lengeler, C. (2005). Habitat characterization and spatial distribution of Anopheles sp. mosquito larvae in Dar es Salaam (Tanzania) during an extended dry period. Malaria Journal, 4(1), 4. https://doi.org/10.1186/1475-2875-4-4. Scott, M. L., & McAllister, J. C. (2012). Comparison of biochemical and molecular tests for detecting insecticide resistance due to insensitive acetylcholinesterase in Culex quinquefasciatus. Journal of the American Mosquito Control Association, 28(4), 323- 326. https://doi.org/10.2987/12-6280R.1. Shah, A. A., Woods, H. A., Havird, J. C., Encalada, A. C., Flecker, A. S., Funk, W. C., . . . Ghalambor, C. K. (2020). Temperature-dependence of metabolic rate in tropical and temperate aquatic insects: support for the climate variability hypothesis in mayflies but not stoneflies. bioRxiv, 2019.2012.2025.888578. https://doi.org/10.1101/2019.12.25.888578. Shang, Q., Pan, Y., Fang, K., Xi, J., & Brennan, J. A. (2012). Biochemical characterization of acetylcholinesterase, cytochrome P450 and cross-resistance in an omethoate-resistant strain of Aphis gossypii Glover. Crop Protection, 31(1), 15-20. https://doi.org/10.1016/j.cropro.2011.09.014. 181 University of Ghana http://ugspace.ug.edu.gh Shapiro, L. L. M., Whitehead, S. A., & Thomas, M. B. (2017). Quantifying the effects of temperature on mosquito and parasite traits that determine the transmission potential of human malaria. PLoS Biol., 15(10), e2003489. https://doi.org/10.1371/journal.pbio.2003489. Shaw, W. R., Holmdahl, I. E., Itoe, M. A., Werling, K., Marquette, M., Paton, D. G., . . . Catteruccia, F. (2021). Multiple blood feeding in mosquitoes shortens the Plasmodium falciparum incubation period and increases malaria transmission potential. PLOS Pathogens, 16(12), e1009131. https://doi.org/10.1371/journal.ppat.1009131. Shehata, A. Z. (2018). Feeding rate and reproductive performance of three mosquito species as influenced by different blood meal sources. Egyptian Academic Journal of Biological Sciences. A, Entomology, 11(6), 77-84. Shimaponda-Mataa, N. M., Tembo-Mwase, E., Gebreslasie, M., Achia, T. N., & Mukaratirwa, S. (2017). Modelling the influence of temperature and rainfall on malaria incidence in four endemic provinces of Zambia using semiparametric Poisson regression. Acta tropica, 166, 81-91. Shou-Min, F. (2012). Insect glutathione S-transferase: a review of comparative genomic studies and response to xenobiotics. Bulletin of Insectology, 65(2), 265-271. Shretta, R., Avanceña, A. L., & Hatefi, A. (2016). The economics of malaria control and elimination: a systematic review. Malaria Journal, 15(1), 593. https://doi.org/10.1186/s12936-016-1635-5. Silberman, J., & Taylor, A. (2020). Carbamate toxicity. StatPearls [Internet]. Silver, J. B. (2008). Mosquito Ecology: Field Sampling Methods. Dordrecht: Springer Netherlands. Simard, F., Nchoutpouen, E., Toto, J. C., & Fontenille, D. (2005). Geographic distribution and breeding site preference of Aedes albopictus and Aedes aegypti (Diptera: Culicidae) in 182 University of Ghana http://ugspace.ug.edu.gh Cameroon, Central Africa. Journal of Medical Entomology, 42(5), 726-731. https://doi.org/10.1093/jmedent/42.5.726. Smith, E. K., & Mayer, A. (2018). A social trap for the climate? Collective action, trust and climate change risk perception in 35 countries. Global Environmental Change, 49, 140- 153. https://doi.org/10.1016/j.gloenvcha.2018.02.014. Sokhna, C., Ndiath, M., & Rogier, C. (2013). The changes in mosquito vector behaviour and the emerging resistance to insecticides will challenge the decline of malaria. Clinical Microbiology and Infection, 19(10), 902-907. https://doi.org/10.1111/1469- 0691.12314. Sood, S., Sharma, A., Sharma, N., & Kanwar, S. (2016). Carboxylesterases: sources, characterization and broader applications. Insights in Enzyme Research, 1, 1-11. Sookrung, N., Reamtong, O., Poolphol, R., Indrawattana, N., Seesuay, W., Saelim, N., . . . Tungtrongchitr, A. (2018). Glutathione S-transferase (GST) of American cockroach, Periplaneta americana: Classes, isoforms, and allergenicity. Scientific reports, 8(1), 484. https://doi.org/10.1038/s41598-017-18759-z. Sriwichai, P., Longley, R., & Sattabongkot, J. (2016). Ecology of malaria vectors and current (nongenetic) methods of control in the Asia region. In Z. N. Adelman (Ed.), Genetic Control of Malaria and Dengue (pp. 69-80). Boston: Academic Press. Steketee, R. W., & Campbell, C. C. (2010). Impact of national malaria control scale-up programmes in Africa: magnitude and attribution of effects. Malar J, 9, 299. https://doi.org/10.1186/1475-2875-9-299. Storey, K. B., & Storey, J. M. (2004). Metabolic rate depression in animals: transcriptional and translational controls. Biological Reviews, 79(1), 207-233. https://doi.org/https://doi.org/10.1017/S1464793103006195 183 University of Ghana http://ugspace.ug.edu.gh Stresman, G. H. (2010). Beyond temperature and precipitation: Ecological risk factors that modify malaria transmission. Acta tropica, 116(3), 167-172. https://doi.org/10.1016/j.actatropica.2010.08.005. Suarez, E., Nguyen, H. P., Ortiz, I. P., Lee, K. J., Kim, S. B., Krzywinski, J., & Schug, K. A. (2011). Matrix-assisted laser desorption/ionization-mass spectrometry of cuticular lipid profiles can differentiate sex, age, and mating status of Anopheles gambiae mosquitoes. Analytica Chimica Acta, 706(1), 157-163. https://doi.org/10.1016/j.aca.2011.08.033. Sukiato, F., Wasserman, R. J., Foo, S. C., Wilson, R. F., & Cuthbert, R. N. (2019). The effects of temperature and shading on mortality and development rates of Aedes aegypti (Diptera: Culicidae). Journal of vector ecology, 44(2), 264-270. https://doi.org/10.1111/jvec.12358. Suwanchaichinda, C., & Paskewitz, S. M. (1998). Effects of Larval Nutrition, Adult Body Size, and Adult Temperature on the Ability of Anopheles gambiae (Diptera: Culicidae) to Melanize Sephadex Beads. Journal of Medical Entomology, 35(2), 157-161. https://doi.org/10.1093/jmedent/35.2.157. Swain, V., Seth, R. K., Mohanty, S. S., & Raghavendra, K. (2008). Effect of temperature on development, eclosion, longevity and survivorship of malathion-resistant and malathion-susceptible strain of Culex quinquefasciatus. Parasitology research, 103(2), 299-303. https://doi.org/10.1007/s00436-008-0969-5. Sy, V. E., Agnew, P., Sidobre, C., & Michalakis, Y. (2014). Reduced survival and reproductive success generates selection pressure for the dengue mosquito Aedes aegypti to evolve resistance against infection by the microsporidian parasite Vavraia culicis. Evolutionary applications, 7(4), 468-479. https://doi.org/10.1111/eva.12144. Sylla, M. B., Nikiema, P. M., Gibba, P., Kebe, I., & Klutse, N. A. B. (2016). Climate change over West Africa: Recent trends and future projections. Adaptation to climate change 184 University of Ghana http://ugspace.ug.edu.gh and variability in rural West Africa, 25-40. https://doi.org/10.1007/978-3-319-31499- 0_3. Tabachnick, W. J. (2010). Challenges in predicting climate and environmental effects on vector-borne disease episystems in a changing world. The Journal of Experimental Biology, 213(6), 946. https://doi.org/10.1242/jeb.037564. Tangena, J.-A. A., Hendriks, C. M. J., Devine, M., Tammaro, M., Trett, A. E., Williams, I., . . . Moyes, C. L. (2020). Indoor residual spraying for malaria control in sub-Saharan Africa 1997 to 2017: an adjusted retrospective analysis. Malaria Journal, 19(1), 150. https://doi.org/10.1186/s12936-020-03216-6. Thermo Fisher Scientific Inc. (2012). General Recommendations for DNA Electrophoresis. Retrieved at https://assets.thermofisher.com/TFS- Assets/LSG/manuals/MAN0012614_Gen_Recommend_DNA_Electrophoresis_UG.p df [Accessed on February 18, 2023]. Toé, L. P., Skovmand, O., Dabiré, K. R., Diabaté, A., Diallo, Y., Guiguemdé, T. R., . . . Gruénais, M.-E. (2009). Decreased motivation in the use of insecticide-treated nets in a malaria endemic area in Burkina Faso. Malaria Journal, 8(1), 175. https://doi.org/10.1186/1475-2875-8-175. Tokachil, N., Yusoff, N., Saaid, A., Appandi, N., & Harun, F. (2017). Effect of water availability in opening containers of breeding site on Aedes aegypti life cycle. Paper presented at the AIP Conference Proceedings. Traoré, B., Koutou, O., & Sangaré, B. (2020). A global mathematical model of malaria transmission dynamics with structured mosquito population and temperature variations. Nonlinear Analysis: Real World Applications, 53, 103081. https://doi.org/10.1016/j.nonrwa.2019.103081. 185 University of Ghana http://ugspace.ug.edu.gh Tripathi, G., Kachhwaha, N., Dabi, I., & Bandooni, N. (2011). Temperature-dependent alterations in metabolic enzymes and proteins of three ecophysiologically different species of earthworms. Braz. Arch. Biol. Technol., 54, 769-776. https://doi.org/10.1590/S1516-89132011000400017. Ughasi, J., Bekard, H. E., Coulibaly, M., Adabie-Gomez, D., Gyapong, J., Appawu, M., . . . Boakye, D. A. (2012). Mansonia africana and Mansonia uniformis are Vectors in the transmission of Wuchereria bancrofti lymphatic filariasis in Ghana. Parasites and vectors, 5(1), 89. https://doi.org/10.1186/1756-3305-5-89. Ukubuiwe, A. C., Ojianwuna, C. C., Olayemi, I. K., Arimoro, F. O., Omalu, I. C. J., Ukubuiwe, C. C., & Baba, B. M. (2019). Quantifying the influence of larval density on disease transmission indices in Culex quinquefasciatus, the major African vector of filariasis. International Journal of Insect Science, 11, 1179543319856022. https://doi.org/10.1177/1179543319856022. Ukubuiwe, A. C., Olayemi, I. K., Arimoro, F. O., Omalu, I. C. J., Baba, B. M., Ukubuiwe, C. C., . . . Adeniyi, K. A. (2018). Influence of rearing-water temperature on life stages’ vector attributes, distribution and utilization of metabolic reserves in Culex quinquefasciatus (Diptera: Culicidae): implications for disease transmission and vector control. The Journal of Basic and Applied Zoology, 79(1), 32. https://doi.org/10.1186/s41936-018-0045-3. Ukubuiwe, A. C., Olayemi, I. K., & Jibrin, A. I. (2016). Genetic variations in bionomics of Culex quinquefasciatus (Diptera: Culicidae) mosquito population in Minna, North Central Nigeria. International Journal of Insect Science, 8, IJIS.S32516. https://doi.org/10.4137/IJIS.S32516. UNDP. (2015). Sustainable Development Goals. Retrieved from https://sustainabledevelopment.un.org/sdgs [Accessed on December 11, 2017]. 186 University of Ghana http://ugspace.ug.edu.gh UNFCCC. (2007). Climate change: impacts, vulnerabilities, and adaptation in developing countries; United Nations Framework Convention on Climate Change Secretariat: Bonn, Germany. Van Den Berg, H., Zaim, M., Yadav, R. S., Soares, A., Ameneshewa, B., Mnzava, A., . . . Ejov, M. (2012). Global trends in the use of insecticides to control Vector-borne diseases. Environmental health perspectives, 120(4), 577-582. https://doi.org/10.1289/ehp.1104340. Vantaux, A., Lefèvre, T., Cohuet, A., Dabiré, K. R., Roche, B., & Roux, O. (2016). Larval nutritional stress affects vector life history traits and human malaria transmission. Scientific reports, 6(1), 36778. https://doi.org/10.1038/srep36778. Vences-Mejía, A., Gómez-Garduño, J., Caballero-Ortega, H., Dorado-González, V., Nosti- Palacios, R., Labra-Ruíz, N., & Espinosa-Aguirre, J. J. (2012). Effect of mosquito mats (pyrethroid-based) vapor inhalation on rat brain cytochrome P450s. Toxicology Mechanisms and Methods, 22(1), 41-46. https://doi.org/10.3109/15376516.2011.591448. Verdonschot, P. F. M., & Besse-Lototskaya, A. A. (2014). Flight distance of mosquitoes (Culicidae): A metadata analysis to support the management of barrier zones around rewetted and newly constructed wetlands. Limnologica, 45, 69-79. https://doi.org/10.1016/j.limno.2013.11.002. Wallace, J. R., & Merritt, R. W. (1999). Influence of microclimate, food, and predation on Anopheles quadrimaculatus (Diptera: Culicidae) growth and development rates, survivorship, and adult size in a Michigan pond. Environmental Entomology, 28(2), 233-239. https://doi.org/10.1093/ee/28.2.233. Wamae, P. M., Githeko, A. K., Otieno, G. O., Kabiru, E. W., & Duombia, S. O. (2015). Early biting of the Anopheles gambiae s.s. and its challenges to vector control using 187 University of Ghana http://ugspace.ug.edu.gh insecticide treated nets in western Kenya highlands. Acta tropica, 150, 136-142. https://doi.org/10.1016/j.actatropica.2015.07.008. Wang, L., Teng, Z., & Zhang, T. (2013). Threshold dynamics of a malaria transmission model in periodic environment. Communications in Nonlinear Science and Numerical Simulation, 18(5), 1288-1303. https://doi.org/10.1016/j.cnsns.2012.09.007. Wang, X., Tang, S., & Cheke, R. A. (2016). A stage structured mosquito model incorporating effects of precipitation and daily temperature fluctuations. Journal of theoretical biology, 411, 27-36. Weaver, S. C., & Lecuit, M. (2015). Chikungunya virus and the global spread of a mosquito- borne disease. New England Journal of Medicine, 372(13), 1231-1239. https://doi.org/10.1056/NEJMra1406035. Wei-Ming, W., Hua-Yun, Z., Jun, C., Guo-Jing, Y., Ju-Lin, L., Ya-Ping, G., . . . Yao-Bao, L. (2011). Impact of different temperatures on development of Anopheles anthropoghagus in Jiangsu Province. Zhongguo xue xi chong bing fang zhi za zhi = Chinese journal of schistosomiasis control, 23(5), 571-574. Weissenböck, H., Hubálek, Z., Bakonyi, T., & Nowotny, N. (2010). Zoonotic mosquito-borne flaviviruses: Worldwide presence of agents with proven pathogenicity and potential candidates of future emerging diseases. Veterinary Microbiology, 140(3), 271-280. https://doi.org/10.1016/j.vetmic.2009.08.025. WHO. (2005). The European health report 2005: public health action for healthier children and populations. World Health Organization, Geneva, Switzerland. WHO. (2006). Malaria vector control and personal protection. World Health Organization, Geneva, Switzerland. WHO. (2009a). Dengue guidelines for diagnosis, treatment, prevention and control: new edition. World Health Organization, Geneva, Switzerland. 188 University of Ghana http://ugspace.ug.edu.gh WHO. (2009b). World Malaria Report. World Health Organization, Geneva, Switzerland. http://apps.who.int/iris/bitstream/10665/44234/1/9789241563901_eng.pdf [Accessed on April 16, 2016]. WHO. (2011). World Malaria Report 2011. World Health Organization, Geneva, Switzerland. WHO. (2012). Global plan for insecticide resistance management in malaria vectors. World Health Organization, Geneva, Switzerland. WHO. (2013a). Larval source management: a supplementary malaria vector control measure: an operational manual. World Health Organization, Geneva, Switzerland. WHO. (2013b). Malaria entomology and vector control. World Health Organization, Geneva, Switzerland. WHO. (2015a). WHO global malaria programme: World Malaria Report 2015. World Health Organization, Geneva, Switzerland. WHO. (2015b). Indoor residual spraying: an operational manual for indoor residual spraying (IRS) for malaria transmission control and elimination. World Health Organization, Geneva, Switzerland. WHO. (2016a). Test procedures for insecticide resistance monitoring in malaria vector mosquitoes. World Health Organization, Geneva, Switzerland (2nd ed ed.). WHO. (2016b). WHO malaria terminology (No. WHO/HTM/GMP/2016.6). World Health Organization, Geneva, Switzerland. WHO. (2017). World malaria report 2016. World Health Organization, Geneva, Switzerland. WHO. (2019a). World malaria report 2019. World Health Organization, Geneva, Switzerland. WHO. (2019b). Malaria. World Health Organization, Geneva Switzerland. Retrieved from https://www.who.int/news-room/fact-sheets/detail/malaria [Accessed on July 18, 2019]. 189 University of Ghana http://ugspace.ug.edu.gh WHO. (2020). World Malaria Report 2020: 20 years of global progress and challenges. World Health Organization, Geneva, Switzerland. WHO. (2021). World Malaria Report 2021. World Health Organization. Retrieved at https://apps.who.int/iris/handle/10665/350147. [Accessed on February 20, 2023]. Wiebe, A., Longbottom, J., Gleave, K., Shearer, F. M., Sinka, M. E., Massey, N. C., . . . Hemingway, J. (2017). Geographical distributions of African malaria vector sibling species and evidence for insecticide resistance. Malaria Journal, 16(1), 85. https://doi.org/10.1186/s12936-017-1734-y. Wilkerson, R. C., Linton, Y.-M., Fonseca, D. M., Schultz, T. R., Price, D. C., & Strickman, D. A. (2015). Making mosquito taxonomy useful: a stable classification of tribe Aedini that balances utility with current knowledge of evolutionary relationships. PLOS one, 10(7), e0133602. https://doi.org/10.1371/journal.pone.0133602. Williams, Y. A., Tusting, L. S., Hocini, S., Graves, P. M., Killeen, G. F., Kleinschmidt, I., . . . Gosling, R. D. (2018). Expanding the Vector Control Toolbox for Malaria Elimination: A Systematic Review of the Evidence. In D. Rollinson & J. R. Stothard (Eds.), Advances in Parasitology (Vol. 99, pp. 345-379): Academic Press. Wilson, R. J., & Maclean, I. M. (2011). Recent evidence for the climate change threat to Lepidoptera and other insects. Journal of Insect Conservation, 15(1-2), 259-268. https://doi.org/10.1007/s10841-010-9342-y. WMO. (2019). What is the Climate Variability? World Meteorological Organization. from http://www.wmo.int/pages/prog/wcp/ccl/faqs.php [Accessed on September 10, 2019]. Wong, G. K. L., & Jim, C. Y. (2016). Do vegetated rooftops attract more mosquitoes? Monitoring disease vector abundance on urban green roofs. Science of the Total Environment, 573, 222-232. https://doi.org/10.1016/j.scitotenv.2016.08.102. 190 University of Ghana http://ugspace.ug.edu.gh Wood, O. R., Hanrahan, S., Coetzee, M., Koekemoer, L. L., & Brooke, B. D. (2010). Cuticle thickening associated with pyrethroid resistance in the major malaria vector Anopheles funestus. Parasites & vectors, 3(1), 67. https://doi.org/10.1186/1756-3305-3-67. Yahouédo, G. A., Cornelie, S., Djègbè, I., Ahlonsou, J., Aboubakar, S., Soares, C., . . . Corbel, V. (2016). Dynamics of pyrethroid resistance in malaria vectors in southern Benin following a large scale implementation of vector control interventions. Parasites and vectors, 9(1), 385. https://doi.org/10.1186/s13071-016-1661-8. Yamana, T. K., & Eltahir, E. A. (2013). Incorporating the effects of humidity in a mechanistic model of Anopheles gambiae mosquito population dynamics in the Sahel region of Africa. Parasites and vectors, 6(1), 1-10. Yang, G.-g., Kim, D., Pham, A., & Paul, C. J. (2018). A meta-regression analysis of the effectiveness of mosquito nets for malaria control: the value of long-lasting insecticide nets. International journal of environmental research and public health, 15(3), 546. https://doi.org/10.3390/ijerph15030546. Yawson, A., McCall, P., Wilson, M., & Donnelly, M. (2004). Species abundance and insecticide resistance of Anopheles gambiae in selected areas of Ghana and Burkina Faso. Medical and Veterinary Entomology, 18(4), 372-377. https://doi.org/10.1111/j.0269-283X.2004.00519.x. Yeap, H. L., Endersby, N. M., Johnson, P. H., Ritchie, S. A., & Hoffmann, A. A. (2013). Body size and wing shape measurements as quality indicators of Aedes aegypti mosquitoes destined for field release. The American journal of tropical medicine and hygiene, 89(1), 78-92. https://doi.org/10.4269/ajtmh.12-0719. Yewhalaw, D., & Kweka, E. J. (2016). Insecticide resistance in East Africa—history, distribution and drawbacks on malaria vectors and disease control. Agricultural and 191 University of Ghana http://ugspace.ug.edu.gh Biological Sciences. Insecticides resistance. Rijeka: Intech, 189-215. https://doi.org/10.5772/61570. Zakharova, N. F., Losev, G. I., & Iakubovich, V. (1990). The effect of density and temperature on the larval populations of the malaria vector Anopheles sacharovi. Med Parazitol (Mosk)(1), 3-7. Zalucki, M. P., & Furlong, M. J. (2017). Behavior as a mechanism of insecticide resistance: evaluation of the evidence. Current Opinion in Insect Science, 21, 19-25. https://doi.org/10.1016/j.cois.2017.05.006. Zöllner, C., De Allegri, M., Louis, V. R., Yé, M., Sié, A., Tiendrebéogo, J., . . . Müller, O. (2015). Insecticide-treated mosquito nets in rural Burkina Faso: assessment of coverage and equity in the wake of a universal distribution campaign. Health Policy and Planning, 30(2), 171-180. https://doi.org/10.1093/heapol/czt108. 192 University of Ghana http://ugspace.ug.edu.gh APPENDICES Appendix I: Search terms and search results from databases Database Search Term Search Results Scopus TITLE-ABS-KEY ( "Anopheles mosquito" OR "malaria" ) AND ( 5,926 "temperature" OR season ) AND ( "development time" OR "survival" OR "longevity" OR "fecundity" OR "gonotrophic cycle" OR "biting rate" OR "enzyme" OR "insecticide" ) PubMed ("Anopheles mosquito" OR "malaria" ) AND ( "temperature" OR season 1,156 ) AND ( "development time" OR "survival" OR "longevity" OR "fecundity" OR "gonotrophic cycle" OR "biting rate" OR "enzyme" OR "insecticide") Science ("Anopheles mosquito") AND ("temperature" OR "season") AND 1,403 Direct ("longevity" OR "fecundity" OR "gonotrophic cycle" OR "development time" OR "enzyme" OR "insecticide") Google ("Anopheles mosquito") AND ("temperature" OR "season") AND 8,130 Scholar ("longevity" OR "fecundity" OR "gonotrophic cycle" OR "development time" OR "enzyme" OR "insecticide") ProQuest ("Anopheles mosquito") AND ("temperature" OR "season") AND 850 ("longevity" OR "fecundity" OR "gonotrophic cycle" OR "development time" OR "enzyme" OR "insecticide") Web of ("Anopheles mosquito") AND ("temperature" OR "season") AND 17 Science ("longevity" OR "fecundity" OR "gonotrophic cycle" OR "development time" OR "enzyme" OR "insecticide") Hand 4 search 193 University of Ghana http://ugspace.ug.edu.gh Appendix II: List of studies excluded with reasons Sn Author name Reason for exclusion 1 Abiodun et al. (2016) 1 2 Abiodun et al. (2017) 1 3 Abiodun et al. (2018) 1 4 Agusto et al. (2015) 1 5 Beck-Johnson (2013) 1 6 Beck-Johnson et al. (2013) 1 7 Beck-Johnson et al. (2017) 1 8 Blanford et al. (2013) 2 9 Charlwood and Bragança (2012b) 3 10 Christiansen-Jucht et al. (2015b) 1 11 Culler et al. (2015) 1 12 Ewing et al. (2016) 1 13 Glunt et al. (2013) 2 14 Gonçalvez De Carvalho et al. (2002) 3 15 Lindsay et al. (1991) 4 16 Lunde et al. (2013) 1 17 Lyons et al. (2014) 1 18 Mordecai et al. (2013) 2 19 Mukhtar et al. (2019) 1 20 Murdock et al. (2016) 2 21 Murdock et al. (2012b) 2 22 Okechukwu et al. (2011) 4 23 Okuneye et al. (2019) 1 24 Owiti and Christopher (2017) 3 25 Owusu et al. (2017) 2 26 Paaijmans et al. (2012) 3 27 Paaijmans et al. (2010) 2 28 Paaijmans et al. (2009) 1 29 Parham and Michael (2010b) 1 30 Parham and Michael (2010a) 1 31 Parham et al. (2012) 1 32 Shimaponda-Mataa et al. (2017) 1 33 Wang et al. (2016) 1 34 Wei-Ming et al. (2011) 4 35 Yamana and Eltahir (2013) 1 36 Zakharova et al. (1990) 4 1 = mathematical models; 2 = Opinions/Letters/Reports; 3 = Study did not report on any of the outcomes of interest; 4 = Full-text not available 194 University of Ghana http://ugspace.ug.edu.gh Appendix III: Risk of bias in included studies using the SYRCLE tool Author/year Sequence Baseline Allocation Incomplete Selective Other bias Other bias generation characteristics concealment outcome data reporting (Rearing of (Funding (selection (selection bias) (selection (attrition (reporting mosquito) source) bias) bias) bias) bias) Aytekin et al. (2009) High risk Low risk Unclear risk Low risk Low risk Low risk High risk Barreaux et al. (2016b) High risk Low risk Unclear risk Low risk Low risk Low risk High risk Barreaux et al. (2018) High risk Low risk Unclear risk Low risk Low risk Low risk Low risk Bayoh and Lindsay (2003) High risk Low risk Unclear risk Low risk Low risk Low risk Low risk Bayoh and Lindsay (2004) High risk Low risk Unclear risk Low risk Low risk Low risk Low risk Charlwood and Bragança High risk Unclear risk Unclear risk Low risk Low risk High risk High risk (2012) Christiansen-Jucht et al. High risk Low risk Unclear risk Low risk Low risk Low risk Low risk (2014) Christiansen-Jucht et al. High risk Low risk Unclear risk Low risk Low risk Low risk Low risk (2015) Davies et al. (2016) High risk Low risk Unclear risk Low risk Low risk Low risk Low risk Faiman et al. (2017) High risk Low risk Unclear risk Low risk Low risk Unclear risk Low risk Glunt et al. (2018) High risk Low risk High risk Low risk Low risk High risk Low risk Glunt et al. (2014) High risk Low risk High risk Low risk Low risk High risk Low risk Impoinvil et al. (2007) High risk Low risk Unclear risk Low risk Low risk Low risk Low risk Kirby and Lindsay (2009) High risk Low risk Unclear risk Low risk Low risk Low risk High risk Lyons et al. (2013) High risk Low risk High risk Low risk Low risk Low risk Low risk Lyons et al. (2012) High risk Low risk High risk Low risk Low risk High risk Low risk Mala et al. (2014) Low risk Low risk High risk Low risk Low risk High risk Low risk NB: Performance (Random housing and Blinding) and Detection (Random outcome assessment and Blinding) biases were not applicable 195 University of Ghana http://ugspace.ug.edu.gh Appendix III: Continued Author/year Sequence Baseline Allocation Incomplete Selective Other bias Other bias generation characteristics concealment outcome data reporting (Rearing of (Funding (selection (selection bias) (selection (attrition (reporting mosquito) source) bias) bias) bias) bias) Mamai et al. (2018) High risk Low risk High risk Low risk Low risk Low risk Low risk Murdock et al. (2014) High risk Low risk High risk Low risk Low risk High risk Low risk Murdock et al. (2013) High risk Low risk High risk Low risk Low risk High risk Low risk Murdock et al. (2012a) High risk Low risk High risk Low risk Low risk High risk Low risk Olayemi et al. (2011) High risk Unclear risk High risk Low risk Low risk High risk High risk Oliver and Brooke (2017) High risk Low risk High risk Low risk Low risk Low risk Low risk Paaijmans et al. (2013a) High risk Low risk High risk Low risk Low risk Low risk High risk Paaijmans et al. (2013b) High risk Low risk High risk Low risk Low risk Low risk Low risk Phasomkusolsil et al. (2011) High risk Low risk High risk Low risk Low risk Low risk High risk Rúa et al. (2005) High risk Low risk High risk Low risk Low risk Low risk High risk Shapiro et al. (2017) High risk Low risk High risk Low risk Low risk Low risk Unclear risk Wallace and Merritt (1999) High risk Low risk High risk Low risk Low risk Low risk Low risk NB: Performance (Random housing and Blinding) and Detection (Random outcome assessment and Blinding) biases were not applicable 196 University of Ghana http://ugspace.ug.edu.gh Appendix IV: Ambient and rearing water conditions for each temperature regime Temperature Ambient conditions in the incubators Rearing water regime (°C) Temperature (°C) Relative Humidity (%) temperature (°C) 25 26.17 ± 0.30 84.67 ± 4.90 24.54 ± 0.15 28 27.98 ± 1.31 81.00 ± 4.66 27.41 ± 0.82 30 31.03 ± 0.25 84.05 ± 4.27 29.46 ± 0.14 32 33.05 ± 0.28 86.33 ± 4.54 30.86 ± 0.13 34 35.19 ± 0.50 84.59 ± 4.43 32.79 ± 0.12 36 36.97 ± 0.24 85.29 ± 3.78 34.79 ± 0.09 38 38.88 ± 0.30 80.40 ± 5.20 36.29 ± 0.10 40 40.95 ± 0.40 87.03 ± 6.62 38.41 ± 0.12 197 University of Ghana http://ugspace.ug.edu.gh Appendix V: Gel photographs of the PCR performed Species identification Molecular identification of sibling species Species identification 198 University of Ghana http://ugspace.ug.edu.gh Species identification Molecular identification of sibling species 199 University of Ghana http://ugspace.ug.edu.gh Appendix VI: Ethical approval for the study 200 University of Ghana http://ugspace.ug.edu.gh Appendix VII: Pairwise comparisons of the development of the immature stages of An. gambiae (s.l.) mosquitoes Temperature Development time Time to pupation Pupation Success (%) Pupal mortality Adults produced Sex ratio (M/F) regime (oC) (in days) (in days) (%) (%) t p-value t p-value H p-value H p-value H p-value H p-value 28 vs 25 -1.77 0.010* -1.81 0.481 -0.90 0.184 3.09 0.001** -0.90 0.183 -0.90 0.184 30 vs 25 -4.10 < 0.001* -3.25 0.035* 0.90 0.184 2.48 0.007 0.90 0.183 -1.84 0.033 32 vs 25 -5.63 < 0.001* -6.50 < 0.001* 1.87 0.031 1.98 0.024 1.83 0.033 -2.70 0.004 34 vs 25 -7.17 < 0.001* -7.22 < 0.001* 2.89 0.002** 1.44 0.075 2.66 0.004 -3.56 < 0.001** 36 vs 25 -10.57 < 0.001* -9.75 < 0.001* 3.32 < 0.001** -0.90 0.185 3.60 < 0.001** -4.50 < 0.001** 30 vs 28 -2.32 0.001* -1.44 0.701 1.80 0.036 -0.61 0.271 1.80 0.036 -0.94 0.175 32 vs 28 -3.86 < 0.001* -4.70 0.001* 2.77 0.003** -1.11 0.133 2.73 0.003** -1.80 0.036 34 vs 28 -5.39 < 0.001* -5.42 < 0.001* 3.79 < 0.001** -1.65 0.049 3.56 < 0.001** -2.66 0.004 36 vs 28 -8.80 < 0.001* -7.95 < 0.001* 4.22 < 0.001** -3.99 < 0.001** 4.49 < 0.001** -3.60 < 0.001** 32 vs 30 -1.53 0.032* -3.25 0.035* 0.97 0.166 -0.50 0.308 0.93 0.175 -0.86 0.194 34 vs 30 -3.07 < 0.001* -3.97 0.007* 1.99 0.023 -1.04 0.149 1.76 0.039 -1.73 0.042 36 vs 30 -6.48 < 0.001* -6.50 < 0.001* 2.43 0.008 -3.38 < 0.001** 2.70 0.004 -2.66 0.004 34 vs 32 -1.54 0.031* -0.72 0.977 1.02 0.153 -0.54 0.295 0.83 0.204 -0.86 0.194 36 vs 32 -4.94 < 0.001* -3.25 0.035* 1.46 0.073 -2.87 0.002** 1.76 0.039 -1.80 0.036 36 vs 34 -3.41 < 0.001* -2.53 0.155 0.43 0.333 -2.34 0.010 0.93 0.175 -0.94 0.175 H = Kruskal-Wallis test statistics; t = One-Way ANOVA test statistics; single asterisk (*) and double asterisk (**) represent significant difference at P < 0.05 (according to Tukey post hoc test) and p < 0.003 (according to Dunn's multiple range test), respectively. 201 University of Ghana http://ugspace.ug.edu.gh Appendix VIII: Two-group comparisons and the overall trend of the effect of temperature on An. gambiae (s.l.) larval survival Temperature Cox proportional hazard The overall effect of regime comparison temperature on larval Hazard ratio 95% CI p-value survival 25 vs. 28 1.35 1.13, 1.61 0.001* Log-rank 5353.12 25 vs. 30 2.63 2.26, 3.06 <0.001* test <0.001* 25 vs. 32 5.62 4.79, 6.59 <0.001* p-value 25 vs. 34 11.37 9.61, 13.45 <0.001* 25 vs. 36 51.07 42.33, 61.61 <0.001* 25 vs. 38 215.85 175.45, 265.54 <0.001* A single asterisk (*) represents a significant difference at P < 0.05; 95% CI = 95% Confidence Interval Appendix IX: Two-group comparisons and an overall trend of the effect of temperature on adult An. gambiae (s.l.) longevity Temperature Cox proportional hazard The overall effect of regime comparison Hazard ratio 95% CI p-value temperature on larval survival Non-blood-fed 25 vs. 28 2.89 2.43, 3.44 <0.001* Log-rank test 1163.60 25 vs. 30 6.86 5.62, 8.37 <0.001* p-value < 0.001* 25 vs. 32 16.46 13.28, 20.40 <0.001* 25 vs. 34 22.65 18.15, 28.26 <0.001* Blood-fed 25 vs. 28 1.26 1.07, 1.49 0.005* Log-rank test 904.15 25 vs. 30 2.71 2.28, 3.23 <0.001* p-value < 0.001* 25 vs. 32 5.27 4.37, 6.36 <0.001* 25 vs. 34 11.16 9.11, 13.67 <0.001* Effect of blood meal on longevity Log-rank test; 217.63, P < 0.001* A single asterisk (*) represents a significant difference at P < 0.05; 95% CI = 95% Confidence Interval 202 University of Ghana http://ugspace.ug.edu.gh Appendix X: Comparison by sex across temperature and an overall trend of the effect of sex on adult An. gambiae (s.l.) longevity Comparison by sex across Blood-fed Non-blood-fed temperature Log-rank test p-value Log-rank test p-value Male (25 °C) vs. Female (25 °C) 3.36 0.067 18.13 < 0.001* Male (28 °C) vs. Female (28 °C) 11.63 0.001* 8.86 0.003* Male (30 °C) vs. Female (30 °C) 7.29 0.007* 31.76 < 0.001* Male (32 °C) vs. Female (32 °C) 1.20 0.274 9.79 0.002* Male (34 °C) vs. Female (34 °C) 5.08 0.024* 5.22 0.022* Overall 925.98 < 0.001* 1198.52 < 0.001* A single asterisk (*) represents significant difference at P < 0.05 Appendix XI: Pairwise comparisons of gonotrophic cycle length, biting rate and fecundity Temperature regime Gonotrophic cycle length Biting rate Fecundity (oC) t p-value t p-value t p-value 28 vs 25 -0.00 1.000 0.24 0.968 -1.31 0.393 30 vs 25 -1.22 0.462 1.22 0.466 -2.63 0.029* 30 vs 28 -1.22 0.462 0.97 0.607 -1.32 0.392 t = One-Way ANOVA test statistics; a single asterisk (*) represents significant difference at P < 0.05 203 University of Ghana http://ugspace.ug.edu.gh Appendix XII: Mortality of An. gambiae (s.l.) mosquitoes exposed to pyrethroids Mosquito Temperature Number of o Insecticide Total Mortality (%) strain regime ( C) death 25 Deltamethrin 93 94 98.94 Permethrin 28 88 31.82 Control 0 42 0.0 28 Deltamethrin 85 85 100.00 Permethrin 71 87 81.61 Control 0 41 0.0 30 Deltamethrin 83 89 93.26 Tiassalé Permethrin 67 89 75.28 Control 0 41 0.0 32 Deltamethrin 75 95 78.95 Permethrin 46 92 50.00 Control 5 41 12.20* 34 Deltamethrin 60 60 100.00 Permethrin 60 60 100.00 Control 18 41 43.90** 25 Deltamethrin 85 85 100.00 Permethrin 92 92 100.00 Control 0 48 0.0 28 Deltamethrin 84 84 100.00 Permethrin 89 89 100.00 Control 0 40 0.0 30 Deltamethrin 81 81 100.00 Kisumu Permethrin 81 81 100.00 Control 4 42 9.52 32 Deltamethrin 83 83 100.00 Permethrin 82 82 100.00 Control 3 46 6.52 34 Deltamethrin - - - Permethrin - - - Control - - - Mortality in control replicates of Tiassalé strain kept at 34 oC exceeded 20 %, hence, results were excluded in the final analysis; Kisumu mosquitoes kept at 34 oC failed to develop, hence no test conducted 204 University of Ghana http://ugspace.ug.edu.gh Appendix XIII: Median levels of metabolic enzyme levels in An. gambiae (s.l.) mosquitoes reared at different temperature regimes Mosquito Temperature Level of enzyme levels (mole/min/mg protein) status regime (°C) MFO (IQR) GST (IQR) α-EST (IQR) β-EST (IQR) 25 7.21×10-10 (1.43×10-10) 1.18×10-3 (6.25×10-4) 2.52×10-7 (7.30×10-8) 1.36×10-7 (6.10×10-8) 28 8.85×10-10 (1.50×10-10) 1.31×10-3 (1.05×10-3) 2.83×10-7 (4.32×10-7) 1.38×10-7 (1.82×10-7) Unexposed to 30 1.49×10-9 (2.26×10-9) 1.37×10-3 (1.43×10-3) 2.12×10-7 (4.10×10-7) 1.30×10-7 (2.93×10-7) pyrethroids 32 4.55×10-9 (4.13×10-9) 8.16×10-3 (1. 30×10-2) 1.32×10-6 (9.41×10-7) 2.87×10-7 (3.21×10-7) 34 1.94×10-9 (3.80×10-10) 1.52×10-3 (7.18×10-3) 4.04×10-7 (1.56×10-7) 3.56×10-7 (1.54×10-7) 25 2.07×10-9 (7.50×10-10) 2.72×10-3 (1.56×10-3) 2.94×10-7 (1.20×10-7) 2.47×10-7 (1.32×10-7) 28 1.34×10-9 (2.50×10-10) 1.35×10-3 (6.59×10-4) 1.44×10-7 (2.40×10-7) 1.11×10-7 (6.85×10-8) Exposed to pyrethroids 30 3.15×10-9 (6.40×10-10) 2.62×10-3 (1.69×10-3) 3.12×10-7 (1.17×10-7) 2.15×10-7 (1.59×10-7) 32 2.40×10-9 (1.07×10-9) 3.55×10-3 (2.63×10-3) 3.13×10-7 (1.81×10-7) 2.64×10-7 (1.63×10-7) MFO = Mixed-Function Oxidase, GST = Glutathione-S-transferase, α-EST = α-Esterase, β-EST = β-Esterase, and IQR = Inter Quartile Range 205 University of Ghana http://ugspace.ug.edu.gh Appendix XIV: Pairwise comparisons of enzyme levels in An. gambiae (s.l.) mosquitoes reared at different temperature regimes Temperature MFO GST α-esterase β-esterase Mosquito status regime (oC) H p-value H p-value H p-value H p-value Unexposed to 28 vs 25 -3.10 0.001* -2.23 0.013 -1.36 0.087 -0.70 0.241 pyrethroids 30 vs 25 -5.33 < 0.001* -2.42 0.008 -0.18 0.430 -0.86 0.194 32 vs 25 -1.12×101 < 0.001* -9.03 < 0.001* -8.56 < 0.001* -3.18 0.001* 34 vs 25 -7.37 < 0.001* -2.856 0.002* -3.47 < 0.001* -6.14 < 0.001* 30 vs 28 -2.24 0.013 -0.17 0.431 1.18 0.120 -0.17 0.433 32 vs 28 -8.11 < 0.001* -6.82 < 0.001* -7.23 < 0.001* -2.44 0.007 34 vs 28 -4.45 < 0.001* -0.73 0.234 -2.18 0.015 -5.30 < 0.001* 32 vs 30 -5.90 < 0.001* -6.68 < 0.001* -8.35 < 0.001* -2.24 0.013 34 vs 30 -2.35 0.010 -0.56 0.286 -3.28 < 0.001* -5.04 < 0.001* 34 vs 32 3.26 0.001* 5.81 < 0.001* 4.69 < 0.001* -2.73 0.003* Exposed to 28 vs 25 3.23 0.001** 2.89 0.002** 2.36 0.009 4.82 < 0.001** pyrethroids 30 vs 25 -5.83 < 0.001** 0.86 0.195 -0.69 0.247 0.95 0.171 32 vs 25 -2.87 0.002** -1.96 0.025 -1.20 0.115 -1.71 0.044 30 vs 28 -7.63 < 0.001** -2.14 0.016 -2.76 0.003** -3.80 < 0.001** 32 vs 28 -5.40 < 0.001** -4.14 < 0.001** -3.27 0.001** -6.08 < 0.001** 32 vs 30 3.23 0.001** -2.59 0.005** -0.40 0.343 -2.48 0.007** H = Kruskal-Wallis test statistics; single asterisk (*) and double asterisk (**) represent significant differences at p < 0.005 and p < 0.008 respectively (according to Dunn's multiple range test). 206 University of Ghana http://ugspace.ug.edu.gh Appendix XV: Mann-Whitney U Test between mosquitoes that were not exposed and those exposed to pyrethroids Metabolic enzyme Temperature regime (oC) z-value p-value MFO 25 -7.72 < 0.001* 28 -5.33 < 0.001* 30 -4.68 < 0.001* 32 5.12 < 0.001* GST 25 -8.12 < 0.001* 28 -0.52 0.605 30 -2.48 0.013* 32 3.79 < 0.001* α-esterase 25 -2.42 0.016* 28 2.26 0.024* 30 -1.53 0.127 32 6.94 < 0.001* β-esterase 25 -6.03 < 0.001* 28 1.41 0.159 30 -1.46 0.144 32 -0.90 0.368 MFO = Mixed-Function Oxidase; GST = Glutathione-S-transferase; single asterisk (*) represents significant difference at P < 0.05 207 University of Ghana http://ugspace.ug.edu.gh Appendix XVI: Measurements of An. gambiae (s.l.) mosquito body parts using Leica application Software Larval length Cephalothorax length Wing length Proboscis length 208 University of Ghana http://ugspace.ug.edu.gh Appendix XVII: Abstracts of publication related to this study 209 University of Ghana http://ugspace.ug.edu.gh 210 University of Ghana http://ugspace.ug.edu.gh 211 University of Ghana http://ugspace.ug.edu.gh 212