antibiotics
Article
Occurrence of Carbapenemases, Extended-Spectrum
Beta-Lactamases and AmpCs among Beta-Lactamase-Producing
Gram-Negative Bacteria from Clinical Sources in Accra, Ghana
Felicia A. Owusu 1, Noah Obeng-Nkrumah 2, Esther Gyinae 3, Sarkodie Kodom 4, Rhodalyn Tagoe 1,
Blessing Kofi Adu Tabi 1, Nicholas T. K. D. Dayie 5 , Japheth A. Opintan 5 and Beverly Egyir 1,*
1 Department of Bacteriology, Noguchi Memorial Institute for Medical Research, University of Ghana,
Accra 00233, Ghana; owusufelicia90@gmail.com (F.A.O.); rhodalyntagoe1310@gmail.com (R.T.);
kofitabi39@gmail.com (B.K.A.T.)
2 Department of Medical Laboratory Sciences, School of Biomedical and Allied Health Sciences,
University of Ghana, Accra 00233, Ghana; noahobengnkrumah@gmail.com
3 Department of Microbiology, Korle-Bu Teaching Hospital, Accra 00233, Ghana
4 University of Ghana Hospital, Accra 00233, Ghana; sarkodiekodom@yahoo.com
5 Department of Medical Microbiology, University of Ghana Medical School, University of Ghana,
Accra 00233, Ghana
* Correspondence: begyir@noguchi.ug.edu.gh or beverlyegyir@gmail.com
Abstract: Beta-lactamase (β-lactamase)-producing Gram-negative bacteria (GNB) are of public health
concern due to their resistance to routine antimicrobials. We investigated the antimicrobial resistance
and occurrence of carbapenemases, extended-spectrum β-lactamases (ESBLs) and AmpCs among
GNB from clinical sources. GNB were identified using matrix-assisted laser desorption/ionization
time of flight–mass spectrometry (MALDITOF-MS). Antimicrobial susceptibility testing was per-
formed via Kirby–Bauer disk diffusion and a microscan autoSCAN system. β-lactamase genes were
Citation: Owusu, F.A.; determined via multiplex polymerase chain reactions. Of the 181 archived GNB analyzed, Escherichia
Obeng-Nkrumah, N.; Gyinae, E.; coli and Klebsiella pneumoniae constituted 46% (n = 83) and 17% (n = 30), respectively. Resistance to
Kodom, S.; Tagoe, R.; Tabi, B.K.A.; ampicillin (51%), third-generation cephalosporins (21%), and ertapenem (21%) was observed among
Dayie, N.T.K.D.; Opintan, J.A.; Egyir, the isolates, with 44% being multi-drug resistant (MDR). β-lactamase genes such as AmpCs ((blaFOX-M
B. Occurrence of Carbapenemases, (64%) and blaDHA-M and blaEDC-M (27%)), ESBLs ((blaCTX-M (81%), other β-lactamase genes blaTEM
Extended-Spectrum Beta-Lactamases (73%) and blaSHV (27%)) and carbapenemase ((blaOXA-48 (60%) and blaNDM and blaKPC (40%)) were
and AmpCs among
also detected. One K. pneumoniae co-harbored AmpC (bla and bla ) and carbapenemase
Beta-Lactamase-Producing FOX-M EBC-M
(blaKPC and blaOXA-48) genes. blaOXA-48 gene was detected in one carbapenem-resistant Acinetobac-Gram-Negative Bacteria from
Clinical Sources in Accra, Ghana. ter baumannii. Overall, isolates were resistant to a wide range of antimicrobials including last-line
Antibiotics 2023, 12, 1016. https:// treatment options. This underpins the need for continuous surveillance for effective management of
doi.org/10.3390/antibiotics12061016 infections caused by these pathogens in our settings.
Academic Editor: Masafumi Seki
Keywords: beta-lactamases; AmpC; extended-spectrum beta-lactamase; carbapenemases; third-
Received: 25 March 2023 generation cephalosporin resistance; Ghana; Africa
Revised: 18 May 2023
Accepted: 22 May 2023
Published: 5 June 2023
1. Introduction
Gram-negative bacteria (GNB) are widespread in nature and cause life-threatening
Copyright: © 2023 by the authors. infections in humans [1]. The expression of beta-lactamase (β-lactamase) enzymes such as
Licensee MDPI, Basel, Switzerland. class C cephalosporinases (AmpCs), extended-spectrum β-lactamase (ESBL) and carbapen-
This article is an open access article emase in GNB has been linked to increased antibiotic resistance resulting in therapeutic
distributed under the terms and failure, prolonged hospital stays, increased healthcare cost and mortality [2].
conditions of the Creative Commons Antimicrobial resistance (AMR) observed among GNB due to the expression of
Attribution (CC BY) license (https:// β-lactamase is a global public health concern [3]. In Ghana and other parts of the world,
creativecommons.org/licenses/by/ there is over-dependence on cephalosporin beta-lactam antibiotics for the treatment of infec-
4.0/). tions due to their low toxicity and high potency, which have contributed to the phenomenon
Antibiotics 2023, 12, 1016. https://doi.org/10.3390/antibiotics12061016 https://www.mdpi.com/journal/antibiotics
Antibiotics 2023, 12, 1016 2 of 11
of resistance [4]. β-lactamases act by disrupting the active amide bond of the beta-lactam
(β-lactam) ring and can be chromosomally encoded or acquired via mobile genetic elements
(MGEs) such as plasmids, integrons, and transposons among bacteria species. The MGEs
serve as vectors in transmitting β-lactamase (bla) and non-betalactam AMR genes among
bacteria species, resulting in limited therapeutic options for the treatment of infections [5].
Plasmid-mediated AmpC β-lactamases (including blaFOX-M, blaDHA-M, blaCMY-M and
blaACC-M) are clinically relevant cephalosporinases that mediate resistance to cephalothin,
cefazolin, cefoxitin, most penicillins and β-lactamase inhibitor–beta-lactam combinations.
The hyperproduction of AmpC confers resistance to extended-spectrum cephalosporins in-
cluding cefotaxime, ceftazidime and ceftriaxone [6]. AmpC production has been frequently
reported in Enterobacterales [7]. Of concern is the hyperproduction of AmpC β-lactamases
and the upregulation of efflux pumps, which may synergistically confer additional resis-
tance to carbapenems in GNB [8]. Most importantly, AmpC-producing bacteria are a cause
of healthcare-associated infections leading to strained therapeutic options [9].
The ESBL group of the β-lactamases mediates a wide range of resistance activities
against frequently administered antibiotics such as penicillins, oxyimino-cephalosporins
and aztreonam, but they are inactive against beta-lactam inhibitors, cephamycins (cefoxitin)
and carbapenems [10]. They are predominant among Enterobacterales strains and have
been associated with multi-drug-resistant (MDR) phenotypes responsible for severe and
fatal infection outcomes as well as hospital and community-linked outbreaks [11]. ESBL-
producing Enterobacterales are part of the World Health Organization critical priority
pathogens for the research and development of novel antibiotics [12]. The most dissemi-
nated genotypes of ESBL are blaTEM, blaSHV and blaCTX-M [13], which are mostly borne on
plasmids, and these plasmids often carry genes that mediate resistance to other classes of
antibiotics such as aminoglycosides, fluoroquinolones and trimethoprim-sulfamethoxazole,
further reducing options for the treatment of ESBL-associated infections [14].
Carbapenems are a drug of choice for the treatment of infections caused by ESBL-
and AmpC-producing pathogens [15]. However, the emergence of carbapenemase en-
zymes [16] has further reduced the treatment options available for infections caused by
these pathogens [17]. These carbapenemase enzymes have been associated with clinically
relevant pathogens of the Enterobacterales family, Pseudomonas aeruginosa (P. aeruginosa)
and Acinetobacter baumannii (A. baumannii) strains [18].
Many variants of carbapenemases have been detected, with the most predominant
being KPC (class A carbapenemases), NDM and VIM (class B metallo-beta-lactamases) and
the OXA-48-type (class D carbapenemases) enzymes [19]. They have been reported globally
as significant contributors to healthcare-associated infections [20]. The class A enzymes
efficiently resist carbapenems and inhibit the actions of clavulanic acid, albeit poorly, whilst
the class B enzymes inhibit the activities of β-lactamase inhibitors and carbapenems but
not aztreonam [21]. On the other hand, class D carbapenemases, which are mostly isolated
from A. baumannii, P. aeruginosa and less commonly in the Enterobacterales family, partially
inhibit clavulanates and weakly hydrolyze carbapenems [22].
In Ghana, although GNB-harboring β-lactamases are established as widespread, most
studies have only investigated the presence of ESBLs and carbapenemases in Enterobac-
terales with emphasis on Escherichia coli (E. coli) and Klebsiella pneumoniae (K. pneumo-
niae) [4,23]. There is therefore a paucity of studies that have reported the concurrent
presence of β-lactamases such as AmpC, ESBL and carbapenemases in an array of GNB
from clinical sources. Data on the antimicrobial resistance of β-lactamase-producing or-
ganisms are essential in guiding antimicrobial therapy, effective surveillance and infection
prevention and control. This study therefore investigated the occurrence and antimicrobial
resistance of AmpCs-, ESBLs- and carbapenemases among a collection of GNB recovered
from clinical sources.
Antibiotics 2023, 12, 1016 3 of 11
2. Results
2.1. Spectrum of Gram-Negative Bacteria
Out of the 181 GNB processed, 89% (n = 161/181) were Enterobacterales, comprising
E. coli (n = 83/161; 52%), K. pneumoniae (n = 30/161; 19%), Proteus mirabilis (n = 18/161;
11%), Enterobacter spp. (n = 16/161; 10%), Salmonella spp. (n = 8/161; 5%), Citrobacter spp.
(n = 3/161; 2%), Providencia spp. (n = 2/161; 1.2%) and Klebsiella oxytoca (n = 1/161; 0.6%).
Pseudomonas aeruginosa (n = 8/181; 4.4%), Acinetobacter spp. (n = 4/181; 2.2%), Neisseria spp.
(n = 3/181; 1.7%), Pseudomonas stutzeri (n = 1/181; 0.5%) and others (n = 4/181; 2.2%) were
also detected. Table 1 shows bacteria species identified and clinical sources.
Table 1. Gram-negative bacteria and their clinical sources.
Urine Wound Blood Throat Stool Ear
Isolates
n (%) n (%) n (%) n (%) n (%) n (%)
Escherichia coli (n = 83) 61 (73) 18 (22) 3 (4) _ _ 1 (1.2)
Klebsiella pneumoniae (n = 30) 25 (83) 3 (10) 2 (7) _ _ _
Proteus mirabilis (n = 18) 8 (44) 2 (11) 7 (39) _ 1 (6) _
Pseudomonas aeruginosa (n = 8) _ 8 (100) _ _ _ _
Pseudomonas stutzeri (n = 1) _ _ 1 (100) _ _ _
Enterobacter cloacae (n = 7) 5 (71) _ 2 (29) _ _ _
Enterobacter asburiae (n = 4) 4 (100) _ _ _ _ _
Enterobacter kobei (n = 4) 3 (75) 1 (25) _ _ _ _
Enterobacter aerogenes (n = 1) 1 (100) _ _ _ _ _
Salmonella paratyphi (n = 3) 1 (33) _ 1 (33) 1 (33) _ _
Salmonella typhi (n = 3) _ _ 3 (100) _ _ _
Salmonella enterica (n = 2) _ _ 1 (50) _ 1 (50) _
Acinetobacter baumannii (n = 2) 1 (50) _ 1 (50) _ _ _
Acinetobacter nosocomialis (n = 2) 2 (100) _ _ _ _ _
Neisseria subflava (n = 2) _ _ _ 2 (100) _ _
Klebsiella oxytoca (n = 1) _ 1 (100) _ _ _ _
Providencia stuartii (n = 1) _ 1 (100) _ _ _ _
Providencia vermicola (n = 1) _ 1 (100) _ _ _ _
Citrobacter koseri (n = 1) 1 (100) _ _ _ _ _
Citrobacter youngae (n = 1) _ _ _ _ 1 (100) _
Citrobacter freundi (n = 1) 1 (100) _ _ _ _ _
Neisseria meningiditis (n = 1) _ _ _ 1 (100) _ _
Kerstersia gyiorum (n = 1) _ 1 (100) _ _ _ _
Achromobacter xylososidans (n = 1) _ 1 (100) _ _ _ _
Alcaligenes faecalis (n = 1) _ 1 (100) _ _ _ _
Cupriavidus gilardii (n = 1) 1 (100) _ _ _ _ _
Total (181) 114 (63) 38 (21) 21 (12) 4 (2.2) 3 (1.6) 1 (0.5)
Note: n—number.
2.2. Antimicrobial Resistance Pattern
The top three antibiotics with the highest susceptibility were cefoxitin (n = 144/168;
86%), ertapenem and norfloxacin (n = 133/168; 79%). Cefuroxime and cefotaxime resistance
was detected among 29% (n = 48/168) of the isolates. Ceftazidime (n = 47/168; 28%)
and ampicillin (n = 86/168; 51%) resistance were also detected. For ertapenem, E. coli
isolates recorded the highest level of resistance (n = 18/83; 22%). Pseudomonas aeruginosa
(n = 8) and Pseudomonas stutzeri (n = 1) were susceptible to all antibiotics tested. Among
the Acinetobacter spp. (n = 4), Acinetobacter nosocomialis (n = 1/4; 25%) showed resistance
to trimethoprim/sulfamethozaxole with an MIC range >2/38 µg/mL. Ampicillin was the
least effective antibiotic against all strains, with a resistance prevalence of 51%. Overall,
44%, (n = 74/168) of the isolates were multi-drug resistant (MDR). The three isolates with
the highest MDR proportions were E. coli (n = 40/74; 54%), K. pneumoniae (n = 11/74; 15%)
and Enterobacter spp. (n = 11/74; 15%). The MDR isolates were susceptible to cefoxitin
Antibiotics 2023, 12, 1016 4 of 11
(n = 52/74; 70%) and ertapenem (n = 42/74; 57%). Table 2 shows the antimicrobial resistance
profiles of the isolates.
Table 2. Antimicrobial resistance profile of isolates recovered.
Bacterial Isolates AMP CTX NOR CAZ ERT FOX CXM MDRN (%) N (%) N (%) N (%) N (%) N (%) N (%) N (%)
E. coli (n = 83) 76 (92) 27 (33) 23 (28) 23 (28) 18 (22) 5 (6) 29 (35) 40 (48)
K. pneumoniae (n = 30) #_ 12 (40) 5 (17) 9 (30) 6 (20) 5 (17) 10 (33) 11 (37)
P. mirabilis (n = 18) 4 (22) 1 (6) 0 6 (33) 2 (11) 0 1 (6) 1 (6)
Enterobacter spp. (n = 16) #_ 3 (19) 2 (13) 4 (25) 3 (19) 8 (50) 3 (19) 11 (69)
Citrobacter spp. (n = 3) #_ 1 (33) 0 0 0 2 (67) 0 2 (67)
Salmonella Typhi (n = 3) 2 (67) 0 0 0 0 1 (33) $_ 1 (33)
Salmonella Paratyphi (n = 3) 0 0 0 0 0 1 (33) $_ 1 (33)
Neisseria spp. (n = 3) NA 1 (33) NA NA NA 0 NA 0
Salmonella enterica. (n = 2) 0 0 0 1 (50) 0 0 $_ 0
K. oxytoca (n = 1) #_ 0 0 0 1 (100) 0 1 (100) 1 (100)
Providencia vermicola (n = 1) 1 (100) 1 (100) 1 (100) 1 (100) 1 (100) 1 (100) 1 (100) 1 (100)
Providencia stuartii (n = 1) 1 (100) 0 1 (100) 0 1 (100) 0 0 1 (100)
Kerstersia gyiorum (n = 1) 0 0 1 (100) 0 0 0 1 (100) 1 (100)
Achromobacter xylososidans (n = 1) 1 (100) 1 (100) 1 (100) 1 (100) 1 (100) 1 (100) 1 (100) 1 (100)
Alcaligenes faecalis (n = 1) 1 (100) 1 (100) 1 (100) 1 (100) 1 (100) 0 1 (100) 1 (100)
Cupriavidus gilardii (n = 1) NA 0 0 1 (100) 1 (100) 0 NA 1 (100)
Total (n = 168) 86 (51) 48 (29) 35 (21) 47 (28) 35 (21) 24 (14) 48 (29) 74 (44)
P. aeruginosa (n = 8) were susceptible to gentamicin (≥15 mm), cefepime (≥18 mm), ceftazidime (≥21 mm),
ciprofloxacin (≥25 mm), piperacillin tazobactam (≥21 mm), amikacin (≥17 mm) and meropenem (≥19 mm).
Acinetobacter sp. (n = 4)—were susceptible to amikacin (MIC ≤ 16 µg/mL), ampicillin/sulbactam
(MIC ≤ 8/4 µg/mL), cefepime (MIC ≤ 1, 4–8 µg/mL), cefotaxime (MIC 8 µg/mL), cef-
tazidime (MIC 4 µg/mL), ciprofloxacin (MIC ≤ 1 µg/mL), gentamicin (MIC ≤ 4 µg/mL), lev-
ofloxacin (MIC ≤ 2 µg/mL), meropenem (MIC ≤ 1 µg/mL), tobramycin (MIC ≤ 4 µg/mL)
and trimethoprim/sulfamethozaxole (MIC < 2/38 µg/mL). Acinetobacter nosocomialis (n = 1)
was resistant to trimethoprim/sulfamethozaxole with MIC > 2/38 µg/mL. Pseudomonas stutzeri
(n = 1) was susceptible to cefepime (MIC ≤ 1 µg/mL), cefotaxime (MIC ≤ 1 µg/mL), ceftazidime
(MIC ≤ 1 µg/mL) and piperacillin/tazobactam (MIC ≤ 16 µg/mL). Note: NA—not applicable; #_—isolates
were not tested because they are intrinsically resistant to ampicillin. $_—results were not reported because
1st- and 2nd-generation cephalosporins may appear active in vitro against Salmonellae but are clinically inactive.
AMP—ampicillin; CTX—cefotaxime; NOR—norfloxacin; CAZ—ceftazidime; ERT—ertapenem; FOX—cefoxitin;
CXM—cefuroxime; MDR—multi-drug resistance.
2.3. Phenotype and Resistance Gene Markers for AmpC, ESBL and Carbapenemase
All isolates except P. aeruginosa (n = 8), Acinetobacter spp. (n = 4), and P. stutzeri
(n = 1), were analyzed for the production of AmpC and ESBL, phenotypically and via
polymerase chain reaction (PCR). Twenty-eight (17%) isolates were phenotypically resistant
to cefoxitin (presumptive AmpC producers) and were screened via PCR for the presence
of plasmid-mediated AmpC β-lactamase genes. Eleven (39%) isolates were positive for
AmpC gene variants. Thirty-six isolates (36/168; 21%) were phenotypically positive for
ESBL production; of these, 29 (81%) contained blaCTX-M genes. E. coli were the predominant
carriers of ESBL genes (n = 22/29; 76%), followed by K. pneumoniae 24% (n = 7/29).
Of the thirty-five ertapenem-resistant isolates, five were positive for carbapenemase
genes, and these included two K. pneumoniae, one E. coli, an A. baumannii and a Providencia
vermicola (P. vermicola). Table 3 shows the phenotypic and genotypic distribution of β-
lactamase amongst the isolates.
2.4. Resistance Gene Distribution among Isolates
AmpC genes were found among E. coli (n = 4/11; 36%), K. pneumoniae (n = 4/11; 36%),
Salmonella spp. (n = 2/11; 18%) and P. vermicola (n = 1/11; 9%) isolates. These isolates
originated from urine (n = 8), blood (n = 2) and wound (n = 1) samples. The most frequently
identified AmpC gene was blaFOX-M (n = 7/11; 64%), observed in four K. pneumoniae
(36%), two E. coli (18%) and one Salmonella Typhi (9%). Other AmpC genes were blaEBC-M
(n = 3/11; 27%), identified in two K. pneumoniae, and one Salmonella paratyphi. The blaDHA-M
gene (n = 3/11; 27%) was found in two E. coli and one P. vermicola isolates. Two out of
four K. pneumoniae co-harbored blaFOX-M and blaEBC-M genes. The 29 isolates harboring
Antibiotics 2023, 12, 1016 5 of 11
the ESBL- blaCTX-M gene were isolated from urine (n = 11) and wound (n = 18) samples.
Other β-lactamase genes, such as blaTEM (n = 16/22; 73%) and blaSHV (n = 6/22; 27%), were
also observed among the phenotypically positive ESBL producing isolates. blaTEM gene
was found in E. coli (n = 9/16; 56%) and K. pneumoniae (n = 7/16; 44%). The blaSHV gene
was harbored by K. pneumoniae (n = 5/6; 83%) and E. coli (n = 1/6; 17%). In all, four (11%)
isolates harbored a blaCTX-M, blaTEM and blaSHV β-lactamase genes whereas eleven (31%)
contained both blaCTX-M and blaTEM genes. Five isolates (14%) possessed both blaCTX-M and
blaSHV genes. The blaOXA-48 gene was the most common carbapenemase gene identified
and was carried by three of the five carbapenem-resistant GN isolates (K. pneumoniae, E.
coli and A. baumannii). Two of the isolates with blaOXA-48 (E. coli and K. pneumoniae) were
from urine samples and each co-harbored a blaKPC gene. A. baumanni carried blaOXA-48
and was recovered from a blood sample. blaNDM was identified in K. pneumoniae (n = 1)
and P. vermicola (n = 1) isolates, both from wound samples. Figure 1 shows beta lactamase
distribution and antibiotypes.
Table 3. Phenotypic and genotypic distribution of AmpC, ESBL and carbapenemases among isolates.
AmpC ESBL Carbapenemase
Isolate Phenotypic Genotypic Phenotypic Genotypic Phenotypic Genotypic
(n = 28) (n = 11) (n = 36) (n = 29) (n = 35) (n = 5)
E. coli (n = 83) 5 4 (80%) 27 22 (81%) 18 1 (6%)
K. pneumoniae (n = 30) 5 4 (80%) 8 7 (88%) 6 2 (33%)
Proteus mirabilis (n = 18) - - 1 - 2 -
Enterobacter spp. (n = 16) 8 - - - 3 -
Salmonella spp. (n = 8) 2 2 (100%) - - - -
Acinetobacter spp. (n = 4) 4 - - - 3 1 (33%)
Citrobacter spp. (n = 3) 2 - - - - -
K. oxytoca (n = 1) - - - - 1 -
Providencia vermicola (n = 1) 1 1 (100%) - - 1 1 (100%)
Achromobacter xylososidans (n = 1) 1 - - - - -
Cupriavidus gilardii (n = 1) - - - - 1 -
P. aeruginosa (n = 8), Neisseria spp. (n = 3), Kerstersia gyiorum (n = 1), Al-
caligenes faecalis (n = 1), Providencia stuartii (n = 1) and Pseudomonas stutzeri
Antibiotics 2023, 12, x FOR PEER REVIEW 6 of 12 
 (n = 1) were negative for AmpC, ESBL and carbapenemase production.
 
Figure 1. -lactamFiagusree 1.g βe-lancteamase gene distribution and antibiotypes of isolates. Yellow cells indicate GNB that β are resistant to andtiibsiottricisb, wuhtilisot bnluea snhodwsa sunscteipbtiiboilittyy tpo eanstiboiofticiss. Tohlea rteed-sco. loYrede lcellolsw alsoc ells indicate GNB
that are resistant tdoepaictn wthibichi ogetniecss t,hew isohlaitel shtarbbolrus, eands thheo gwreesn-csoulosrecde cpelltsi dbeipliictt ythe taobseancne toifb a igoentei cins . The red-colored
the isolate. NOTE: 1–31—Non duplicate isolates. AMP—ampicillin; CTX—cefotaxime; NOR—nor-
cells also depict whfloixcahcing; CeAnZe—scetfhtaezidiismoe;l aERteT—heratarpbenoerms; ,FaOnX—dcetfhoxeiting; rCeXeMn—-cceofulrooxrimeed, ScXeTl—lstrimdee-pict the absence of
thoprim sulphamethozaxole. 
a gene in the isolate. NOTE: 1–31—Non duplicate isolates. AMP—ampicillin; CTX—cefotaxime;
NOR—norfloxacin;3.C DAiscZus—siocne ftazidime; ERT—ertapenem; FOX—cefoxitin; CXM—cefuroxime, SXT—
This study found high levels of β-lactamase genes among GNB. The finding that E. 
trimethoprim sulphcoalim aned tKh. ponzeuamxoonilae .were the predominant GNB is similar to previous studies conducted 
in the country [4] as well as other parts of the world [3]. These organisms have been asso-
ciated with antibiotic resistance and implicated in series of infections associated with high 
morbidity and mortality rates [24]. 
The most effective antibiotic in the study was cefoxitin. Cefoxitin, a cephamycin/sec-
ond-generation cephalosporin, is known to exhibit bactericidal actions against GNB and 
is very potent in vitro against ESBL producers [25]. All the ESBL-producing GNB in our 
study, except one, were susceptible to cefoxitin. It is known to be a suitable alternative for 
carbapenems in infection treatment [25]. A substantial proportion of the study isolates 
were susceptible to fluoroquinolone, contrary to other studies in the country [26] and else-
where (Nigeria, Tanzania and Rwanda) [27–29]. Our findings could be an indication that 
such a class of antibiotic might still be relevant in the treatment of GNB-associated infec-
tions in Ghana. 
The proportion (22%) of ESBL phenotypes observed among the Enterobacterales is 
in line with studies in the country [30] and in other parts of the world [31,32], with E. coli 
and K. pneumoniae as frequent ESBL producers. The most predominant ESBL gene was 
blaCTX-M (81%), which is the case globally [33–35]. On the contrary, blaTEM was the predom-
inant gene in a recent study in Ghana [30] and Nigeria [36]. The presence of blaCTX-M 
Antibiotics 2023, 12, 1016 6 of 11
3. Discussion
This study found high levels of β-lactamase genes among GNB. The finding that E.
coli and K. pneumoniae were the predominant GNB is similar to previous studies conducted
in the country [4] as well as other parts of the world [3]. These organisms have been
associated with antibiotic resistance and implicated in series of infections associated with
high morbidity and mortality rates [24].
The most effective antibiotic in the study was cefoxitin. Cefoxitin, a cephamycin/second-
generation cephalosporin, is known to exhibit bactericidal actions against GNB and is very
potent in vitro against ESBL producers [25]. All the ESBL-producing GNB in our study,
except one, were susceptible to cefoxitin. It is known to be a suitable alternative for car-
bapenems in infection treatment [25]. A substantial proportion of the study isolates were
susceptible to fluoroquinolone, contrary to other studies in the country [26] and elsewhere
(Nigeria, Tanzania and Rwanda) [27–29]. Our findings could be an indication that such
a class of antibiotic might still be relevant in the treatment of GNB-associated infections
in Ghana.
The proportion (22%) of ESBL phenotypes observed among the Enterobacterales
is in line with studies in the country [30] and in other parts of the world [31,32], with
E. coli and K. pneumoniae as frequent ESBL producers. The most predominant ESBL gene
was blaCTX-M (81%), which is the case globally [33–35]. On the contrary, blaTEM was the
predominant gene in a recent study in Ghana [30] and Nigeria [36]. The presence of
blaCTX-M represents a significant public health threat since isolates harboring this gene
co-harbor extra antimicrobial resistance genes making them resistant to a wide range of
antimicrobials [37]. This is particularly worrying since these drugs are part of treatment
regimens for the management of infections in Ghana [8]. The co-harboring of blaCTX-M and
other genes could foster the growth and dissemination pathogens with multiple resistance
genes in the country [37].
The finding of greater proportions of AmpC-producing GNB being MDRs was ex-
pected since the presence of AmpC β-lactamases is accompanied with resistance to first to
third-generation cephalosporins, including cephymacins. It is known that AmpC enzymes
may disguise the true effect of ESBLs and their identification in a bacteria strain, thus
complicating the treatment of infections caused by bacteria co-harboring both genes [38].
In this study, E. coli co-harbored AmpC and ESBL (blaTEM and blaDHA-M) genes; likewise, K.
pneumoniae co-harbored AmpC and carbapenemase genes ((blaFOX-M + blaEBC-M) + (blaKPC +
blaOXA-48)), which has also been observed in studies in Egypt [38] and Nigeria [39].
Carbapenems are the drug of choice for the treatment of severe infections [39]. In our
study, the carbapenem-tested ertapenem was one of the most effective antibiotics, and this
is an assurance that this drug class is still effective. However, the blaKPC gene, which is
known to hydrolyze carbapenems and was initially identified in the north-eastern part
of the US, has now spread throughout the US and most of the world [40]. Our study
isolated carbapenem-resistant K. pneumoniae co-harboring blaKPC and blaOXA-48. To the best
of our knowledge, this is one of two studies in the country to record a dual detectable
carbapenemase gene (blaKPC and blaOXA-48) in a single carbapenem-resistant K. pneumoniae
strain [41]. The presence of blaOXA-48 and blaNDM among GNB has been reported in other
studies in Ghana [42]. Furthermore, we observed that the carbapenem-resistant A. baumanii
(crAb) isolated from a blood culture harbored a blaOXA-48 gene in this study. In Ghana,
Monheimer and colleagues identified crAb (77%) that harbored blaOXA-23, and blaNDM
genes [43]. Carbapenem-resistant A. baumannii are among the WHO-prioritized organisms
under surveillance worldwide since they are associated with life-threatening infections and
the frequent carriage of multi-drug resistance [17]. Their isolation from a blood sample
means that such a patient will not respond to the routinely used antimicrobials. Meanwhile,
data are still limited in this part of Africa on the characteristics of this pathogen [44]. As far
as we know, this is the first report of a blaOXA-48 crAb recovered from a blood culture in the
country. In this study, there was one K. pneumoniae strain that co-harbored carbapenemase
(blaKPC + blaOXA-48) and AmpC genes (blaFOX-M + blaEBC-M). Kaizeman in Iran had a similar
Antibiotics 2023, 12, 1016 7 of 11
result, but his K. pneumoniae isolates harbored ESBL genes (blaCTX-M, blaTEM and blaSHV)
and a blaVIM carbapenemase gene [45].
The ability to harbor multiple resistance genes by GNB gives them the advantage to
thrive longer in healthy individuals or the environment or cause infections in immune-
compromised victims. The resistant genes identified in this study fail infection control
systems and subsquently lead to dire outcomes [17]. There is the need to improve infec-
tion control measures, strengthen antimicrobial resistance surveillance and identify new
treatment strategies in order to mitigate this problem.
4. Materials and Methods
4.1. Identification of Bacteria
This study analyzed 181 archived GNB recovered from clinical sources from April
2017 to April 2018 as a form of laboratory surveillance of antimicrobial resistance and
β-lactamase production. Isolates originated from urine (n = 114), wounds (n = 38), blood
(n = 21), throat swabs (n = 4), stools (n = 3), and an ear swab from humans (outpatients
and inpatients) with diverse infections. The isolates were sub-cultured on blood and Mac-
Conkey agar. The identification and confirmation of bacteria species was achieved using
matrix-assisted laser desorption/ionization time of flight (MALDI-TOF)–mass spectrom-
etry (Bruker Daltonics, Bremen, Germany) using Biotyper™ system 2.0 software at the
genus (log(score) 1.7–2.0)) and species (log(score) ≥ 2.0) level.
4.2. Antimicrobial Susceptibility Testing
Kirby–Bauer disk diffusion was performed using the 0.5 McFarland standard of bac-
teria suspension seeded into Mueller–Hinton agar plates. The antibiotics tested included
ampicillin (10 µg), cefotaxime (30 µg), norfloxacin (10 µg), ceftazidime (30 µg), ertapenem
(10 µg), cefoxitin (30 µg) and cefuroxime (30 µg). The measured zone sizes were inter-
preted according to the Clinical and Laboratory Standard (CLSI, M100, 26th ed, 2018)
guidelines (CLSI 2018). P. aeruginosa was tested against gentamicin (10 µg), cefepime
(30 µg), ceftazidime (30 µg), ciprofloxacin (5 µg), piperacillin tazobactam (110 µg), amikacin
(30 µg) and meropenem (10 µg). Pseudomonas stutzeri and Acinetobacter spp. were tested
against 11 antibiotics in a microbroth dilution using the MicroScan autoSCAN-4-System
with the NC 66 panel (Beckman Coulter Life Sciences, Indianapolis, IN, USA) following the
manufacturer’s instructions. K. pneumoniae ATCC 700603 and E. coli ATCC 25922 were used
as control strains in the evaluation of the performance of the tests. An MDR phenotype
was defined as non-susceptibility to ≥1 agent in ≥3 antimicrobial categories [46]. Isolates
with non-susceptibility to 3rd-generation cephalosporins were examined for the possible
presence of AmpCs and ESBLs according to the CLSI guideline.
4.3. Phenotypic Screening for AmpC, ESBL and Carbapenem Resistance
Investigations for AmpC, ESBL and carbapenemases were only carried out for En-
terobacterales. Other GNB were screened for carbapenemase production. Using the disk
diffusion assay, the presumptive detection of AmpC was performed by observing reduced
susceptibility (inhibition zone < 18 mm) to cefoxitin (30 µg). The expression of ESBLs was
ascertained via the combined double-disk method using cefotaxime (30 µg) and ceftazidime
(30 µg) alone and in combination with clavulanic acid (10 µg). An inhibition zone difference
of ≥5 mm between the single and the clavulanic acid combination disks for cefotaxime and
ceftazidime confirmed ESBL expression. Isolates resistant to ertapenem (10 µg) (inhibition
zone ≤ 15 mm) were deemed possible carbapenemase producers. These isolates were
subjected to a confirmatory test using the Modified Hodges Test (MHT) and the modified
Carbapenem Inactivation Method (mCIM) according to the CLSI guidelines. K. pneumo-
niae ATCC BAA 1705 and E. coli ATCC 25922 strains were used as positive and negative
controls, respectively.
Antibiotics 2023, 12, 1016 8 of 11
4.4. Molecular Detection of Antimicrobial-Resistant Gene Markers of Beta-Lactamases
Isolates that tested positive for AmpC, ESBL, or carbapenemase phenotypes were
subjected to PCR to confirm the genes encoding for AmpC (blaMOX-M, blaACC-M, blaEBC-M,
blaFOX-M, blaCIT-M and blaDHA-M) [47], ESBLs (blaCTX-M) [48], carbapenemases (blaKPC, blaNDM,
blaVIM, blaIMP and blaOXA-48) [49], and other β-lactamase genes (blaTEM and blaSHV) [48] with
slight modifications. Crude DNA (10 µL) was extracted from pure overnight cultures and
suspended in 200µL of molecular-grade nuclease-free water, heated for 10 min at 98 ◦C, and
centrifuged for 5 min at 4 ◦C and 20,000 g, as previously suggested by Quansah [42]. The
supernatant was transferred into sterile 1.5 mL Eppendorf® tubes and used as a template for
the PCR. For the PCR amplification, each reaction mix of 25 µL consisted of 12.5 uL of Green
PCR Master Mix (2×) (DreamTaq, Thermo Scientific, Waltham, MA, USA), 4.5 µL of primer
mix, 6 µL of molecular-grade nuclease-free water and 2 µL of crude DNA template, as pre-
viously demonstrated by Khurana et al., 2018 [49]. The primers used for PCR amplification
and cycling conditions are listed in Table 4. All PCR amplicons were analyzed via hori-
zontal gel-electrophoresis in a 2% (weight/volume) agarose gel (SeaKem®GTG®Agarose,
Lonza, Basel, Switzerland) using Tris/Acetate/EDTA 50× concentrate buffer.
Table 4. PCR amplification: primer sequences and cycling conditions.
Gene Primers (5′-3′) Size(Bp) Cycling Conditions References
ESBL
Initial denaturation at 95 ◦C
CTX-M FP: GAAGGTCATCAAGAAGGTGCGRP: GCATTGCCACGCTTTTCATAG 560 for 5 min, followed by 30
OTHER BETA-LACTAMASE cycles of denaturation at 95 ◦C
SHV FP: GTCAGCGAAAAACACCTTGCC
for 30 s, primer annealing at 60
RP: GTCTTATCGGCGATAAACCAG 383 ◦
[48]
C for 30 s, extension at 72 ◦C
TEM FP: GAGACAATAACCCTGGTAAAT
for 2 min and a final
RP: AGAAGTAAGTTGGCAGCAGTG 420 elongation temperature at
72 ◦C for 10 min.
CARBAPENEMASE
KPC FP: ATGTCACTGTATCGCCGTCRP: AATCCCTCCGAGCGCGAG 863 Amplification was carried out
FP: GCTTGATCGCCCTCGATT at 94 ◦C for 3 min as the initialOXA-48 RP: GATTTGCTCCGTGGCCGAAA 281 step for denaturation,
IMP FP: GGCAGTCGCCCTAAAACAAA
followed by 35 cycles of
RP: TAGTTACTTGGCTGTGATGG 737 denaturation at 94 ◦C for 30 s, [49]
FP: AAAGTTATGCCGCACTCACC annealing at 61.6 ◦C for 30 sVIM RP: TGCAACTTCATGTTATGCCG 865 and extension at 72 ◦C for
FP: GGTGCATGCCCGGTGAAATC 1 min. Final elongation was atNDM RP: ATGCTGGCCTTGGGGAACG 660 72 ◦C for 7 min.
AMPC
MOXM FR: GCTGCTCAAGGAGCACAGGATRP: CACATTGACATAGGTGTGGTGC 520
CITM FR: TGGCCAGAACTGACAGGCAAA Amplification was carried outRP: TTT CTC CTG AAC GTG GCT GGC 462 at 94 ◦C for 15 min as the
DHAM FR: AACTTTCACAGGTGTGCTGGGTRP: CCGTACGCATACTGGCTTTGC 405
initial step for denaturation,
25 cycles of denaturation at 94
FP: AACATGGGGTATCAGGGAGATG ◦C for 30 s, annealing at 64 ◦C [47]FOXM RP: CAAAGCGCGTAACCGGATTGG 190 for 90 s and extension at 72 ◦C
ACCM FP: AACAGCCTCAGCAGCCGGTTA for 60 s. Final elongation wasRP: TTCGCCGCAATCATCCCTAGC 346 at 72 ◦C for 10 min.
EBCM FR: TCGGTAAAGCCGATGTTGCGGRP: CTTCCACTGCGGCTGCCAGTT 302
4.5. Data Analysis
Data from laboratory investigations were entered into a Microsoft Excel (version 2304)
database for editing and analyses. Categorical variables were summarized with frequencies
and percentages.
Antibiotics 2023, 12, 1016 9 of 11
5. Conclusions
We show in this study that GNB are frequently resistant to antimicrobials and harbor
genes for β-lactamases such as AmpCs, ESBLs and carbapenemases which are significant
determinants of antimicrobial resistance. The finding of blaKPC and blaOXA-48 producing
GNB is worrying, especially in the absence of the routine detection of these pathogens
in most of the clinical microbiology laboratories in the country. The study results further
support the need for efficient AMR surveillance systems at local and national levels to mon-
itor the rise and spread of these beta-lactamase-producers and other multi-drug resistant
pathogens in the country.
6. Limitations
Not all the classes of AmpC, ESBLs and carbapenemase genes were screened using
PCR. Thus, resistant isolates harboring other relevant resistance genes were not identified.
Because the genomes of the isolates were not sequenced, the specific types of TEM and
SHV β-lactamase, as well as the OXA-48 identified in A. baumannii, were not determined.
Author Contributions: Conceptualization, B.E., N.O.-N. and F.A.O.; methodology, F.A.O., B.E. and
N.O.-N.; validation, B.E., F.A.O., E.G., N.O.-N., N.T.K.D.D. and S.K.; formal analysis, F.A.O., B.E.
and N.O.-N.; investigation, F.A.O., E.G., S.K., B.K.A.T., R.T., N.T.K.D.D., N.O.-N., J.A.O. and B.E.;
resources, B.E. and N.O.-N.; data curation, F.A.O., E.G., B.E., N.O.-N. and S.K.; writing—original draft
preparation, F.A.O. and B.E.; writing—review and editing, B.E., F.A.O., E.G., S.K., N.O.-N., J.A.O. and
N.T.K.D.D.; visualization, F.A.O., N.O.-N. and B.E.; supervision, B.E., J.A.O. and N.O.-N.; project
administration, B.E.; funding acquisition, B.E. All authors have read and agreed to the published
version of the manuscript.
Funding: Funding (project code: RY89) to cover article processing fee was received from the Carnegie
Corporation of New York. This support was provided to Beverly Egyir, a Fellow under the Cambridge
Africa Partnership for Research Excellence (CAPREx).
Institutional Review Board Statement: Ethical approval for the study was received from the Institu-
tional Review Board (IRB) of Noguchi Memorial Institute for Medical Research (Protocol number:
109/15-16) and University of Ghana Ethical and Protocol Review Committee, College of Health
Sciences (Protocol number: CHS-Et/M.I-P.2.13/2017-2018).
Informed Consent Statement: This study investigated archived isolates previously collected and
de-identified and therefore obtaining an informed consent was not applicable.
Data Availability Statement: The data used/analyzed in this study can be made available by the
corresponding author on request.
Acknowledgments: The authors are grateful to the staff of Africa AMR Hub at Noguchi Memorial
Institute for Medical Research, University of Ghana, for their contribution to/support of the study.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. De Oliveira DM, P.; Forde, B.M.; Kidd, T.J.; Harris PN, A.; Schembri, M.A.; Beatson, S.A.; Paterson, D.L.; Walker, M.J. Antimicrobial
Resistance in ESKAPE Pathogens. Clin. Microbiol. Rev. 2020, 33, e00181-19. [CrossRef] [PubMed]
2. Habeeb, M.A.; Sarwar, Y.; Ali, A.; Salman, M.; Haque, A. Rapid emergence of ESBL producers in E. coli causing urinary and
wound infections in Pakistan. Pak. J. Med. Sci. 2013, 29, 540. [CrossRef] [PubMed]
3. Ibrahim, M.E.; Abbas, M.; Al-Shahrai, A.M.; Elamin, B.K. Phenotypic Characterization and Antibiotic Resistance Patterns of
Extended-Spectrum β-Lactamase- and AmpC β-Lactamase-Producing Gram-Negative Bacteria in a Referral Hospital, Saudi
Arabia. Can. J. Infect. Dis. Med. Microbiol. 2019, 2019, 6054694. [CrossRef]
4. Obeng-Nkrumah, N.; Twum-Danso, K.; Krogfelt, K.A.; Newman, M.J. High Levels of Extended-Spectrum Beta-Lactamases in a
Major Teaching Hospital in Ghana: The Need for Regular Monitoring and Evaluation of Antibiotic Resistance. Am. J. Trop. Med.
Hyg. 2013, 89, 960–964. [CrossRef]
5. Bush, K. Proliferation and significance of clinically relevant β-lactamases. Ann. N.Y. Acad. Sci. 2013, 1277, 84–90. [CrossRef]
[PubMed]
6. Abdalhamid, B.; Albunayan, S.; Shaikh, A.; Elhadi, N.; Aljindan, R. Prevalence study of plasmid-mediated AmpC β-lactamases in
Enterobacteriaceae lacking inducible ampC from Saudi hospitals. J. Med. Microbiol. 2017, 66, 1286–1290. [CrossRef]
Antibiotics 2023, 12, 1016 10 of 11
7. Mata, C.; Miró, E.; Rivera, A.; Mirelis, B.; Coll, P.; Navarro, F. Prevalence of acquired AmpC β-lactamases in Enterobacteriaceae
lacking inducible chromosomal ampC genes at a Spanish hospital from 1999 to 2007. Clin. Microbiol. Infect. 2010, 16, 472–476.
[CrossRef]
8. Codjoe, F.; Donkor, E. Carbapenem Resistance: A Review. Med. Sci. 2017, 6, 1. [CrossRef]
9. Reuland, E.A.; al Naiemi, N.; Raadsen, S.A.; Savelkoul, P.H.M.; Kluytmans, J.A.J.W.; Vandenbroucke-Grauls, C.M.J.E. Prevalence
of ESBL-producing Enterobacteriaceae in raw vegetables. Eur. J. Clin. Microbiol. Infect. Dis. 2014, 33, 1843–1846. [CrossRef]
10. Ghafourian, S.; Sadeghifard, N.; Soheili, S.; Sekawi, Z. Extended Spectrum Beta-lactamases: Definition, Classification and
Epidemiology. Curr. Issues Mol. Biol. 2015, 17, 11–21. [CrossRef]
11. Hijazi, S.M.; Fawzi, M.A.; Ali, F.M.; Abd El Galil, K.H. Multidrug-resistant ESBL-producing Enterobacteriaceae and associated
risk factors in community infants in Lebanon. J. Infect. Dev. Ctries. 2016, 10, 947–955. [CrossRef] [PubMed]
12. WHO. Prioritization of Pathogens to Guide Discovery, Research and Development of New Antibiotics for Drug-Resistant Bacterial Infections,
Including Tuberculosis; WHO: Geneva, Switzerland, 2017; pp. 1–88.
13. Bradford, P.A. Extended-Spectrum β-Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of This
Important Resistance Threat. Clin. Microbiol. Rev. 2001, 14, 933–951. [CrossRef] [PubMed]
14. Lukac, P.J.; Bonomo, R.A.; Logan, L.K. Extended-Spectrum-Lactamase-Producing Enterobacteriaceae in Children: Old Foe,
Emerging Threat. Clin. Infect. Dis. 2015, 60, 1389–1397. [CrossRef] [PubMed]
15. Paterson, D.L.; Ko, W.-C.; von Gottberg, A.; Mohapatra, S.; Casellas, J.M.; Goossens, H.; Mulazimoglu, L.; Trenholme, G.;
Klugman, K.P.; Bonomo, R.A.; et al. Antibiotic Therapy for Klebsiella pneumoniae Bacteremia: Implications of Production of
Extended-Spectrum-Lactamases. Clin. Infect. Dis. 2004, 39, 31–37. [CrossRef] [PubMed]
16. Meletis, G. Carbapenem resistance: Overview of the problem and future perspectives. Ther. Adv. Infect. Dis. 2016, 3, 15–21.
[CrossRef]
17. Papp-Wallace, K.M.; Endimiani, A.; Taracila, M.A.; Bonomo, R.A. Carbapenems: Past, Present, and Future. Antimicrob. Agents
Chemother. 2011, 55, 4943–4960. [CrossRef]
18. Livermore, D.M.; Woodford, N. The β-lactamase threat in Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends Microbiol.
2006, 14, 413–420. [CrossRef]
19. Halat, D.H.; Moubareck, C.A. The current burden of Carbapenemases: Review of significant properties and dissemination among
gram-negative bacteria. Antibiotics 2020, 9, 186. [CrossRef]
20. Schultsz, C.; Geerlings, S. Plasmid-Mediated Resistance in Enterobacteriaceae. Drugs 2012, 72, 1–16. [CrossRef]
21. Bedenić, B.; Plečko, V.; Sardelić, S.; Uzunović, S.; Godič Torkar, K. Carbapenemases in Gram-Negative Bacteria: Laboratory
Detection and Clinical Significance. BioMed Res. Int. 2014, 2014, 841951. [CrossRef]
22. Moquet, O.; Bouchiat, C.; Kinana, A.; Seck, A.; Arouna, O.; Bercion, R.; Breurec, S.; Garin, B. Class D OXA-48 Carbapenemase in
Multidrug-Resistant Enterobacteria, Senegal. Emerg. Infect. Dis. 2011, 17, 143–144. [CrossRef] [PubMed]
23. Osei, M.-M.; Dayie, N.T.K.D.; Azaglo, G.S.K.; Tettey, E.Y.; Nartey, E.T.; Fenny, A.P.; Manzi, M.; Kumar, A.M.v.; Labi, A.-K.; Opintan,
J.A.; et al. Alarming Levels of Multidrug Resistance in Aerobic Gram-Negative Bacilli Isolated from the Nasopharynx of Healthy
Under-Five Children in Accra, Ghana. Int. J. Environ. Res. Public Health 2022, 19, 10927. [CrossRef] [PubMed]
24. Donkor, E.S.; Horlortu, P.Z.; Dayie, N.T.; Obeng-Nkrumah, N.; Labi, A.-K. Community acquired urinary tract infections among
adults in Accra, Ghana. Infect. Drug Resist. 2019, 12, 2059–2067. [CrossRef] [PubMed]
25. Mambie, A.; Vuotto, F.; Poitrenaud, D.; Weyrich, P.; Cannesson, O.; Dessein, R.; Faure, K.; Guery, B.; Galpérine, T. Cefoxitin: An
alternative to carbapenems in urinary tract infections due to extended-spectrum beta-lactamase-producing Enterobacteriaceae.
Med. Et Mal. Infect. 2016, 46, 215–219. [CrossRef]
26. Aldrich, C.; Hartman, H.; Feasey, N.; Chattaway, M.A.; Dekker, D.; Al-Emran, H.M.; Larkin, L.; McCormick, J.; Sarpong, N.; le
Hello, S.; et al. Emergence of phylogenetically diverse and fluoroquinolone resistant Salmonella Enteritidis as a cause of invasive
nontyphoidal Salmonella disease in Ghana. PLoS Negl. Trop. Dis. 2019, 13, e0007485. [CrossRef]
27. Leopold, S.J.; van Leth, F.; Tarekegn, H.; Schultsz, C. Antimicrobial drug resistance among clinically relevant bacterial isolates in
sub-Saharan Africa: A systematic review. J. Antimicrob. Chemother. 2014, 69, 2337–2353. [CrossRef]
28. Kumburu, H.H.; Sonda, T.; Mmbaga, B.T.; Alifrangis, M.; Lund, O.; Kibiki, G.; Aarestrup, F.M. Patterns of infections, aetiological
agents and antimicrobial resistance at a tertiary care hospital in northern Tanzania. Trop. Med. Int. Health 2017, 22, 454–464.
[CrossRef]
29. Ntirenganya, C.; Muvunyi, C.M.; Manzi, O.; Ogbuagu, O. High Prevalence of Antimicrobial Resistance Among Common Bacterial
Isolates in a Tertiary Healthcare Facility in Rwanda. Am. J. Trop. Med. Hyg. 2015, 92, 865–870. [CrossRef]
30. Dela, H.; Egyir, B.; Majekodunmi, A.O.; Behene, E.; Yeboah, C.; Ackah, D.; Bongo, R.N.A.; Bonfoh, B.; Zinsstag, J.; Bimi, L.; et al.
Diarrhoeagenic E. coli occurrence and antimicrobial resistance of Extended Spectrum Beta-Lactamases isolated from diarrhoea
patients attending health facilities in Accra, Ghana. PLoS ONE 2022, 17, e0268991. [CrossRef]
31. Ouedraogo, A.-S.; Sanou, M.; Kissou, A.; Sanou, S.; Solaré, H.; Kaboré, F.; Poda, A.; Aberkane, S.; Bouzinbi, N.; Sano, I.; et al.
High prevalence of extended-spectrum ß-lactamase producing enterobacteriaceae among clinical isolates in Burkina Faso. BMC
Infect. Dis. 2016, 16, 326. [CrossRef]
32. Nakayama, T.; Ueda, S.; Huong BT, M.; Tuyen, L.D.; Komalamisra, C.; Kusolsuk, T.; Hirai, I.; Yamamoto, Y. Wide dissemination of
extended-spectrum&beta;-lactamase-producing Escherichia coli in community residents in the Indochinese peninsula. Infect.
Drug Resist. 2015, 12, 3317–3325. [CrossRef]
Antibiotics 2023, 12, 1016 11 of 11
33. Duval, V.; Maiga, I.; Maiga, A.; Guillard, T.; Brasme, L.; Forte, D.; Madoux, J.; Vernet-Garnier, V.; de Champs, C. High prevalence
of CTX-M-type beta-lactamases among clinical isolates of enterobacteriaceae in Bamako, Mali. Antimicrob Agents Chemother 2009,
53, 4957–4958. [CrossRef] [PubMed]
34. Doi, Y.; Park, Y.S.; Rivera, J.I.; Adams-Haduch, J.M.; Hingwe, A.; Sordillo, E.M.; Lewis, J.S.; Howard, W.J.; Johnson, L.E.; Polsky,
B.; et al. Community-Associated Extended-Spectrum β-Lactamase–Producing Escherichia coli Infection in the United States. Clin.
Infect. Dis. 2013, 56, 641–648. [CrossRef] [PubMed]
35. Peirano, G.; van Greune, C.H.J.; Pitout, J.D.D. Characteristics of infections caused by extended-spectrum β-lactamase–producing
Escherichia coli from community hospitals in South Africa. Diagn. Microbiol. Infect. Dis. 2011, 69, 449–453. [CrossRef] [PubMed]
36. Chukwu, E.E.; Awoderu, O.B.; Enwuru, C.A.; Afocha, E.E.; Lawal, R.G.; Ahmed, R.A.; Olanrewaju, I.; Onwuamah, C.K.; Audu,
R.A.; Ogunsola, F.T. High prevalence of resistance to third-generation cephalosporins detected among clinical isolates from
sentinel healthcare facilities in Lagos, Nigeria. Antimicrob. Resist. Infect. Control 2022, 11, 134. [CrossRef] [PubMed]
37. Agyekum, A.; Fajardo-Lubián, A.; Ansong, D.; Partridge, S.R.; Agbenyega, T.; Iredell, J.R. blaCTX-M-15 carried by IncF-type
plasmids is the dominant ESBL gene in Escherichia coli and Klebsiella pneumoniae at a hospital in Ghana. Diagn. Microbiol. Infect.
Dis. 2016, 84, 328–333. [CrossRef]
38. Shaaban, M.; Elshaer, S.L.; Abd El-Rahman, O.A. Prevalence of extended-spectrum β-lactamases, AmpC, and carbapenemases in
Proteus mirabilis clinical isolates. BMC Microbiol. 2022, 22, 247. [CrossRef] [PubMed]
39. Yusuf, I.; Haruna, M.; Yahaya, H. Prevalence and antibiotic susceptibility of AmpC and ESBLs producing clinical isolates at a
tertiary health care center in Kano, north-west Nigeria. Afr. J. Clin. Exp. Microbiol. 2013, 14, 109–119. [CrossRef]
40. Arnold, R.S.; Thom, K.A.; Sharma, S.; Phillips, M.; Kristie Johnson, J.; Morgan, D.J. Emergence of Klebsiella pneumoniae
Carbapenemase-Producing Bacteria. South. Med. J. 2011, 104, 40–45. [CrossRef]
41. Codjoe, F.S. Detection and Characterisation of Carbapenem-Resistant Gram-Negative Bacilli Infections in Ghana. Ph.D. Thesis,
Sheffield Hallam University, Sheffield, UK, 2016.
42. Quansah, E.; Amoah Barnie, P.; Omane Acheampong, D.; Obiri-Yeboah, D.; Odarkor Mills, R.; Asmah, E.; Cudjoe, O.; Dadzie, I.
Geographical Distribution of β-Lactam Resistance among Klebsiella spp. from Selected Health Facilities in Ghana. Trop. Med.
Infect. Dis. 2019, 4, 117. [CrossRef]
43. Monnheimer, M.; Cooper, P.; Amegbletor, H.K.; Pellio, T.; Groß, U.; Pfeifer, Y.; Schulze, M.H. High Prevalence of Carbapenemase-
Producing Acinetobacter baumannii in Wound Infections, Ghana, 2017/2018. Microorganisms 2021, 9, 537. [CrossRef] [PubMed]
44. Codjoe, F.S.; Brown, C.A.; Smith, T.J.; Miller, K.; Donkor, E.S. Genetic relatedness in carbapenem-resistant isolates from clinical
specimens in Ghana using ERIC-PCR technique. PLoS ONE 2019, 14, e0222168. [CrossRef] [PubMed]
45. Kazemian, H.; Heidari, H.; Ghanavati, R.; Ghafourian, S.; Yazdani, F.; Sadeghifard, N.; Valadbeigi, H.; Maleki, A.; Pakzad,
I. Phenotypic and Genotypic Characterization of ESBL-, AmpC-, and Carbapenemase-Producing Klebsiella pneumoniae and
Escherichia coli Isolates. Med. Princ. Pract. 2019, 28, 547–551. [CrossRef] [PubMed]
46. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.;
Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert
proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [CrossRef]
47. Obeng-Nkrumah, N.; Labi, A.K.; Blankson, H.; Awuah-Mensah, G.; Oduro-Mensah, D.; Anum, J.; Teye, J.; Kwashie, S.D.; Bako, E.;
Ayeh-Kumi, P.F.; et al. Household cockroaches carry CTX-M-15-, OXA-48- And NDM-1-producing enterobacteria, and share
beta-lactam resistance determinants with humans. BMC Microbiol. 2019, 19, 1–11. [CrossRef] [PubMed]
48. Sharma, M. Prevalence and antibiogram of Extended Spectrum β-Lactamase (ESBL) producing Gram negative bacilli and further
molecular characterization of ESBL producing Escherichia coli and Klebsiella spp. J. Clin. Diagn. Res. 2013, 7, 2173–2177.
[CrossRef]
49. Khurana, S.; Mathur, P.; Kapil, A.; Valsan, C.; Behera, B. Molecular epidemiology of beta-lactamase producing nosocomial
Gram-negative pathogens from North and South Indian hospitals. J. Med. Microbiol. 2017, 66, 999–1004. [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.