UNIVERSITY OF GHANA COLLEGE OF HEALTH SCIENCES EXTENDED SPECTRUM BETA-LACTAMASE IN CLINICAL ISOLATES OF ESCHERICHIA COLI AND KLEBSIELLA PNEUMONIAE FROM THE TAMALE TEACHING HOSPITAL BY FRANCIS KWAME MORGAN TETTEH (10207184) THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN PARTIAL FULFILMENT OF THE REQUIREMENT FOR THE AWARD OF MASTER OF PHILOSOPHY IN MICROBIOLOGY JULY, 2015 University of Ghana http://ugspace.ug.edu.gh i DECLARATION This is to certify that this thesis is the result of research undertaken by Francis Kwame Morgan Tetteh towards the award of the Masters of Philosophy in Microbiology in the Department of Medical Microbiology, School of Biomedical and Allied Health Sciences, College of Health Sciences, University of Ghana. References to the works of other investigators have been duly acknowledged. Signature--------------------------------------- Date---------------------------------- Francis Kwame Morgan Tetteh (Candidate) Signature--------------------------------------- Date--------------------------------- Dr. J.A. Opintan (Supervisor) Signature------------------------------------ Date--------------------------------- Dr. A. Ablordey (Supervisor) University of Ghana http://ugspace.ug.edu.gh ii ABSTRACT BACKGROUND: Extended Spectrum Beta-Lactamase (ESBL) producing Escherichia coli and Klebsiella pneumoniae are pathogens of significant public health interest to which new antibiotics therapies are urgently needed. AIM: This study was designed to determine the prevalence of ESBLs in clinical isolates of E. coli and K. pneumoniae from patients attending the Tamale Teaching Hospital (TTH). METHODOLOGY: The study was conducted from April through June, 2015. A total of 140 isolates of E. coli (83.6%; n=117) and K. pneumoniae (16.4%; n=23) were cultured from clinical specimens of consenting patients. Antimicrobial susceptibility were determined using the Kirby- Bauer disc diffusion method. Screening and confirmation of ESBL-producing phenotypes among the clinical isolates were performed according to the guidelines of the Clinical and Laboratory Standard Institute (CLSI, 2012). Escherichia coli and K. pneumoniae positive for ESBL phenotype were examined for the presence of TEM, SHV and CTX-M genes. RESULTS: Sixty two (44.3%) of the 140 isolates phenotypically expressed ESBLs. Of these, 83.9% (n=52) were E. coli and 16.1% (n=10) were K. pneumoniae isolates. The proportion of ESBL- producing isolates were found to be relatively higher in adults (15-65 years) than in neonates (< 28 days) (p=0.14). Majority of the isolates showed high percentage resistance to ampicillin (96%) and tetracycline (89%), but relatively low for amikacin (36%). None of the isolates were resistant to meropenem. Extended Spectrum Beta-Lactamase (ESBL)-producers were multidrug resistant compared to non-ESBL-producers (23%, n=14/62 versus 18% n=14/78; p=0.573). Overall, 74.2% (n=46/62) of the ESBL genotypes expressed BlaCTX-M-1 genes followed by 62.9% (n=39/62) BlaTEM University of Ghana http://ugspace.ug.edu.gh iii and 16.1% (n=10/62) BlaSHV. Two (3.2%) isolates had both TEM and SHV genes, 29 (46.8%) harboured TEM and CTX-M-1, 2 (3.2%) had SHV and CTXM-1, while 4 (6.5%) harboured all three genes. None expressed genes for CTX-M 2 and CTX-M 9. In univariate comparisons, patients who reported their previous medication as having been prescribed by a Physician and those who reportedly completed their previous medication were more likely to be infected by ESBL organisms. CONCLUSION: The study showed high ESBL positive E. coli and K. pneumoniae, mostly CTX- M-1 producers in Tamale Teaching Hospital. Routine laboratory ESBL detection is warranted. University of Ghana http://ugspace.ug.edu.gh iv DEDICATION “Now thank we all our God” (MHB 10). I dedicate this work to the almighty God, for He is true. Also to my lovely wife Trudy Janice Tetteh and our daughter Kayleigh Tetteh. University of Ghana http://ugspace.ug.edu.gh v ACKNOWLEDGEMENTS “Gracious God, to Thee we raise, this our sacrifice of praise” (MHB 35). I ascribe all thanks and praise to the Almighty God for seeing me through the period of study. It was not easy but it was worth it. I am very grateful to all who helped me accomplished this study. My sincere gratitude goes to my supervisors, Dr. Japheth Awuletey Opintan and Dr. Anthony Ablordey for their immense contribution, support, direction and enlightenment throughout this work. I appreciate your valuable advice, insight and time throughout the period. I would like to express my deepest thanks to Mr. Noah Obeng-Nkrumah for his immense expertise, brotherly support and mentorship throughout this work. I appreciate you very much. Special thanks also goes to Mr. Abdul-Rahman Mubarak (Immunology department, UG, Korle-Bu), Mr. Evans Ahortor and Shirley Simpson (Noguchi Memorial Institute for Medical Research - NMIMR, Legon) for their immense expertise and support in the course of the work. My sincere thanks goes to all staff of the Microbiology department (TTH), all staff of the Department of Medical Microbiology, School of Biomedical and Allied Health Sciences, Korle-Bu, all staff of the Bacteriology and Virology Department (NMIMR, Legon) and all staff of the Bacteriology Department, 37 Military Hospital, Accra for the good working environment created for me and the technical support provided me throughout the work. Finally, I am highly grateful to the Noguchi Postdoctoral Master’s Program for funding this academic research work. Thank you all. University of Ghana http://ugspace.ug.edu.gh vi TABLE OF CONTENT CONTENTS DECLARATION ............................................................................................................................................. i ABSTRACT .................................................................................................................................................... ii DEDICATION ............................................................................................................................................... iv ACKNOWLEDGEMENTS ........................................................................................................................... v TABLE OF CONTENT ................................................................................................................................ vi LIST OF FIGURES ...................................................................................................................................... xi LIST OF TABLES ....................................................................................................................................... xii LIST OF ABBREVIATIONS ......................................................................................................................xiii CHAPTER ONE ............................................................................................................................................. 1 INTRODUCTION .......................................................................................................................................... 1 1.0 BACKGROUND ...................................................................................................................................... 1 1.1 Problem Statement ................................................................................................................................... 2 1.2 Justification ............................................................................................................................................... 3 1.3 Hypothesis ................................................................................................................................................. 4 1.4 Aim of the Study ....................................................................................................................................... 4 1.5 Specific Objectives of the Study .............................................................................................................. 4 CHAPTER TWO ........................................................................................................................................... 5 LITERATURE REVIEW .............................................................................................................................. 5 University of Ghana http://ugspace.ug.edu.gh vii 2.0 Epidemiological Prevalence of ESBL ..................................................................................................... 5 2.1 Reports of Multidrug Resistant ESBL-Producing Enterobacteriaceae ............................................... 7 2.2 Contributory Factors to Multidrug Resistance Problem...................................................................... 8 2.3 General Mechanisms of Antimicrobial Resistance .............................................................................. 10 2.4 Laboratory Detection of ESBL Phenotypes ......................................................................................... 11 2.4.1 Screening Methods for Detecting ESBL Phenotypes .......................................................................... 12 2.4.2 Confirmatory Test Methods for ESBL Phenotypes ............................................................................. 14 2.4.2.1 Combined-Disc Diffusion Method .................................................................................................. 15 2.4.2.2 Double-Disc Synergy Method .......................................................................................................... 17 2.4.2.3 Vitek ESBL Test ............................................................................................................................... 17 2.4.2.4 The E-test ESBL Strip Method ....................................................................................................... 17 2.5 Molecular Characterization of ESBL Genes ....................................................................................... 18 2.6 The Problem of ESBL Detection ........................................................................................................... 18 CHAPTER THREE ..................................................................................................................................... 20 MATERIALS AND METHODS................................................................................................................. 20 3.0 Study Design ........................................................................................................................................... 20 3.1 Study Setting ........................................................................................................................................... 20 3.2 Collection of Clinical Isolates ................................................................................................................ 20 3.2.1 Inclusion Criteria ................................................................................................................................. 20 3.2.2 Exclusion Criteria ................................................................................................................................ 21 University of Ghana http://ugspace.ug.edu.gh viii 3.2.3 Minimum Sample Size.......................................................................................................................... 21 3.3 Data Collection ....................................................................................................................................... 21 3.4 Laboratory Investigations ..................................................................................................................... 22 3.4.1 Phase I: Bacteriological Confirmation of E. coli and K. pneumoniae Isolates received from TTH using MINIBACT-E micro-test kits .............................................................................................................. 22 3.4.2 Phase II: General Antibiotic Susceptibility Testing and Stocking of Characterized Isolates ........... 23 3.4.3 Phase III: Phenotypic Determination of ESBL-producing Isolates .................................................. 24 3.4.4 Phase IV: Molecular Characterization of ESBL-producing Isolates ................................................ 25 3.6 Statistical Analysis of Data .................................................................................................................... 28 CHAPTER FOUR ........................................................................................................................................ 29 RESULTS...................................................................................................................................................... 29 4.0 General Characteristics of Study Participants .................................................................................... 29 4.1 Phenotypic Expression of ESBLs .......................................................................................................... 32 4.2 Antimicrobial Resistance among ESBL-Producers and Non-ESBL Producers ............................... 36 4.3 Detection of ESBL Genotypes ............................................................................................................... 38 CHAPTER FIVE .......................................................................................................................................... 41 DISCUSSION ............................................................................................................................................... 41 5.1 Limitations of the Study ........................................................................................................................ 44 CHAPTER SIX ............................................................................................................................................. 45 CONCLUSIONS AND RECOMMENDATIONS ..................................................................................... 45 University of Ghana http://ugspace.ug.edu.gh ix 6.1 Conclusions ............................................................................................................................................. 45 6.2 Recommendations .................................................................................................................................. 46 REFERENCES ............................................................................................................................................. 47 APPENDICES .............................................................................................................................................. 61 Appendix I..................................................................................................................................................... 61 Informed Consent Form ............................................................................................................................... 61 Appendix II ................................................................................................................................................... 65 Questionnaire ................................................................................................................................................ 65 Appendix III ................................................................................................................................................. 69 Laboratory Protocols ..................................................................................................................................... 69 Appendix IV .................................................................................................................................................. 80 Performance Breakpoints ............................................................................................................................. 80 Appendix V ................................................................................................................................................... 81 Preparation of Master Mix............................................................................................................................ 81 Appendix VI .................................................................................................................................................. 82 Supplementary Results .................................................................................................................................. 82 Appendix VII ................................................................................................................................................ 84 Gel photograph of TEM genes amplified ..................................................................................................... 84 Appendix VIII ............................................................................................................................................... 85 Gel photograph of CTX-M-1 genes amplified .............................................................................................. 85 University of Ghana http://ugspace.ug.edu.gh x Appendix IX .................................................................................................................................................. 86 Gel photograph of SHV genes amplified ...................................................................................................... 86 Appendix X ................................................................................................................................................... 87 Ethical Clearance .......................................................................................................................................... 87 University of Ghana http://ugspace.ug.edu.gh xi LIST OF FIGURES Fig. 2.1 The combined-disc diffusion method……………………………………………..16 Fig 4.1 Antibiogram of E. coli and K. pneumoniae in TTH………………………………31 Fig. 4.2 ESBL-producers isolated from various age groups……………………………….34 Fig. 4.3 Antibiogram of ESBL-producers and non-ESBL producers in TTH…………......37 Fig. 4.4 PCR profile for BlaTEM of enterobacteria isolates…………………………………84 Fig. 4.5 PCR profile for BlaCTX-M-1 of enterobacteria isolates……………………………..85 Fig. 4.6 PCR profile for BlaSHV of enterobacteria isolates…………………………………86 University of Ghana http://ugspace.ug.edu.gh xii LIST OF TABLES Table 2.1 Recommended Breakpoints for Detecting ESBLs Courtesy BSAC……………….13 Table 2.2 Performance Breakpoints of Reference Strains Escherichia coli ATCC 25922 to ESBL Detection Agents……………………………………………………………80 Table 3.1 Primers and Cycling Conditions used for Amplification of TEM, SHV and CTX-M genes (Obeng-Nkrumah et al., 2013)………………………………………………27 Table 3.2 Preparation of Master Mix from Qiagen…………………………………………...81 Table 4.1 General Characteristics of the Study Participants………………………………….30 Table 4.2 Phenotypic Expression of ESBLs………………………………………………….33 Table 4.3 Univariate Analysis of Patient’s Characteristics in Relation to ESBL…………….35 Table 4.4 Performance of DNA Extraction Procedures for ESBL Genotypic Detection…….39 Table 4.5 ESBL Genotypes in E. coli and K. pneumoniae Isolates that Phenotypically Expressed ESBLs…………………………………………………………………..40 Table 4.6 List of Clinical Isolates Studied Between April and June, 2015…………………..82 Table 4.7 DNA Concentration and Purity Comparison of Extraction Methods……………...82 Table 4.8 Enterobacteria Expressing Multidrug Resistant Phenotypes to Amikacin, Ciprofloxacin, Tetracycline and Chloramphenicol………………………………..83 University of Ghana http://ugspace.ug.edu.gh xiii LIST OF ABBREVIATIONS AmpC – Ampillicin API – Analytical Profile Index AST – Antimicrobial Susceptibility Test ATCC – American Type Culture Collection BA – Blood Agar BlaCTX-M – Beta Lactam Cefotaximase BlaTEM - Beta Lactam Temoneira BlaSHV - Beta Lactam Sufhydryl variable CLSI – Clinical and Laboratory Standard Institute cDNA - Complementary Deoxyribonucleic Acid CTX-M - Cefotaximase ESBL – Extended-Spectrum Beta Lactamase HPA – Health Protection Agency ID – Identification KATH – Komfo Anokye Teaching Hospital KBTH – Korle Bu Teaching Hospital University of Ghana http://ugspace.ug.edu.gh xiv MHA – Mueller Hinton Agar MIC – Minimum Inhibition Concentration µg - Microgram µl - Microliter NCTC- National Collection of Type Cultures NMIMR – Noguchi Memorial Institute of Medical Research OXA - Oxacillin PBS – Phosphate Buffered Saline SHV – Sufhydryl variable SPSS - Statistical Package for the Social Scientists TEM - Temoneira TTH – Tamale Teaching Hospital University of Ghana http://ugspace.ug.edu.gh 1 CHAPTER ONE INTRODUCTION 1.0 BACKGROUND Βeta-lactamases are bacterial enzymes that inactivates beta-lactam antibiotics by hydrolysis (Livermore, 2003). Among the groups of β-lactamase enzymes, Extended Spectrum β-Lactamases (ESBLs), Class C Cephalosporinases (AmpCs) and Carbapenemases constitute the chief resistant mechanisms against β-lactam antibiotics. Of these, ESBLs are the commonest source of resistance to the β-lactams (Jacoby and Munoz-Price, 2005). Extended Spectrum Beta-Lactamases have the ability to hydrolyze and cause resistance to Penicillins, Cephalosporins and Monobactams but not Cephamycins or Carbapenems (Pitout and Laupland, 2008). The spread of bacterial resistance is mainly mediated by plasmids as they can be transferred between Gram negative bacteria by conjugation (Thomson and Smith, 2000). This transferability is responsible for outbreaks of resistance (Dbaibo, 1999; Sarma and Ahmed, 2010). Extended Spectrum Beta-Lactamases include the widespread plasmid-encoded enzyme families and their variants: Temoniera (TEM) (Shah et al., 2004), Sulfhydryl variable (SHV), and Oxacillinases (OXA) (Sarma and Ahmed, 2010). In recent years, many ESBLs of non-TEM, non-SHV and non- OXA types especially the cefotaximase (CTX-M) have been detected and reported worldwide (Sarma and Ahmed, 2010). The CTX-M type ESBL spreads rapidly and is now one of the most dominant types of ESBLs in many countries (Livermore et al., 2007; Lee et al., 2009). Escherichia coli and K. pneumoniae remain the major ESBL-producing organisms isolated worldwide but the enzymes have also been identified in several other members of the University of Ghana http://ugspace.ug.edu.gh 2 Enterobacteriaceae and in some non-fermenting Gram negative bacteria (Jacoby and Munoz-Price, 2005) like Pseudomonas sp. and Proteus mirabilis. Extended Spectrum Beta-Lactamase-producing enterobacteria have spread across the world but some Health Authorities are not aware of this problem especially in African countries (Pitout et al., 2004). In other African countries, the issue of routine detection remains a contentious issue owing to the huge financial demands involved (Pitout et al., 2004). Most clinical laboratories in Ghana do not routinely screen for ESBLs (Adu-Sarkodie, 2010). It is therefore imperative to heighten awareness among clinicians and policy-makers, and enhance testing by clinical laboratories, for the detection of ESBLs. This will improve patient management. It will also help determine the extent of the ESBL problem and inform appropriate interventions needed for the control of the spread of ESBL-producing bacteria (Pfaller and Segreti, 2006). 1.1 Problem Statement Dissemination of ESBL-producers. An increasing number of antimicrobial classes are becoming ineffective against a significant number of ESBL-producing organisms. Across the United States and several areas in Europe, this phenomenon has been observed and is now being observed across countries in Africa (Paterson and Bonomo, 2005). Of greatest concern are reports from hospitals in Nigeria confirming high levels of ESBL-associated resistance to non-β-lactam antibiotics including ciprofloxacin (Kesah and Odugbemi, 2002; Aibinu et al., 2003). Limited therapeutic options. The presence of Extended Spectrum β-Lactamases (ESBLs) in enterobacteria renders β-lactam antimicrobials ineffective, including extended spectrum cephalosporins, necessitating the wider usage of non-β-lactam agents including ciprofloxacin and University of Ghana http://ugspace.ug.edu.gh 3 amikacin in the treatment of serious infections caused by these pathogens. Nevertheless ESBL presence may be associated with a phenomenon of antimicrobial coresistance, to both β-lactam and non-β-lactam antibiotics (Luzzaro et al., 2006), significantly reducing therapeutic options available for treatment. Consequently, the duration of hospital stays, cost and mortality rates also increases by over 40% (Tumbarello et al., 2007). Absence of ESBL data in Northern Ghana. Documented surveys exist on the resistance of Enterobacteriaceae in Korle-Bu Teaching Hospital (KBTH) (Newman et al., 2004) and Komfo- Anokye Teaching Hospital (KATH) (Feglo et al., 2013) to extended-spectrum cephalosporins and other non-β-lactam antibiotics. There are, however, no published reports on ESBL-producing isolates from the Tamale Teaching Hospital (TTH), which provides services to the three Northern regions and neighboring towns. Whereas many laboratories may not be fully aware of the importance of ESBL-producing enterobacteria, others may lack the ability to correctly identify and report these organisms. The absence of routine surveillance and laboratory detection of ESBLs in many clinical laboratories in Africa, and Ghana in particular, further compounds the ESBL-problem. 1.2 Justification In view of absence of data from the Northern part of Ghana, it is imperative to investigate the contribution of ESBLs to antimicrobial resistance in E. coli and K. pneumoniae in Tamale Teaching Hospital. The availability of a local epidemiological data will prove indispensable to patients’ infection management whilst creating the necessary awareness on the clinical implications of β- lactamase producing organisms in Ghanaian hospitals and communities. The outcome of the study will improve antimicrobial administration and inform public health interventions including routine University of Ghana http://ugspace.ug.edu.gh 4 ESBL laboratory detection. It will also buttress hospital surveillance programs for drug resistant bacteria. 1.3 Hypothesis High levels of ESBL exist among E. coli and K. pneumoniae of Tamale Teaching Hospital. 1.4 Aim of the Study The overall objective of the study was to determine the prevalence of ESBLs in clinical isolates of E. coli and K. pneumoniae from patients attending Tamale Teaching Hospital. 1.5 Specific Objectives of the Study 1. To determine the prevalence of ESBL-producing E. coli and K. pneumoniae associated with clinical infections at the TTH. 2. To compare the antibiogram of ESBL-producing and non-ESBL-producing E. coli and K. pneumoniae. 3. To determine the presence of TEM, SHV and CTX-M genes among E. coli and K. pneumoniae isolates that phenotypically expressed ESBL. University of Ghana http://ugspace.ug.edu.gh 5 CHAPTER TWO LITERATURE REVIEW 2.0 Epidemiological Prevalence of ESBL Beta-lactam antibiotics are responsible for the inhibition of bacterial cell wall biosynthesis (Liras and Martin, 2006). This activity is achieved by two mechanisms targeting the inhibition of cell wall synthesis (Samaha-Kfoury and Araj, 2003). For the first action, antibiotics are incorporated into the bacterial cell wall, to inhibit the action of the transpeptidase enzymes responsible for the completion of the cell wall. The second action involves, antibiotics attachment to the penicillin binding proteins that normally suppress cell hydrolases, allowing the hydrolases free to act and lyse the bacterial cell wall (Samaha-Kfoury and Araj, 2003). In an attempt to survive, bacteria show resistance by bypassing these mechanisms of antimicrobial action, via production of β-lactam inactivating enzymes such as the beta-lactamases. Beta-lactam antibiotics are used all over the world, however, the distribution of the enzymes responsible for resistance to oxyimino-cephalosporins varies (Miro et al., 2005; Nordmann et al., 2009). Βeta-lactamases are bacterial enzymes that inactivate beta-lactam antibiotics by hydrolysis (Livermore and Woodford, 2006; Bush and Jacoby, 2010). Among the groups of beta-lactamase enzymes, Extended Spectrum β-Lactamases (ESBLs), Class C Cephalosporinases (AmpCs) and Carbapenemases constitute the main resistant mechanisms against beta-lactam antibiotics. Of these, ESBLs are the commonest source of resistance to the beta-lactams (Jacoby and Munoz-Price, 2005). Extended Spectrum Beta-Lactamases have the ability to hydrolyze and cause resistance to Penicillins, Cephalosporins and Monobactams but not Cephamycins or Carbapenems (Pitout and University of Ghana http://ugspace.ug.edu.gh 6 Laupland, 2008). Extended Spectrum Beta-Lactamases have been reported especially in K. pneumoniae, K. oxytoca and E. coli, (Apisarnthanarak et al., 2007; Coque et al., 2008). Extended Spectrum Beta-Lactamases have also been reported in Citrobacter, Enterobacter, Proteus, Serratia and other genera of enteric organisms (Chaudhary and Aggarwal, 2004; Blomberg et al., 2005; Apisarnthanarak et al., 2007; Canton et al., 2008; Coque et al., 2008) and non-enteric organisms such as Acinetobacter baumanii (Song et al., 2006) and Pseudomonas aeruginosa (Weldhagen et al., 2003). Extended Spectrum Beta-Lactamase prevalence is higher in isolates from Intensive Care Unit (ICU) compared to isolates from other units or wards within the hospital settings (Jacoby and Munoz-Price, 2005; Rodriguez-Villalobos et al., 2011). The problem of ESBLs evolved in the 1960s (Nordmann and Guibert, 1998) from Western Europe, where Extended spectrum beta-lactam drugs were first used. Currently ESBL prevalence amongst clinical isolates within institutions and from country to country varies. Several studies have examined the incidence of ESBL in Europe, South America and Southeast Asia but only a few have studied isolates from Africa (Obeng-Nkrumah et al., 2013). Among the Enterobacteriaceae group, ESBL production ranges from 0 to 25% within institutions in the United States, with a national average of 3% (http://www.cdc.gov/ncidod/hip/SURVEILL/NNIS.HTM). The prevalence of ESBL varies greatly from country to country across Europe with relatively low occurrences of 3% and 1% in Sweden and the Netherlands respectively (Rodriguez-Villalobos et al., 2011), to as high as 42% in an intensive care unit in France (Branger et al., 1998). Extended Spectrum β-Lactamase production in Asia varies from 0.4% in Japan (Yagi et al., 2000), 4.8% in Korea (Pai et al., 1999) and 12% in Hong Kong (Ho et al., 2000). In the 1990s, ESBL types reported were chiefly TEM and SHV beta- lactamase families usually found in Klebsiella pneumoniae during nosocomial outbreaks (Coque et University of Ghana http://ugspace.ug.edu.gh 7 al., 2008), however, the CTX-M ESBL commonly found in E. coli isolates from community- acquired infections are increasingly being reported (Coque et al., 2008). This phenomenon has been attributed to dissemination of specific clones or clonal groups and epidemic plasmids in community and nosocomial settings. The most widespread ESBL reported in increasing order belong to the TEM (TEM-24, TEM-4, TEM-52); SHV (SHV-5, SHV-12) and CTX-M (CTX-M-9, CTX-M-3, CTX-M- 14, CTX-M-15) families in Europe (Coque et al., 2008). In Africa, there are reports of routine ESBL surveillance programmes in South Africa with several excellent reviews averaging low prevalence rates of less than 3% (Bell et al., 2002). Extended Spectrum Beta-Lactamases have been reported in Tunisia (Ben-Hamouda et al., 2004), Morocco (AitMhand et al., 2002), Egypt (Shannon et al., 1990) and Kenya (Kariuki et al., 2001). In West Africa, ESBLs have been reported in Nigeria (Kesah and Odugbemi, 2002; Aibinu et al., 2003), however, no surveillance and epidemiological data exist in these countries including Ghana (Obeng- Nkrumah et al., 2013). This increasing prevalence of ESBLs on the African continent has grave consequences on the already strained healthcare systems. Albeit treatment of infection with ESBL- producing bacteria remains difficult in high-income countries, the situation is formidable in low- income countries where expensive second-line drugs are unavailable and microbiological services are accessible only in few referral hospitals. It is therefore important that the emergence of such a phenomenon be carefully monitored and eventually contained. 2.1 Reports of Multidrug Resistant ESBL-Producing Enterobacteriaceae In recent years, some studies have assessed the occurrence of ESBL induced multidrug resistance in clinical isolates of Enterobacteriaceae. In 2001, the result of a nationwide survey in Italy indicated that 6.3% of all clinical isolates harboured ESBL genes with an average antimicrobial coresistance University of Ghana http://ugspace.ug.edu.gh 8 of 25% to all non-β-lactam drugs tested (Spanu et al., 2002). On the contrary, a study in Israel involving a Jewish population in 2004 revealed that the overall prevalence of ESBL was 20% with an alarming high antimicrobial coresistance from a low of 40% to piperacillin-tazobactam to a high of 75% for gentamicin (Schwaber et al., 2004). This result was in agreement with a study in Tanzania, reporting extreme levels of coresistance of 90.9% to trimethoprim-sulphurmethoxazole and amikacin (Ndugulile et al., 2005) and also in Nigeria where a coresistance of 89% to streptomycin, 100% to gentamicin and trimethoprim-sulphurmethoxazole were reported (Aibinu et al., 2003). There are no published reports on ESBL-producing isolates and the extent of antimicrobial coresistance conferred by these enzymes in Tamale Teaching Hospital (TTH). Therefore, there is a growing need for a study, particularly in tertiary and referral healthcare facilities like TTH, which may harbour many different microorganisms, to confirm the existence of ESBL-producing Enterobateriaceae associated with coresistance. 2.2 Contributory Factors to Multidrug Resistance Problem A major contributing factor to possible occurrence of this phenomenon of coresistance is the use of sub-therapeutic antibiotics both prescribed and unprescribed (Emery and Weymouth, 1997). Of greater concern, is the apparent non-performance of routine laboratory screening for ESBL- producing Enterobacteriaceae to provide clinicians with reliable therapeutic options in many health communities (Tenover et al., 1999). Besides, there are not much data on comprehensive antibiotic susceptibility patterns for potentially useful beta-lactam and non-beta-lactam antibiotics in most countries in the sub-Saharan region. These could lead to inappropriate administration of antibiotics for empirical treatment, leading to the selection of species that may have naturally developed University of Ghana http://ugspace.ug.edu.gh 9 resistance to these drugs. These multiple-resistant Gram negative bacilli or rods may survive even on the finger tips, adding to their spread (Casewell and Desai, 1983). In addition to hand carriage, institutional and bacterial properties that contribute to both epidemic and endemic spread are not fully understood (Tullus et al., 1988), despite known risk factors such as length of hospital stay, severity of illness, time in the intensive care units (ICU) and gastric incubations (Pena et al., 1997). The consequences span from several treatment failures to outbreaks of multidrug resistance, which requires expensive control efforts. The problem of multidrug resistance are increasing and becoming more complex. Some investigators have determined that animals and food vegetables might represent possible source of genes encoding ESBL to humans. There is evidence of ESBL-producing isolates in poultry (Weill et al., 2004), cattle (Shiraki et al., 2004), dogs and cats (Carattoli et al., 2005) and these might act as reservoirs for spread of resistant isolates of Enterobacteriaceae. Some workers, including Shiraki et al., (2004) have hypothesized that some types of ESBLs (CTX-M-2) emerged initially from cattle with subsequent transmission to humans. As resistant plasmids are the major source of ESBL transmission (Harris et al., 2007), it has been postulated that ESBL-producing Enterobacteriaceae possess transferable elements that travel alongside the ESBL-containing plasmids, conferring resistance to other antimicrobial classes yielding multidrug resistance traits. It is possible that resistance factors including mutators and integrons may contribute to this possible emerging phenomenon of high antibiotic coresistance (Chopra et al., 2003; Gruteke et al., 2003). University of Ghana http://ugspace.ug.edu.gh 10 2.3 General Mechanisms of Antimicrobial Resistance The general mechanisms of antimicrobial resistance include: altering the receptor for the drug; decreasing the amount of the drug that reaches the receptor by altering entry or increasing removal of the drug; destroying or inactivating the drug and developing resistant metabolic pathways. Bacteria can possess one or all of these resistant mechanisms simultaneously (Kern et al., 2008; Vollmer & Bertsche, 2008). A typical organism like Pseudomonas aeruginosa possesses an active efflux pump system that can reduce the intracellular accumulation of antibiotics and allow an enzyme with only limited hydrolytic capacity to inactivate the drug before reaching the target. For other organisms, there are diminished expression of an outer-membrane porin required for beta- lactam uptake. In Klebsiella pneumoniae, decreased expression of outer-membrane porins often accompanies ESBL production and may allow a TEM or SHV-type ESBL to express resistance to cefepime (Bradford et al., 1997; Martinez-Martinez et al., 1999). The production of β-lactamase enzymes is the main resistance mechanism against β-lactam drugs that inhibits the drugs from binding to the penicillin-binding proteins (James et al., 2009). Introduction of these antibiotics in any population can result in the evolution of bacterial strains capable of producing new penicillin-binding proteins, to which no β-lactam antibiotic can bind. The main mechanism is the production of enzymes called penicillinase, which has the ability to attack other β-lactam drugs such as the cephalosporins, carbarpenems and monobactams, and so they are most appropriately called β-lactamases (Rastogi, 2010). The most important activity of these β- lactamase enzymes is the alteration of the β-lactam ring of the drug (Samaha-Kfoury and Araj, 2003). The introduction of newer classes of β-lactam antibiotics such as the third generation cephalosporins and aztreonam and their widespread use, have co-evolved with the new enzymes that University of Ghana http://ugspace.ug.edu.gh 11 have led to the Extended Spectrum Beta-lactamases among the Enterobacteriaceae (Thomson and Smith, 2000; Samaha-Kfoury and Araj, 2003). These enzymes have an extended substrate among the cephalosporin and monobactam antibiotics together with the ability to confer resistance to other non-β-lactam antibiotics and so these enzymes were labeled Extended Spectrum β-lactamases, thus ESBLs (Chaudhary and Aggarwal, 2004). The spread of bacterial resistance is most often by plasmids. These are transferred between Gram positive and Gram negative bacteria by transducing phages and conjugation respectively (Thompson and Smith, 2000). This mechanism of transferability is primarily responsible for outbreaks of resistance (Dbaibo, 1999; Sarma and Ahmed, 2010). 2.4 Laboratory Detection of ESBL Phenotypes Currently, the recommended procedure for ESBL-producing E. coli and K. pneumoniae detection by the Clinical and Laboratory Standards Institute (CLSI, 2012) involves an initial disk-diffusion or broth dilution screening test with one or more oxyimino-β-lactams. Confirmatory test follows, to measure the susceptibilities to cefotaxime (CTX), ceftazidime (CAZ) or cefpodoxime (CPD) alone and in combination with an ESBL inhibitor, usually clavulanic acid (CA) (Jacoby and Munoz-Price, 2005). Other ESBL inhibitors include sulbactam and tazobactam. Aside these recommended tests for detecting ESBLs in enteric bacteria (especially E. coli and K. pneumoniae), there are no recommended test for detecting ESBLs in Pseudomonas aeruginosa (Jacoby and Munoz-Price, 2005). University of Ghana http://ugspace.ug.edu.gh 12 2.4.1 Screening Methods for Detecting ESBL Phenotypes According to the Health Protection Agency (HPA) (2004), cefpodoxime or ceftazidime are the best third generation cephalosporin substrates for TEM and SHV-derived ESBLs, qualifying them to be included in the first line routine susceptibility testing of isolates. Cefotaxime is considered appropriate for CTX-M genes and it is also used as a first line routine susceptibility testing agent. Based on these recommendations, the British Society for Antimicrobial Chemotherapy (BSAC) developed and approved the zone sizes for the routine disc diffusion tests and Minimum Inhibition Concentration (MIC) breakpoints (mm) for the broth dilution method (Table 2.1) (Jonathan, 2005). University of Ghana http://ugspace.ug.edu.gh 13 Table 2.1 Recommended breakpoints for detecting ESBLs courtesy BSAC (Courtesy; HPA, 2004) Antibiotic/ dics contents Zone breakpoints (mm) for the disc diffusion test MIC (mg/L) for broth dilution or E-test Resistant, ≤ Susceptible, ≥ Resistant, ≥ Susceptible, ≤ Cefotaxime, 30µg 29 30 1 1 Ceftazidime, 30µg (E. coli and Klebsiella) 21 22 2 2 Ceftazidime, 30µg (other species) 27 28 2 2 Cefpodoxime, 10µg 25 26 1 1 University of Ghana http://ugspace.ug.edu.gh 14 The Clinical and Laboratory Standards Institute (CLSI) reviewed the BSAC methods for testing and recommended both disc diffusion and MIC methods for screening ESBL-producing E. coli and Klebiella as well as other coliforms (CLSI, 2012). Alternatively, CLSI suggested that laboratories that make use of the disc diffusion method for antimicrobial susceptibility testing during ESBL screening, must adopt the BSAC breakpoints for more than one testing antibiotic (cefotaxime, ceftazidime, cefpodoxime and ceftriaxone) (CLSI, 2012). The following general traits of cephalosporins for screening ESBL-producing isolates, were proposed by HPA in 2004 as guidelines, owing to the numerous test methods available and the confusion involved:  TEM and SHV ESBL-producing enterobacteria are obviously resistant to ceftazidime (CAZ), with variable results when tested using cefotaxime (CTX).  CTX-M ESBLs producers are obviously resistant to cefotaxime; with variable results to ceftazidime.  All ESBL-producers, however, have obvious resistance to cefpodoxime (CPD), and so this antibiotic may be used as the drug of choice for the screening of ESBLs.  Cefuroxime, cephalexin and cephradine are unreliable indicators. In any case the suspected organisms must be confirmed for ESBL production (HPA, 2004). 2.4.2 Confirmatory Test Methods for ESBL Phenotypes Enterobacteriaceae suspected to be ESBL-producers, may be submitted to the under listed confirmatory tests. These tests make it possible to evaluate the inhibition of ESBL activity by the use of clavulanic acid. Examples of the confirmatory test methods include: University of Ghana http://ugspace.ug.edu.gh 15 2.4.2.1 Combined-Disc Diffusion Method For the combined-disc diffusion method, cefotaxime or ceftazidime may be used alone as an indicator cephalosporins or in combination with clavulanic acid (CLSI, 2012). This method was proposed by both Oxoid and the BSAC for the detection of ESBL-producing Enterobacteriaceae. Using the same procedure, cefpodoxime (CPD) only as well as CPD in combination with clavulanic acid are placed at appreciable distance (about 30mm) apart on Mueller-Hinton agar (MHA) inoculated with the test organism and incubated aerobically at 37°C for 18 to 24 hours. The zones of inhibition for both discs (used alone and in combination with CA) are measured using a vernier caliper or measuring rule and compared. Between the two discs (single and combined disc), a difference of greater than 5mm increase in zone diameter is considered positive for ESBL production (Carter et al., 2000). With regard to controls when performing confirmatory testing, K. pneumoniae ATCC 700603 and E. coli ATCC 25922 must be tested routinely (daily or weekly) or for every batch. For K. pneumoniae ATCC 700603, a difference of greater than 5mm increase in CAZ plus CA zone diameter and greater than 3mm increase in CTX plus CA zone diameter is considered positive. Likewise, for E. coli ATCC 25922, a difference of greater than 2mm increase in zone diameter of the cephalosporin agent tested alone verses its zone when tested in combination with clavulanic acid is considered positive. Aside the combined-disc diffusion method described, there are several other test methods for confirming ESBL-producers. Few of these test methods are mentioned below but not exhaustive. University of Ghana http://ugspace.ug.edu.gh 16 Figure 2.1 The Combined-Disc Diffusion Method Zone size of combined disc (CAZ/CA) = 22mm, whereas that of ceftazidime alone (CAZ) = 11mm. Thus, 22mm – 11mm = > 5mm. Therefore, phenotypically the isolate is an ESBL-producer (Carter et al., 2000) 11mm 22mm University of Ghana http://ugspace.ug.edu.gh 17 2.4.2.2 Double-Disc Synergy Method In this method, discs containing cephalosporins (cefotaxime, ceftriaxone, ceftazidime, cefepime) are applied next to a disc with clavulanic acid, amoxicillin plus clavulanic acid or ticarcillin plus clavulanic acid. Positive result is indicated when the inhibition zones around any of the cephalosporin discs are augmented in the direction of the disc containing clavulanic acid. The distance between the discs is crucial, such that 30mm center-to-center has been found to be optimal for 30µg cephalosporin discs; however it may be reduced to 25mm or expanded to 35mm for strains with very high or low resistance levels, respectively. 2.4.2.3 Vitek ESBL Test This method is an automated test method for ESBL detection, produced by BioMeriex Vitek (bioMerieux Vitek, Inc. Hazelwood, Missouri). This method employs cephalosporin and cephalosporin inhibitors in wells on a card, for the detection of ESBLs, which can be determined within 4-15 hours (Livermore et al., 2002). 2.4.2.4 The E-test ESBL Strip Method For this method, cefotaxime or ceftazidime are the frequently used E-test ESBL strips, seen on one side of the strip with the other end having the corresponding antibiotics plus clavulanate as confirmatory agents. For a phenotically positive ESBL-production test, the Minimum Inhibition Concentration (MIC) ratio of cephalosporin alone to cephalosporin plus clavulanic acid is MIC ≥ 8, or a decrease in the MIC of cephalosporin of more than three dilutions in the presence of clavulanic acid (Sridhar et al., 2008). University of Ghana http://ugspace.ug.edu.gh 18 2.5 Molecular Characterization of ESBL Genes With the availability of PCR followed by sequencing, it is now possible to differentiate between different variants of ESBL genes and non-ESBL parent enzymes, making this system the method of choice (Fluit and Schmitz, 2001). Owing to the challenging and laborious nature of the molecular procedures, they are not performed routinely for clinical diagnostic purposes, rather they are restricted to reference laboratories and molecular surveillance studies in many countries (Woodford et al., 2006). Frantic attempts have, however, been made to develop very simple, affordable and easily accessible molecular techniques (rapid-cycle sequencing and microarrays for genotyping ESBLs) for diagnostic laboratories (Pitout and Laupland, 2008) but this hope is yet to be realized. 2.6 The Problem of ESBL Detection The ability of clinical laboratories to identify and characterize organisms producing ESBL is a major challenge owing to the fact that, ESBL enzymes have variable affinity for different substrates (HPA, 2004). This substrate variability and inoculums effect make some ESBL-producing organisms difficult to detect (HPA, 2004). The World Health organization (WHO) has expressed concerns about the current abilities of some laboratories to fully detect ESBL-producing organisms (Tenover et al., 2001). Additionally, many clinical laboratories may not be fully aware of the importance of organisms producing ESBLs. The current detection of ESBL-producing pathogens in microbiology laboratories therefore remains a controversial issue with some people questioning its clinical relevance in view of the financial demands involved (Pitout and Laupland, 2008). In response, the Clinical and Laboratory Standards Institute (CLSI) has a publication on the guidelines for ESBL detection (Paterson and Bonomo, 2005). With reference to the guidelines, University of Ghana http://ugspace.ug.edu.gh 19 molecular methods are used to identify the presence of specific ESBL genotypes in clinical isolates but the procedures are complicated with variability in data interpretations (Bradford, 2001). Many researchers use the genotypic methods to ascertain the geographical relatedness of ESBL-producing organisms in epidemiological studies (Paterson and Bonomo, 2005). It is, however, worth noting that, clinically no precise association can be established between ESBL genotypes and the susceptibility of ESBL-producing Enterobacteriaceae to different β-lactams, since susceptibility depends on ESBL gene expression, changes in outer membrane pores and production of additional β-lactamases (Bradford, 2001). In clinical microbiology laboratories, the phenotypic methods are popular in detecting ESBL expression in isolates, and sensitivity may range from 81% to 97% depending on the method used (Bradford, 2001). A phenotypic assay of ‘cephalosporin-clavulanic acid’ disk diffusion on Mueller- Hinton agar technique will be used in this study, according to CLSI, 2012 standards. This method is cost effective, suitable for routine laboratory work, easy to interpret and reproducible in results with over 93% sensitivity (Paterson and Bonomo, 2005). University of Ghana http://ugspace.ug.edu.gh 20 CHAPTER THREE MATERIALS AND METHODS 3.0 Study Design This study was a cross-sectional study that involved convenient sampling of E. coli and K. pneumoniae isolates collected randomly from patient’s clinical specimen at the Tamale Teaching Hospital (TTH) between April and June 2015. 3.1 Study Setting The Tamale Teaching Hospital is located in the Eastern part of the Tamale Metropolis, in a catchment area which has a population of approximately 2.1 million. The Hospital was established to serve as a Medical Referral Centre for the Northern, Upper East and Upper West Regions, the Northern parts of Brong Ahafo Region and neighboring countries, including La Cote D’Ivoire, Burkina Faso and Togo. The hospital has a bed capacity of four hundred and fifty-two (452). The hospital has many wards/units and blocks comprising of maternity block, obstetrics and gynecological block, intensive care unit (ICU), males and females wards, trauma and surgical wards and out-patient department (OPD). The microbiological laboratory provides routine bacteriological services to the hospital and the population in general with over 8,000 clinical cultures annually (http://www.tamaleteachinghospital.org). 3.2 Collection of Clinical Isolates 3.2.1 Inclusion Criteria Clinical isolates clearly identified as E. coli and K. pneumoniae were investigated in the study. University of Ghana http://ugspace.ug.edu.gh 21 3.2.2 Exclusion Criteria Multiple isolates per species from the same patient and having the same antibiogram pattern were excluded from the study to avoid duplication. 3.2.3 Minimum Sample Size Clinical isolates of E. coli and K. pneumoniae were used for this study. The minimum sample size of isolates screened for ESBL production was determined using the formula: N = 𝑍2(𝑃)(1 − 𝑃) (𝐸𝑟𝑟𝑜𝑟)2 Where: Z = 1.96, is the standard score for the confidence interval at 95%. P = 0.493, is the sample proportion of the prevalence of ESBL-producing isolates in Ghana, (Obeng- Nkrumah et al., 2013). A 9% allowable error was used. Our sample size, N = (1.96)2(0.493)(1−0.493) (0.09)2 = 118.54 = 119 E. coli and K. pneumoniae isolates collected randomly. Overall, 140 isolates were screened and confirmed for ESBL producers and non-producers. 3.3 Data Collection During the study period, clinical isolates of E. coli and K. pneumoniae recovered as etiologic agents of infections from clinical specimen submitted by patients to the Microbiology laboratory (TTH) for bacteriological investigations were randomly collected. For each clinical isolate, the respective University of Ghana http://ugspace.ug.edu.gh 22 patient data including personal data (age, gender), diagnosis and type of specimen submitted for investigation, were obtained using structured questionnaire. Additional information covering history on antibiotic usage, patients’ assessing a hospital facility and comorbid conditions (diabetes, dialysis and chemotherapy treatment) were also collected to determine if these variables were more or less often associated with ESBL-producing E. coli and K. pneumoniae. 3.4 Laboratory Investigations The laboratory investigations were in four phases: PHASE I – Bacteriological confirmation of E. coli and K. pneumoniae isolates received from Tamale Teaching Hospital (TTH) using MINIBACT-E micro-test kits (SSI, Denmark). PHASE II – General antibiotic susceptibility testing and stocking of characterized isolates. PHASE III – Phenotypic determination of ESBL-producing isolates. PHASE IV – Molecular identification of ESBL genes responsible for phenotypes in phase III. 3.4.1 Phase I: Bacteriological Confirmation of E. coli and K. pneumoniae Isolates received from TTH using MINIBACT-E micro-test kits The work was done in the Medical Microbiology Department (Korle-Bu) and Noguchi Memorial Institute for Medical Research (NMIMR, Legon). Phases I, II and III were carried out in the Korle- Bu and Phase IV in Legon. Isolates received from TTH were sub-cultured onto MacConkey agar plate (Mac) and incubated in ambient air at 35±2°C for 16 to 18 hours. After overnight incubation, the identities of all the clinical isolates were confirmed using the MINIBACT-E micro-test kits University of Ghana http://ugspace.ug.edu.gh 23 according to the manufacturer’s instructions (Appendix III) and results read after four hours’ incubation. The MINIBACT-E is a ready-to-use four hour chromogenic micro-test kit embedded with substrates in the various wells, which works on the principle of colour change for bacteria identification. This was used to confirm clinical isolates of E. coli and K. pneumoniae from TTH. The micro-test kit takes up to four cultures per plate with 16 wells each. The use of the kit saved time, labour and cost. 3.4.2 Phase II: General Antibiotic Susceptibility Testing and Stocking of Characterized Isolates Antibiotic susceptibility testing for each isolate studied was determined using the Clinical and Laboratory Standard Institute (CLSI, 2012). Purity plates were prepared as working stock for study isolates sub-cultured onto MHA. Four to six morphologically similar colonies from the pure cultures were touched using sterile inoculating loops and transferred into 3ml peptone broth, to make a suspension of 0.5 McFarland standard (107-8cfu/ml). After 15 minutes incubation to enhance appreciable growth, sterile cotton tipped swabs were dipped into the standardized inoculums and swabbed carefully in three dimensions on the Mueller-Hinton agar (MHA) plates (Oxiod, UK). The moisture was allowed to be absorbed for at least 15 minutes. The antibiotic discs were placed firmly on the surface of the agar plate and incubated at 35±2°C for 16 to 18 hours in ambient air, after allowing the agar plate to be on the bench at room temperature for about 15 minutes to enhance adequate antibiotics absorption. Susceptibilities of all isolates studied to the following antibiotics (MAST, UK) listed below were recorded after overnight incubation. They included: ampicillin (10µg), amikacin (30µg), meropenem (10µg), gentamicin (10µg), ciprofloxacin (5µg), cefuroxime (30µg), cefotaxime (30µg), chloramphenicol (30µg), and tetracycline (30µg). Nalidixic acid (30µg) was used for urine isolates. Susceptible reference strains of E. coli ATCC 25922 and K. pneumoniae University of Ghana http://ugspace.ug.edu.gh 24 ATCC 700603 as controls were performed for every batch carried out and the zones of inhibition recorded after 16 to 18 hours of incubation. Escherichia coli and K. pneumoniae isolates characterized for ESBL production were stored in trypticase soy broth containing 10% glycerol (v/v) in 1.5ml cryovial tubes (Sigma, UK) and stored at -20°C for further workup. Working cultures of pure isolates were kept on solid agar slants at -5°C. 3.4.3 Phase III: Phenotypic Determination of ESBL-producing Isolates Phenotypic determination of ESBL-producing isolates was carried out using the Kirby-Bauer’s method of susceptibility testing on Mueller Hinton agar (MAST, UK) (CLSI, 2012). The inhibition zone diameters were interpreted according to the reference breakpoints of the Clinical and Laboratory Standard Institute (CLSI, 2012). Escherichia coli ATCC 25922 (ESBL-negative) and K. pneumoniae ATCC 700603 (ESBL-positive) were used as controls. This phase comprised of screening and confirmation of ESBL-producing isolates using the combined disc synergy method. With reference to the CLSI screening guidelines, isolates with zones inhibition diameters of less than or equal to 27mm for Cefotaxime (CTX) (30μg), less than or equal to 22mm for Ceftazidime (CAZ) (30μg) and less than or equal to 17mm for Cefpodoxime (CPD) (10μg) were considered as potential ESBL-producers. Isolates that were resistant at these breakpoints to at least one of the three screening antibiotics were described as positive for ESBL screening. These potential ESBL- producers were further investigated in order to confirm ESBL production. The test was carried out using the Kirby-Bauer disc diffusion method according to the CLSI recommendation. Cefotaxime (30μg), Ceftazidime (30μg) and Cefpodozime (10μg) antibiotic discs with or without Clavulanic acid (10μg) were placed at a distance of 25mm on MHA plate inoculated University of Ghana http://ugspace.ug.edu.gh 25 with bacteria suspension of 0.5 McFarland turbidity standards and incubated overnight at 37°C. As determined by the CLSI reference, the study isolates that demonstrated clavulanic acid effect defined by the increase in zone diameter greater than 5mm for at least one test antibiotic, were confirmed ESBL-producers. 3.4.4 Phase IV: Molecular Characterization of ESBL-producing Isolates Phenotypically documented ESBL-producing E. coli and K. pneumoniae were characterized by PCR to confirm the presence of gene families (TEM, SHV and CTX-M) that encode ESBLs. In this phase, two extraction procedures (Boiling and Qiagen extraction) were used with the aim of achieving optimum DNA concentrations and purity for amplification. The DNA concentrations and purity were quantified using the Nanodrop device (Thermo Scientific, USA). The boiling suspension method was used to extract DNA from bacteria samples (Holmes and Quingely, 1981). About 4 - 6 morphologically similar colonies of test isolates were touched and suspended in 200µl nuclease free water in a 1.5ml eppendorf screw-capped tubes. The suspension was heated at 98°C for about 20 minutes using a waterbath incubator to obtain cell lysate. The mixtures were centrifuged at 2,000 rpm for 15 minutes and the supernatant transferred into sterile 1.5ml eppendorf screw-capped tubes as the DNA template leaving behind the pellet. Qiagen extraction kits were also used to extract DNA from the test isolates following the manufacturers protocol as provided in Appendix III. Isolates were screened for TEM, SHV and CTX-M-1, 2 and 9 cluster groups of ESBLs. PCR was carried out using thermal cycler (BioRad, USA) with a total volume of 25.0μl containing 2.0µl DNA template and 23.0µl Master Mix (Qiagen, UK) (Apendix III). The primer sequences and cycling conditions used for the different PCRs are shown in Table 2. The PCR products for each reaction University of Ghana http://ugspace.ug.edu.gh 26 was electrophoresized on 2% agarose gel with a 100 base pair molecular DNA marker (Biolabs, New England). Gels were visualized using the UV-transilluminator after staining in ethidium bromide. University of Ghana http://ugspace.ug.edu.gh 27 Table 3.1 Primers and cycling conditions used for amplification of TEM, SHV and CTX-M genes Resistant gene Sequence (5’ to 3’) Size (bp) Cycling conditions TEM FP:GTATCCGCTCATGAGACAATAACCCTG RP: CCAATGCTTAATCAGTGAGGCACC 918 Initial heat activation temperature at 94°C for 15minutes; denaturation for 30 cycles at 94°C for 30seconds; annealing at 63°C for 90seconds; extension at 72°C for 60seconds; final extension at 72°C for 10 minutes SHV FP: CGC CTG TGT ATT ATC TCC CTG TTA GCC RP: TTG CCA GTG CTC GAT CAG CG 842 Initial heat activation temperature at 94°C for 15minutes; denaturation for 30 cycles at 94°C for 30seconds; annealing at 63°C for 90seconds; extension at 72°C for 60seconds; final extension at 72°C for 10 minutes CTX-M 1 FP: GACAGACTATTCATGTTGTTGTTAWTTCG RP: CCGTTTCCSCTATTACAAA 940 Initial heat activation temperature at 94°C for 15 minutes; denaturation for 30 cycles at 94°C for 30seconds; annealing at 50°C for 90seconds; extension at 72°C for 60seconds; final extension at 72°C for 10 minutes CTX-M 2 FP: ACAGTTGGTGACGTGGCTTAAGG RP : TCAGAAACCGTGGGTTACGA 253 Initial heat activation temperature at 94°C for 15 minutes; denaturation for 30 cycles at 94°C for 30seconds, annealing at 50°C for 90seconds, extension at 72°C for 60seconds; final extension at 72°C for 10 minutes CTX-M 9 FP: ATGGTGACAAAGAGAGTGCAACG RP: ATGATTCTCGCCGCTGAAGC 860 Initial heat activation temperature at 94°C for 15 minutes; denaturation for 27 cycles at 94°C for 30seconds, annealing at 50°C for 90seconds, extension at 72°C for 60seconds; final extension at 72°C for 10 minutes (Primers designed with modifications as published by Hackman et al., 2014) University of Ghana http://ugspace.ug.edu.gh 28 3.5 Ethics The work received ethical clearance from the Ethical and Protocol Review Committee of the University of Ghana Medical School (MS-Et/M.7-P3.2/2014-2015) (Appendix IV). Clinical isolates recovered from patients’ specimens were assigned arbitrary numbers to ensure anonymity. Informed consent were sought from appropriate authorities of Tamale Teaching Hospital and the Department of Microbiology, TTH, Tamale. 3.6 Statistical Analysis of Data Data obtained were entered in Microsoft Office Excel, and results analyzed using Statistical Package for Social Sciences (SPSS) (Version 20) in order to address the objectives of the study. Point estimates of statistical significance were indicated with 2 tailed p-values <0.05. Descriptive statistics (frequencies and cross-tabulations) were used to determine the prevalence of ESBLs. For continuous variables, standard weighted-mean statistics using Kruskal Wallis or Mann Whitney test (respectively for normalized and non-normalised distributions) were used to estimate differences in population means. Categorical data were compared across study parameters using Chi-square or the Fisher’s exact test where appropriate. Univariate comparisons between study outcomes and covariates were computed with Chi-square tests and unadjusted Odds ratios (OR) at 95% confidence interval (CI). University of Ghana http://ugspace.ug.edu.gh 29 CHAPTER FOUR RESULTS 4.0 General Characteristics of Study Participants A total of 140 isolates of E. coli (83.6%; n=117) and K. pneumoniae (16.4%; n=23) were randomly obtained from patients’ clinical specimen at the Tamale Teaching Hospital (TTH). The isolates were mainly from cultures of urine (55.7%; n=78), HVS/ endocervical swab (17.1%; n=24), aspirates (8.6%; n=12), wound (7.1%; n=10), sputum (6.4%; n=9) and blood (5.0%; n=7). The mean age of patients was 32.7±19.2 and comprised 44 males (40.8±22.3) and 96 females (29.0±16.4). Out of the 117 patients infected with E. coli, 31.6% (n=37) were males whereas 68.4% (n=80) were females. Also, out of the 23 patients infected with K. pneumoniae, 30.4% (n=7) were males whereas 69.6% (n=16) were females. Figure 4.1 illustrates the general antibiotic susceptibility pattern of the study isolates as per Kirby- Bauer method of susceptibility testing. A total of 10 antimicrobials (ampicillin, gentamicin, cefotaxime, cefuroxime, chloramphenicol, nalidixic acid, tetracycline, ciprofloxacin, amikacin and meropenem) were tested against the study isolates. Generally, there was high percentage resistance to ampicillin 96% and tetracycline 89%. Resistance to nalidixic acid and ciprofloxacin were 77% and 74% respectively, while chloramphenicol, cefuroxime, gentamicin and cefotaxime were 60%, 56%, 54% and 46% respectively. Relatively lower resistance was noted for amikacin 36%, however, none of the isolates was resistant to meropenem, using CLSI inhibition zone size interpretation criteria (CLSI, 2012). Isolates resistant to at least one agent in three or more antimicrobial categories is referred to as Multidrug Resistant (MDR) (Magiorakos et al., 2012). In this study, 19.7% of E. coli and 26.1% of K. pneumoniae were determined to be MDR. University of Ghana http://ugspace.ug.edu.gh 30 Table 4.1 General Characteristics of Study Participants Variables Total (n=140) E. coli (n=117) K. pneumoniae (n=23) Socio-demographic data Age (yrs) 32.7±19.2 32.9±19.2 31.5±18.4 Male 44 (31.4%) 37 (31.6%) 7 (30.4%) Female 96 (68.6%) 80 (68.4%) 16 (69.6%) Locality/ Region Northern 138 (98.6%) 115 (83.3%) 23 (16.7%) Upper East 2 (1.4%) 2 (100%) 0 (0.0%) Diagnosis queried by clinicians Wound abscess 10 (7.1%) 10 (8.5%) 0 (0.0%) Sepsis 7 (5.0%) 4 (3.4%) 3 (13.0%) Chest pain 2 (1.4%) 0 (0.0%) 2 (8.7%) PID 4 (2.9%) 1 (0.9%) 3 (13.0%) BPH 5 (3.6%) 5 (4.3%) 0 (0.0%) Chronic cough 7 (5.0%) 2 (1.7%) 5 (21.7%) Peritonitis 10 (7.1%) 10 (8.5%) 0 (0.0%) Ascites 2 (1.4%) 2 (1.7%) 0 (0.0%) Lower abdominal pain 2 (1.4%) 2 (1.7%) 0 (0.0%) UTI/ painful urination 73 (52.1%) 69 (59.0%) 4 (17.4%) Vaginal discharge 18 (12.9%) 12 (10.3%) 6 (26.1%) Sample types Urine 78 (55.7%) 74 (63.2%) 4 (17.4%) HVS 24 (17.1%) 15 (12.8%) 9 (39.1%) Aspirates 12 (8.6%) 12 (10.3%) 0 (0%) Wound 10 (7.1%) 10 (8.5%) 0 (0%) Sputum 9 (6.4%) 2 (1.7%) 7 (30.4%) Blood 7 (5.0%) 4 (3.4%) 3 (13.0%) PID-Pelvic inflammatory disease, BPH-Benign prostatic hyperplasia, UTI-Urinary tract infection, HVS-High vaginal swab, n-Number of isolates. University of Ghana http://ugspace.ug.edu.gh 31 Figure 4.1 Antibiogram of E. coli and K. pneumoniae in TTH 0 20 40 60 80 100 120 O v er al l % r es is ta n ce a m o n g s tu d y i so la te s Antimicrobial agents Overall resistance University of Ghana http://ugspace.ug.edu.gh 32 4.1 Phenotypic Expression of ESBLs Sixty two (44.3%) of the 140 clinical isolates were ESBL-producers. Of these, 83.9% (n=52) were E. coli and 16.1% (n=10) were K. pneumoniae isolates as shown in Table 4.2. The proportion of ESBL-producing isolates were found to be relatively higher (p=0.14) in adults (15-65 years) than in neonates (< 28 days) as illustrated in Figure 4.2. However, age had no significant association with respect to ESBL-producing enterobacteria (p=0.14). Univariate analysis using patient’s characteristics and their association with ESBLs were performed as shown in Table 4.3. Diagnosis and gender showed no significant association with ESBL-producing enterobacteria. Patients who reported their previous medication as having been prescribed by a Physician as well as those who completed their previous medication showed significant associations with ESBL-producing enterobacteria (p=0.0008 and 0.0399 respectively). University of Ghana http://ugspace.ug.edu.gh 33 Table 4.2 Phenotypic Expression of ESBLs ESBL-producers as determined by phenotypic tests Isolated species Urine HVS Aspirate Wound Sputum Blood Total ESBL (%) Escherichia coli n (ESBL%) 33 (44.6%) 4 (26.7%) 8 (66.7%) 5 (50%) 1 (50%) 1 (25%) 52 (83.9%) Klebsiella pneumoniae n (ESBL%) 2 (20%) 5 (55.6%) 0 (0.0%) 0 (0.0%) 1 (14.3%) 2 (66.7%) 10 (16.1%) Total ESBL-producers 35 (44.9%) 9 (37.5%) 8 (66.7%) 5 (50.0%) 2 (22.2%) 3 (42.9%) 62 (44.3%) *n is the number of isolates. University of Ghana http://ugspace.ug.edu.gh 34 Figure 4.2 ESBL-producers isolated from various age groups * Where d- days and y- years, ≤28- neonates, 29d-1y- infants, >1y-5y- pediatrics, >5y-15y- other children, > 15y-65y- adults, >65y- elderly 0.0 10.0 20.0 30.0 40.0 50.0 60.0 70.0 80.0 90.0 ≤28d 29d-1y >1y-5y >5y-15y >15y-65y >65y P er ce n ta g e o f E S B L i so la te s Age distribution of ESBL-producing isolates percentage University of Ghana http://ugspace.ug.edu.gh 35 Table 4.3 Univariate Analysis of Patient’s Characteristics in Relation to ESBL Variables Total n=140 ESBL Odds ratio (95% CI) P-value Producers n= 62 Non-producers n=78 Socio-demographic data Age group ≤28d 0 (0.00%) 1 (1.28%) 0 (0-0) 1 29d-1y 0 (0.00%) 3 (3.85%) 0 (0-0) 0.26 >1y-5y 2 (3.23%) 0 (0.00%) 0 (0-0) 0.2 >5y-15y 4 (6.45%) 1 (1.28%) 5.03 (0.55-46.18) 0.18 >15y-65y 49 (79.03%) 65 (83.33%) 0.95 (0.58-1.56) 0.9 >65y 7 (11.29%) 8 (10.26%) 1.10 (0.38-3.20) 1 Male 18 (29.0%) 26 (33.3%) 0.82 (0.40-1.69) 0.71 Female 44 (71.0%) 52 (66.7%) Diagnosis queried by Clinician Wound abscess 5 (8.1%) 5 (6.4%) 1.30 (0.36-4.70) 0.75 Sepsis 3 (4.8%) 4 (5.1%) 0.94 (0.20-2.23) 1 Chest pain 0 (0.0%) 2 (2.6%) 0.00 (0.00-0.00) 0.5 PID 3 (4.8%) 1 (1.3%) 3.92 (0.40-38.60) 0.32 BPH 2 (2.3%) 3 (3.8%) 0.83 (0.13-5.15) 1 Chronic cough 3 (4.8%) 4 (5.1%) 0.94 (0.20-4.37) 1 Peritonitis 7 (11.3%) 3 (3.8%) 3.18 (1.05-12.86) 0.11 Ascites 1 (1.6%) 1 (1.3%) 1.26 (0.08-20.60) 1 Lower abdominal pain 1 (1.6%) 1 (1.3%) 1.26 (0.08-20.60) 1 UTI/ painful urination 32 (51.6%) 41 (52.6%) 0.96 (0.49-0.88) 1 Vaginal discharge 5 (8.1%) 13 (16.7%) 0.44 (0.15-1.31) 0.2 Sample type Urine 34 (54.8%) 44 (56.4%) 0.97 (0.56-1.70) 1 HVS 9 (14.5%) 15 (19.2% 0.75 (0.31-1.84) 0.66 Aspirates 8 (12.9%) 4 (5.1%) 2.52 (0.72-8.74) 0.23 Wound 5 (8.1%) 5 (6.4%) 1.26 (0.35-4.54) 0.75 Sputum 3 (4.8%) 6 (7.7%) 0.63 (0.15-2.62) 0.73 Blood 3 (4.8%) 4 (5.1%) 0.94 (0.20-4.37) 1 Previous antibiotics medication -Prescribed by doctor 53 (85.5%) 47 (60.3%) 3.88 (1.68-8.99) *0.0008 -Self-prescribed 9 (14.5%) 31 (39.7%) Completion of previous medication 49 (79.0%) 50 (64.1%) 2.11 (0.98-4.54) *0.0399 *Shows significant association in relation to ESBLs. CI-Confidence interval, PID-Pelvic inflammatory disease, BPH-Benign prostatic hyperplasia, UTI-Urinary tract infection, HVS- High vaginal swab. University of Ghana http://ugspace.ug.edu.gh 36 4.2 Antimicrobial Resistance among ESBL-Producers and Non-ESBL Producers Comparison of antibiograms of ESBL-producers and non-ESBL-producers as per Kirby-Bauer susceptibility testing method is illustrated in Figure 4.3. Significant differences in antibiotic resistance between ESBL-producers and non-ESBL-producers were observed for cefuroxime (p=0.00001), gentamicin (p=0.004) and amikacin (p=0.02). However, all isolates used in this study were susceptible to meropenem. Of the ESBL-producers, 22.6% (n=14) were multidrug resistant (MDR) strains whereas 17.9% (n=14) non-ESBL-producers, were observed to be MDR (Table 4.8). University of Ghana http://ugspace.ug.edu.gh 37 Figure 4.3 Antibiogram of ESBL-producers and non-ESBL producers (April to June 2015) in TTH *Antimicrobial resistance showing significant difference between ESBL-producers and non-ESBL-producers University of Ghana http://ugspace.ug.edu.gh 38 4.3 Detection of ESBL Genotypes In this study, two DNA extractions methods (Qiagen extraction and boiling lysate) were assessed to determine their performance in providing DNA templates for a positive ESBL amplification test. Altogether, ESBL PCR positivity based on either of the extraction procedures was crudely considered as the gold standard. Both Qiagen and boiling extraction methods used, showed good concordance as extraction methods for DNA templates for TEM, SHV and CTX-M-1 gene amplification (Κ=97%, K=96% and K=93% respectively). Both extraction methods had good (>83%) sensitivity and specificity with high negative predictive values (>82) for each ESBL gene. The total number of ESBL gene positivity determined from DNA templates prepared with either of the extraction methods did not significantly differ (p=0.61). Extended Spectrum β-Lactamase-producing E. coli and K. pneumoniae isolates were characterized for BlaTEM, BlaSHV and BlaCTX-M genes. About seventy four percent (74.2%) of the ESBL genotypes expressed BlaCTX-M-1 genes followed by 62.9% BlaTEM and 16.1% BlaSHV. None of the isolates expressed genes for CTX-M 2 and CTX-M 9. About 6.5% (n=4) of the isolates harbored all three genes (BlaTEM, BlaSHV and BlaCTX-M 1). Overall, 12.9% (n=8) of the isolates that phenotypically expressed ESBLs, did not harbour any identifiable Beta-lactamase genes as shown in Table 4.5. University of Ghana http://ugspace.ug.edu.gh 39 Table 4.4 Performance of DNA Extraction Procedures for ESBL Genotypic Detection Resistant genes Methods Number of true positives Prevalence (%) Sensitivity (%) Specificity (%) Positive predictive value Negative predictive value Kappa value TEM (n=62) QIAGEN 36 58 100 88 92 100 96.5 BOILED 36 63 92 100 100 88 SHV (n=62) QIAGEN 10 19 83 100 100 96 96.3 BOILED 10 16 100 96 83 100 CTX-M 1 (n=62) QIAGEN 42 71 95 98 91 88 92.9 BOILED 42 74 91 88 95 78 *n is the number of isolates. University of Ghana http://ugspace.ug.edu.gh 40 Table 4.5 ESBL Genotypes in E. coli and K. pneumoniae Isolates that Phenotypically Expressed ESBLs Resistance genes Number of positive genotypes TEM only 4 (6.5%) SHV only 2 (3.2%) CTX-M 1 only 11 (17.7%) CTX-M 2 only 0 (0.0%) CTX-M 9 only 0 (0.0%) TEM + SHV 2 (3.2%) TEM + CTX-M-1 29 (46.8%) SHV + CTX-M-1 2 (3.2%) TEM + SHV + CTX-M-1 4 (6.5%) ESBL expressing isolates without identifiable ESBL genes 8 (12.9%) Total 62 (44.3%) Total TEM 39 (62.9%) Total SHV 10 (16.1%) Total CTX-M-1 46 (74.2%) University of Ghana http://ugspace.ug.edu.gh 41 CHAPTER FIVE DISCUSSION A relatively high proportion (44.3%) of ESBL-producing E. coli and K. pneumoniae in TTH, Ghana was recorded in the present study. The level of ESBL reported is higher compared to that reported by Aibinu et al., (2003) in Nigeria (20%, 8 of 40). The prevalence recorded in this study is comparable to that documented by Obeng-Nkrumah et al., (2013) in Korle-Bu Teaching Hospital (49.3%; n=148/300, p=0.32) but lower than the prevalence reported by Feglo et al., (2013) from Komfo-Anokye Teaching Hospital (57.8%; n=234/405, p=0.006). Escherichia coli and Klebsiella pneumoniae are responsible for common community and hospital acquired infections. These organisms have become multidrug resistant over time, making infections they cause difficult to treat (Blomberg et al., 2005). The major resistance mechanism expressed by E. coli and K. pneumoniae are ESBLs; and they remain the commonest ESBL producing organisms worldwide (Jacoby and Munoz-Price, 2005). The ESBL prevalence amongst clinical isolates within institutions varies greatly from country to country. Across Europe there is varying prevalence, with low occurrence of 1% and 3% in the Netherlands and Sweden respectively (Rodriguez-Villalobos et al., 2011), to as high as 42% in an intensive care unit in France (Branger et al., 1998). The general antimicrobial susceptibility pattern in the present study showed an overall high resistance prevalence among the antibiotics used. Significant difference in antimicrobial resistance between ESBL-producers and non-ESBL-producers were observed for cefuroxime, gentamicin and amikacin (p=0.00001, 0.004 and 0.02 respectively). The higher antibiotic resistance levels recorded in the present study is similar to the study conducted by Obeng-Nkrumah et al., (2013), where they University of Ghana http://ugspace.ug.edu.gh 42 documented high antimicrobial resistance among Enterobacteriaceae in KBTH and reported that, prevalence is on the rise. Other works elsewhere in Ghana have reported similar conclusions (Adu- Sarkodie, 2010; Feglo et al., 2013). In the present study, all the isolates were susceptible to meropenem. This may be attributed to the fact that, meropenem is a very expensive board-spectrum antimicrobial agent usually prescribed for serious infections. More so, meropenem administration is parenteral and is less likely to be abused. Multidrug Resistant (MDR) is an acquired non-susceptibility to at least one agent in three or more antimicrobial categories (Magiorakos et al., 2012). In the present study, isolates that expressed resistance to three or more antimicrobials categories (penicillins, aminoglycosides, cephalosporins, carbapenems, tetracyclines, fluoroquinolones, quinolones and phenicol) were referred to as multidrug-resistant. Approximately 23% ESBL-producers were observed to be MDR, compared to non-ESBL-producers (18%). These figures are similar to those reported by Obeng-Nkrumah et al., (2013) in KBTH, with statistically no significant difference between ESBL-producers and non- ESBL-producers in association with MDR. The levels of MDRs reported in this study could be attributed to the indiscriminate sale and misuse of antibiotics in Ghana (Newman et al., 2011), the failure to complete antibiotic treatment and the use of antimicrobials in animal husbandry (Tajick, 2006). In the present study, majority of the isolates expressed BlaCTX-M-1 genes (74.2%). Similar findings were reported in a study by Hackman et al., (2014) in Accra, where 78% of their isolates were positive for CTX-M-1 group ESBL genes. These results are, however, lower compared to the prevalence reported by Feglo et al., (2013) in Kumasi with 93.5% (n=72) of their isolates expressing BlaCTX-M-1 genes in E. coli. Additionally, Feglo et al., (2013) reported that about 90% of the isolates University of Ghana http://ugspace.ug.edu.gh 43 co-harboured CTX-M-1 and TEM. The percentage reported in their study was higher compared to the figure (approximately 50%) observed in the present study. The CTX-M ESBLs commonly found in E. coli isolates are increasingly reported (Coque et al., 2008) and the level of resistance conferred by these enzymes to cefotaxime and ceftazidime is high (Bonnet, 2004). The predominance of these enzymes among the study isolates may explain the widespread antimicrobial resistance among the isolates. The spread of these resistant organisms could have occurred through hospital cross infections, improper hand hygiene practices especially after visiting the lavatory, improper use of disinfectants and overcrowding in communities (Raymond et al., 2007). Among the ESBL expressing isolates, none expressed genes for CTX-M 2 and CTX-M 9. Also, ESBL expressing isolates without identifiable ESBL genes were found to be 12.9%. This observation suggests that the isolates could possess other ESBL enzyme types besides TEM, SHV and CTX-M-1 genes which were not sought for in the present study. Often, seriously ill patients stand the risk of developing infections caused by ESBL-producing organisms. This is due to prolonged hospital stays and use of invasive medical devices (urinary catheters, endotracheal tubes, central venous lines) (Paterson and Bonomo, 2005). In the present study, univariate analysis on some patient’s characteristics in relation to ESBLs was conducted. Patients who reported their previous treatment with antibiotics prescribed by a Physician were more likely to be infected with ESBL-producing organisms. Patients who also completed their previous medication were also found to be associated with ESBL-producing enterobacteria. Heavy antibiotic use has been reported as a factor for acquisition of an ESBL-producing enterobacteria (Pena et al., 1997; Ariffin et al., 2000; Lautenbach et al., 2001). However in the present study, this risk factor was not determined owing to the limited information from the patient’s questionnaire. University of Ghana http://ugspace.ug.edu.gh 44 In order to ensure empirical therapy, reduction in antimicrobial abuse and not compromising patients’ health, there is an urgent need for routine laboratory detection of ESBL-producing isolates. Proper antimicrobial administration to buttress the usefulness of active hospital surveillance programs for drug resistant bacteria is also warranted. 5.1 Limitations of the Study The study depended on laboratory generated results, and so relevant patient’s clinical information that would have provided more insight into the risk factors associated with the occurrence of ESBLs were missing. The limited time and budget allocated for the study, restricted the number of isolates (140) involved in the study. University of Ghana http://ugspace.ug.edu.gh 45 CHAPTER SIX CONCLUSIONS AND RECOMMENDATIONS 6.1 Conclusions The aim of the study was to determine the prevalence of ESBLs in clinical isolates of E. coli and K. pneumoniae from patients attending the Tamale Teaching Hospital (TTH). There is relatively high proportion (44.3%) of ESBL-producers among E. coli and K. pneumoniae in TTH. The results generated during the study period, revealed that, there is high antimicrobial resistance amongst E. coli and K. pneumoniae to the commonly prescribed antimicrobial drugs in TTH, due to ESBL- production. However, resistance levels of isolates to amikacin is low. Overall, meropenem proved useful against the isolates tested and is therefore recommended in the treatment for infections caused by these isolates. Extended Spectrum Beta-Lactamase producing isolates that harbored all three genes (BlaTEM, BlaSHV and BlaCTX-M-1) were 4 (6.5%). Those without identifiable genes were 8 (12.9%). Meanwhile, among the ESBL expressing isolates, none expressed genes for CTX-M 2 and CTX-M 9. University of Ghana http://ugspace.ug.edu.gh 46 6.2 Recommendations 1. It is recommended that more data covering a wider sample type (including non-fermenters like, Pseudomonas and Proteus mirabilis) be collected to determine more accurately the situation of ESBL-producers and provide a better understanding of the epidemiology associated with ESBL-producing strains in TTH in further studies. 2. It is also recommended that further studies with the sequencing of ESBL-producing isolates obtained from TTH be performed to determine their relatedness. University of Ghana http://ugspace.ug.edu.gh 47 REFERENCES Adu-Sarkodie, Y. (2010). Extended spectrum [beta]-lactamase production at the Komfo Anokye Teaching Hospital, Kumasi, Ghana. [doi: 10.1016/j.ijid.2010.02.1559]. International Journal of Infectious Diseases, 14(1): e33-e34. Aibinu, I. E., Ohaegbulam V. C., Adenipekun, E. A., Ogunsola, F. T., Odugbemi, T. O., Mee, B. J. (2003). Extended-spectrum Beta-lactamase enzymes in clinical isolates of Enterobacter species from Lagos, Nigeria. Journal of Clinical Microbiology. 41: 2197–2200. AitMhand, R., Soukri, A., Moustaoui, N., Amarouch, H., ElMdaghri, N., Sirot, D., & Benbachir, M. (2002). Plasmid-mediated TEM-3 extended-spectrum β-lactamase production in Salmonella typhimurium in Casablanca. Journal of Antimicrobial Chemotherapy, 49(1): 169-172. Apisarnthanarak, A., Kiratisin, P., Saifon, P., Kitphati, R., Dejsirilert, S., & Mundy, L. M. (2007). Clinical and molecular epidemiology of community-onset, extended-spectrum β- lactamase-producing Escherichia coli infections in Thailand: a case-case-control study. American Journal of Infection Control, 35(9): 606-612. Ariffin, H., Navaratnam, P., Mohamed, M., Arasu, A., Abdullah, W. A., Lee, C. L., & Peng, L. H. (2000). Ceftazidime-resistant Klebsiella pneumoniae bloodstream infection in children with febrile neutropenia. International Journal of Infectious Diseases, 4(1): 21-25. Bell, J. M., Turnidge, J. D., Gales, A. C., Pfaller, M. A., Jones, R. N., & Sentry APAC Study Group. (2002). Prevalence of extended spectrum β-lactamase (ESBL)-producing clinical University of Ghana http://ugspace.ug.edu.gh 48 isolates in the Asia-Pacific region and South Africa: regional results from SENTRY Antimicrobial Surveillance Program (1998–99). Diagnostic Microbiology and Infectious Disease, 42(3): 193-198. Ben-Hamouda, T., Foulon, T., & Ben-Mahrez, K. (2004). Involvement of SHV-12 and SHV-2a encoding plasmids in outbreaks of extended-spectrum β-lactamase-producing Klebsiella pneumoniae in a Tunisian neonatal ward. Microbial Drug Resistance, 10(2): 132-138. Blomberg, B., Jureen, R., Manji, K. P., Tamim, B. S., Mwakagile, D. S., Urassa, W. K., Fataki, M., Msangi, V., Tellevik, M. G., Maselle, S. Y., & Langeland, N. (2005). High rate of fatal cases of pediatric septicemia caused by gram-negative bacteria with extended- spectrum beta-lactamases in Dar es Salaam, Tanzania. Journal of Clinical Microbiology, 43(2): 745-749. Bonnet, R. (2004). Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrobial Agents and Chemotherapy, 48(1): 1-14. Bradford, P. A., Urban, C., Mariano, N., Projan, S. J., Rahal, J. J., & Bush, K. (1997). Imipenem resistance in Klebsiella pneumoniae is associated with the combination of ACT-1, a plasmid-mediated AmpC beta-lactamase, and the foss of an outer membrane protein. Antimicrobial Agents and Chemotherapy, 41(3): 563-569. Bradford, P. A. (2001). Extended-spectrum β-Lactamases in the 21st century: Characterization, epidemiology and detection of this important resistance threat. Clinical Microbiology Review, 14: 933-951. University of Ghana http://ugspace.ug.edu.gh 49 Branger, C., Lesimple, A. L., Bruneau, B., Berry, P., & Lambert-Zechovsky, N. (1998). Long- term investigation of the clonal dissemination of Klebsiella pneumoniae isolates producing extended-spectrum β-lactamases in a university hospital. Journal of Medical Microbiology, 47(3): 201-209. Bush, K., & Jacoby, G. A. (2010). Updated functional classification of β-lactamases. Antimicrobial Agents and Chemotherapy, 54(3): 969-976. Cantón, R., Novais, A., Valverde, A., Machado, E., Peixe, L., Baquero, F., & Coque, T. M. (2008). Prevalence and spread of extended‐spectrum β‐lactamase‐producing Enterobacteriaceae in Europe. Clinical Microbiology and Infection, 14(1): 144-153. Carattoli, A., Lovari, S., Franco, A. (2005). Extended-spectrum β-lactamases in Escherichia coli isolated from dogs and cats in Rome, Italy, from 2001 to 2003. Antimicrobial Agents Chemotherapy, 49: 833-835. Carter, M. W., Oakton, K. J., Warner, M., & Livermore, D. M. (2000). Detection of extended- spectrum β-lactamases in Klebsiellae with the Oxoid combination disk method. Journal of Clinical Microbiology, 38(11): 4228-4232. Casewell, M. W., & Desai, N. (1983). Survival of multiply-resistant Klebsiella aerogenes and other Gram-negative bacilli on finger-tips. Journal of Hospital Infection, 4(4): 350-360. Chaudhary, U., & Aggarwal, R. (2004). Extended spectrum-lactamases (ESBL)-An emerging threat to clinical therapeutics. Indian Journal of Medical Microbiology, 22(2): 75. University of Ghana http://ugspace.ug.edu.gh 50 Chopra, I., O’Neill, A. J., & Miller, K. (2003). The role of mutators in the emergence of antibiotic- resistant bacteria. Drug Resistance Updates, 6(3): 137-145. Clinical and Laboratory Standards Institute, CLSI. (2012). Performance standards for antimicrobial susceptibility testing; Twenty-second informational supplement. CLSI Publication M100-S22, M02- A11 and M07- A09. Pennsylvania, 32(3): 46. Coque, T. M., Baquero, F., & Canton, R. (2008). Increasing prevalence of ESBL-producing Enterobacteriaceae in Europe. Euro surveillance: bulletin europeen sur les maladies transmissibles= European Communicable Disease Bulletin, 13(47): 5437-5453. Dbaibo, G. S. (1999). Old and new targets of antibacterial therapy. Le Journal medical libanais. The Lebanese Medical Journal, 48(4): 177-181. Emery, C. L., & Weymouth, L. A. (1997). Detection and clinical significance of extended- spectrum beta-lactamases in a tertiary-care medical center. Journal of Clinical Microbiology, 35(8): 2061-2067. Feglo, P., Adu-Sarkodie, Y., Ayisi, L., Jain, R., Spurbeck, R. R., Springman, A. C., Engleberg, N. C., Newman, D. W., Xi, C., & Walk, S. T. (2013). Emergence of a Novel Extended- Spectrum-β-Lactamase (ESBL)-producing, fluoroquinolone-resistant clone of extraintestinal pathogenic Escherichia coli in Kumasi, Ghana. Journal of Clinical Microbiology, 51(2): 728-730. Fluit, A. C., Visser, M. R., & Schmitz, F. J. (2001). Molecular detection of antimicrobial resistance. Clinical Microbiology Reviews, 14(4): 836-871. University of Ghana http://ugspace.ug.edu.gh 51 Gruteke, P., Goessens, W., Van Gils, J., Peerbooms, P., Lemmens-den Toom, N., van Santen- Verheuvel, M., Van Belkum, A., & Verbrugh, H. (2003). Patterns of resistance associated with integrons, the extended-spectrum β-lactamase SHV-5 gene, and a multidrug efflux pump of Klebsiella pneumoniae causing a nosocomial outbreak. Journal of Clinical Microbiology, 41(3): 1161-1166. Hackman, H. K., Brown, C. A., & Twum-Danso, K. (2014). Antibiotic Resistance Profile of Non- Extended Spectrum Beta-Lactamase-producing Escherichia coli and Klebsiella pneumoniae in Accra, Ghana. Journal of Biology, Agriculture and Healthcare, 4(14): 12- 16. Harris, A. D., Kotetishvili, M., Shurland, S., Johnson, J. A., Morris, J. G., Nemoy, L. L., & Johnson, J. K. (2007). How important is patient-to-patient transmission in extended- spectrum β-lactamase< i> Escherichia coli acquisition. American Journal of Infection Control, 35(2): 97-101. Ho, P. L., Tsang, D. N. C., Que, T. L., Ho, M., Yuen, K. Y. (2000). Comparison of screening methods for detection of extended-spectrum β-lactamases and their prevalence among Escherichia coli and Klebsiella species in Hong Kong. Acta Pathologica Microbiologica et Immunologica Scandinavica (APMIS), 108(3): 237-240. HPA. (2004). Laboratory detection and reporting of bacteria with extended spectrum β- lactamases. National Standard Method. QSOP, 51(2): 2-14. http://www.cdc.gov/ncidod/hip/SURVEILL/NNIS.HTM (Accessed 10th July, 2014). University of Ghana http://ugspace.ug.edu.gh 52 Jacoby, G. A., & Munoz-Price, L. S. (2005). The new β-lactamases. New England Journal of Medicine, 352(4): 380-391. James, C. E., Mahendran, K. R., Molitor, A., Bolla, J. M., Bessonov, A. N., Winterhalter, M., & Pagès, J. M. (2009). How beta-lactam antibiotics enter bacteria: a dialogue with the porins. PLoS One, 4(5): e5453. Jonathan, N. (2005). Screening for extended-spectrum beta-lactamase-producing pathogenic enterobacteria in district general hospitals. Journal of Clinical Microbiology, 43(3): 1488- 1490. Kariuki, S., Corkill, J. E., Revathi, G., Musoke R, Hart, C. A. (2001). Molecular Characterization of a Novel plasmid-encoded cefotaximase (CTX-M-12) found in clinical Klebsiella pneumoniae isolates from Kenya. Antimicrobial Agents Chemotherapy, 45: 2141-2143. Kern, T., Hediger, S., Müller, P., Giustini, C., Joris, B., Bougault, C., Vollmer, W., & Simorre, J. P. (2008). Toward the Characterization of Peptidoglycan Structure and Protein− Peptidoglycan Interactions by Solid-State NMR Spectroscopy. Journal of the American Chemical Society, 130(17): 5618-5619. Kesah, C. N., & Odugbemi, T. O. (2002). Beta-lactamase detection in nosocomial bacterial pathogens in Lagos, Nigeria. The Nigerian Postgraduate Medical Journal, 9(4): 210-213. Lautenbach, E., Patel, J. B., Bilker, W. B., Edelstein, P. H., & Fishman, N. O. (2001). Extended- spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae: risk factors for infection and impact of resistance on outcomes. Clinical Infectious Diseases, 32(8): 1162-1171. University of Ghana http://ugspace.ug.edu.gh 53 Lee, S. G., Jeong, S. H., Lee, H., Kim, C. K., Lee, Y., Koh, E., Chong, Y., & Lee, K. (2009). Spread of CTX-M–type extended-spectrum β-lactamases among bloodstream isolates of< i> Escherichia coli and< i> Klebsiella pneumoniae from a Korean hospital. Diagnostic Microbiology and Infectious Disease, 63(1): 76-80. Liras, P., & Martín, J. F. (2006). Gene clusters for beta-lactam antibiotics and control of their expression: why have clusters evolved, and from where did they originate? International Microbiology, 9(1): 9. Livermore, D. M., Struelens, M., Amorim, J., Baquero, F., Bille, J., Canton, R., Henning, S., Gatermann, S., Marchese, A., Mittermayer, H., Nonhoff, C., Oakton, K. J., Praplan, F., Ramos, H., Schito, G. C., Van Eldere, J., Verhaegen, J., Verhoef, J., & Visser, M. R. (2002). Multicentre evaluation of the VITEK 2 Advanced Expert System for interpretive reading of antimicrobial resistance tests. Journal of Antimicrobial Chemotherapy, 49(2): 289-300. Livermore, D. M. (2003). Bacterial resistance: origins, epidemiology, and impact. Clinical Infectious Diseases, 36(1): S11-S23. Livermore, D. M., Canton, R., Gniadkowski, M., Nordmann, P., Rossolini, G. M., Arlet, G., & Woodford, N. (2007). CTX-M: changing the face of ESBLs in Europe. Journal of Antimicrobial Chemotherapy, 59(2): 165-174. Livermore, D. M., & Woodford, N. (2006). The β-lactamase threat in Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends in Microbiology, 14(9): 413-420. University of Ghana http://ugspace.ug.edu.gh 54 Luzzaro, F., Mezzatesta, M., Mugnaioli, C., Perilli, M., Stefani, S., Amicosante, G., Rossolini, G. M., & Toniolo, A. (2006). Trends in production of extended-spectrum β-lactamases among enterobacteria of medical interest: report of the second Italian nationwide survey. Journal of Clinical Microbiology, 44(5): 1659-1664. Martínez-Martínez, L., Pascual, A., Hernández-Allés, S., Alvarez-Díaz, D., Suárez, A. I., Tran, J., Benedi, V. J., & Jacoby, G. A. (1999). Roles of β-lactamases and porins in activities of carbapenems and cephalosporins against Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy, 43(7): 1669-1673. Magiorakos, A. P., Srinivasan, A., Carey, R. B., Carmeli, Y., Falagas, M. E., Giske, C. G., Harbarth, S., Hindler, J. F., Kahlmeter, G., Olsson-Liljequist, B., Paterson, D. L., Rice, L. B., Stelling, J., Struelens, M. J., Vatopoulos, A., Weber, J. T., & Monnet, D. L. (2012). Multidrug‐resistant, extensively drug‐resistant and pandrug‐resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clinical Microbiology and Infection, 18(3): 268-281. Miró, E., Mirelis, B., Navarro, F., Rivera, A., Mesa, R. J., Roig, M. C., Gomez, L., & Coll, P. (2005). Surveillance of extended-spectrum β-lactamases from clinical samples and faecal carriers in Barcelona, Spain. Journal of Antimicrobial Chemotherapy, 56(6): 1152-1155. Ndugulile, F., Jureen, R., Harthug, S., Urassa, W., & Langeland, N. (2005). Extended Spectrum β-Lactamases among Gram-negative bacteria of nosocomial origin from an Intensive Care Unit of a tertiary health facility in Tanzania. BioMed Central infectious Diseases, 5(1): 86. University of Ghana http://ugspace.ug.edu.gh 55 Newman, M. J., Frimpong, E., Donkor, E. S., Opintan, J. A., & Asamoah-Adu, A. (2011). Resistance to antimicrobial drugs in Ghana. Infection and Drug Resistance, 4: 215. Newman, M. J., Frimpong, E., Asamoah-Adu, A., Sampane-Donkor, E. (2004). Resistance to antimicrobial drugs in Ghana. Ghana Health Service Project Report; 1-43. Nordmann, P., Cuzon, G., & Naas, T. (2009). The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. The Lancet Infectious Diseases, 9(4): 228-236. Nordmann, P., & Guibert, M. (1998). Extended-spectrum β-lactamases in Pseudomonas aeruginosa. Journal of Antimicrobial Chemotherapy, 42(2): 128-131. Obeng-Nkrumah, N., Twum-Danso, K., Krogfelt, K. A., & Newman, M. J. (2013). High levels of extended-spectrum beta-lactamases in a major teaching hospital in Ghana: the need for regular monitoring and evaluation of antibiotic resistance. The American Journal of Tropical Medicine and Hygiene, 89(5): 960-964. Pai, H., Lyu, S., Lee, J. H., Kim, J., Kwon, Y., Kim, J. W., & Choe, K. W. (1999). Survey of extended-spectrum β-lactamases in clinical isolates of Escherichia coli and Klebsiella pneumoniae: prevalence of TEM-52 in Korea. Journal of Clinical Microbiology, 37(6): 1758-1763. Paterson, D. L., & Bonomo, R. A. (2005). Extended-spectrum β-lactamases: a clinical update. Clinical Microbiology Reviews, 18(4): 657-686. Pena, C., Pujol, M., Ricart, A., Ardanuy, C., Ayats, J., Linares, J., Garrigosaf, F., Ariza J., & Gudiol, F. (1997). Risk factors for faecal carriage of Klebsiella pneumoniae producing University of Ghana http://ugspace.ug.edu.gh 56 extended spectrum β-lactamase (ESBL-KP) in the intensive care unit. Journal of Hospital Infection, 35(1): 9-16. Pfaller, M. A., & Segreti, J. (2006). Overview of the epidemiological profile and laboratory detection of extended-spectrum β-Lactamases. Clinical Infectious Diseases, 42(4): S153- S163. Pitout, J. D., Hanson, N. D., Church, D. L., & Laupland, K. B. (2004). Population-based laboratory surveillance for Escherichia coli–producing extended-spectrum β-lactamases: importance of community isolates with blaCTX-M genes. Clinical Infectious Diseases, 38(12): 1736-1741. Pitout, J. D., & Laupland, K. B. (2008). Extended-spectrum β-lactamase-producing Enterobacteriaceae: an emerging public-health concern. The Lancet Infectious Diseases, 8(3): 159-166. Rastogi, V., Nirwan, P. S., Jain, S., & Kapil, A. (2010). Nosocomial outbreak of septicaemia in neonatal intensive care unit due to extended spectrum β-lactamase producing Klebsiella pneumoniae showing multiple mechanisms of drug resistance. Indian Journal of Medical Microbiology, 28(4): 380. Raymond, J., Nordmann, P., Doit, C., Thien, H. V., Guibert, M., Ferroni, A., & Aujard, Y. (2007). Multidrug-resistant bacteria in hospitalized children: a 5-year multicenter study. Pediatrics, 119(4): e798-e803. Rodriguez-Villalobos, H., Bogaerts, P., Berhin, C., Bauraing, C., Deplano, A., Montesinos, I., De Mendonca, R., Jans, B., & Glupczynski, Y. (2011). Trends in production of extended- University of Ghana http://ugspace.ug.edu.gh 57 spectrum β-lactamases among Enterobacteriaceae of clinical interest: results of a nationwide survey in Belgian hospitals. Journal of Antimicrobial Chemotherapy, 66(1): 37-47. Samaha-Kfoury, J. N., & Araj, G. F. (2003). Recent developments in β-lactamases and extended spectrum β-lactamases. BMJ: British Medical Journal, 327(7425): 1209. Sarma, J. B., & Ahmed, G. U. (2010). Prevalence and risk factors for colonisation with extended spectrum β-lactamase producing enterobacteriacae vis-à-vis usage of antimicrobials. Indian Journal of Medical Microbiology, 28(3): 217. Schwaber, M. J., Raney, P. M., Rasheed, J. K., Biddle, J. W., Williams, P., McGowan, J. E., & Tenover, F. C. (2004). Utility of NCCLS guidelines for identifying extended-spectrum β- lactamases in non-Escherichia coli and non-Klebsiella spp. of Enterobacteriaceae. Journal of Clinical Microbiology, 42(1): 294-298. Shah, A. A., Hasan, F., Ahmed, S., & Hameed, A. (2004). Characteristics, epidemiology and clinical importance of emerging strains of Gram-negative bacilli producing extended- spectrum β-lactamases. Research in Microbiology, 155(6): 409-421. Shannon, K. P., King, A., Phillips, I., Nicolas, M. H., & Philippon, A. (1990). Importation of organisms producing broad-spectrum SHV-group β-lactamases into the United Kingdom. Journal of Antimicrobial Chemotherapy, 25(3): 343-351. Shiraki, Y., Shibata, N., Doi, Y., & Arakawa, Y. (2004). Escherichia coli producing CTX-M-2 beta-lactamase in cattle, Japan. Emerging Infectious Diseases, 10(1): 69-75. University of Ghana http://ugspace.ug.edu.gh 58 Song, W., Kim, J. S., Kim, H. S., Yong, D., Jeong, S. H., Park, M. J., & Lee, K. M. (2006). Increasing trend in the prevalence of plasmid-mediated AmpC β-lactamases in Enterobacteriaceae lacking chromosomal ampC gene at a Korean university hospital from 2002 to 2004. Diagnostic Microbiology and Infectious Disease, 55(3): 219-224. Spanu, T., Luzzaro, F., Perilli, M., Amicosante, G., Toniolo, A., Fadda, G., & Italian ESBL Study Group. (2002). Occurrence of extended-spectrum β-lactamases in members of the family Enterobacteriaceae in Italy: implications for resistance to β-lactams and other antimicrobial drugs. Antimicrobial Agents and Chemotherapy, 46(1): 196-202. Sridhar Rao, P. N., Basavarajappa, K. G., & Krishna, G. L. (2008). Detection of extended spectrum beta-lactamase from clinical isolates in Davangere. Indian Journal of Pathology and Microbiology, 51(4): 497. Tajick, M. A. (2006). Detection of antibiotic residue in chicken meat using TLC. International Journal of Poultry Science, 5(7): 611-612. Tamale Teaching Hospital. Our Mandate. http://www.tamaleteachinghospital.org. (Accessed 15th December 2014). Tenover, F. C., Mohammed, M. J., Gorton, T. S., & Dembek, Z. F. (1999). Detection and reporting of organisms producing extended-spectrum β-lactamases: survey of laboratories in Connecticut. Journal of Clinical Microbiology, 37(12): 4065-4070. Tenover, F. C., Mohammed, M. J., Stelling, J. (2001). Ability of laboratories to detect emerging antimicrobial resistance: proficiency testing and quality control results from the World University of Ghana http://ugspace.ug.edu.gh 59 Health Organization’s external quality assurance system for antimicrobial susceptibility testing. Journal of Clinical Microbiology, 39: 241-250 Thomson, K. S., and Smith, E. M. (2000). The new β-lactamases of Gram-negative bacteria at the dawn of the new millennium. Microbes and Infection, 2(10): 1225-1235. Tullus, K. J. E. L. L., Berglund, B., Fryklund, B., Kühn, I., & Burman, L. G. (1988). Epidemiology of fecal strains of the family Enterobacteriaceae in 22 neonatal wards and influence of antibiotic policy. Journal of Clinical Microbiology, 26(6): 1166-1170. Tumbarello, M., Sanguinetti, M., Montuori, E., Trecarichi, E. M., Posteraro, B., Fiori, B., Citton, R., D’lnzeo, T., Fadda, G., Cauda, R., & Spanu, T. (2007). Predictors of mortality in patients with bloodstream infections caused by extended-spectrum-β-lactamase- producing Enterobacteriaceae: importance of inadequate initial antimicrobial treatment. Antimicrobial Agents and Chemotherapy, 51(6): 1987-1994. Vollmer, W., & Bertsche, U. (2008). Murein (peptidoglycan) structure, architecture and biosynthesis in Escherichia coli. Biochimica et Biophysica Acta (BBA)-Biomembranes, 1778(9): 1714-1734. Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A., Marquine, M., & Raymond, M. (2004). The unique mutation in ace‐1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Molecular Biology, 13(1): 1-7. Weldhagen, G. F., Poirel, L., & Nordmann, P. (2003). Ambler class A extended-spectrum β- lactamases in Pseudomonas aeruginosa: novel developments and clinical impact. Antimicrobial Agents and Chemotherapy, 47(8): 2385-2392. University of Ghana http://ugspace.ug.edu.gh 60 Woodford, N., Fagan, E. J., & Ellington, M. J. (2006). Multiplex PCR for rapid detection of genes encoding CTX-M extended-spectrum β-lactamases. Journal of Antimicrobial Chemotherapy, 57(1): 154-155. Yagi, T., Kurokawa, H., Shibata, N., Shibayama, K., & Arakawa, Y. (2000). A preliminary survey of extended-spectrum β-lactamases (ESBLs) in clinical isolates of Klebsiella pneumoniae and Escherichia coli in Japan. Federation of European Microbiological Societies (FEMS) Microbiology letters, 184(1): 53-56. University of Ghana http://ugspace.ug.edu.gh 61 APPENDICES Appendix I Informed Consent Form Subject Path. Number: ………………… Date: ……..……… CONSENT TO PARTICIPATE IN A RESEARCH PROJECT TITLE OF PROJECT: Extended Spectrum Beta-Lactamase Genes in Clinical Isolates of Escherichia coli and Klebsiella pneumoniae from the Tamale Teaching Hospital. The contents will be explained to the participants in the language that he/she is most comfortable with. Patients/ Guardians will be requested to assist in the provision of information for the study. This form describes the nature and purpose of the study, explanation of procedures, benefits, refusal/withdrawal, rights and complaints, confidentiality, research authorization for use, and disclosure of your health care information. Nature and Purpose of the Study The study is been conducted by the team of investigators from Noguchi Memorial Institute for Medical Research (NMIMR), University of Ghana, Legon. You are being invited to participate in a research project because you are within the area of interest under study and this is the first of its kind to be conduct in the Northern part of Ghana. The purpose of the study is to determine the occurrence of ESBLs in clinical isolates of E. coli and K. pneumoniae in Tamale Teaching Hospital (TTH). University of Ghana http://ugspace.ug.edu.gh 62 Benefits There are no direct benefits by participating in this project. However, you can also request for your ESBL test results. In case you want your ESBL test results, please prompt the investigator explaining the study to you. We will also request that you make your telephone number available which we will use to contact you to come for your ESBL test results which would be in a sealed envelope for your collection from the Doctor in Charge of the ward/unit. The result will also be accompanied with the antibiogram outcome to know the appropriate antibiotics for effective treatment. Explanation of Procedures: The procedure will be well explained to you in the language you are most comfortable with before commencement. You will be asked to answer a questionnaire about your age, education level, occupation, ethnicity, marital status, income and risk factors for ESBL infection such as indiscriminate abuse of antibiotics, under/ over-use of antibiotics and the quality of antibiotics on the Ghanaian market. Based on your clinical diagnosis, the appropriate clinical specimen will be collected and investigated for ESBL-producers in the laboratory. Confidentiality and Research Authorization for Use and Disclosure of Your Health Care Information. All information gathered from the study will remain confidential to the fullest extent of the law. Your identity as a participant will not be disclosed to any unauthorized persons; only the researchers will have access to the research materials, which will be kept under lock. The study participants will be coded with the code known only to the principal investigator and research staff. The principal investigator will only break the code if you require further treatment. Refusal/Withdrawal University of Ghana http://ugspace.ug.edu.gh 63 Participation in this study is voluntary; refusal to participate will involve no penalty or loss of medical care. You are free to withdraw consent and discontinue participation in this project at any time. Withdrawal or refusal to participate will not affect the care you receive from the ward/ unit. Rights and Complaints Any questions concerning the research project, participants can call Noah Obeng-Nkrumah, University of Ghana, Department of Microbiology, Korle-Bu on (+233 548 394763, email: successfulnoahforchrist@yahoo.com). Questions regarding any rights issues as a person in this research project and in the case of injury due to the project should be directed to the chairperson (Contact Tel; +233 302 666987, email: esugms@yahoo.com)of the Ethical and Protocol Review Committee of the University of Ghana Medical School, College of Health Sciences. University of Ghana http://ugspace.ug.edu.gh 64 Consent to participate in Research I, ………………………………………………………………………………………..………… � confirm that I have read the written information (or have had the information read to me) for the study on Extended Spectrum Beta-Lactamase Genes in Clinical Isolates of Escherichia coli and Klebsiella pneumoniae from the Tamale Teaching Hospital and that the study procedures have been explained to me by study staff during the consent process for this study. � confirm that I have had the opportunity to ask questions about this study and I am satisfied with the answers and explanations that have been provided. � understand that I grant access to data to authorised persons described in the information sheet. � have been given time and opportunity to consider taking part in this study. Tick above as appropriate (this decision will not affect your ability to enter the study): I consent to participate in the above research study. Signature of Subject �/ Guardian �: .......................................... Date............................... Signature of Interviewer: ............................................................ Date............................... Name of Impartial Witness: ………………………………...… Signature of Impartial Witness: ………………………………. Date............................... University of Ghana http://ugspace.ug.edu.gh 65 Appendix II Questionnaire Project Title: Extended Spectrum Beta-Lactamase Genes in Clinical Isolates of Escherichia coli and Klebsiella pneumoniae from the Tamale Teaching Hospital. Subject Path. Number ……….… Date …………… In-patient � Ward/ Folder number ……..………………...… Date/ Time admitted ……………… Period stayed ………… Brief diagnosis (from folder)………………………………..…………… Out-patient � Ghanaian � Non Ghanaian � Patient’s information for the study provided by Patient �/ Guardian � 1) Personal Profile Age ……………… Gender ………..……… Educational Level: None � Primary � Secondary � Tertiary � Occupation…………………………………………………………………………………………. Region……………………………………………………………………………………………… Marital status: Single � Married � Separated � Divorced � Widowed � Level of income per month: GH¢ 500 � 2) Medical History Number of hospital admission(s) in a year? …………………………………………..... Number of days spent for hospital admission in a year? ……………………………….. Number of hospital contacts within three months? …………………………………….. Admission to ICU? Yes � No � If yes, length of admission in ICU………………………………………………………. Admission time /stage of infection? ……………………………………………………… University of Ghana http://ugspace.ug.edu.gh 66 3) History on healthcare exposure Out-patient �/ In-patient � at the time of culture? Specimen type: blood �, urinary tract �, wound/ abscess �, respiratory tract �, vaginal discharge �, cerebrospinal fluid �, others � (please state) ………………………………..…… Etiological agent: E. coli �/ K. pneumoniae � (To be filled by interviewer)* Please note the following conditions: Community onset infections (cultured samples from patients <48 hours after admission, test positive), Healthcare-associated infections (positive cultures <48 hours on admission from another health facility), Hospital acquired or Nosocomial infections (positive cultures from patients after ≥48 hours on admission) Patient infection: Community acquired �/ Hospital acquired � (To be filled by interviewer)* Number of patients on the ward? …………………………….……………………. Number of household contacts with the outpatient? ………………………………. 4) History on antibiotics usage (To be filled by interviewer)* Who prescribed your previous antibiotics? Physician �, Self-diagnosed �, Unknown � Did you complete your previous medication? Yes � No � If no, why not? (Please state)……………………………………………………………………….. Are you currently on medications? Yes � No � If yes, which drugs? (Please state)………………………………………………………………….. How long have you been on the drug? < 1 month � 3 to 6 months � > 6 months � Number of antibiotics used in previous three months………………………………………………. University of Ghana http://ugspace.ug.edu.gh 67 Previous antibiotics therapy in three months: Cephalosporins �, days of use…………; Flouroquionolones �, days of use…….……; Aminoglycosides �, days of use…………; Cotrimoxazole �, days of use..........................…; others �, days of use………………………….. Intake of antibiotics before sample was collected for culture? Yes � No � 5) Life style characteristics Do you abuse drugs? Yes � No � If yes, which type of drugs? (Please state).......................................................................... Do you know the side effect of the drugs you abuse? Yes � No � If yes, (Please state)……………………………........................................................... Chronic alcoholic? Yes � No � Chronic smoker? Yes � No � 6) Comorbid conditions within 30 days prior to culture date: Neutropenia (absolute neutrophil count < 500/mm3)? ………; White blood cell count (…..x109/L) Chemotherapy treatment? Yes � No �; Dialyses? Yes � No �; Supplementary oxygen? Yes � No�; Diabetes? Yes � No �; Respiratory disease? Yes � No �; Surgical procedures? Yes � No �; Underlining infections? Yes � No � and Renal disease? Yes � No � The presence of indwelling devices such as: Central or arterial venous catheter? Yes � No � and Urinary catheter? Yes � No � prior to culture date. University of Ghana http://ugspace.ug.edu.gh 68 Any other information ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… ……………………………………………………………………………………………………… Please note * To be filled by interviewer. Thank you for the sample and your time!!! University of Ghana http://ugspace.ug.edu.gh 69 Appendix III Laboratory Protocols A. Enterobacteriaceae Identification Protocol using MINIBACT-E micro-test kits 1. About 4 to 6 morphologically similar colonies of test isolates were used to prepare dense suspension in a 2ml dH2O and mixed gently to obtain a homogenous suspension (in comparison with 1.0 McFarland as the standard). 2. 200µl of the solution was pipetted into each well of the micro-test kit embedded with their respective substrates (16 wells in all), covered and incubated aerobically at 35 - 37°C for 4 hours. 3. After the 4 hour incubation, about 1 to 2 drops of Nitrite (N), Phenyl-alanine (PD) and Indole (I) reagents were added to wells G, F and E respectively. Again, 2 drops of Voges Proskauer (VP 1) reagent was added to the VP-test well followed by 2 drops of (VP 2) reagent and mixed by puffing vigorously 5 times using the ‘puff flask’. This important part of the reaction was done by holding the flask 5-10 minutes, after which the panels were read. 4. The result form the VP test well was recorded first, followed by the other wells and outcome documented in terms of octal codes (4, 2 or 1). 5. The recorded octal codes were used to locate the corresponding strains of the enterobacteriaceae under investigation from the manufacturer’s identification manual to know their identity. University of Ghana http://ugspace.ug.edu.gh 70 D A T E S E R IA L / IS O L A T E N U M B E R S P E C IM E N T Y P E F R O M W H IC H I S O L A T E W A S O B T A IN E D G R A M IS O L A T E I D U S IN G M IN IB A C T ® ANTIMICROBIAL SENSITIVITY TEST PHENOTYPIC ID ESBL A M P IC IL L IN G E N T A M IC IN C E F O T A X IM E C E F U R O X IM E C H L O R A M P H E N IC O L N IT R O F U R A N T O IN T E T R A C Y C L IN E C IP R O F L O X A C IN A M IK A C IN M E R P E N E M SCRENNING CONFIRMATION P O S IT IV E ( > 5 m m ) N E G A T IV E ( < 5 m m ) C T X C A Z C P D C T X /C A C A Z /C A C P D /C A 001 STOOL GNR (LF) EC 0 16 0 0 22 0 14 10 18 30 10 12 0 28 26 22 √ 002 MSU GNR (LF) EC 0 10 0 0 0 0 0 0 18 30 10 12 0 30 28 26 √ 003 MSU GNR (LF) EC 0 18 28 20 24 0 0 24 18 30 30 26 26 30 26 26 √ 004 MSU GNR (LF) EC 18 0 28 0 0 0 0 0 20 32 30 26 26 30 26 26 √ 005 MSU GNR (LF) EC 0 16 26 20 0 0 0 0 22 28 30 30 24 32 30 26 √ 006 STOOL GNR (LF) EC 0 18 26 20 0 0 0 0 16 28 28 28 24 30 28 24 √ 007 STOOL GNR (LF) EC 0 18 0 20 24 0 0 0 16 30 10 12 0 26 26 20 √ 008 STOOL GNR (LF) EC 0 0 28 24 22 20 0 24 18 28 30 24 24 30 26 26 √ 009 WOUND GNR (LF) EC 0 18 22 16 0 0 0 0 20 30 28 24 24 28 26 24 √ 010 MSU GNR (LF) EC 0 18 0 0 24 0 0 0 16 30 30 22 28 32 26 28 √ 011 MSU GNR (LF) EC 0 14 28 22 0 0 0 22 16 30 32 26 28 32 30 28 √ 012 HVS GNR (LF) EC 0 0 8 24 26 0 0 0 18 34 8 10 0 26 24 20 √ 013 MSU GNR (LF) EC 0 18 30 20 0 20 0 20 18 30 30 24 26 30 26 28 √ 014 HVS GNR (LF) EC 0 18 0 0 0 0 20 0 16 28 28 24 22 28 26 26 √ 015 MSU GNR (LF) EC 0 18 26 20 0 0 0 12 18 30 30 24 28 30 26 28 √ B. Raw Antimicrobial Susceptibility Data (zone sizes in mm) University of Ghana http://ugspace.ug.edu.gh 71 016 HVS GNR (LF) KP 0 20 28 20 20 24 22 26 20 24 28 24 28 30 26 28 √ 017 HVS GNR (LF) EC 12 20 26 22 22 22 22 26 20 26 30 14 26 32 16 30 √ 018 HVS GNR (LF) EC 0 0 26 16 18 0 0 0 18 26 28 24 24 28 24 24 √ 019 HVS GNR (LF) EC 0 0 0 0 22 0 0 0 16 26 0 12 0 26 26 26 √ 020 MSU GNR (LF) EC 0 18 0 0 26 18 0 20 16 28 0 10 0 24 24 20 √ 021 MSU GNR (LF) EC 0 16 0 0 0 0 0 22 16 26 10 14 0 26 24 22 √ 022 MSU GNR (LF) EC 0 12 0 0 0 0 0 0 14 28 10 10 0 28 26 24 √ 023 MSU GNR (LF) EC 0 0 28 22 22 0 0 0 16 30 30 26 26 30 26 26 √ 024 MSU GNR (LF) EC 0 10 24 18 0 0 0 0 14 30 24 24 20 26 26 22 √ 025 MSU GNR (LF) EC 0 18 28 0 24 0 0 0 18 28 30 20 28 30 22 28 √ 026 MSU GNR (LF) EC 0 0 0 0 0 0 0 0 0 26 0 0 0 26 22 22 √ 027 SPUTUM GNR (LF) EC 0 0 0 0 10 0 14 0 14 26 0 0 0 20 20 18 √ 028 MSU GNR (LF) KP 0 16 0 0 0 0 0 0 16 30 10 18 0 28 28 24 √ 029 MSU GNR (LF) KP 0 20 28 20 0 0 0 0 16 26 30 24 28 32 24 30 √ 030 HVS GNR (LF) EC 0 0 30 24 26 0 0 0 24 30 30 26 26 30 26 26 √ 031 MSU GNR (LF) EC 0 0 22 22 0 0 0 26 16 26 30 22 22 30 30 28 √ 032 MSU GNR (LF) EC 0 16 20 0 20 20 0 24 18 28 28 24 24 28 24 24 √ 033 BLOOD GNR (LF) KP 0 0 0 0 0 0 22 0 14 26 10 12 0 28 26 24 √ 034 SPUTUM GNR (LF) KP 0 16 20 20 20 20 14 25 22 26 30 24 26 30 26 28 √ University of Ghana http://ugspace.ug.edu.gh 72 035 HVS GNR (LF) EC 0 0 28 18 22 0 0 0 18 26 28 26 26 28 26 26 √ 036 MSU GNR (LF) EC 0 0 17 20 24 0 0 0 16 28 18 20 14 18 20 14 √ 037 MSU GNR (LF) EC 0 10 30 22 18 20 8 14 22 30 32 28 28 34 28 28 √ 038 MSU GNR (LF) KP 8 8 30 24 10 20 10 18 16 26 30 26 26 30 26 26 √ 039 MSU GNR (LF) EC 0 0 0 8 10 0 0 24 18 26 8 10 0 24 24 20 √ 040 MSU GNR (LF) EC 0 0 22 20 20 18 8 18 14 24 28 24 26 28 26 26 √ 041 MSU GNR (LF) EC 0 0 10 0 0 0 0 0 16 26 10 12 0 28 26 24 √ 042 MSU GNR (LF) EC 10 14 28 22 14 10 8 10 28 30 30 26 28 30 26 28 √ 043 MSU GNR (LF) EC 0 0 0 8 0 0 0 0 14 24 0 14 0 26 22 0 √ 044 MSU GNR (LF) EC 0 0 0 0 0 0 0 8 14 26 0 14 0 26 26 0 √ 045 MSU GNR (LF) EC 0 0 0 10 0 0 0 8 14 24 0 10 0 24 20 0 √ 046 HVS GNR (LF) KP 0 10 24 22 14 16 10 12 12 22 22 20 20 26 26 26 √ 047 HVS GNR (LF) KP 0 0 28 28 18 18 12 18 16 28 28 20 28 28 26 26 √ 048 MSU GNR (LF) KP 0 8 26 22 18 20 0 10 22 30 28 20 20 30 26 26 √ 049 SPUTUM GNR (LF) KP 0 0 24 18 10 16 0 8 18 24 24 16 20 24 22 26 √ 050 MSU GNR (LF) EC 0 0 0 14 0 8 12 18 20 22 0 14 0 28 28 0 √ 051 SPUTUM GNR (LF) KP 0 0 26 20 0 12 0 10 14 26 21 16 24 26 24 22 √ 052 MSU GNR (LF) EC 0 0 0 8 0 0 0 10 18 28 0 18 0 28 26 12 √ 053 MSU GNR (LF) EC 0 0 0 10 0 0 0 8 22 24 0 16 0 26 24 10 √ University of Ghana http://ugspace.ug.edu.gh 73 054 MSU GNR (LF) EC 0 0 0 0 0 8 0 0 18 24 0 14 0 22 24 0 √ 055 MSU GNR (LF) EC 0 0 0 18 0 0 0 10 10 22 8 10 0 30 26 26 √ 056 HVS GNR (LF) KP 0 0 0 14 0 18 10 0 14 26 0 10 0 24 24 20 √ 057 MSU GNR (LF) EC 0 0 0 8 0 0 0 0 12 20 0 0 0 26 22 18 √ 058 STOOL GNR (LF) EC 0 0 8 10 8 0 0 18 20 28 10 16 0 28 26 24 √ 059 STOOL GNR (LF) EC 0 0 0 10 0 0 0 10 20 28 0 14 0 28 26 8 √ 060 MSU GNR (LF) EC 0 8 28 20 18 16 20 18 22 30 28 26 26 28 26 26 √ 061 MSU GNR (LF) EC 8 20 30 20 18 24 26 20 26 30 34 30 30 34 30 30 √ 062 MSU GNR (LF) EC 0 0 0 8 0 10 12 10 14 24 0 12 0 24 24 10 √ 063 MSU GNR (LF) EC 0 0 0 18 0 0 0 10 16 22 0 16 0 24 24 10 √ 064 MSU GNR (LF) EC 8 18 26 22 12 20 18 26 24 28 30 26 28 30 28 28 √ 065 MSU GNR (LF) EC 0 0 0 0 0 0 0 0 20 20 0 0 0 14 14 0 √ 066 BLOOD GNR (LF) EC 0 20 30 30 0 26 0 36 22 26 36 32 32 36 32 30 √ 067 MSU GNR (LF) EC 0 20 26 28 0 24 0 26 14 30 34 28 30 32 28 30 √ 068 SPUTUM GNR (LF) KP 0 8 10 0 8 22 0 16 20 30 12 16 0 30 26 26 √ 069 HVS GNR (LF) KP 0 10 10 0 0 0 0 0 14 24 12 14 0 30 28 26 √ 070 HVS GNR (LF) KP 12 18 26 26 26 26 22 30 22 26 32 28 30 32 30 30 √ 071 STOOL GNR (LF) EC 0 0 24 26 26 0 0 0 22 30 34 26 28 34 26 26 √ 072 STOOL GNR (LF) EC 0 22 28 24 0 0 28 0 24 32 30 26 26 30 28 26 √ University of Ghana http://ugspace.ug.edu.gh 74 073 MSU GNR (LF) EC 0 0 26 20 0 0 0 0 18 26 30 28 26 30 28 26 √ 074 BLOOD GNR (LF) KP 6 20 24 22 22 24 22 30 22 28 30 26 28 30 26 28 √ 075 WOUND GNR (LF) EC 0 6 8 0 22 0 0 0 26 28 10 12 0 26 26 22 √ 076 MSU GNR (LF) EC 0 0 0 0 30 0 0 0 22 30 8 14 0 28 28 26 √ 077 BLOOD GNR (LF) KP 0 22 26 26 0 26 0 28 22 30 30 26 30 28 30 30 √ 078 MSU GNR (LF) EC 24 20 24 26 26 8 10 26 20 30 32 30 28 32 30 30 √ 079 STOOL GNR (LF) EC 0 22 0 0 24 0 0 0 24 30 0 0 0 26 26 24 √ 080 MSU GNR (LF) EC 0 0 14 0 26 0 0 0 22 32 14 18 0 32 30 28 √ 081 HVS GNR (LF) EC 0 22 30 28 0 28 0 34 26 34 38 34 34 38 34 34 √ 082 HVS GNR (LF) EC 0 22 30 28 26 0 0 0 26 34 36 34 34 38 34 30 √ 083 WOUND GNR (LF) EC 0 20 28 26 0 0 0 22 24 34 34 30 30 34 30 30 √ 084 HVS GNR (LF) EC 0 22 30 28 0 26 0 32 26 34 36 30 34 36 32 34 √ 085 MSU GNR (LF) EC 0 22 26 26 0 26 0 34 26 34 32 30 30 32 28 30 √ 086 MSU GNR (LF) EC 0 26 28 10 0 34 0 36 26 36 34 34 26 34 30 22 √ 087 MSU GNR (LF) EC 0 24 8 0 0 0 0 0 26 36 10 12 0 30 30 26 √ 088 HVS GNR (LF) EC 0 0 0 0 0 0 0 0 26 32 0 10 0 30 30 26 √ 089 MSU GNR (LF) EC 0 20 26 22 22 0 0 0 26 34 32 26 26 32 26 26 √ 090 MSU GNR (LF) EC 0 0 26 20 0 0 0 0 24 34 30 28 26 30 28 26 √ 091 MSU GNR (LF) EC 20 20 8 8 0 0 0 0 26 36 14 16 0 36 36 32 √ University of Ghana http://ugspace.ug.edu.gh 75 092 MSU GNR (LF) EC 0 0 0 0 0 0 0 0 0 24 0 0 0 14 10 10 √ 093 HVS GNR (LF) EC 0 22 30 24 24 0 0 20 24 34 34 28 28 34 28 30 √ 094 MSU GNR (LF) EC 0 22 30 28 26 30 28 38 22 36 38 34 34 38 34 32 √ 095 WOUND GNR (LF) EC 0 10 0 0 0 0 0 0 22 28 0 12 0 26 24 22 √ 096 MSU GNR (LF) EC 0 0 8 0 0 0 0 0 20 30 12 12 0 30 28 28 √ 097 HVS GNR (LF) EC 0 20 30 24 0 28 0 30 22 30 32 28 30 32 28 20 √ 098 MSU GNR (LF) EC 0 0 8 0 20 0 0 0 20 28 10 12 0 26 26 24 √ 099 MSU GNR (LF) EC 0 20 24 22 0 24 0 28 20 28 28 24 26 28 26 24 √ 100 MSU GNR (LF) EC 0 0 30 24 26 26 0 30 20 28 32 28 26 32 28 26 √ 101 BLOOD GNR (LF) EC 0 18 0 0 0 0 0 0 20 26 0 10 0 24 24 24 √ 102 MSU GNR (LF) EC 20 20 30 20 24 24 20 30 20 30 32 28 30 32 28 26 √ 103 MSU GNR (LF) EC 0 16 20 18 20 20 0 24 22 28 26 26 26 26 26 26 √ 104 SPUTUM GNR (LF) KP 0 20 30 24 0 18 0 20 22 30 30 28 30 30 28 30 √ 105 MSU GNR (LF) EC 0 20 26 20 0 0 0 0 18 30 30 26 28 30 26 28 √ 106 MSU GNR (LF) EC 0 20 24 20 18 0 0 0 16 28 28 24 24 28 24 24 √ 107 WOUND GNR (LF) EC 0 10 0 0 0 0 0 18 18 18 0 14 0 26 26 14 √ 108 SPUTUM GNR (LF) KP 0 0 6 0 0 0 0 0 18 30 12 10 0 26 26 18 √ 109 MSU GNR (LF) EC 0 0 20 18 0 0 0 0 14 28 26 24 22 26 24 22 √ 110 MSU GNR (LF) EC 0 10 0 0 26 0 0 0 20 26 0 15 0 26 22 22 √ University of Ghana http://ugspace.ug.edu.gh 76 111 WOUND GNR (LF) EC 0 22 24 20 0 0 0 0 20 28 28 30 24 30 30 30 √ 112 HVS GNR (LF) KP 10 20 24 20 24 16 12 16 16 22 26 24 26 26 24 26 √ 113 STOOL GNR (LF) EC 0 12 0 0 0 0 0 0 14 26 0 14 0 24 22 24 √ 114 HVS GNR (LF) KP 0 20 20 20 22 20 10 24 20 22 26 24 26 26 22 24 √ 115 WOUND GNR (LF) EC 0 14 0 0 20 0 0 0 14 24 0 14 0 24 22 22 √ 116 MSU GNR (LF) EC 0 10 0 0 20 0 0 0 14 26 0 12 0 22 22 18 √ 117 MSU GNR (LF) EC 0 22 26 22 0 0 0 30 22 28 30 26 28 28 26 26 √ 118 MSU GNR (LF) EC 0 14 0 0 0 0 0 0 16 26 8 14 0 24 22 22 √ 119 HVS GNR (LF) KP 0 20 8 0 24 10 0 14 18 24 10 14 0 24 22 22 √ 120 WOUND GNR (LF) EC 0 20 0 0 0 0 0 18 20 26 0 14 0 26 22 22 √ 121 MSU GNR (LF) EC 0 10 0 0 16 0 0 0 16 26 0 10 0 22 18 20 √ 122 MSU GNR (LF) EC 20 16 26 22 24 20 10 24 22 30 28 22 28 28 26 26 √ 123 MSU GNR (LF) EC 20 16 26 22 24 20 10 24 22 30 28 22 28 28 26 26 √ 124 MSU GNR (LF) EC 14 18 26 25 20 20 18 28 24 26 30 26 28 30 26 28 √ 125 WOUND GNR (LF) EC 0 14 20 18 0 0 0 0 20 30 26 30 24 30 30 24 √ 126 BLOOD GNR (LF) EC 0 16 20 20 0 0 0 0 18 30 30 30 26 32 30 26 √ 127 HVS GNR (LF) EC 0 20 26 22 0 24 0 28 22 30 32 26 28 32 28 28 √ 128 MSU GNR (LF) EC 0 18 0 0 20 0 0 0 20 26 0 10 0 28 26 18 √ 129 SPUTUM GNR (LF) KP 0 20 20 20 0 14 0 16 18 26 24 24 22 24 24 22 √ University of Ghana http://ugspace.ug.edu.gh 77 130 MSU GNR (LF) EC 0 18 24 22 22 24 18 30 20 28 30 28 28 30 28 28 √ 131 HVS GNR (LF) EC 0 0 0 0 0 0 00 0 16 28 0 10 0 26 24 20 √ 132 WOUND GNR (LF) EC 12 18 14 14 22 0 0 0 16 24 20 18 18 20 18 18 √ 133 MSU GNR (LF) EC 0 18 22 20 22 18 14 22 18 28 30 26 26 30 26 26 √ 134 STOOL GNR (LF) EC 0 0 0 0 0 0 0 0 14 24 0 0 0 28 24 20 √ 135 MSU GNR (LF) EC 0 18 16 16 0 16 14 24 16 26 24 26 22 28 26 26 √ 136 SPUTUM GNR (LF) EC 0 0 18 20 18 0 0 0 18 22 18 16 16 18 16 16 √ 137 BLOOD GNR (LF) EC 0 18 20 20 18 16 18 22 18 28 30 24 26 30 26 26 √ 138 STOOL GNR (LF) EC 0 0 0 0 0 0 0 0 16 30 0 10 0 30 26 20 √ 139 MSU GNR (LF) EC 0 0 0 0 0 0 0 0 14 30 0 10 0 26 26 22 √ 140 MSU GNR (LF) EC 0 0 0 0 22 0 0 0 10 28 0 14 0 28 24 24 √ University of Ghana http://ugspace.ug.edu.gh 78 B. Preparation of DNA Templates using Qiagen Extraction kits 1. About 4 to 6 morphologically similar colonies of test isolates were suspended in 200µl nuclease free water in a 1.5ml microcentrifuge tube and mixed gently to obtain a homogenous suspension. 2. Bacterial cells were lysed by adding 20µl of Qiagen protease (or proteinase K), followed by 200µl Buffer AL and pulse-vortexing, for 15 seconds ensuring a homogeneous solution and efficient cell lysis. 3. The solution was incubated at 56°C for 10 minutes to ensure maximum DNA yield and centrifuged at 6,000xg for 1 minute. 4. Absolute ethanol (200µl) was added to the lysed sample and mixed again by pulse-vortexing for 15 seconds, followed by brief centrifugation at 6,000xg for 1 minute. 5. Lysed sample were carefully applied to the QIAamp Mini spin column (in a 2ml collection tube) without wetting the rim and the cap closed tightly. This was centrifuged at 6,000 x g (8,000 rpm) for 1 minute. The QIAamp Mini spin column was then removed and placed in a clean 2ml collection tube, discarding the previous tube containing the filtrate. 6. Buffer AW1 (500µl) was added to the QIAamp Mini spin column without wetting the rim and centrifuged at 6,000 x g (8,000 rpm) for 1 minute. The QIAamp Mini spin column was then removed and placed in a clean 2ml collection tube, discarding the previous tube containing the filtrate. 7. Buffer AW2 (500µl) was also added to the QIAamp Mini spin column without wetting the rim and centrifuged at full speed (20,000 x g; 14,000 rpm) for 3 minutes. Again, the QIAamp Mini spin column was removed and placed in a clean 2ml collection tube, discarding the University of Ghana http://ugspace.ug.edu.gh 79 previous tube containing the filtrate. This was further centrifuged at full speed for 1 minute to eliminate the chances of possible Buffer AW2 carryover. 8. The QIAamp Mini spin column was placed in a clean 1.5ml microcentrifuge tube, discarding the previous tube containing the filtrate. DNA was eluted by adding 100µl buffer AE and incubated at room temperature for 1 minute followed by centrifugation at 6,000 x g (8,000 rpm) for 1 minute. The eluted DNA was stored at -20°C. University of Ghana http://ugspace.ug.edu.gh 80 Appendix IV Performance Breakpoints Table 2.2 Performance Breakpoints of Reference Strain Escherichia coli ATCC 25922 to ESBL Detection Agents Acceptable zone range (mm) Total zone size (mm) of Escherichia coli ATCC 25922 Screening Cefotaxime (31-39) 34 Ceftazidime (34-44) 38 Cefpodoxime (28-32) 28 Confirmation clavulanate effect ≤ 2mm Cefotaxime/clavulanate 1.3 Ceftazidime/clavulanate 1.0 Cefpodoxime/clavulanate 1.5 *according to Clinical and Laboratory Standards Institute (CLSI, 2012) University of Ghana http://ugspace.ug.edu.gh 81 Appendix V Preparation of Master Mix Table 3.2 Preparation of Master Mix from Qiagen PCR operation Volume (µl)/ 1 reaction Master mix for 61 reactions (µl) 2x Qiagen multiplex PCR master mix 12.5 762.5 10x primer mix 2.5 152.5 5x Q solution 2.5 152.5 DNAs/RNAs free PCR water from Qiagen 5.5 335.5 Template DNA 2.0 X Total mix 25.0 Volumes of master mix were prepared for a number of PCR reaction tubes plus 1 extra unit to compensate for pipetting errors. Calculation for Primer mix Given that: C1=100µM C2 = 4µM V1 =? V2=200µl using C1V1 = C2V2 V1 = C2V2 C1 V1 = 8µl thus, V1 = 8µl + 192µl dH2O Thus, 8µl of the primer stock was pipetted from the whole primer stock after thawing and added to 192µl of dH2O to make up the 4µl primer working concentration. The primer working solution was then vortexed and kept at -20°C to be used for the general PCR and ESBL genotyping. University of Ghana http://ugspace.ug.edu.gh 82 Appendix VI Supplementary Results Table 4.6 List of Clinical Isolates Studied Between April and June, 2015 Table 4.7 DNA Concentration and Purity Comparison of Extraction Methods Method Mean±SD P value 95% CI Lower limit Upper limit Qiagen DNA Conc 26.9±11.4 <0.001 -211.8 -145.8 Boiled DNA Conc 205.7±130.9 <0.001 -212.2 -145.3 Qiagen DNA purity 1.8±0.2 0.35 0.0065 0.16931 Boiling DNA purity 1.7±0.2 0.35 0.0065 0.16931 SD - Standard deviation, CI - Confidence interval. Clinical isolates Overall Total number Percentage (%) Escherichia coli 117 83.6 Klebsiella pneumoniae 23 16.4 Total 140 100 University of Ghana http://ugspace.ug.edu.gh 83 Table 4.8 Enterobacteria Expressing Multidrug Resistant Phenotypes to Amikacin, Ciprofloxacin, Tetracycline and Cotrimoxazole Antimicrobial drugs combinations Multidrug resistant (MDR) phenotypes ESBL-producers n=62 Non-ESBL-producers n=78 AMK CIP TET 14 (22.6%) 14 (17.9%) AMK CIP TET C 12 (19.4%) 8 (10.3%) * AMK-Amikacin, CIP-Ciprofloxacin, TET-Tetracycline, C-Chloramphenicol. University of Ghana http://ugspace.ug.edu.gh 84 Appendix VII Gel photograph of TEM genes amplified Figure 4.4 PCR Profile for BlaTEM of Enterobacteria Isolates Lane L – Ladder. Lanes N and P - Negative and Positive controls respectively. Lanes numbered 1 – 4, 9, 10, 12 – 14, 16, 17 and 21 are positive for BlaTEM genes. Lanes numbered 5 – 8, 11, 15 and 18 – 20 are negative for BlaTEM genes University of Ghana http://ugspace.ug.edu.gh 85 Appendix VIII Gel photograph of CTX-M-1 genes amplified Figure 4.5 PCR Profile for BlaCTX-M-1 of Enterobacteria Isolates Lane L – Ladder. Lanes P and N - Positive and Negative controls respectively. Lanes numbered 1 – 4 and 6 – 26 are positive for BlaCTX-M-1 genes. Lane numbered 5 is negative for BlaCTX-M-1 genes University of Ghana http://ugspace.ug.edu.gh 86 Appendix IX Gel photograph of SHV genes amplified Figure 4.6 PCR Profile for BlaSHV of Enterobacteria Isolates Lanes L, P and N – Ladder, Positive and Negative controls respectively. Lanes numbered 26, 27, 33, 46 and 47 are positive for BlaSHV genes. Lanes numbered 2, 7, 12, 19, 20, 21, 22, 28, 31, 39, 41, 43, 44, 45 and 51 are negative for BlaSHV genes University of Ghana http://ugspace.ug.edu.gh 87 Appendix X Ethical Clearance University of Ghana http://ugspace.ug.edu.gh