RESEARCH ARTICLE Inflammasome-triggered IL-18 controls skin inflammation in the progression of Buruli ulcer Toshihiko SuzukiID 1*, Kotchakorn Boonyaleka1, Tokuju Okano1, Tamako Iida1, Mitsunori Yoshida2, Hanako Fukano2, Yoshihiko Hoshino2, Yoichiro Iwakura3, Anthony S. Ablordey4, Hiroshi Ashida1 1 Department of Bacterial Pathogenesis, Infection and Host Response, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University (TMDU), Tokyo, Japan, 2 Department of Mycobacteriology, Leprosy Research Center, National Institute of Infectious Diseases, Tokyo, Japan, 3 Research Institute for Biomedical Sciences, Tokyo University of Science, Noda, Chiba, Japan, 4 Department of Bacteriology, Noguchi Memorial Institute for Medical Research, University of Ghana, Accra, Ghana * suzuki.bact@tmd.ac.jp Abstract Buruli ulcer is an emerging chronic infectious skin disease caused by Mycobacterium ulcer- ans. Mycolactone, an exotoxin produced by the bacterium, is the only identified virulence factor so far, but the functions of this toxin and the mechanisms of disease progression remain unclear. By interfering Sec61 translocon, mycolactone inhibits the Sec61-dependent co-translational translocation of newly synthesized proteins, such as induced cytokines and immune cell receptors, into the endoplasmic reticulum. However, in regard to IL-1β, which is secreted by a Sec61-independent mechanism, mycolactone has been shown to induce IL- 1β secretion via activation of inflammasomes. In this study, we clarified that cytokine induc- tion, including that of IL-1β, in infected macrophages was suppressed by mycolactone pro- duced by M. ulcerans subsp. shinshuense, despite the activation of caspase-1 through the inflammasome activation triggered in a manner independent of mycolactone. Intriguingly, mycolactone suppressed the expression of proIL-1β as well as TNF-α at the transcriptional level, suggesting that mycolactone of M. ulcerans subsp. shinshuense may exert additional inhibitory effect on proIL-1β expression. Remarkably, constitutively produced IL-18 was cleaved and mature IL-18 was actually released from macrophages infected with the causa- tive mycobacterium. IL-18-deficient mice infected subcutaneously with M. ulcerans exhib- ited exacerbated skin inflammation during the course of disease progression. On the other hand, IL-1β controls bacterial multiplication in skin tissues. These results provide informa- tion regarding the mechanisms and functions of the induced cytokines in the pathology of Buruli ulcer. PLOS PATHOGENS PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 1 / 18 a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 OPEN ACCESS Citation: Suzuki T, Boonyaleka K, Okano T, Iida T, Yoshida M, Fukano H, et al. (2023) Inflammasome- triggered IL-18 controls skin inflammation in the progression of Buruli ulcer. PLoS Pathog 19(11): e1011747. https://doi.org/10.1371/journal. ppat.1011747 Editor: Thomas Hawn, UW, UNITED STATES Received: July 10, 2023 Accepted: October 10, 2023 Published: November 1, 2023 Copyright: © 2023 Suzuki et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All data are in the manuscript and/or supporting information files. Funding: This study was supported by the Japan Agency for Medical Research and Development (AMED, http://www.amed.go.jp/en/) under Grant Numbers 22wm0125007, 22wm0225004, 22wm0225022 (TS), Grant Numbers 22wm0125007, 22wm0225004, 22wm0225022 (YH), Grant Numbers 22wm0225022 (MY) and Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS) under Grant numbers 19KK0217, 19H03467, https://orcid.org/0000-0003-3853-0106 https://doi.org/10.1371/journal.ppat.1011747 http://crossmark.crossref.org/dialog/?doi=10.1371/journal.ppat.1011747&domain=pdf&date_stamp=2023-11-01 http://crossmark.crossref.org/dialog/?doi=10.1371/journal.ppat.1011747&domain=pdf&date_stamp=2023-11-01 http://crossmark.crossref.org/dialog/?doi=10.1371/journal.ppat.1011747&domain=pdf&date_stamp=2023-11-01 http://crossmark.crossref.org/dialog/?doi=10.1371/journal.ppat.1011747&domain=pdf&date_stamp=2023-11-01 http://crossmark.crossref.org/dialog/?doi=10.1371/journal.ppat.1011747&domain=pdf&date_stamp=2023-11-01 http://crossmark.crossref.org/dialog/?doi=10.1371/journal.ppat.1011747&domain=pdf&date_stamp=2023-11-01 https://doi.org/10.1371/journal.ppat.1011747 https://doi.org/10.1371/journal.ppat.1011747 http://creativecommons.org/licenses/by/4.0/ http://www.amed.go.jp/en/ Author summary Buruli ulcer, caused byMycobacterium ulcerans, is an emerging chronic disease of the skin, characterized by massive skin ulceration. Mycolactone, an exotoxin produced byM. ulcerans is the sole identified virulence factor, but its functions are still unclear. By inter- fering Sec61 translocon, mycolactone inhibits Sec61-dependent co-translational translo- cation of newly synthesized proteins, such as induced cytokines and immune cell receptors, into the endoplasmic reticulum. However, in regard to IL-1β, which is secreted by a Sec61-independent mechanism, mycolactone has been shown to induce IL-1β secre- tion. In this study, we analyzed the activation of inflammasomes in infected macrophages using wild-type and toxin-negative strains ofM. ulcerans subsp. shinshuense, and found that mycolactone inhibited IL-1β secretion, but not IL-18, resulting in the exclusive induc- tion of IL-18 by the bacterial infection. Intriguingly, mycolactone suppressed the expres- sion of proIL-1β as well as TNF-α at the transcriptional level, suggesting that mycolactone ofM. ulcerans subsp. shinshuensemay exert additional inhibitory effect on proIL-1β expression. Inflammasome activation accompanied by caspase-1 activation in cases of Buruli ulcer appears to be triggered in a manner largely independent of mycolactone. Using a mouse model of Buruli ulcer, we further demonstrated that IL-18 attenuates the progression of Buruli ulcer by controlling accumulation of neutrophils in the infected skin lesions. On the other hand, IL-1β controls bacterial multiplication in the skin. Our results shed light on the etiology of Buruli ulcer and provide insight into the relationship between the activation of inflammasomes and functions of cytokines. Introduction Buruli ulcer (BU) is a chronic skin disease characterized by massive skin ulceration. It is an emerging infectious disease caused byMycobacterium ulcerans, and has been defined as a neglected tropical disease by the World Health Organization (WHO). BU has been reported in more than 30 countries worldwide, with areas of endemicity emerging in Africa and Australia [1,2]. Absence of pain is a major characteristic of the skin lesions in BU, and the absence of other overt signs of infection in the disease often delays the diagnosis. If left untreated, the necrotic skin ulcers and soft tissue destruction could extend up to 15% of the body surface area, causing both disfigurement and disability [3]. Treatment with antibiotics may be effective in the early phase of disease, but surgical procedures such as debridement and skin grafting may be necessary in more severe cases, or even limb amputation in extreme cases [4]. The typical host immune response to mycobacterial infections such asM. tuberculosis orM. leprae is the formation of the characteristic granuloma, an organized structure composed of immune cells surrounding the infecting mycobacteria. In contrast, BU lesions are character- ized by clusters of extracellular bacilli within necrotic tissue, with a relative paucity of infiltrat- ing leukocytes [5,6]. These pathological features are due to the exotoxin called mycolactone, a unique virulence factor secreted byM. ulcerans [7]. Mycolactone, produced byM. ulcerans, is encoded by a large plasmid and plays a central role in the pathogenesis of BU [8]. Mycolactone suppresses both innate and adaptive immune responses in the hosts, by abrogating the production of cytokines and chemokines by immune cells such as macrophages and T cells, and also preventing induction immune receptors on the cell surface and antigen presentation [6,9–15]. These biological actions of mycolactone are exerted via toxin-mediated interference to Sec61 translocon, which results in inhibition of Sec61-dependent co-translational PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 2 / 18 22H02865 (TS), Grant numbers 19KK0217 (YH), Grant numbers 19KK0217 (MY), and also supported by research funding from T.E.N. Ghana MV25 B.V. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors declare no competing interests. https://doi.org/10.1371/journal.ppat.1011747 translocation of newly synthesized proteins into the endoplasmic reticulum (ER) [12]. In turn, this results in inhibition of secretory proteins, such as cytokines and immune receptors induced by bacterial infection, suggesting that the toxin may confer immune evasion proper- ties [14,16]. Also, by targeting AT2R receptors, the toxin is thought to be contribute to the absence of pain in the skin ulcers of BU [17,18]. Furthermore, the toxin also exerts cytotoxic activity, inducing tissue destruction and necrosis through a mechanism that might involve its interaction with Sec61 [7,19,20]. Although the biological activities of mycolactone during infection are thought to mediate immunosuppressive effects, recent studies have shown that exposure to a low dose of mycolac- tone can trigger NLRP3 inflammasome activation resulting in IL-1β release from LPS-primed human macrophages [21,22]. Infection withM. ulcerans and treatment with extracellular vesi- cles containing mycolactone revealed that the production of IL-1β by human macrophages occurred in a mycolactone-dependent manner [21]. The secretion of IL-1β as well as that of IL-18 is regulated by the inflammasome. Activation of inflammasomes results in conversion of caspase-1 to its active form, which, in turn, proteolytically processes proIL-1β and proIL-18 to produce active cytokines. The family of Nod-like receptor (NLR) finely regulates caspase-1 activation in response to extracellular stimuli [23]. The secretion pathway of these cytokines is mechanistically distinctive as compared with that for other cytokines such as TNF-α. Recent study showed that mycolactone stimulates IL-1β secretion by activating the NLRP3 inflamma- some [21]. On the other hand, mycolactone inhibits production of IL-1β, as well as that of other cytokines that are induced by TLR ligands [11]. Thus, to date, the precise molecular mechanisms underlying mycolactone-mediated inflammasome activation and its role in dis- ease progression remain controversial. How inflammasome activation and consequent induc- tion of inflammatory cytokines contributes to the progression of BU also remains unclear. In the present study, we used an in vitro infection model using both viable wild-typeM. ulcerans subsp. shinshuense, and mycolactone-deficient plasmid-cured strain to investigate the induction of cytokines and activation of inflammasomes in infected murine macrophages. The secretion of IL-1β was inhibited in a mycolactone-dependent manner, despite the activation of caspase-1 via inflammasome activation. Unexpectedly, mycolactone also suppressed the proIL-1β expression at the transcriptional level through a Sec61-independent mechanism. On the other hand, inflammasome activation was triggered in a manner that was largely indepen- dent of mycolactone. Remarkably, constitutively produced proIL-18 was cleaved and mature IL-18 was actually released from the macrophages infected with wild-typeM. ulcerans. We also examined the functional roles of IL-18 in disease progression using an IL-18-deficient mouse model with subcutaneous infection. We found that IL-18 negatively regulated the exacerbation of skin inflammation induced by the bacterial infection, whereas IL-1β was involved in the control of the bacterial burden. Taken together, the above results suggest that IL-18, which is induced in a mycolactone- independent manner, plays a key role in the regulation of inflammation. Results M. ulcerans exclusively induces IL-18 secretion through inflammasome activation The inflammatory responses of resident macrophages in the skin play a major role in protect- ing the skin tissue against infection with pathogenic microbes. To investigate the inflammatory responses induced byM. ulcerans infection, we used theM. ulcerans subsp. shinshuense, a causative agent of BU in Japan, to infect mouse bone marrow-derived macrophages (BMDMs) and analyze the subsequent induction of cytokines. This wild-type strain ShT-P produces PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 3 / 18 https://doi.org/10.1371/journal.ppat.1011747 mycolactone A/B, S1 and S2 [24]. Consistent with previous reports [12,15], TNF-α was not induced upon infection with wild-typeM. ulcerans ShT-P strain (Fig 1A). Furthermore, we found that IL-1β was also not induced after infection with wild-typeM. ulcerans (Fig 1B). In contrast, macrophages infected with theM. bovis BCG strain or the plasmid-curedM. ulcerans ShT-N strain (which does not produce mycolactone) secreted remarkable amounts of TNF-α and IL-1β (Fig 1A and 1B). Western blot analysis revealed that the levels of cytosolic proIL-1β and cleaved IL-1β (the biologically active mature form) in the supernatants were markedly reduced following infection with the wild-type strain, but not after infection with the BCG or ShT-N strain (Fig 1C). These data suggest that mycolactone suppresses induction of the IL-1β protein, resulting in markedly reduced secretion of IL-1β as well as TNF-α from the infected macrophages. The mature form of IL-1β is generated by caspase-1, which is activated by a cytosolic multi- protein platform known as an inflammasome. We examined caspase-1 activation in macro- phages infected with the wild-typeM. ulcerans and plasmid-cured M. ulcerans strains. Intriguingly, caspase-1 was activated upon infection with wild-typeM. ulcerans as well as infection with a plasmid-cured strain, suggesting that capase-1 activation is induced in a myco- lactone-independent manner. We then focused on another inflammatory cytokine, IL-18; this cytokine is also activated by caspase-1 as well as IL-1β. Mycolactone exerted little effect on con- stitutively produced proIL-18; furthermore, significant amounts of mature IL-18 were secreted into the supernatant of cells infected with wild-typeM. ulcerans (Fig 1C and 1D). No differ- ence in lactate dehydrogenase (LDH) release induced by caspase-1 activation was seen between cells infected with the wild-type and plasmid-cured strains ofM. ulcerans (Fig 1E). These results suggest that infection with wild-typeM. ulcerans exclusively induces IL-18 secretion from the infected macrophages. Fig 1. M. ulcerans exclusively induces IL-18 secretion through inflammasome activation. (A) TNF-α production, (B) IL-1β production, (D) IL-18 production, as determined by ELISA, in the supernatants of bone marrow-derived macrophages (BMDMs) obtained from WT mice at 6 or 20 h after infection with theM. ulcerans strains. (C) Results of Western blot analysis showing representative cleavages and secretions of caspase-1, IL-1β, and IL-18 at 20 h after infection. (E) LDH release from the infected macrophages; representative of at least 3 experiments. The error bars represent the means ± SD. **P< 0.01; two- tailed unpaired t tests for (D). https://doi.org/10.1371/journal.ppat.1011747.g001 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 4 / 18 https://doi.org/10.1371/journal.ppat.1011747.g001 https://doi.org/10.1371/journal.ppat.1011747 To clarify the unexpected inhibitory effect of mycolactone observed on proIL-1β expres- sion, we examined the inflammatory responses induced in macrophages infected at a low mul- tiplicity of infection (MOI). The expression of proIL-1β was still suppressed by infection with the wild-type ShT-P strain as compared with the ShT-N at an MOI of 2 or 10 (Fig 2A). Infec- tion at an MOI of 2 or 10 also did not induce high value of LDH release (Fig 2B), suggesting that the suppression of proIL-1β expression by infection with the wild-typeM. ulcerans was not a result of cell death of the infected macrophages. On the other hand, caspase-1 was acti- vated on MOI-dependent manner and closely correlated with the amounts of LDH release (Figs 1B and 2A). The activation was slightly enhanced in the macrophages infected with the mycolactone-expressing wild-type strain at a low MOI (band density of cleaved caspase-1 at 20 h at a MOI of 2) as compared with the macrophages infected with ShT-N, suggesting partial contribution of mycolactone to inflammasome activation. The amounts of IL-1β released reflected the expression level of proIL-1β and state of activation of caspase-1 (Fig 2C). Next, we examined the transcription level of proIL-1β and TNF-α in the macrophages at an MOI of 2 or Fig 2. Mycolactone, an exotoxin produced by M. ulcerans, suppresses proIL-1β expression even after infection at a low MOI. (A) Results of Western blot analysis showing representative cleavages and secretions of caspase-1, IL-1β, and IL-18 after infection at a MOI of 2, 10 or 40. (B) LDH release from the infected macrophages. (C) IL-1β production as determined by ELISA. (D) RT-qPCR analysis to determine the transcription levels of IL-1β and TNF-α at a MOI of 2 or 10 for 6 h. Relative fold change in gene expression was calculated using uninfected cells as the control; representative of at least 3 experiments. The error bars represent the means ± SD. **P< 0.01; one-way ANOVA for (D). https://doi.org/10.1371/journal.ppat.1011747.g002 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 5 / 18 https://doi.org/10.1371/journal.ppat.1011747.g002 https://doi.org/10.1371/journal.ppat.1011747 10 for 6 h after infection withM. ulcerans. As shown in Fig 2D, mRNA expression of proIL-1β was markedly suppressed in the infection with wild-type ShT-P strain, suggesting that myco- lactone inhibits the proIL-1β expression at the transcriptional level. Mycolactone suppresses the induced cytokines such as TNF-α by interfering Sec61 translocon. However, not as con- spicuous as the inhibition of proIL-1β mRNA, the toxin significantly inhibited TNF-α mRNA induction as compared with toxin-negative ShT-N infection. These data suggest the possibility that mycolactone inhibits the induction of induced cytokines at the transcriptional level by a mechanism independent of the Sec61-mediated protein secretion system. The induction of inflammatory cytokines was also examined in macrophages infected with anotherM. ulcerans strain, Agy99, or related strainsM.marinum orM. pseudoshottsii (S1 Fig). The mycolactone A/B-producing Agy99 strain [25] apparently did not suppress proIL-1β expression, but rather induced the secretion of small amounts of IL-1β and TNF-α (S1C Fig). The level of caspase-1 activation was comparatively lower, resulting in a low level of IL-1β secretion. The infected cells also released a low level of LDH (S1B and S1C Fig). These results suggest that the level of suppression of cytokines and caspase-1 activation might differ depend- ing on the infecting strain ofM. ulcerans. Since theM.marinum strain does not produce mycolactone, large amounts of cytokines were released from the cells infected with this strain (S1A and S1B Fig). On the other hand, similar to theM. ulcerans subsp. shinshuense, infection with mycolactone F-producingM. pseudoshottsii [26] exclusively induced IL-18 production (S1D Fig), suggesting that the mycolactone-mediated suppression of cytokines is not anM. ulcerans-specific phenomenon. M. ulcerans triggers inflammasome activation in a manner dependent on ASC but not on NLRP3, NLRP6, AIM2 or non-canonical pathways induced by caspase-11 We next investigated which components are necessary forM. ulcerans infection to activate the inflammasome using BMDMs derived from gene-knockout mice. The results of Western blot analysis showed that wild-type (ShT-P) or plasmid-cured (ShT-N)M. ulcerans still activated caspase-1, but only reduced amounts of the cleaved form of IL-1β and IL-18 were found in the supernatants of NLRP3-deficient cells, suggesting a partial dependency on NLRP3 (Fig 3A). In contrast, caspase-1 activation and cleavage/secretion of IL-1β or IL-18 in BMDMs infected by theM. bovis BCG strain occurred in an NLRP3-dependent manner. Use of adaptor protein ASC-deficient (Pycard-/-) BMDMs definitively showed that ASC is essential for both the cas- pase-1 activation and cleavage/secretion of the cytokines that were induced by all the bacterial strains. We also observed no suppressive effect on NLRP6 or AIM2, or caspase-11-deficient cells. Activation of the inflammatory responses in the cells infected withM. ulcerans was not mediated by non-canonical pathways involving caspase-11. Interestingly, inflammasome acti- vation byM. bovis BCG occurred in a caspase-11-dependent manner. These data suggest that the induction of inflammasome activation byM. ulcerans requires Nod-like receptors other than NLRP6 or AIM2, in addition to NLRP3. We examined the amounts of the cytokines secreted into the supernatants by ELISA. Secre- tion of TNF-α from cells infected with the BCG or plasmid-cured strain (ShT-N) was induced in a manner that was independent of both NLRP3 and ASC (Fig 3B). Consistent with the results of Western blotting, markedly reduced amounts of IL-1β were secreted from infected NLRP3-deficient macrophages, and the secretion of IL-1β was completely suppressed from infected ASC-deficient BMDMs (Fig 3C). On the other hand, the results in regard to inhibition of IL-18 secretion were unclear, because of the limited detection sensitivity in the lower con- centration range of the ELISA system. However, the secretion of IL-18 induced by infection PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 6 / 18 https://doi.org/10.1371/journal.ppat.1011747 with all the strains was significantly suppressed in the NLRP3- or ASC-deficient macrophages (Fig 3D). Inflammasome activation and secretion of IL-1β/IL-18 following infection withM. ulcerans strain Agy99,M.marinum, orM. pseudoshottsii were also completely abolished in ASC-defi- cient macrophages (S2 Fig). Dependency on NLRP3 was observed in theM. pseudoshottsii- infected cells, but only partially in theM.marinum-infected cells. IL-18 attenuates the progression of skin ulceration by M. ulcerans infection Since IL-18 is exclusively secreted from macrophages infected with wild-typeM. ulcerans, we next examined the role of this cytokine on the progression of BU. First, we established a subcu- taneous infection model using C57BL/6 mice. The wild-typeM. ulcerans ShT-P strain was administered s subcutaneously into the shaved dorsal skin of the mice; a negative group (Mid- dlebrook 7H9 media only) and a group infected with the plasmid-cured ShT-N strain were also used as controls. At 14 days post-infection, the skin lesions were evaluated. Localized nod- ules were observed in the mice infected with the wild-type strain, but not in the negative con- trol group (media only) or group infected with the plasmid-cured mycolactone-negative strain (Fig 4A). Then, we examined the functional roles of IL-18 in the disease progression using IL- Fig 3. M. ulcerans triggers inflammasome activation in a manner dependent on ASC but not on NLRP3, NLRP6, AIM2 or non-canonical pathways inducted by caspase-11. (A) Results of Western blot analysis showing representative cleavages and secretions of caspase-1, IL-1β, and IL- 18 in the infected BMDMs at 20 h after infection. BMDMs were isolated from WT,Nlrp3−/−,Nlrp6−/−, Pycard−/−, Aim2−/− or Casp11−/− mice. (B) TNF-α production, (C) IL-1β production, (D) IL-18 production, as determined by ELISA; representative of at least 3 experiments. The error bars represent the means ± SD. *P< 0.05, **P< 0.01; one-way ANOVA for (D). https://doi.org/10.1371/journal.ppat.1011747.g003 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 7 / 18 https://doi.org/10.1371/journal.ppat.1011747.g003 https://doi.org/10.1371/journal.ppat.1011747 18-deficient mice and IL-1β-deficient mice. We anticipated that the lesions in the IL-18-defi- cient mice would be attenuated, since we speculated that IL-18 might accelerate skin inflam- mation through a mechanism phenotypically similar to that involved in the effect of anti-IL-18 Fig 4. IL-18 attenuates the progression of skin ulcerations following infection with M. ulcerans. (A) Representative skin lesions on Day 14 in WT, Il1b−/−, and Il18−/− mice infected withM. ulcerans strains. (B) Severity of the skin lesions in the infected mice. (C) Representative hematoxylin and eosin (H&E)-stained sections of skin tissue prepared from animals infected with a wild-typeM. ulcerans strain. The red rectangles indicate lipoarabinomannan (LAM)- positive regions, and the blue rectangles indicate the surrounding regions (Fig 5A). Bar, 1 mm. (D) Skin thickness of the infected mice on day 14. The error bars represent the means ± SD. *P< 0.05, **P< 0.01; (B) and (D) n = 7–9, one- way ANOVA. https://doi.org/10.1371/journal.ppat.1011747.g004 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 8 / 18 https://doi.org/10.1371/journal.ppat.1011747.g004 https://doi.org/10.1371/journal.ppat.1011747 therapy in autoinflammatory IL-18-driven diseases, such as familial Mediterranean fever and systemic juvenile idiopathic arthritis [27–29]. Unexpectedly, however, we found that the skin lesions in the IL-18-deficient mice infected with the wild-type strain were, in fact, exacerbated, with extensive ulcerations visible on the skin of the animals (Fig 4A). In contrast, the localized nodules on the skin observed in the infected IL-1β-deficient mice were comparable to those observed in the wild-type mice, suggesting that IL-18, but not IL-1β, exerts a protective role against disease progression. The exacerbation of the skin lesions in the infected IL-18-deficient mice was confirmed by the higher clinical score in these mice, as compared with the scores in the other groups (Fig 4B). Although hematoxylin and eosin (H&E)-stained sections of infected skin revealed hyperplasia of the dermis and subcutaneous tissue in all of the infected wild- type, IL-1β-deficient, and IL-18-deficient mice (Fig 4C), the thicknesses of these tissues in the IL-18-deficient mice were significantly greater than those in the other groups (Fig 4D). IL-18 controls the accumulation of neutrophils in the skin lesions, whereas IL-1β is involved in eradicating the infecting mycobacteria We examined the bacterial colonization of the skin tissue by immunohistochemistry using mycobacteria-specific anti-lipoarabinomannan (LAM) antibody. The results revealed diffuse localization of mycobacteria in the subcutaneous tissue of the wild-type, IL-1β-deficient, as well as IL-18-deficient mice, but not in the uninfected control mice (Fig 5A). The number of bacteria in the infected skin tissue was then quantified using real-time PCR. Interestingly, the number of mycobacteria in the infected IL-1β-deficient mice was tenfold higher than that in skin tissue specimens obtained from the other infected mouse groups (Fig 5B). These results suggest that even though mycolactone secreted byM. ulcerans suppresses IL-1β production in the infected macrophages at the cellular level, IL-1β is somehow functional and involved in the inhibition of bacterial growth or eradication at the tissue level. The localization of granulo- cytes, including neutrophils and macrophages, in the skin tissue regions colonized by the mycobacteria was examined by immunohistochemistry using the Gr-1 and F4/80 antibody for neutrophils and macrophages, respectively. Neutrophil accumulation in the areas colonized by the bacteria was observed in the wild-type, IL-1β-deficient, as well as IL-18-deficient mice (Fig 5A). Quantification of the number of neutrophils accumulated in the infected skin areas revealed a significantly higher number in the IL-18-deficient mice as compared with that in the other infected mouse groups (Fig 5C). On the other hand, neutrophils were nearly absent in the skin of the uninfected control mice. As compared with the number of macrophages, the number of migrated neutrophils in the skin was not affected by the activity of mycolactone. However, numerous macrophages were observed in the region (blue rectangles in Fig 4C) surrounding the infected areas of the skin (red rectangle in Fig 4C). These results suggest thatM. ulcerans can eliminate macrophages, but not neutrophils, via mycolactone-mediated cytotoxicity. Taken together, our results sug- gest that IL-18 controls the migration of neutrophils and the inflammation induced by these cells, while IL-1β plays a role in eradicating the causativeM. ulcerans bacteria from the infected subcutaneous lesions. Discussion Mycolactone produced byM. ulcerans is the only reported virulence factor until date in Buruli ulcer. Functionally, mycolactone was at first thought to only suppress protein synthesis and secretion. On the other hand, recent reports have also shown mycolactone-induced inflamma- some activation in the macrophages, followed by IL-1β secretion [21,22]. To further investigate these conflicting actions of mycolactone, we investigated cytokine induction and PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 9 / 18 https://doi.org/10.1371/journal.ppat.1011747 inflammasome activation in infected murine macrophages using an in vitro model of infection with viable wild-typeM. ulcerans and mycolactone-deficient plasmid-cured strains. Cytokine induction, including that of IL-1β, was clearly suppressed in a mycolactone-dependent man- ner. On the other hand, the infection triggered activation of caspase-1 in a mycolactone-inde- pendent manner. Remarkably, constitutively produced proIL-18 was cleaved and mature IL- 18 was, in fact, actually released from the macrophages infected with wild-typeM. ulcerans. Inflammasome activation byM. ulcerans is dependent on adaptor protein ASC, but only par- tially dependent on NLRP3. The functional role of IL-18 in disease progression was examined using a subcutaneous infection model and IL-18-deficient mice. We found that IL-18 nega- tively regulated the severity of the skin inflammation induced by the bacterial infection, whereas IL-1β was involved in controlling the bacterial burden. Based on our findings, we pro- pose that IL-18, which is induced in a mycolactone-independent manner, plays a key role in the regulation of inflammation in BU. Fig 5. IL-18 controls the accumulation of neutrophils in the infected lesions, whereas IL-1β is involved in eradicating the infecting mycobacteria. (A) Representative images following immunostaining with anti-LAM (Mycobacteria), anti-Gr-1 (granulocytes), and anti-F4/80 (macrophages) of the LAM-positive region or surrounding region. The nuclei were counterstained with TO-PRO-3. Bar, 100 μm. (B) Quantification of the number of bacteria in the infected tissue. (C) Quantification of the number of Gr-1-positive cells (granulocytes) in the infected areas under magnification (x20). The error bars represent the means ± SD. *P< 0.05, **P< 0.01; (B) n = 5–6, (C) n = 10–12, one-way ANOVA. https://doi.org/10.1371/journal.ppat.1011747.g005 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 10 / 18 https://doi.org/10.1371/journal.ppat.1011747.g005 https://doi.org/10.1371/journal.ppat.1011747 We also found mycolactone-dependent suppression of proIL-1β expression in the infected macrophages. The results observed in the cells infected at a low MOI, which does not induce rapid LDH release, lent support to this finding. At least, the suppressive effect was not attribut- able to cell death of the infected macrophages. Mycolactone suppresses the proIL-1β at the transcriptional level, suggesting that mycolactone might inhibit IL-1β expression via a mecha- nism independent of the Sec61-mediated secretion system. Previous studies have shown that mycolactone induces IL-1β secretion [21,22]. We speculate that the suppression of cytokines byM. ulcerans infection might differ depending on theM. ulcerans strain used to infect the cells or the type of mycolactone produced by the strains. Further studies are needed to under- stand the precise mechanisms of actions of mycolactone. Recent reports have shown that IL-1β secretion from LPS-primed macrophages is induced by both mycolactone treatment and infection withM. ulcerans [21,22]. It should be noted that in our experiments, the analysis of the inflammatory responses in the macrophages following bacterial infection was performed without pre-treatment of the cells with LPS. If proIL-1β expression is induced by LPS prior to bacterial infection or treatment with mycolactone, the resulting proIL-1β could be cleaved by activated caspase-1 and mature IL-1β could be readily released, along with the induction of necrotic cell death by mycolactone. Recent report has shown that the release of IL-1β is induced byM. ulcerans infection and treatment with micro- vesicles containing mycolactone even in the absence of LPS [21]. The expression of proIL-1β could be activated by mycobacterial pathogen-associated molecular patterns which trigger Toll-like receptors (TLRs) such as TLR2. Inflammasome activation byM. ulcerans was completely inhibited in adaptor protein ASC-deficient macrophages, but residual partial acti- vation still occurred in NLRP3-deficient cells. Possibly, another NLR protein might be involved in inflammasome activation byM. ulcerans. Foulon et al. also reported demonstrated NLRP3-dependent inflammasome activation by mycolactone [21]. However, we wish to dis- cuss a little further about the K+ efflux induced by the cytotoxicity of mycolactone [17]. K+ efflux from the cytosol has been identified as a common switching signal for triggering NLRP3 [30]. Therefore, some level of lytic cell death with membrane integrity likely results in second- ary engagement of the NLRP3 inflammasome pathway. However, since even low doses of mycolactone induced IL-1β release from the infected macrophages in the absence of any obvi- ous cytotoxicity [21], it is possible that mycolactone can trigger the NLRP3 inflammasome via a pathway different from the K+ efflux-mediated pathway. In our study, inflammasome activa- tion by the infected bacteria was closely associated with the release of LDH, suggesting that K+ efflux plays a major role in the activation. However, the possibility of differences in effects among mycolactone types produced byM. ulcerans strains cannot be ruled out. Expression of IL-18 was first identified in Kupffer cells and macrophages [31], and also epi- dermal keratinocytes [32]. IL-18 is constitutively present in its precursor form in blood mono- cytes, macrophages, and dendritic cells [28]. In our experimental mouse model of subcutaneous infection, the supposed cell lineage may include macrophages or Langerhans cells. In general, IL-18 is known as a strong inducer of IFN-γ production by activated T cells. Several studies have shown suppression of IFN-γ production in patients of BU [33,34]. Studies have also demonstrated a Th2 response in BU patients [35] and an inverse correlation between the expression level of IFN-γ in the skin macrophages and the severity of BU [36]. IFN-γ-defi- cient mice exhibited more rapid progression of the skin ulcerations in BU [37]. Furthermore, the susceptibility to BU has been demonstrated to be associated with IFNG gene polymor- phisms [38]. These findings suggest a strong association between suppression of IFN-γ-medi- ated immune responses and the rate of disease progression in BU. Our observation of the exacerbation of skin lesions in the IL-18-decient mice could be related to further suppression of the IFN-γ-mediated host response. PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 11 / 18 https://doi.org/10.1371/journal.ppat.1011747 On the other hand, while IL-18 is known to enhance Th2 differentiation [39], it can also repress the Th2 response in vivo. IL-18-deficient mice show enhanced allergen-induced inflammation and exacerbation of chronic helminthic infections [40,41], suggesting the con- text-dependent role of IL-18 in type 2 immunity. Considering the roles of IL-18 in BU, it is possible that IL-18 may protect against disease progression by modifying the Th2 response. IL-18 was also demonstrated to protect against colitis in a previously reported mouse model [42–44]. In contrast, inhibition of IL-18 has also been shown to exert protective effect in experimental colitis models [45–48]. These conflicting findings have led to much contro- versy and discussion, and the roles of IL-18 in intestinal homeostasis and in the development of inflammatory diseases of the bowel are still uncertain. In the case of BU, although we have suggested a protective role of IL-18, further investigation is necessary to clarify the roles of IL- 18 in the course of progression of the disease. IL-1β is an important proinflammatory cytokine. While IL-1β is mainly induced in macro- phages during inflammation, its induction in neutrophils has also been demonstrated in sev- eral examples of bacterial infection [49–51]. We demonstrated that IL-1β induction was inhibited in macrophages infected with wild-typeM. ulcerans in vitro. In our skin infection model in mice, the resident macrophages disappeared in areas colonized by the bacteria. We speculate that the migrated neutrophils might also produce IL-1β, which is involved in bacte- rial eradication. Alternatively, macrophages localized at a distance from the areas colonized by the mycobacteria may produce IL-1β. In fact, IL-1β-producing cells were observed at some dis- tance from areas colonized by the acid-fast bacteria in biopsy specimens obtained from patients with BU [21]. Such cells might be activated with induction of IL-1β in response to low concentrations of mycolactone that have diffused farther from the areas of bacterial coloniza- tion [52], while the bacterial colonization might be controlled by activated neutrophils. Understanding the molecular mechanisms by which skin inflammation is triggered in BU is essential for identifying the factors involved in disease progression, as well as preventing the prognostic symptoms and complications. Indeed, we observed many patients with sequelae, such as bony deformities, in endemic areas of Ghana. Antibiotic treatment alone is not suffi- cient for the treatment of Buruli ulcer. Our results shed light on the etiology of Buruli ulcer and provide insight into the relationships between inflammasome activation and cytokine functions. Materials and methods Ethics statement and mice All the animal experiments conducted in this study were performed in accordance with the Guidelines for Animal Experimentation of the Japanese Association for Laboratory Animal Science. The Institutional Animal Care and Use Committee of Tokyo Medical and Dental Uni- versity approved all the protocols prior to use (approval number: A2021-118A). The experi- mental protocols involving the use of a Living Modified Organism and gene-knockout mice were approved by the Genetically Modified Organisms Safety Committee of Tokyo Medical and Dental University (approval number: G2018-021C10). C57BL/6 mice were purchased as the WT mice from Japan SLC (Tokyo, Japan). NLRP3-deficient (Nlrp3−/−) [53], NLRP6-defi- cient (Nlrp6−/−) (generated in our laboratory), ASC-deficient (Asc−/− or Pycard−/−) [54], cas- pase-11-deficient (Casp11−/−) (provided by Dr. Masahiro Yamamoto), IL-1β-deficient (Il1b−/ −) [55], and IL-18-deficient (Il18−/−) [56] mice with a C57BL/6 background were housed in a specific-pathogen-free facility. The bone marrow of AIM2-deficient (Aim2−/−) mice was pro- vided by Dr. Yasushi Kawaguchi. PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 12 / 18 https://doi.org/10.1371/journal.ppat.1011747 Bacterial strains M. ulcerans subsp. shinshuense wild-type ShT-P and the isogenic plasmid-cured strain ShT-N [57],M. ulcerans Agy99 (provided by Dr. Mineo Watanabe) andM. bovis BCG strains were used in this study.M.marinum JCM17638 andM. pseudoshottsii JCM15466 were provided by the Japan Collection of Microorganisms, RIKEN BRC, which is a participant of the National BioResource Project of MEXT, Japan. The handling of theMycobacterium strains under biosafety level 2 conditions was approved by the Safety Control Committee for Pathogenic Microbes of Tokyo Medical and Dental Uni- versity (approval number: M22019-004c3). Bacteria were cultured at room temperature (37˚C for BCG strain) in Middlebrook 7H10 agar medium (Becton Dickinson) supplemented with 0.5% glycerol and 10% OADC Enrichment (Becton Dickinson). Mycobacteria grown on a solid plate were resuspended in 7H9 middlebrook medium and the optical densities (ODs) were measured at 540 nm. The approximate bacterial count was calculated as 1OD ~1.0 x 108/ml, based on counting of the CFUs on the plates. Cells and infection Bone marrow-derived macrophages (BMDMs) were prepared from the femurs of the above- mentioned experimental mice and cultured for 7 days in RPMI 1640 (Sigma) containing 10% FBS and 1% penicillin/streptomycin, supplemented with 30% supernatant of mouse L929-cell producing G-CSF. The cells were then infected withM. ulcerans strains at a MOI of 40 or treated with an equivalent volume of the corresponding Middlebrook 7H9 medium (Becton Dickinson). Western blotting BMDMs were seeded at 1.6 x 106 cells/well in 6-well plates containing RPMI 1640 supplemented with 10% FBS. Post-infection, the cells were lysed with lysis buffer (25 mM Tris-HCl, pH7.4, 150 mM NaCl, 1%NP-40, complete protease inhibitor cocktail; Roche Diagnostics), and the superna- tants were precipitated by the addition of 6% trichloroacetic acid. The samples were loaded onto 15% SDS-PAGE. The following antibodies were obtained commercially; mouse anti-caspase-1 (p20) (Casper-1; Adipogen, AG-20B-0042), goat anti-mouse IL-1β (R&D, AF-401-NA), rabbit anti-mouse IL-18 (BioVision, 5180R-100), and anti-actin (Merck, MAB1501) antibody. ELISA and cytotoxicity assay BMDMs were seeded at a density of 4 x 105 cells/well in 24-well plates containing RPMI 1640 supplemented with 10% FBS. At the times indicated after the infection, the cytokines released into the culture supernatants were quantified using ELISA kits. The following ELISA kits were purchased commercially; mouse IL-1β (Invitrogen, 88-7013-88), mouse IL-18 (Invitrogen, BMS618-3), and mouse TNF-α (Invitrogen, 88-7324-88) kits. The lactate dehydrogenase (LDH) activity in culture supernatants of the infected cells was measured using a CytoTox 96 assay kit (Promega), in accordance with the manufacturer’s protocol. Subcutaneous infection of mice Twenty-five microliters of a bacterial suspension containing 2.5x105 CFU ofM. ulcerans in Middlebrook 7H9 broth were injected subcutaneously into the shaved dorsal skin of six-week- old female C57BL/6 mice. Uninfected control mice received the same volume of just the 7H9 broth. At 14 days post-infection, the mice were euthanized, and their skin lesions were exam- ined. The clinical severity score of the lesions was determined using a 5-point scale: 0, no symptoms; 1, localized swelling; 2, localized nodule with induration; 3, localized ulcer; and 4, PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 13 / 18 https://doi.org/10.1371/journal.ppat.1011747 diffuse ulcer with bleeding (by reference to the WHO fact sheets for Buruli ulcer: https://www. who.int/news-room/fact-sheets/detail/buruli-ulcer-(mycobacterium-ulcerans-infection)). Histochemical analysis Extracted skin lesions were fixed in 4% paraformaldehyde for 24 h at 4˚C; the tissues were then immersed overnight in 10% sucrose, 30% sucrose, or OCT compound, followed by embedding in OCT compound. Seven-micrometer-thick sections were prepared and stained with hematoxylin and eosin (H&E), in accordance with the appropriate standard protocol. For immunofluorescence staining, the tissue slices were permeabilized and blocked in 25 mM Tris-HCl, pH7.4, 150 mM NaCl, 0.2% saponin, 10% blocking One (Nacalai Tesque). The mycobacteria were stained with anti-Mycobacteria LAM (ViroStat, 5179) after treatment with fluorochrome-conjugated secondary antibody. To visualize neutrophils and macrophages, the following antibodies were obtained from commercial sources; anti-mouse Ly-6G/Ly-6C (Gr- 1) (BioLegend, 108403) and anti-mouse F4/80 (BD, 565409), respectively. The samples were incubated with an amplifying secondary antibody (Simple stain mouse MAX-PO, Nichirei, 414311) after reacting with the primary antibody, then stained using a tyramide-based tech- nique (TSA Fluorescein, PerkinElmer). Images were obtained on the LSM 800 Airyscan confo- cal microscope (Carl Zeiss). The cell numbers in two randomly selected tissue areas (magnification, x20) were calculated using the ImageJ software. Quantitative PCR Total RNA of the infected macrophages was isolated using the miRNeasy Mini kit (QIAGEN, 217004). Quantitative RT-PCR was performed using RNA-direct SYBR Green Realtime PCR Master Mix (TOYOBO) and the CFX96 Real-Time system (Bio-Rad). Quantitative compari- son of the gene expression levels of mouse Il1b and Tnfa was performed by the ΔΔCT method, using the expression level of Gapdh as the reference gene. The primer sequences used for Il1b, Tnfa and Gapdh were in accordance with Origene. The High Pure PCR Template Preparation Kit (Roche) was used to extract DNA from the mouse skin samples. Quantitative PCR was per- formed using Thunderbird SYBR qPCR Mix (TOYOBO) and the CFX96 Real-Time system. To generate a standard curve for real-time PCR, DNA was extracted from a bacterial suspen- sion containing 1 x 107 cells and serial dilutions were prepared. One microliter of DNA solu- tion corresponded to a defined number of CFU (1.6 x 101 to 1 x 104). The total numbers of bacterial cells in the skin samples were extrapolated from the averaged standard curve in accor- dance with the manufacturer’s instructions. The primer sequences for IS2404 ofM. ulcerans were F- GCGCAGATCAACTTCGCGGT and R- GCCCGATTGGTGCTCGGTCA. Quantification and statistical analysis Results are shown as the means ± SD. Comparisons and statistical tests were performed as indicated in each figure legend. For comparisons of two groups, two-tailed unpaired t-tests were used. For comparisons of multiple groups, one-way ANOVA was used. The statistical analyses were performed using the GraphPad Prism 8 software. The P values denoted through- out the manuscript highlight biologically relevant comparisons. A P value of less than 0.05 was considered as indicative of significance, denoted as *P< 0.05, **P<0.01 for all analyses. Supporting information S1 Fig. Different behaviors of production of cytokines from BMDMs infected with Myco- bacterium strains. Related to Fig 1. (A) TNF-α production, (B) IL-1β production, (D) IL-18 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 14 / 18 https://www.who.int/news-room/fact-sheets/detail/buruli-ulcer-(mycobacterium-ulcerans-infection https://www.who.int/news-room/fact-sheets/detail/buruli-ulcer-(mycobacterium-ulcerans-infection http://journals.plos.org/plospathogens/article/asset?unique&id=info:doi/10.1371/journal.ppat.1011747.s001 https://doi.org/10.1371/journal.ppat.1011747 production, as determined by ELISA, of bone marrow-derived macrophages (BMDMs) super- natants at 6 or 20 h after infection withMycobacterium strains. (C) Representative cleavage and secretion of caspase-1, IL-1β, and IL-18 by Western blot analysis. (E) Release of LDH from infected macrophages; representative at least 3 experiments. The error bars represent the means ± SD. (TIF) S2 Fig. Mycobacterium strains trigger inflammasome activation in dependent on ASC but not NLRP3, NLRP6. Related to Fig 3. (A) Representative cleavage and secretion of caspase-1, IL-1β, and IL-18 of infected BMDMs by Western blot analysis. BMDMs were isolated from WT, Nlrp3−/−, Nlrp6−/−, Pycard−/− mice. (B) TNF-α production, (C) IL-1β production, (D) IL- 18 production, as determined by ELISA; representative at least 3 experiments. The error bars represent the means ± SD. (TIF) S1 Data. Legends of S1 Data for graphs. Excel spreadsheet containing, in separate sheets, the underlying numerical data and statistical analysis for Figure panels 1A, S1A, 1B, S1B, 1D, S1D, 1E, S1E, 2B, 2C, 2D, 3B, S2B, 3C, S2C, 3D, S2D, 4B, 4D, 5B and 5C. (XLSX) Acknowledgments We would like to thank the members of the Department of Bacterial Pathogenesis, Infection and Host Response of the Tokyo Medical and Dental University for their help during our study. Author Contributions Conceptualization: Toshihiko Suzuki. Formal analysis: Kotchakorn Boonyaleka, Tokuju Okano, Hiroshi Ashida. Investigation: Toshihiko Suzuki, Kotchakorn Boonyaleka, Tokuju Okano. Resources: Kotchakorn Boonyaleka, Tokuju Okano, Tamako Iida, Mitsunori Yoshida, Hanako Fukano, Yoshihiko Hoshino, Yoichiro Iwakura, Anthony S. Ablordey. Writing – original draft: Toshihiko Suzuki. References 1. Loftus MJ, Tay EL, Globan M, Lavender CJ, Crouch SR, Johnson PDR, et al. Epidemiology of Buruli Ulcer Infections, Victoria, Australia, 2011–2016. Emerg Infect Dis (2018) 24: 1988–1997. https://doi. org/10.3201/eid2411.171593 PMID: 30334704 2. Omansen TF, Erbowor-Becksen A, Yotsu R, van der Werf TS, Tiendrebeogo A, Grout L, et al. Global Epidemiology of Buruli Ulcer, 2010–2017, and Analysis of 2014 WHO Programmatic Targets. Emerg Infect Dis (2019) 25: 2183–2190. https://doi.org/10.3201/eid2512.190427 PMID: 31742506 3. Yotsu RR, Suzuki K, Simmonds RE, Bedimo R, Ablordey A, Yeboah-Manu D, et al. Buruli Ulcer: a Review of the Current Knowledge. Curr Trop Med Rep (2018) 5: 247–256. https://doi.org/10.1007/ s40475-018-0166-2 PMID: 30460172 4. Simpson C, O’Brien DP, McDonald A, Callan P Mycobacterium ulcerans infection: evolution in clinical management. ANZ J Surg (2013) 83: 523–526. https://doi.org/10.1111/j.1445-2197.2012.06230.x PMID: 22989109 5. Bolz M, Ruggli N, Ruf MT, Ricklin ME, Zimmer G, Pluschke Experimental infection of the pig with Myco- bacterium ulcerans: a novel model for studying the pathogenesis of Buruli ulcer disease. PLoS Negl Trop Dis (2014) 8: e2968. https://doi.org/10.1371/journal.pntd.0002968 PMID: 25010421 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 15 / 18 http://journals.plos.org/plospathogens/article/asset?unique&id=info:doi/10.1371/journal.ppat.1011747.s002 http://journals.plos.org/plospathogens/article/asset?unique&id=info:doi/10.1371/journal.ppat.1011747.s003 https://doi.org/10.3201/eid2411.171593 https://doi.org/10.3201/eid2411.171593 http://www.ncbi.nlm.nih.gov/pubmed/30334704 https://doi.org/10.3201/eid2512.190427 http://www.ncbi.nlm.nih.gov/pubmed/31742506 https://doi.org/10.1007/s40475-018-0166-2 https://doi.org/10.1007/s40475-018-0166-2 http://www.ncbi.nlm.nih.gov/pubmed/30460172 https://doi.org/10.1111/j.1445-2197.2012.06230.x http://www.ncbi.nlm.nih.gov/pubmed/22989109 https://doi.org/10.1371/journal.pntd.0002968 http://www.ncbi.nlm.nih.gov/pubmed/25010421 https://doi.org/10.1371/journal.ppat.1011747 6. Ruf MT, Steffen C, Bolz M, Schmid P, Pluschke G Infiltrating leukocytes surround early Buruli ulcer lesions, but are unable to reach the mycolactone producing mycobacteria. Virulence (2017) 8: 1918– 1926. https://doi.org/10.1080/21505594.2017.1370530 PMID: 28873327 7. George KM, Chatterjee D, Gunawardana G, Welty D, Hayman J, Lee R, et al. Mycolactone: a polyketide toxin from Mycobacterium ulcerans required for virulence. Science (1999) 283: 854–857. https://doi. org/10.1126/science.283.5403.854 PMID: 9933171 8. Stinear TP, Mve-Obiang A, Small PL, Frigui W, Pryor MJ, Brosch R, et al. Giant plasmid-encoded poly- ketide synthases produce the macrolide toxin of Mycobacterium ulcerans. Proc Natl Acad Sci U S A (2004) 101: 1345–1349. https://doi.org/10.1073/pnas.0305877101 PMID: 14736915 9. Coutanceau E, Decalf J, Martino A, Babon A, Winter N, Cole ST, et al. Selective suppression of den- dritic cell functions by Mycobacterium ulcerans toxin mycolactone. J Exp Med (2007) 204: 1395–1403. https://doi.org/10.1084/jem.20070234 PMID: 17517970 10. Pahlevan AA, Wright DJ, Andrews C, George KM, Small PL, Foxwell BM The inhibitory action of Myco- bacterium ulcerans soluble factor on monocyte/T cell cytokine production and NF-kappa B function. J Immunol (1999) 163: 3928–3935. 11. Simmonds RE, Lali FV, Smallie T, Small PL, Foxwell BM Mycolactone inhibits monocyte cytokine pro- duction by a posttranscriptional mechanism. J Immunol (2009) 182: 2194–2202. 12. Hall BS, Hill K, McKenna M, Ogbechi J, High S, Willis AE, et al. The pathogenic mechanism of the Mycobacterium ulcerans virulence factor, mycolactone, depends on blockade of protein translocation into the ER. PLoS Pathog (2014) 10: e1004061. https://doi.org/10.1371/journal.ppat.1004061 PMID: 24699819 13. Boulkroun S, Guenin-Mace L, Thoulouze MI, Monot M, Merckx A, Langsley G, et al. Mycolactone sup- presses T cell responsiveness by altering both early signaling and posttranslational events. J Immunol (2010) 184: 1436–1444. https://doi.org/10.4049/jimmunol.0902854 PMID: 20042571 14. Baron L, Paatero AO, Morel JD, Impens F, Guenin-Mace L, Saint-Auret S, et al. Mycolactone subverts immunity by selectively blocking the Sec61 translocon. J Exp Med (2016) 213: 2885–2896. https://doi. org/10.1084/jem.20160662 PMID: 27821549 15. Torrado E, Adusumilli S, Fraga AG, Small PL, Castro AG, Pedrosa J Mycolactone-mediated inhibition of tumor necrosis factor production by macrophages infected with Mycobacterium ulcerans has implica- tions for the control of infection. Infect Immun (2007) 75: 3979–3988. https://doi.org/10.1128/IAI. 00290-07 PMID: 17517872 16. Demangel C, High S Sec61 blockade by mycolactone: A central mechanism in Buruli ulcer disease. Biol Cell (2018) 110: 237–248. 17. Marion E, Song OR, Christophe T, Babonneau J, Fenistein D, Eyer J, et al. Mycobacterial toxin induces analgesia in buruli ulcer by targeting the angiotensin pathways. Cell (2014) 157: 1565–1576. https:// doi.org/10.1016/j.cell.2014.04.040 PMID: 24949969 18. Song OR, Kim HB, Jouny S, Ricard I, Vandeputte A, Deboosere N, et al. A Bacterial Toxin with Analge- sic Properties: Hyperpolarization of DRG Neurons by Mycolactone. Toxins (Basel) (2017) 9. 19. Ogbechi J, Hall BS, Sbarrato T, Taunton J, Willis AE, Wek RC, et al. Inhibition of Sec61-dependent translocation by mycolactone uncouples the integrated stress response from ER stress, driving cytotox- icity via translational activation of ATF4. Cell Death Dis (2018) 9: 397. https://doi.org/10.1038/s41419- 018-0427-y PMID: 29540678 20. Hsieh LT, Dos Santos SJ, Hall BS, Ogbechi J, Loglo AD, Salguero FJ, et al. Aberrant stromal tissue fac- tor localisation and mycolactone-driven vascular dysfunction, exacerbated by IL-1beta, are linked to fibrin formation in Buruli ulcer lesions. PLoS Pathog (2022) 18: e1010280. 21. Foulon M, Robbe-Saule M, Manry J, Esnault L, Boucaud Y, Alcais A, et al. Mycolactone toxin induces an inflammatory response by targeting the IL-1beta pathway: Mechanistic insight into Buruli ulcer patho- physiology. PLoS Pathog (2020) 16: e1009107. 22. Hall BS, Hsieh LT, Sacre S, Simmonds RE The One That Got Away: How Macrophage-Derived IL- 1beta Escapes the Mycolactone-Dependent Sec61 Blockade in Buruli Ulcer. Front Immunol (2021) 12: 788146. 23. Rathinam VA, Fitzgerald KA Inflammasome Complexes: Emerging Mechanisms and Effector Func- tions. Cell (2016) 165: 792–800. https://doi.org/10.1016/j.cell.2016.03.046 PMID: 27153493 24. Hande SM, Kazumi Y, Lai WG, Jackson KL, Maeda S, Kishi Y Synthesis and structure of two new mycolactones isolated from M. ulcerans subsp. shinshuense. Org Lett (2012) 14: 4618–4621. https:// doi.org/10.1021/ol302072b PMID: 22924773 25. Hong H, Demangel C, Pidot SJ, Leadlay PF, Stinear T Mycolactones: immunosuppressive and cyto- toxic polyketides produced by aquatic mycobacteria. Nat Prod Rep (2008) 25: 447–454. https://doi.org/ 10.1039/b803101k PMID: 18497894 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 16 / 18 https://doi.org/10.1080/21505594.2017.1370530 http://www.ncbi.nlm.nih.gov/pubmed/28873327 https://doi.org/10.1126/science.283.5403.854 https://doi.org/10.1126/science.283.5403.854 http://www.ncbi.nlm.nih.gov/pubmed/9933171 https://doi.org/10.1073/pnas.0305877101 http://www.ncbi.nlm.nih.gov/pubmed/14736915 https://doi.org/10.1084/jem.20070234 http://www.ncbi.nlm.nih.gov/pubmed/17517970 https://doi.org/10.1371/journal.ppat.1004061 http://www.ncbi.nlm.nih.gov/pubmed/24699819 https://doi.org/10.4049/jimmunol.0902854 http://www.ncbi.nlm.nih.gov/pubmed/20042571 https://doi.org/10.1084/jem.20160662 https://doi.org/10.1084/jem.20160662 http://www.ncbi.nlm.nih.gov/pubmed/27821549 https://doi.org/10.1128/IAI.00290-07 https://doi.org/10.1128/IAI.00290-07 http://www.ncbi.nlm.nih.gov/pubmed/17517872 https://doi.org/10.1016/j.cell.2014.04.040 https://doi.org/10.1016/j.cell.2014.04.040 http://www.ncbi.nlm.nih.gov/pubmed/24949969 https://doi.org/10.1038/s41419-018-0427-y https://doi.org/10.1038/s41419-018-0427-y http://www.ncbi.nlm.nih.gov/pubmed/29540678 https://doi.org/10.1016/j.cell.2016.03.046 http://www.ncbi.nlm.nih.gov/pubmed/27153493 https://doi.org/10.1021/ol302072b https://doi.org/10.1021/ol302072b http://www.ncbi.nlm.nih.gov/pubmed/22924773 https://doi.org/10.1039/b803101k https://doi.org/10.1039/b803101k http://www.ncbi.nlm.nih.gov/pubmed/18497894 https://doi.org/10.1371/journal.ppat.1011747 26. Ranger BS, Mahrous EA, Mosi L, Adusumilli S, Lee RE, Colorni A, et al. Globally distributed mycobacte- rial fish pathogens produce a novel plasmid-encoded toxic macrolide, mycolactone F. Infect Immun (2006) 74: 6037–6045. https://doi.org/10.1128/IAI.00970-06 PMID: 16923788 27. Alehashemi S, Goldbach-Mansky R Human Autoinflammatory Diseases Mediated by NLRP3-, Pyrin-, NLRP1-, and NLRC4-Inflammasome Dysregulation Updates on Diagnosis, Treatment, and the Respec- tive Roles of IL-1 and IL-18. Front Immunol (2020) 11: 1840. 28. Kaplanski G Interleukin-18: Biological properties and role in disease pathogenesis. Immunol Rev (2018) 281: 138–153. https://doi.org/10.1111/imr.12616 PMID: 29247988 29. Hausmann JS Targeting cytokines to treat autoinflammatory diseases. Clin Immunol (2019) 206: 23– 32. https://doi.org/10.1016/j.clim.2018.10.016 PMID: 30394352 30. Munoz-Planillo R, Kuffa P, Martinez-Colon G, Smith BL, Rajendiran TM, Nunez G K(+) efflux is the com- mon trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter. Immunity (2013) 38: 1142–1153. 31. Okamura H, Tsutsi H, Komatsu T, Yutsudo M, Hakura A, Tanimoto T, et al. Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature (1995) 378: 88–91. https://doi.org/10.1038/ 378088a0 PMID: 7477296 32. Stoll S, Muller G, Kurimoto M, Saloga J, Tanimoto T, Yamauchi H, et al. Production of IL-18 (IFN- gamma-inducing factor) messenger RNA and functional protein by murine keratinocytes. J Immunol (1997) 159: 298–302. PMID: 9200466 33. Yeboah-Manu D, Peduzzi E, Mensah-Quainoo E, Asante-Poku A, Ofori-Adjei D, Pluschke G, et al. Sys- temic suppression of interferon-gamma responses in Buruli ulcer patients resolves after surgical exci- sion of the lesions caused by the extracellular pathogen Mycobacterium ulcerans. J Leukoc Biol (2006) 79: 1150–1156. https://doi.org/10.1189/jlb.1005581 PMID: 16531561 34. Loglo AD, Frimpong M, Sarpong Duah M, Sarfo F, Sarpong FN, Agbavor B, et al. IFN-gamma and IL-5 whole blood response directed against mycolactone polyketide synthase domains in patients with Mycobacterium ulcerans infection. PeerJ (2018) 6: e5294. 35. Gooding TM, Johnson PD, Smith M, Kemp AS, Robins-Browne RM Cytokine profiles of patients infected with Mycobacterium ulcerans and unaffected household contacts. Infect Immun (2002) 70: 5562–5567. 36. Prevot G, Bourreau E, Pascalis H, Pradinaud R, Tanghe A, Huygen K, et al. Differential production of systemic and intralesional gamma interferon and interleukin-10 in nodular and ulcerative forms of Buruli disease. Infect Immun (2004) 72: 958–965. https://doi.org/10.1128/IAI.72.2.958-965.2004 PMID: 14742541 37. Bieri R, Bolz M, Ruf MT, Pluschke G Interferon-gamma Is a Crucial Activator of Early Host Immune Defense against Mycobacterium ulcerans Infection in Mice. PLoS Negl Trop Dis (2016) 10: e0004450. 38. Bibert S, Bratschi MW, Aboagye SY, Collinet E, Scherr N, Yeboah-Manu D, et al. Susceptibility to Myco- bacterium ulcerans Disease (Buruli ulcer) Is Associated with IFNG and iNOS Gene Polymorphisms. Front Microbiol (2017) 8: 1903. https://doi.org/10.3389/fmicb.2017.01903 PMID: 29046669 39. Sylvester M, Son A, Schwartz DM The Interactions Between Autoinflammation and Type 2 Immunity: From Mechanistic Studies to Epidemiologic Associations. Front Immunol (2022) 13: 818039. https:// doi.org/10.3389/fimmu.2022.818039 PMID: 35281022 40. Kodama T, Matsuyama T, Kuribayashi K, Nishioka Y, Sugita M, Akira S, et al. IL-18 deficiency selec- tively enhances allergen-induced eosinophilia in mice. J Allergy Clin Immunol (2000) 105: 45–53. https://doi.org/10.1016/s0091-6749(00)90176-3 PMID: 10629451 41. Helmby H, Takeda K, Akira S, Grencis RK Interleukin (IL)-18 promotes the development of chronic gas- trointestinal helminth infection by downregulating IL-13. J Exp Med (2001) 194: 355–364. https://doi. org/10.1084/jem.194.3.355 PMID: 11489954 42. Dupaul-Chicoine J, Yeretssian G, Doiron K, Bergstrom KS, McIntire CR, LeBlanc PM, et al. Control of intestinal homeostasis, colitis, and colitis-associated colorectal cancer by the inflammatory caspases. Immunity (2010) 32: 367–378. https://doi.org/10.1016/j.immuni.2010.02.012 PMID: 20226691 43. Zaki MH, Boyd KL, Vogel P, Kastan MB, Lamkanfi M, Kanneganti TD The NLRP3 inflammasome pro- tects against loss of epithelial integrity and mortality during experimental colitis. Immunity (2010) 32: 379–391. https://doi.org/10.1016/j.immuni.2010.03.003 PMID: 20303296 44. Oficjalska K, Raverdeau M, Aviello G, Wade SC, Hickey A, Sheehan KM, et al. Protective role for cas- pase-11 during acute experimental murine colitis. J Immunol (2015) 194: 1252–1260. https://doi.org/ 10.4049/jimmunol.1400501 PMID: 25548224 45. Kanai T, Watanabe M, Okazawa A, Sato T, Yamazaki M, Okamoto S, et al. Macrophage-derived IL-18- mediated intestinal inflammation in the murine model of Crohn’s disease. Gastroenterology (2001) 121: 875–888. https://doi.org/10.1053/gast.2001.28021 PMID: 11606501 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 17 / 18 https://doi.org/10.1128/IAI.00970-06 http://www.ncbi.nlm.nih.gov/pubmed/16923788 https://doi.org/10.1111/imr.12616 http://www.ncbi.nlm.nih.gov/pubmed/29247988 https://doi.org/10.1016/j.clim.2018.10.016 http://www.ncbi.nlm.nih.gov/pubmed/30394352 https://doi.org/10.1038/378088a0 https://doi.org/10.1038/378088a0 http://www.ncbi.nlm.nih.gov/pubmed/7477296 http://www.ncbi.nlm.nih.gov/pubmed/9200466 https://doi.org/10.1189/jlb.1005581 http://www.ncbi.nlm.nih.gov/pubmed/16531561 https://doi.org/10.1128/IAI.72.2.958-965.2004 http://www.ncbi.nlm.nih.gov/pubmed/14742541 https://doi.org/10.3389/fmicb.2017.01903 http://www.ncbi.nlm.nih.gov/pubmed/29046669 https://doi.org/10.3389/fimmu.2022.818039 https://doi.org/10.3389/fimmu.2022.818039 http://www.ncbi.nlm.nih.gov/pubmed/35281022 https://doi.org/10.1016/s0091-6749%2800%2990176-3 http://www.ncbi.nlm.nih.gov/pubmed/10629451 https://doi.org/10.1084/jem.194.3.355 https://doi.org/10.1084/jem.194.3.355 http://www.ncbi.nlm.nih.gov/pubmed/11489954 https://doi.org/10.1016/j.immuni.2010.02.012 http://www.ncbi.nlm.nih.gov/pubmed/20226691 https://doi.org/10.1016/j.immuni.2010.03.003 http://www.ncbi.nlm.nih.gov/pubmed/20303296 https://doi.org/10.4049/jimmunol.1400501 https://doi.org/10.4049/jimmunol.1400501 http://www.ncbi.nlm.nih.gov/pubmed/25548224 https://doi.org/10.1053/gast.2001.28021 http://www.ncbi.nlm.nih.gov/pubmed/11606501 https://doi.org/10.1371/journal.ppat.1011747 46. Siegmund B, Fantuzzi G, Rieder F, Gamboni-Robertson F, Lehr HA, Hartmann G, et al. Neutralization of interleukin-18 reduces severity in murine colitis and intestinal IFN-gamma and TNF-alpha production. Am J Physiol Regul Integr Comp Physiol (2001) 281: R1264–1273. https://doi.org/10.1152/ajpregu. 2001.281.4.R1264 PMID: 11557635 47. Ten Hove T, Corbaz A, Amitai H, Aloni S, Belzer I, Graber P, et al. Blockade of endogenous IL-18 ame- liorates TNBS-induced colitis by decreasing local TNF-alpha production in mice. Gastroenterology (2001) 121: 1372–1379. https://doi.org/10.1053/gast.2001.29579 PMID: 11729116 48. Nowarski R, Jackson R, Gagliani N, de Zoete MR, Palm NW, Bailis W, et al. Epithelial IL-18 Equilibrium Controls Barrier Function in Colitis. Cell (2015) 163: 1444–1456. https://doi.org/10.1016/j.cell.2015.10. 072 PMID: 26638073 49. Cho JS, Guo Y, Ramos RI, Hebroni F, Plaisier SB, Xuan C, et al. Neutrophil-derived IL-1beta is suffi- cient for abscess formation in immunity against Staphylococcus aureus in mice. PLoS Pathog (2012) 8: e1003047. 50. Karmakar M, Katsnelson M, Malak HA, Greene NG, Howell SJ, Hise AG, et al. Neutrophil IL-1beta pro- cessing induced by pneumolysin is mediated by the NLRP3/ASC inflammasome and caspase-1 activa- tion and is dependent on K+ efflux. J Immunol (2015) 194: 1763–1775. 51. Patankar YR, Mabaera R, Berwin B Differential ASC requirements reveal a key role for neutrophils and a noncanonical IL-1beta response to Pseudomonas aeruginosa. Am J Physiol Lung Cell Mol Physiol (2015) 309: L902–913. 52. Hong H, Coutanceau E, Leclerc M, Caleechurn L, Leadlay PF, Demangel C Mycolactone diffuses from Mycobacterium ulcerans-infected tissues and targets mononuclear cells in peripheral blood and lym- phoid organs. PLoS Negl Trop Dis (2008) 2: e325. https://doi.org/10.1371/journal.pntd.0000325 PMID: 18941518 53. Martinon F, Petrilli V, Mayor A, Tardivel A, Tschopp Gout-associated uric acid crystals activate the NALP3 inflammasome. Nature (2006) 440: 237–241. https://doi.org/10.1038/nature04516 PMID: 16407889 54. Yamamoto M, Yaginuma K, Tsutsui H, Sagara J, Guan X, Seki E, et al. ASC is essential for LPS- induced activation of procaspase-1 independently of TLR-associated signal adaptor molecules. Genes Cells (2004) 9: 1055–1067. https://doi.org/10.1111/j.1365-2443.2004.00789.x PMID: 15507117 55. Horai R, Asano M, Sudo K, Kanuka H, Suzuki M, Nishihara M, et al. Production of mice deficient in genes for interleukin (IL)-1alpha, IL-1beta, IL-1alpha/beta, and IL-1 receptor antagonist shows that IL- 1beta is crucial in turpentine-induced fever development and glucocorticoid secretion. J Exp Med (1998) 187: 1463–1475. https://doi.org/10.1084/jem.187.9.1463 PMID: 9565638 56. Takeda K, Tsutsui H, Yoshimoto T, Adachi O, Yoshida N, Kishimoto T, et al. Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity (1998) 8: 383–390. https://doi.org/10.1016/s1074- 7613(00)80543-9 PMID: 9529155 57. Nakanaga K, Ogura Y, Toyoda A, Yoshida M, Fukano H, Fujiwara N, et al. Naturally occurring a loss of a giant plasmid from Mycobacterium ulcerans subsp. shinshuense makes it non-pathogenic. Sci Rep (2018) 8: 8218. https://doi.org/10.1038/s41598-018-26425-1 PMID: 29844323 PLOS PATHOGENS Functional role of IL-18 in Buruli ulcer progression PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011747 November 1, 2023 18 / 18 https://doi.org/10.1152/ajpregu.2001.281.4.R1264 https://doi.org/10.1152/ajpregu.2001.281.4.R1264 http://www.ncbi.nlm.nih.gov/pubmed/11557635 https://doi.org/10.1053/gast.2001.29579 http://www.ncbi.nlm.nih.gov/pubmed/11729116 https://doi.org/10.1016/j.cell.2015.10.072 https://doi.org/10.1016/j.cell.2015.10.072 http://www.ncbi.nlm.nih.gov/pubmed/26638073 https://doi.org/10.1371/journal.pntd.0000325 http://www.ncbi.nlm.nih.gov/pubmed/18941518 https://doi.org/10.1038/nature04516 http://www.ncbi.nlm.nih.gov/pubmed/16407889 https://doi.org/10.1111/j.1365-2443.2004.00789.x http://www.ncbi.nlm.nih.gov/pubmed/15507117 https://doi.org/10.1084/jem.187.9.1463 http://www.ncbi.nlm.nih.gov/pubmed/9565638 https://doi.org/10.1016/s1074-7613%2800%2980543-9 https://doi.org/10.1016/s1074-7613%2800%2980543-9 http://www.ncbi.nlm.nih.gov/pubmed/9529155 https://doi.org/10.1038/s41598-018-26425-1 http://www.ncbi.nlm.nih.gov/pubmed/29844323 https://doi.org/10.1371/journal.ppat.1011747