University of Ghana http://ugspace.ug.edu.gh DEPARTMENT OF BIOCHEMISTRY, CELL AND MOLECULAR BIOLOGY FUNCTIONAL CHARACTERIZATION OF PLASMODIUM FALCIPARUM CLAUDIN- LIKE APICOMPLEXAN MICRONEME PROTEIN (PfCLAMP) (Pf3D7_1030200) THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE AWARD OF MPHIL MOLECULAR CELL BIOLOGY OF INFECTIOUS DISEASES DEGREE BY EVELYN BAABA QUANSAH (10402830) JULY, 2019 University of Ghana http://ugspace.ug.edu.gh DECLARATION I, Evelyn Baaba Quansah, declare that the work reported in this thesis was undertaken by me at the West African Centre for Cell Biology of Infectious Pathogens, Department of Biochemistry, Cell and Molecular Biology, under the supervision of Dr. Yaw Aniweh. All references used are duly cited. ……………………………………… …………………………………….. EVELYN BAABA QUANSAH DR. YAW ANIWEH (STUDENT) (SUPERVISOR) DATE: ……………………………… DATE: …………………………….. i University of Ghana http://ugspace.ug.edu.gh ACKNOWLEDGEMENTS I would like to sincerely to thank to my supervisor, Dr. Yaw Aniweh, for continuously supporting my MPhil study and research. For his patience, immense knowledge and motivation I would forever be grateful. His guidance helped me throughout my research and the writing of this thesis. I could not have imagined having a better supervisor and mentor for my study. My heartfelt appreciation also goes to Professor Gordon A. Awandare for the opportunity to work in his laboratory and for the support he provided me during my studies at the University of Ghana. I am highly indebted to WACCBIP for the WACCBIP-DELTAS fellowship and the Travel fellow offered me during the course of my studies. A big thank you to Professor Jake Baum of Imperial College, London for the opportunity to visit his laboratory and the support provided in the generation of the conditional knockout of the PfCLAMP gene. To Mr. Tom Blake, thank you for your kindness, patience and for being an awesome supervisor during my stay at Imperial College. A big thank you to Reuben Ayivor-Djanie for introducing me to RT-qPCR and for being a wonderful lab partner and colleague. Sincere thanks to Dr. Joseph Mutungi, for reading and commenting on the thesis write up. My appreciation to the wonderful members of the Cell Biology and Immunology Laboratory for their encouragement and friendship. Finally, I would like to say a big thank you to WACCBIP-DELTAS for funding this project. ii University of Ghana http://ugspace.ug.edu.gh DEDICATION To my parents Mr. Teddy Quansah and Miss Florence London and all the wonderful people in my life who have contributed in diverse ways to ensure that I receive the best education at the highest level possible. iii University of Ghana http://ugspace.ug.edu.gh TABLE OF CONTENTS DECLARATION............................................................................................................................ i ACKNOWLEDGEMENTS ......................................................................................................... ii DEDICATION.............................................................................................................................. iii TABLE OF CONTENTS ............................................................................................................ iv LIST OF FIGURES ..................................................................................................................... vi LIST OF TABLES ...................................................................................................................... vii LIST OF ABBREVIATIONS ................................................................................................... viii ABSTRACT .................................................................................................................................. xi CHAPTER ONE ........................................................................................................................... 1 1.0 INTRODUCTION .......................................................................................................... 1 1.1 HYPOTHESIS ................................................................................................................. 4 1.2 AIM ................................................................................................................................... 4 CHAPTER TWO .......................................................................................................................... 5 2.0 LITERATURE REVIEW .............................................................................................. 5 2.1 THE GLOBAL BURDEN OF MALARIA .................................................................... 5 2.2 BIOLOGY OF PLASMODIUM FALCIPARUM ........................................................ 7 2.3 LIGAND-RECEPTOR INTERACTIONS FOR ERYTHROCYTE INVASION ... 16 2.4 MECHANISMS OF HOST IMMUNE EVASION ..................................................... 18 2.5 VACCINE DEVELOPMENT STRATEGIES ............................................................ 21 CHAPTER THREE .................................................................................................................... 25 3.0 MATERIALS AND METHODS...................................................................................... 25 3.1 MATERIALS ................................................................................................................. 25 3.1.1 Reagents and Antibodies ............................................................................................ 25 3.2 METHODS ..................................................................................................................... 25 3.2.1 Analysis of PfCLAMP Gene Sequences.................................................................... 25 3.2.2 Plasmid Design ............................................................................................................ 26 3.2.3 Cloning into pBCam 3xHA plasmid ......................................................................... 27 3.2.4 Parasite Culture and Transfection ............................................................................ 27 3.2.5 PfCLAMP Knockdown .............................................................................................. 28 iv University of Ghana http://ugspace.ug.edu.gh 3.2.6 DNA extraction and CNV analysis............................................................................ 29 3.2.7 Microscopy .................................................................................................................. 29 3.2.8 Differential Expression Analysis ............................................................................... 30 3.2.9 Peptide Selection, Synthesis and Antibody Generation .......................................... 31 3.2.10 Invasion Inhibition Assay ........................................................................................ 31 3.2.11 Bioinformatic analysis .............................................................................................. 32 CHAPTER FOUR ....................................................................................................................... 33 4.0 RESULT ........................................................................................................................ 33 4.1 PfCLAMP is highly conserved in the population ....................................................... 33 4.2 Some clinical isolates habour multiple copies of PfCLAMP gene............................. 35 4.3 PfCLAMP is differentially expressed in different P. falciparum strains .................. 36 4.4 Endogenously tagged PfCLAMP ................................................................................. 37 4.5 PfCLAMP is expressed in clinical isolates .................................................................. 39 4.6 PfCLAMP has four transmembrane domains and two extracellular loops............. 40 4.7 Generation of PfCLAMP conditional knockout lines ................................................ 42 4.8 PfCLAMP is apically concentrated in P. falciparum.................................................. 46 4.9 Antibody to the extracellular epitope of PfCLAMP inhibits invasion ..................... 48 CHAPTER FIVE ........................................................................................................................ 51 5.0 DISCUSSION AND CONCLUSION .......................................................................... 51 5.1 DISCUSSION ................................................................................................................. 51 5.2 CONCLUSION .............................................................................................................. 54 5.3 RECOMMENDATION AND FUTURE WORK ....................................................... 55 REFERENCES ............................................................................................................................ 56 APPENDIX .................................................................................................................................. 81 v University of Ghana http://ugspace.ug.edu.gh LIST OF FIGURES Figure 2.1. The life cycle of Plasmodium falciparum (adapted from Cowman et al. 2012). ... 8 Figure 2.2. P. falciparum merozoite structure (adapted from Cowman, Brendan and Crabb, 2006). ............................................................................................................................................ 10 Figure 2.3. Overview of the erythrocyte invasion process of Plasmodium falciparum merozoite (adapted from Koch & Baum, 2016) ....................................................................... 15 Figure 2.4. Receptor-ligand interactions involved in erythrocyte invasion (Adapted from Weiss et al. 2015). ........................................................................................................................ 17 Figure 2.5. Mechanisms of host immune evasion (adapted from Wright & Rayner, 2014). 18 Figure 2.6. Strategies for vaccine development (Adapted from Arama & Troye-Blomberg, 2014). ............................................................................................................................................ 22 Figure 4.1. PfCLAMP is highly conserved in the population. ................................................ 34 Figure 4.2. Copy number variations of the PfCLAMP gene................................................... 35 Figure 4.3. PfCLAMP is expressed at the late stage of P. falciparum. ................................... 37 Figure 4.4 Endogenous Tagging of PfCLAMP confirms Late stage expression. .................. 38 Figure 4.5 Transcript level of PfCLAMP gene in Clinical isolates. ....................................... 39 Figure 4.6 PfCLAMP has four transmembrane domains and two extracellular loops. ....... 42 Figure 4.7. Conditional knockout of PfCLAMP. ..................................................................... 45 Figure 4.8. PfCLAMP is apically concentrated....................................................................... 48 Figure 4.9. Anti-PfCLAMP antibodies inhibits invasion. ....................................................... 50 vi University of Ghana http://ugspace.ug.edu.gh LIST OF TABLES Table 1: Primers for Copy number variation studies by qPCR and gene expression analysis by RT-qPCR ................................................................................................................................ 81 Table 2: RT-qPCR reaction set up ............................................................................................ 81 Table 3: RT-qPCR reaction conditions..................................................................................... 81 Table 4: qPCR reaction set up ................................................................................................... 82 Table 5: RT-qPCR reaction set up ............................................................................................ 82 Table 6: Primers for genotyping PfCLAMP mutants ............................................................. 83 vii University of Ghana http://ugspace.ug.edu.gh LIST OF ABBREVIATIONS AMA-1 – Apical Membrane Antigen 1 CCTOP – Constrained Consensus Topology Prediction Software CFDA-SE – Carboxyfluorescein diacetate succinimidyl ester cKO – Conditional Knockout CR1 – Complement receptor 1 CSP – Circumsporozoite Protein CyRPA – Cysteine-rich Protective Antigen DAPI – 4’,6-diamidino-2-phenylindole DMSO – Dimethylsulfoxide EBA175 – Erythrocyte Binding Antigen 175 GAP – Glideosome-associated Protein GFP – Green fluorescent Protein GLURP – Glutamine-Rich Protein GLURP- Glutamine Rich Protein GPI – Glycophosphatidylinositol HA – Hemagglutinin HRP – Histidine Rich Protein viii University of Ghana http://ugspace.ug.edu.gh IDC – Intraerythrocytic Developmental Cycle IgG – Immunoglobulin G IMC – Inner Membrane Complex IRS – Indoor Residual Spray ITN – Insecticide treated nets Mb – Mega bases MSP1 – Merozoite Surface Protein 1 MVIP – Malaria Vaccine Implementation Programme ORF – Open reading frame PBS – Phosphate Buffered Saline PCR – Polymerase Chain Reaction Pf – Plasmodium falciparum PFA – Paraformaldehyde PfCLAMP – Plasmodium falciparum Claudin-like Apicomplexan Microneme Protein PfEMP1 – Plasmodium falciparum erythrocyte membrane protein 1 PfRh – Plasmodium falciparum reticulocyte homologue PfRipr – Plasmodium falciparum Rh5 interacting protein PVM – Parasitophorous Vacuolar Membrane ix University of Ghana http://ugspace.ug.edu.gh qPCR – Quantitative real time polymerase chain reaction RAS – Radiation Attenuated Sporozoites RDT – Rapid Diagnostic Test RIFIN – Repetitive Interspersed Family Protein RON – Rhoptry Neck Protein RT-qPCR – Reverse transcriptase real time polymerase chain reaction TBV – Transmission Blocking Vaccine WHO – World Health Organization x University of Ghana http://ugspace.ug.edu.gh ABSTRACT Malaria is still a public health burden. With the recent reports of artemisinin resistance in Plasmodium falciparum coupled with the low efficacy of the RTS, S vaccine currently under a WHO-recommended pilot malaria vaccine implementation programme (MVIP), there is the need to continue identifying new targets by functionally characterizing some of the ~60% of the parasite’s genes with unknown functions. This will foster the identification of viable vaccine and possible drug targets for the development of interventions against the parasite. This project focused on studying P. falciparum Claudin-Like Apicomplexan Microneme Protein (PfCLAMP) with gene ID (Pf3D7_1030200) and its role during invasion of the parasite. CLAMP has been shown to be highly conserved in apicomplexans, with its orthologue in P. falciparum being essential for parasite growth and invasion. Here, using specific antibodies raised against the extracellular domain of the PfCLAMP, we report that PfCLAMP localizes at the apical portion of merozoites. The generated antibodies inhibited parasite invasion in a dose dependent manner. We have also observed that PfCLAMP is differentially expressed across the different asexual stages of the parasite, with peak expression occurring at the late stages of the parasite. We also discovered that some clinical isolates habour multiple copies of the PfCLAMP gene. Additionally, we show that PfCLAMP conditional gene knockout reduced invasion by up to 30% in the first cycle of the parasite development. Altogether, our data demonstrates that PfCLAMP provides a potentially attractive target for further investigation for drug and vaccine development. xi University of Ghana http://ugspace.ug.edu.gh CHAPTER ONE 1.0 INTRODUCTION Malaria is a global endemic disease caused by an obligate intracellular protozoan parasite Plasmodium and is transmitted by the bite of an infected female Anopheles mosquito. More than 100 species of Plasmodium are known to exist, 6 of which are known to infect humans. They are Plasmodium falciparum, P. knowlesi, P. vivax, P. ovale, P. malariae (Boddey et al. 2013; Carter and Mendis, 2002) and the recently described human infection by P. Cynomolgi (Imwong et al. 2019). P. falciparum is regarded as important because it is responsible for the severe form of malaria, and in sub-Saharan Africa, affects mostly children under the age of 5 years. According to the World Health Organization’s (WHO) malaria report of 2018, about half of the world’s population is at risk of malaria with an estimate of 435,000 deaths being recorded globally. These can be attributed to resistance by mosquitoes to pyrethriods (Corbel et al. 2007), the only molecule recommended by WHO for insecticide treated nets (ITN) (Zaim et al. 2000). Also, deletions of histidine rich protein 2 (HRP2) (Amoah et al. 2016; Koita et al. 2012; Wurtz et al. 2013) which allows the parasite to evade detection by rapid diagnostic tests (RDTs) as well as parasite resistance to artemisinin and its partner drugs (Amaratunga et al. 2016; Dondorp et al. 2009) that have been reported in south-east Asia (WHO, 2016) contribute to the increased malaria associated deaths. The use of drugs for malaria treatment have proven to be temporal over the years due to the history of the development of drug resistance, therefore, vaccines are a good alternative to the use of drugs for malaria treatment. Vaccines have been effective in the prevention of diseases such as small pox, polio and measles (A. Rieckmann et al. 2017). However, there is currently no effective vaccine against malaria. The challenge with malaria vaccine development is that the biology of P. falciparum is not fully understood. That is, some of its protein coding genes, which could serve as 1 University of Ghana http://ugspace.ug.edu.gh potential vaccine targets, have not been functionally annotated (Böhme et al. 2019; Gardner et al. 2002). Again, the few parasite ligands (targets) that have been identified for vaccine development are either redundant and polymorphic (Weiss et al. 2015) or not sufficiently immunogenic (Douglas et al. 2011). RTS,S, the only current anti-malaria vaccine under WHO-recommended pilot implementation has a reported efficacy of 39% in preventing malaria infection and 29% in preventing severe malaria (“Efficacy and safety of RTS,S/AS01 malaria vaccine with or without a booster dose in infants and children in Africa: Final results of a phase 3, individually randomised, controlled trial,” 2015) and wanes off over time (Agnandji et al. 2014; Olotu et al. 2016). This calls for the need to identify new parasite ligands to serve as potential vaccine targets and to also give a better understanding of the biology of the parasite. For infection to occur, P. falciparum actively invades host erythrocytes in order to continue its life cycle. This invasion step is complex and requires multiple erythrocyte receptor and parasite ligand interactions (Barnwell and Galinski, 1991; Weiss et al. 2015). Most of the proteins involved in the invasion process form part of the repertoire of parasite proteins that remain uncharacterized. In this respect, Plasmodium falciparum Apicomplexan Microneme Protein (PfCLAMP) was selected for functional characterization. This gene, according to transcriptomic data available on PlasmoDB (https://plasmodb.org/plasmo), is highly expressed in the late stages of the parasite. A genetic screen was conducted in Toxoplasma gondii by sidik et al. (2016) to assess the contribution of the each of its genes during the process of infection. This study identified previously uncharacterized genes that were essential to the parasite. Among these was the PfCLAMP gene that was found to be present in all apicomplexan genomes and is localized within secretory organelles making it important in establishing infection. This gene was also found to 2 University of Ghana http://ugspace.ug.edu.gh be import for P. falciparum invasion . (Sidik et al. 2016). Furthermore, when P. falciparum strains were treated with compounds that inhibited the schizont stage of the life cycle, transcriptional profiling revealed a three-fold increase in the expression in about 59% of its protein coding genes (Hu et al. 2010). Predicting the function of these genes using guilt-by-association showed that PfCLAMP clustered with already characterized genes localized in the apical portion of merozoites (Hu et al. 2010). This suggests a possible role of PfCLAMP in the invasion process reinforcing the importance to further study the gene. PfCLAMP protein was found to be similar in structure to the mammalian tight junction protein Claudin 15 and Claudin 19 (Sidik et al. 2016). Claudins are the most abundant and important proteins that make up mammalian tight junctions (Furuse et al. 1999; Günzel and Yu, 2013; Odenwald and Turner, 2017). Their function includes formation of the tight junction strands that connect to the actin cytoskeleton as well as regulating its paracellular permeability to ions (Tsukita et al. 2001). Tight junction formation is a committed step in the invasion process of P. falciparum and acts as an anchor point for the internalization of the parasite (Richard et al. 2010a; Weiss et al. 2015a; Zuccala et al. 2012). Under super resolution microscopy, the tight junction is seen as a ring between the host’s erythrocyte and the P. falciparum merozoite (Riglar et al. 2011). This is formed by an interaction between the parasite ligands apical membrane antigen 1 (AMA-1) and rhoptry neck proteins (a complex made up of RON2/RON4/RON5) (Bargieri et al. 2013; Riglar et al. 2011). The merozoite then moves through this ring into the erythrocyte with energy provided by the actin-myosin motor of the parasite (Besteiro et al. 2009; Riglar et al. 2011; Tonkin et al. 2011) from the anterior to the posterior of the merozoite to cause its internalization in a parasitophorous vacuole (PV). Studies have shown that when AMA-1 gene is deleted, Plasmodium merozoites have the ability to bind and deform erythrocytes but they cannot invade (Richard et al. 2010; Treeck et al. 2009; Yap et al. 2014). 3 University of Ghana http://ugspace.ug.edu.gh Also, peptides generated from the exposed loop of RON2 blocks the invasion of merozoites by competing with AMA-1 for binding (Harris et al. 2005; Richard et al. 2010). These studies therefore suggest that the tight junction is critical for the invasion of P. falciparum and that targeting components of it for vaccine development would be crucial in the elimination of malaria. Since proteins with similar structures often have similar functions, this study sought to find out if the PfCLAMP gene plays a crucial role in the invasion process of P. falciparum. 1.1 HYPOTHESIS It is hypothesized that PfCLAMP (Pf3D7_1030200) may be involved in the invasion of Plasmodium falciparum. 1.2 AIM To study the function of PfCLAMP protein during P. falciparum invasion. 1.2.1 SPECIFIC OBJECTIVES ❖ To determine the diversity and expression profile of PfCLAMP ❖ To generate transgenic parasite lines for the characterization of PfCLAMP ❖ To investigate the role of PfCLAMP in erythrocyte invasion 4 University of Ghana http://ugspace.ug.edu.gh CHAPTER TWO 2.0 LITERATURE REVIEW 2.1 THE GLOBAL BURDEN OF MALARIA Approximately, half of the world’s population is estimated to be at risk of malaria with children under the age of 5 years, pregnant women, HIV/AIDS patients and non-immune migrants being the most affected (World Health Organization, 2018). There are 6 species of Plasmodium known to infect humans and they are Plasmodium falciparum, P. knowlesi, P. vivax, P. ovale, P. malariae (Boddey et al., 2013; Carter and Mendis, 2002) and P. Cynomolgi (Imwong et al. 2019). Of these, P. vivax is the most widely distributed in terms of the affected populations. However, Plasmodium falciparum is the most virulent and prevalent species in sub-Saharan Africa. In 2017, about 219 million cases of malaria were reported globally which was an increase compared to the 217 million cases in 2016 (World Health Organization, 2017)(WHO, 2017). Most of these reported cases were from the WHO’s African region and represented 93% of the global malaria cases. There was also 435,000 malaria associated deaths reported in the world in 2017. Again, the WHO African region constituted 93% of these reported death cases. Despite the slight increase in the occurrence of the disease in 2017, there has generally been a decline of about 20 million in malaria reported cases globally from 2010. This is due to the combined effects of control measures such as the use of insecticide-treated bed net (ITNs), indoor residual sprays (IRS), intermittent preventive treatment in pregnant women and children under five years, improved and accessible diagnostic tools, and the availability of efficacious chemotherapies such as the artemisinin derivatives and their partner drugs (World Health Organization, 2017). Despite all these measures, malaria remains a global public health concern. This is attributable to resistance by mosquitoes to pyrethriods (Corbel et al. 2007), the only molecule recommended by WHO for the use in insecticide treated nets (ITN) (Zaim 5 University of Ghana http://ugspace.ug.edu.gh et al. 2000) as well as emergence of parasites which are resistant (prolonged parasite clearance) to current artemisinin-combination therapies (ACT) (Amaratunga et al. 2016; Dondorp et al. 2009). Parasite mutations also pose another challenge of failure in effective P. falciparum diagnosis; some parasites have deletions of histidine rich protein 2 (HRP2), the parasite protein which serves as target for most rapid diagnostic tests (RDTs) kits (Amoah et al. 2016; Koita et al. 2012; Wurtz et al. 2013). These problems indicate the need to find alternate control measures against either the mosquito or the parasite. Vaccines have been effective in the prevention of measles, small pox and hepatitis (Rieckmann et al. 2017) and as such can be useful in the control and possible eradication of malaria. The symptoms of malaria occur during the blood stage of the parasite’s life cycle. At this stage, the infected erythrocytes rapture to release malaria toxic waste which activate the innate immune system. This causes the release of cytokines (Mawson, 2013) leading to the observed symptoms. The first symptoms of malaria are headache, fatigue, body pains which eventually lead to fever, chills and vomiting if left untreated. When the patient is provided with the appropriate treatment at this stage, the prognosis is good. However, when P. falciparum infections remain untreated, they may progress to severe malaria, which can still be cured but turns lethal if not treated. The symptoms of severe malaria include unarousable coma, severe distress, seizures and severe anemia. Besides the treatment regimen, the outcome of the disease also depends on the parasite strain and the immune status of the host (World Health Organization, 2018). 6 University of Ghana http://ugspace.ug.edu.gh 2.2 BIOLOGY OF PLASMODIUM FALCIPARUM 2.2.1 Life Cycle The life cycle of P. falciparum is complex and involves two different hosts (fig. 2.1); a definitive host (Anopheles mosquito) and an intermediate host for instance humans. The cycle comprises 2 stages namely the sexual and asexual stage. It begins with the bite of an infected mosquito during a blood meal. During this period, the mosquito injects saliva which may contain sporozoites into the skin of the host. The injected sporozoites quickly migrate through the cells of the skin into the liver where it invades only the hepatocytes. The parasite then divides over several days into thousands of merozoites which are released into the blood stream to invade erythrocytes and start the asexual stage of the cycle. In the erythrocyte, the parasite modifies the cell to create an environment for it to be able to obtain nutrients for development and in addition, evade the immune system of the host. The invaded merozoite develops into a ring, through to a trophozoite and then to a schizont in a span of 48 hours. The schizont then divides to about 6-32 merozoites which are released from the erythrocytes then primed to invade new erythrocytes to continue the asexual cycle (Garg et al. 2015). This is the stage responsible for the clinical manifestations of the disease. Some parasites differentiate into male (microgamete) and female (macrogamete) gametocytes and this begins the sexual stage of the cycle. If a female Anopheles mosquito picks up the gametocyte during a blood meal, inside the mosquito midgut, the gametocytes develop into sexual gametes and the male gametes fertilize the female gametes to form a zygote. The zygote develops into an elongated and motile form known as the ookinete, which invades the mosquito’s midgut wall and develops into an oocyst. The oocyst then grows, divides many times and raptures to release sporozoites which migrate to the salivary glands of the mosquito, ready for inoculation into a vertebrate host (Sinden, 1983b, 1983a; Vaughan, 2007) . 7 University of Ghana http://ugspace.ug.edu.gh Figure 2.1. The life cycle of Plasmodium falciparum (adapted from (Cowman et al. 2012). The life cycle commences when the Anopheles mosquito bites and inoculates sporozoites into the human host. The sporozoites migrate to the liver, invade the liver cells and then mature into merozoites which are then released into the blood stream. These merozoites invade erythrocyte and grow from rings to trophozoites and then mature schizonts. Merozoites are released from ruptured schizonts-containing erythrocytes and invade new erythrocytes. Gametocytes that form during the asexual stage are taken into the mosquito’s guts during their blood meal. The male gamete fertilizes the female gametes to form a zygote which develops into an ookinete. The ookinete then develops into an oocyst which divides many times to form sporozoites which migrate to the salivary glands of the mosquito. 8 University of Ghana http://ugspace.ug.edu.gh 2.2.2 P. falciparum merozoite The merozoite (fig. 2.2) is the invasive form of the parasite and is released from both the liver and infected erythrocytes during the intraerythrocytic stage of the parasite’s life cycle. It is about 1 – 2 µm in size and is distinctively adapted for erythrocyte invasion (Bannister et al. 1986). It has the architecture of a conventional eukaryotic cell, that is, it has a cytoskeletal system and organelles such as rhoptries, mitochondrion, nucleus, micronemes, and dense granules (Bannister et al. 2000; McFadden et al. 1996; Roos et al. 1999). It also has the inner membrane complex (IMC) that lies underneath the plasma membrane. Electron micrographs show the merozoite covered by a bristle coat (Aikawa et al. 1978; Bannister et al. 1975; Langreth et al. 1978) that is shed off during the erythrocyte invasion process. The merozoite deploys an array of proteins that are important for erythrocyte invasion. These proteins are found either within the apical secretory organelles or on the merozoite surface. The latter may be glycophosphatidylinositol (GPI)-anchored proteins, integral membrane proteins or peripheral proteins which interact with membrane-bound proteins. The merozoite is the only stage in the parasites life cycle that is exposed to the host immune system. Therefore, targeting merozoite proteins is a good strategy for vaccine development. 9 University of Ghana http://ugspace.ug.edu.gh Figure 2.2. P. falciparum merozoite structure (adapted from Cowman, Brendan and Crabb, 2006). The picture depicts the cellular architecture and organelles present in the merozoite. The merozoite is ovoid-shaped and has the rhoptries and microneme concentrated at its apical end. It also has other organelles such as the dense granules, ribosomes, mitochondrion, nucleus and microtubules. It has an inner-membrane complex that lies beneath the plasma membrane. The architecture of the merozoite is distinctively adapted for erythrocyte invasion. 10 University of Ghana http://ugspace.ug.edu.gh 2.2.3 Invasion by Plasmodium falciparum The invasion of erythrocytes (fig. 2.3) by P. falciparum merozoites is a very important process for the parasite’s survival as well as the progression and pathogenesis of malaria. It involves the release of proteins from organelles at the apical region of free merozoites to mediate interactions between the parasite ligand and host erythrocytes (Iyer et al. 2007; Preiser et al. 2000). The kinetics of this process has been shown to be highly conserved in Plasmodium spp. (Gilson and Crabb, 2009) and it can be divided into four phases (Koch and Baum, 2016). In the first phase, the merozoite contacts the erythrocyte surface causing deformation in the erythrocyte. In the second phase, the merozoite reorients itself such that the apical portion is juxtaposed with the erythrocyte membrane. This results in the formation of a tight junction which propels the merozoite into the erythrocyte. A protective coat, the parasitophorous vacuolar membrane (PVM), is formed around the invaded parasite and this makes up the final phase. The merozoite first makes contact with the erythrocyte surface via its surface proteins. This merozoite-erythrocyte contact has been shown by video microscopy to cause disturbances to the erythrocyte surface such that the interaction appears dynamic (Crick et al. 2014; Dvorak et al. 1975; Esposito et al. 2010). When the merozoite bumps into the erythrocyte surface, the erythrocyte weakly bends its shape resulting in a strong deformation in the entire erythrocyte. Some studies have suggested that the merozoite surface proteins (MSPs) are the ligands involved in the initial contact and deformation of the erythrocyte (Kadekoppala and Holder, 2010; Lin et al. 2014). MSP-1 is the most abundant and best characterized of these proteins. Blocking the MSP-1 protein has been shown to render majority of the merozoites incapable of binding to erythrocytes (Boyle et al. 2010). Furthermore, the few merozoites that are able to attach do so with a force reduced by 75% (Crick et al. 2014). This reiterates the fact that the MSPs are important for 11 University of Ghana http://ugspace.ug.edu.gh invasion. However recent data has shown that merozoites that have their MSP-1 protein knocked out still possess the ability to invade suggesting that it is not essential for invasion (Das et al. 2015). Apart from the MSPs that are found only on the surface of the merozoites, other adhesins such as the Erythrocyte Binding Antigen (EBAs) and Reticulocyte binding-like homologous (PfRh) families of proteins are secreted unto the merozoite surface. It has been observed that invasion inhibitory antibodies to the EBAs and the PfRh ligands reduced the ability of the merozoite to deform erythrocyte, hence blocks invasion into target cells (Weiss et al. 2015). This again suggests that these family of proteins play a role in the deformation of the erythrocyte prior to invasion. Following the initial attachment process, the merozoite reorients itself so that the apical end is in contact with the erythrocyte surface. This orientation facilitates the invasion process because it lines up the apical organelles (which secretes the ligands important for invasion) at the erythrocyte membrane so that once the ligands are released, invasion can take place. The reorientation process could be as a result of membrane wrapping (Dasgupta et al. 2014) or the interaction of PfRh5 with its receptor basigin (Crosnier et al. 2011). The parasite then proceeds to invade the erythrocyte. When PfRh5, a member of the reticulocyte family of proteins makes contacts with its receptor, it is believed that a pore is formed that leads to the efflux of Ca2+ from the merozoites into the erythrocytes (Volz et al. 2016; Weiss et al. 2015b). This theory buttresses the belief that a pore is formed between the merozoite and erythrocyte which allows proteins to be released into the host cell (Cowman et al. 2017). During the invasion process, PfRh5 forms a complex with Plasmodium falciparum Rh5 interacting protein (PfRipr) and Cysteine-rich protective antigen (CyRPA) (Volz et al. 2016) and become tightly attached to the erythrocyte membrane. PfRH5 does not possess a GPI anchor but it is found tethered to the erythrocyte surface. A study suggested that Rh5 is initially tethered to the merozoite surface by a Pf113, an 12 University of Ghana http://ugspace.ug.edu.gh abundant GPI anchored protein, which binds at the amino terminus and serves as a scaffold to allow the Rh5 protein to bind to its receptor (Galaway et al. 2017). There has however been no evidence of the involvement of Pf113 in the invasion process, therefore it is believed that it dissociates from Rh5 when it forms an interaction with PfRipr. This PfRh5-PfRipr interaction is then tethered to the merozoite surface by CyRPA which has a GPI anchor (Reddy et al. 2015). The PfRh5-PfRipr-PfCyRPA complex leads to the formation of a pore between the parasite and erythrocyte. Downstream of the PfRh5 engagement is the formation of tight junction. This junction is made up of AMA1 and RON2 (Alexander et al. 2005; Besteiro et al. 2009; Tonkin et al. 2011) proteins, both from the parasite. AMA1 is localized on the surface of the merozoites whilst the RON2, which is part of a larger complex of RON proteins, is found in the neck of the rhoptries. For the tight junction to form, RON2 is injected into the erythrocyte to serve as a receptor for AMA1 resulting in the ring-like structure observed under super resolution microscope. Work done in T. gondii suggests that this mechanism is used by all apicomplexans to promote successful invasion. There has been controversy over the years regarding the essentiality of AMA1 to the overall process of parasite invasion, however a study by Bargieri et al. 2013 revealed that AMA1 interaction with the RON complex is important. When the AMA1-RON2 interaction is blocked, the erythrocyte is observed to undergo echinocytosis suggesting that the formation of tight junction occurs after the Rh5 engagement (Weiss et al. 2015). A recent study has identified a new protein, the claudin-like apicomplexan microneme protein (CLAMP) that may play a role in the formation of the tight junction (Sidik et al. 2016). However, the exact role it plays has not yet been elucidated although conditionally knocked out mutants were unable to invade or form tight junctions. This tight junction is thought to act as an anchoring structure on which the merozoites move in order to get into the erythrocytes. For the merozoites to move into the host cell, it is believed that a 13 University of Ghana http://ugspace.ug.edu.gh glideosome connects the adhesins (the EBAs, PfRhs and AMA) to the inner membrane complex by connecting to their cytoplasmic tail of the parasite and provides a forward force by the actomyosin motor. The glideosome is made up of glideosome-associated proteins (GAPs) and it acts as a scaffold to provide anchor for myosin A (which provides the gliding motion needed for the invasion process) (Meissner et al. 2002). This suggests that during the process, the adhesins are dragged from the anterior to the posterior end of the parasite along the plane of the membrane resulting in host cell entry. 14 University of Ghana http://ugspace.ug.edu.gh Figure 2.3. Overview of the erythrocyte invasion process of Plasmodium falciparum merozoite (adapted from Koch and Baum, 2016). When the merozoite interacts with the erythrocyte it undergoes reorientation to bring its apical end close to the erythrocyte. The re-oriented parasite secretes ligands from its micronemal and rhoptry organelles to engage in strong interaction with erythrocyte surface receptors leading to the formation of tight (moving) junctions. This junction drives the parasite into the erythrocyte aided by the parasites actinomyosin motor. this is accompanied by the shedding of merozoite surface proteins and the subsequent sealing of the erythrocyte membrane to enclose the parasite. 15 University of Ghana http://ugspace.ug.edu.gh 2.3 LIGAND-RECEPTOR INTERACTIONS FOR ERYTHROCYTE INVASION For invasion to be successful merozoite proteins (ligands) must bind to specific erythrocyte receptors (fig. 2.4). Several groups of these merozoite proteins have been described including the MSPs which form a large proportion of proteins on the merozoite surface (Cowman and Crabb, 2006; Cowman et al. 2017; Gilson et al. 2006). While many of them have been identified, the widely studied and most abundant is the MSP1, a GPI anchored protein believed to be involved in the attachment process of merozoite during invasion. Its specific role is still not known, however, a study reported that binding of MSP1 to heparin sulfate inhibits invasion suggesting that it interacts with an unknown erythrocyte receptor (Stubbs et al. 2005). Other groups of ligands involved in the invasion process are the Erythrocyte binding Antigens (EBAs) and the reticulocyte binding-like homologs (PfRhs). The EBAs include EBA-140, EBA- 175, EBA-181 and EBL-1. EBA-175 binds to glycophorin A (Camus and Hadley, 1985), EBA- 140 binds to glycophorin C (Maier et al. 2003; Mayer et al. 2009) whilst EBL-1 binds to glycophorin B (Mayer et al. 2009). The EBA-181 however has no known receptor (Gilberger et al. 2003). Other PfRhs include PfRh1, PfRh2a and PfRh2b which bind to unknown receptors (Duraisingh et al. 2003; Rayner et al. 2002; Stubbs et al. 2005). PfRh4 binds to the erythrocytes complement receptor 1 (CR1) (Tham et al. 2010) whilst PfRh5 binds to basigin (Crosnier et al. 2011). The PfRhs are involved in the initial sensing function of identifying suitable erythrocytes for invasion (Duraisingh et al. 2003; Rayner, Galinski, Ingravallo, and Barnwell, 2000). Furthermore, they are involved in the regulation of Ca2+ signals that lead to the release of EBA- 175 and other components of the invasion machinery. But the PfRh5 has a function distinct from that of the other members of the family. It binds to its receptor basigin and is observed as part of the moving junction. This contrasts with the function of the other members of the family which 16 University of Ghana http://ugspace.ug.edu.gh occurs before the tight junction formation. While Rh1 functions specifically prior to the formation of the tight junction, both Rh2a and Rh2b have been observed as part of the moving junction together with Rh4 and Rh5. Figure 2.4. Receptor-ligand interactions involved in erythrocyte invasion (Adapted from Weiss et al. 2015). The merozoite interacts with the erythrocyte receptors in order to invade. The MSPs form a complex (grey) involving MSP6, MSP1 and MSP7, and bind to heparin-like receptors whilst the EBAs (orange) are secreted from the micronemes (orange) and interact with glycoproteins on the erythrocytes. AMA1 forms a complex with RON4, RON2 and RON5 which is crucial for invasion. The RHs reside in the rhoptry neck of the merozoite and bind to different receptors, with RH4 binding to CR1 and Rh5 binding to basigin, while the receptors for Rh1 and Rh2 remain unknown. case of AMA1-RON2 interaction, the parasite provides its own ligands and receptor, respectively, and thus is independent of host determinants. Each of these interactions can be interrupted using techniques such as enzyme treatment, chemical inhibition and competitive antibody or peptide inhibition. 17 University of Ghana http://ugspace.ug.edu.gh 2.4 MECHANISMS OF HOST IMMUNE EVASION The merozoite is the only stage in P. falciparum’s developmental cycle exposed to the host’s immune system. This puts them at risk of being eliminated by the host’s defense system (fig. 2.5). In order to survive it must devise strategies to avoid the host’s immune system so that it can undergo successful invasion of erythrocytes. Therefore, understanding these strategies of host immune evasion will lead to the identification of weak spots in the process which can serve as targets for vaccine development. Figure 2.5. Mechanisms of host immune evasion (adapted from Wright and Rayner, 2014). Antibodies in the host attack the merozoite through opsonization or by binding to the merozoite proteins in order to prevent invasion. The parasite has cleverly devised ways to avoid these attacks. Some of the proteins on the merozoites are polymorphic whist others like the EBAs and RHs have multiple copies of the same gene. Other proteins like the Rh5 do not elicit enough immune response in natural infections due to the limited level of exposure. P. falciparum has multiple invasion related protein families in its genome. The best studied among them are the MSPs, EBAs and the RHs. The MSPs form the outer coat of merozoites and are thought to be involved in the initial erythrocyte attachment phase of the invasion process. When 18 University of Ghana http://ugspace.ug.edu.gh these merozoites are released into the blood stream of the host, MSPs come under the attack of either the host’s antibodies or complement system (Wright and Rayner, 2014). Therefore, to avoid these attacks the MSPs tend to be highly polymorphic with different variants of the protein circulating in the population. This results in immunologically distinct merozoites that can evade even an already primed immune system (Wright and Rayner, 2014). A major challenge towards the development of an invasion-blocking vaccine is the presence of multiple-member protein families in the genome of P. falciparum; the EBAs and RHs. These proteins are thought to function after the merozoite – erythrocyte initial attachment phase although studies have implicated some of its members in the process (Weiss et al. 2015). These proteins are functionally redundant meaning that the multiple proteins in each of these families all perform the same function. Studies have shown that deleting the gene of a particular ligand in any of these families’ results in the ability of the parasite to invade an enzymatically (neuraminidase, chymotrypsin and trypsin) treated erythrocyte (Desimone et al. 2009; Duraisingh et al. 2003; Lopaticki et al. 2011). A similar observation is seen when the parasites are treated with antibodies that target either of these ligands in an invasion inhibition assay. This shows that the proteins have alternate invasion pathways which is evident in the upregulation of Rh4 protein when EBA175 is knocked out (Stubbs et al. 2005). To date, all members of the EBAs have been shown to be sensitive to neuraminidase treatment, suggesting a conserved function. The RHs on the contrary are resistant to neuraminidase treatment, except for Rh1. Several studies with laboratory strains of P. falciparum have shown that increased expression of the RHs are observed when either the receptors or ligands for sialic acid (SA)- dependent invasion are absent. Clinically, it has been observed that immunity to the EBAs precede that of the RHs. These observations suggest the emergence of the RHs to compensate for the loss 19 University of Ghana http://ugspace.ug.edu.gh of the SA-dependent invasion pathway either due to immune response to the ligands mediating the pathway or the variability in host erythrocyte receptors. The presence of multiple members of the EBAs and RHs presents the parasite with a variety of invasion ligands which provides the ability to overcome either the cell-mediated or humoral immune responses specific ligands. The Rh5 protein which binds to the receptor basigin has been shown to be a good target for vaccine development. What makes it a promising target is the fact that it is soluble (Campeotto et al. 2017; Chen et al. 2014; Crosnier et al. 2011; Hjerrild et al. 2016), it has limited diversity in its sequence (Manske et al. 2012), it is essential for erythrocyte invasion (Awandare et al. 2018; Baum et al. 2009; Chen et al. 2011; Crosnier et al. 2011; Galaway et al. 2017; Mensah-Brown et al. 2015; Sony Reddy et al. 2014) antibodies against Rh5 have been shown to confer protection against malaria non-human (primates) which correlates with similar studies conducted on AMA1 and MSP1 (Douglas et al. 2015; Mahdi Abdel Hamid et al. 2011; Singh et al. 2006) as well as P. falciparum in humanized mouse model and the Aotus monkey (Douglas et al. 2019; Foquet et al. 2018) and humans (Partey et al. 2018). However, these attributes are faulted by the fact that humoral immune responses to Rh5 are low and short lived (Partey et al. 2018; Payne et al. 2017) in natural infections. This is probably another mechanism by which the parasite employs to evade the hosts immune system by limiting the exposure of the antigen. Also, studies conducted in P. falciparum clinical strains have shown that inhibiting the Rh5-basigin interaction is not sufficient to block erythrocyte invasion (Mensah-Brown et al. 2015). These observations show that the Rh5 is not sufficiently immunogenic and as such a sub-unit vaccine based on Rh5 and its interacting partners may not provide adequate protection. 20 University of Ghana http://ugspace.ug.edu.gh AMA1 is a very important parasite invasion ligand because gene knockout studies have shown that this antigen is essential for erythrocyte invasion. AMA1 binds to a parasite ligand RON2 which is inserted into the erythrocyte during invasion. It has been the leading blood stage vaccine target for many years (Collins et al. 2009; Remarque et al. 2008). The problem from the many vaccine trials conducted is that the protein is very polymorphic and that only strains that encode AMA1 antigen similar to the variant used in the production of the vaccine will be inhibited. This shows the parasite is able to evade once again the host immune system by creating a wide range of variants of AMA1 similar to the MSPs (Wright and Rayner, 2014). 2.5 VACCINE DEVELOPMENT STRATEGIES The quest for an effective malaria vaccine has been ongoing for over 50 decades (Nussenzweig et al. 1967). To identify viable vaccine candidates, scientists have exploited the different stages of the parasite’s life cycle to produce transmission blocking vaccines (TBV), pre-erythrocytic stage vaccines and erythrocytic stage vaccines (fig. 2.6). 21 University of Ghana http://ugspace.ug.edu.gh Figure 2.6. Strategies for vaccine development (Adapted from Arama and Troye-Blomberg, 2014). Schematics showing the stages in the life cycle of P. falciparum that could be targeted for vaccine production. Three different strategies are shown: the pre-erythrocytic vaccines, blood stage vaccines and transmission blocking vaccines. The aim of the pre-erythrocytic vaccine strategy was to prevent malaria infection to the host. This vaccine approach targets the liver stage of the parasite. Earlier studies inoculated volunteers with an attenuated form of the whole sporozoite and observed high levels of protection among humans and rodents after subjecting them to non-attenuated sporozoites through mosquito bite (Clyde et al. 1973; Draper et al. 2018; Nussenzweig et al. 1967; Rieckmann et al. 1974). Although this was successful, it was impractical for large scale use therefore the antigen on the surface of the sporozoite, the circumsporozoite protein (CSP) was targeted for vaccine development (Draper et al. 2018). High level of protection was observed in an experiment where mice were immunized with the CSP. This lead to the development of the current sub-unit malaria vaccine, RTS,S (Birkett, 2010; Crompton et al. 2010; Stoute et al. 1997). However, the low efficacy of this vaccine has 22 University of Ghana http://ugspace.ug.edu.gh revived the interest in whole sporozoite vaccine (WSV) strategy. The recent advancement made in the development of a pre-erythrocytic vaccine based on the WSV include the isolation of a purified, sterile, cryopreserved product of radiation attenuated sporozoites (RAS) with an efficacy of approximately 90% (Hoffman et al. 2010). Another strategy is the use of a genetically attenuated sporozoite through the deletion of specific genes in the genome of the sporozoite (Vaughan et al. 2010). This results in a parasite that is unable to develop to the blood stage thereby exposing the liver stage specific proteins longer to the immune system (Doumbo et al. 2018). The aim of blood stage vaccine strategies is to reduce the number of parasites in the blood so as to reduce the severity of the disease. This is based on evidence which suggests that people who have constant exposure to the disease develop natural immunity to malaria overtime (Marsh and Kinyanjui, 2006). In an immunoglobulin gamma (IgG) passive transfer study where purified antibodies from malaria immune adults were given to children, showed massive clearance of the parasite (Cohen et al. 1961). A similar study was conducted where purified antibodies from African adults were inoculated in Thai patients and showed reduced parasitemia levels suggesting that IgGs from different geographical regions have the ability to neutralize parasites (Sabchareon et al. 1991). These observations suggest that a vaccine containing proteins from the merozoite surface is feasible and can prevent malaria. The aim for transmission blocking vaccine (TBV) development is to prevent mosquitos carrying malaria parasites from spreading them. This strategy targets the sexual stage of the parasite, the gametocytes and it is believed that blocking them with antibodies would prevent transmission of malaria. The first evidence that antibodies can prevent mosquito infection in hosts was conducted in avian species (Gwadz, 1976; Huff et al. 1958) and then later in mammalian malaria parasites (Carter and Chen, 1976). Target antigens for this strategy are the Pfs25, Pfs48/45, Pfs28 and 23 University of Ghana http://ugspace.ug.edu.gh Pfs230 (Kaushal et al. 1983; Nikolaeva et al. 2015) and were found to be localized on the surface of ookinetes, gametes and zygote. Although these antigens are less polymorphic and antibodies against them are capable of blocking transmission to approximately 90%, expression of the proteins in their native conformations has proven difficult due to the presence of a 6-cysteine disulfide bonding pattern present in the protein structure. However, co-expression of Pfs48/45 with periplasmic folding catalysts, as well as codon harmonization in E. coli expression systems has yielded correctly folded proteins with transmission blocking activity. Recently, a chimeric recombinant antigen made up of fragments of Pfs48/45, and the blood stage antigen glutamine- rich protein (GLURP) has been successfully produced (Theisen et al. 2014) . Antibodies against this chimera displays multi-stage inhibitory activity, thus providing evidence of the feasibility of a multistage malaria vaccine. The progress with respect to the expression of immunogenic transmission blocking antigens hold promise towards a possible transmission blocking malaria vaccine development. 24 University of Ghana http://ugspace.ug.edu.gh CHAPTER THREE 3.0 MATERIALS AND METHODS 3.1 MATERIALS 3.1.1 Reagents and Antibodies The antifolate drug WR99210 was from Jacobus Pharmaceuticals (New Jersey, USA). Neomycin, Rapamycin and DMSO were purchased from Sigma. Polyclonal rabbit anti-PfCLAMP antibodies that recognized three different epitopes on the PfCLAMP protein as well as the two synthetic PfCLAMP constructs were obtained from GeneScript. Monoclonal rabbit anti-GFP, mouse anti- HA, mouse anti-AMA-1 antibodies as well as PfCLAMP peptides were obtained from Invitrogen. All primers were obtained from Inqaba biotech or Invitrogen. CFDA dye was obtained from Invitrogen. 3.2 METHODS 3.2.1 Analysis of PfCLAMP Gene Sequences Plasmodium falciparum samples (Pf3k) from 14 countries were collected under the Malaria Genomic Epidemiology Network (MalariaGEN). These 2,512 samples were genotyped using the GATK software to identify insertions, deletions and single nucleotide polymorphisms (SNPs). Per-chromosome VCF files containing genotypes for all samples at ~2M high-quality SNP and indel loci were downloaded from the MalariaGEN website. GATK tools (SelectVariants, VariantFiltration, and FastaAlternateReferenceMaker) were used to generate a consensus sequence for the PfCLAMP gene. Sequences were aligned using MAFFT software (auto) and converted to phylip format using a custom-made script. RAxML software was used for sequential 25 University of Ghana http://ugspace.ug.edu.gh and parallel maximum likelihood-based inference of phylogenetic trees for the PfCLAMP gene. The best phylogenetic tree was exported to R-software and converted to cophenetic distances which is an estimate of how the two closely related sequences (branched from a single node) in the phylogenetic tree are similar. The cophenetic correlation coefficients were obtained by calculating the correlation levels in the distance matrix and this was used to plot the heatmap. High levels of sequence conservation between samples are shown by clustering of similar sequences in the heatmap. 3.2.2 Plasmid Design There were two constructs designed to conditionally knockout (cKO) the PfCLAMP gene using the pARL-FIKK10.1 plasmid. This plasmid is consists of loxPint modules, Flag, myc and GFP tags, and skip 2 peptides The first construct pARL_CLAMP_tTM_CTD_aaGFP (TM), had the last 960 bp of the PfCLAMP gene, constituting both the transmembrane and cytoplasmic domains, flanked by loxPint modules whilst the second construct pARL_CLAMP_tCTD_aaGFP (CTD) had the last 600 bp (only ctoplasmic domain) flanked by loxPint modules. For the generation of these two cKO constructs, synthetic gene fragments consisting of the codon optimized PfCLAMP sequences, loxPint modules, Flag and myc tags, T2A skip peptide, and ~700 bp long homology regions with 30bp Gibson flanks were synthesized by Thermo Scientific. The parent vector (pARL-FIKK10.1) was linearized by BgIII/PstI and assembled with the synthetic PfCLAMP construct by Gibson assembly. The assembled plasmid was transformed into D10β competent E. coli cells and later purified from E. coli cultures using the Qiagen Maxi kit. 26 University of Ghana http://ugspace.ug.edu.gh 3.2.3 Cloning into pBCam 3xHA plasmid PfCLAMP was endogenously tagged with a 3x HA epitope tag. To obtain this parasite line, full length PfCLAMP was amplified from 3D7 P. falciparum genomic DNA using specific primers. The PCR product was cloned into the pBCam-HA plasmid between BglII and NotI. The assembled plasmid was transformed into competent E. coli cells and was purified from the E. coli cultures using Qiagen Maxi kit according to developer’s protocol. 3.2.4 Parasite Culture and Transfection Parasite strains 3D7 and B11 were cultured in RPMI 1640 (Life technologies) according to standard conditions (trager and Gjensen at 4% hematocrit and synchronized with 5% sorbitol (sigma) (Lambros and Vanderberg, 1979). To generate the cKO parasite lines B11 parasites were grown to ring stage at 5% parasitemia and electroporated with 100-200 ug of plasmid in 15ul of sterile TE buffer added to 385ul of sterile cytomix (Adjalley, Lee, and Fidock, 2010). Parasite lines that had taken up the plasmid was selected by adding media with 2.5 nM WR99210 continuously for 7 days and then every 2 days until parasitemia re-established. These parasites were grown to 2-4% parasitaemia and integrated parasites selected with 400 ug/ml G418 (Birnbaum et al. 2017). Media containing G418 was added daily for 10 days before returning the parasites to drug-free media. Successful integration was confirmed by amplifying the integrated locus with specific primers using diagnostic PCR and genomic DNA from the 2 parasite lines. To obtain the 3x HA parasite, 50 µl of plasmid (100 µg) was added to 350 µl of cytomix and electroplated into ring stage P. falciparum 3D7. Plasmid uptake was selected for by adding media containing Blasticidin drug (BSD) every day for 6 days and then every other day until parasite population increased. Integration was selected for by subjecting these parasites to an on and off 27 University of Ghana http://ugspace.ug.edu.gh drug treatment until integrant population re-established. Successful integration was confirmed by amplifying the integrated locus using diagnostic PCR with specific primers. 3.2.5 PfCLAMP Knockdown To knockdown the expression of PfCLAMP protein, both PfCLAMP mutant parasites lines were cultured to late stage schizont, purified with 70% percoll and allowed to reinvade erythrocytes. At ring stage, these parasites were synchronized using 5% sorbitol and split into 2 flasks at 2% parasitemia. These flasks were incubated for 16 hours with either 0.2% DMSO or rapamycin (100nM, Sigma). After 16 hours, the parasites were washed twice in incomplete media and divided into different portions. Genomic DNA was extracted from one portion of the parasite cultures and using specific primers (table 6), PCR amplification was conducted to detect the excised locus. The other portion was maintained in culture until they had developed to the schizont stage. Again, these were split into 2 portions. Schizonts from one portion were incubated with RBCs overnight in an invasion assay whilst the other portion was used in an immunofluorescence assay. 28 University of Ghana http://ugspace.ug.edu.gh 3.2.6 DNA extraction and CNV analysis For copy number variation studies, genomic DNA was isolated from 140 samples from Accra, Cape Coast and Kintampo, on dried filter paper using the QI Amp Blood Mini kit by following the instructor’s protocol. This reaction was conducted using the SYBR green method and the Applied Biosystems Quanstudio 5. Quantitative real time PCR was conducted at a final primer concentration of 0.25uM, 1X PerfeCTa SYBR Green Supermix and a DNA volume of 2µl. Each sample was run in duplicate and the sampling conditions are seen in Table 5. The endogenous control used was the seryl-tRNA synthetase whilst 3D7 was used as the reference sample for each run. The specificity of the resulting products was analyzed using the melting curve and experiments with non-specific products were repeated. CNV of the gene was estimated using the 2-ΔΔCt method of relative quantification. 3.2.7 Microscopy Aliquots of either DMSO or rapamycin treated parasite line were treated with cysteine protease inhibitor E64 for 4-6 hours to prevent egress. These parasites were then washed twice in PBS, fixed with 4% PFA/0.025% glutaraldehyde/PBS for 1 hour and permeabilized with 0.1% triton X- 100/PBS for 10 minutes. They were blocked overnight at 40C in 3% BSA/PBS. 100µl of fixed cells was incubated with F1804 mouse anti-FLAG or mouse anti-GFP anti bodies (1:3000) for 2 hours then washed three times in 3% BSA/PBS. Secondary antibodies were added at 1:1000 dilutions and incubated for 1 hour. The cells were resuspended to a hematocrit of 10% and mounted with DAPI-VECTORSHIELD. Images were acquired with an orcaflash4.0 CMOS camera using Nikon TI microscope (NIKON Plan Apo 100x 1.4-NA oil immersion objective). Z-Stacks were acquired with a step size of 0.2 µm and images were deconvolved using the EpiDEMIC Plugin 29 University of Ghana http://ugspace.ug.edu.gh with 50 iterations in ICY software. Subsequent image manipulations were carried out in ImageJ. Thin blood smears of 3D7, the PfCLAMP mutant and HA tagged parasite lines were made, air dried and fixed in acetone for 5 min. These fixed slides were blocked with 3% BSA/PBS for an hour, washed 3 times in PBS and then incubated with either mouse anti-HA, mouse anti-myc or rabbit anti-PfCLAMP antibodies for another hour. The slides were washed 3 times in PBS and incubated with secondary goat anti-mouse and goat anti-rabbit antibodies for 1 hour and mounted with DAPI-VECTOR SHIELD, covered with a cover slip and images taken as above. 3.2.8 Differential Expression Analysis Quantitative RT-PCR (RT-qPCR) was employed for differential expression analysis as well as copy number variation studies on the PfCLAMP gene. For the expression analysis, laboratory strains of P. falciparum parasites were cultured to about 5% parasitaemia and sorbitol synchronized. These parasites were followed up in the intra-erythocytic developmental cycle and arrested at an 8-hour time interval for 48 hours. Total RNA was extracted from each of these arrested stages using the phenol-chloroform method. Amplification and quantification of the PfCLAMP gene was performed using QuantStudio5 (Applied Biosystems) and Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Inc.) according to the manufacturer’s instructions. Each sample was run in duplicate at a total volume of 10 µl containing 1X PerfeCTa SYBR Green SuperMix, 0.5 µM each of the forward and the reverse primers and 2 µl of the target RNA using the default thermocycler conditions (5 minutes at 95oC, 40 cycles of 15 seconds at 95oC and 1 minutes at 60oC). The specificity of the resulting products was analyzed using the melting curve and experiments with non-specific products were repeated. Differential expression of the gene was estimated using the 2-ΔΔCt method of relative quantification. 30 University of Ghana http://ugspace.ug.edu.gh 3.2.9 Peptide Selection, Synthesis and Antibody Generation Amino acid sequence of the PfCLAMP gene was obtained from PlasmoDB.org and submitted to the Genescript software. Using the algorithm of the software, three peptide sequences were selected based on the antigenicity, surface exposure and hydrophilicity scores. One of the peptides was located on the extracellular domain of the protein whilst the other 2 were intracellular. These selected peptide sequences were validated by mass spectrometry. To generate polyclonal antibodies, three different rabbits were inoculated with each of the selected peptides. The sera obtained for each peptide was titrated and validated in an ELISA to obtain a dilution limit of 1:512,000. Antibodies were purified and diluted to working concentrations in sterile distilled water. 3.2.10 Invasion Inhibition Assay Invasion inhibition assay was conducted using commercial antibodies against three different epitopes on the PfCLAMP protein. In brief, different laboratory adapted P. falciparum strains (3D7, Dd2 and FCR3) were cultured to late trophozoite or schizont stages. These parasites were incubated with uninfected red blood cells (RBCs) and different concentrations (25 µg/ml, 50 µg/ml, 75 µg/ml and 100 µg/ml) of the antibodies in a 96-well plate overnight. The cultures were then stained with Hoechst dye and parasitemia determined using LSRFortessa™ X-20 Flow cytometer. 31 University of Ghana http://ugspace.ug.edu.gh 3.2.11 Bioinformatic analysis Amino acid sequence of the PfCLAMP gene was obtained from PlasmoDB.org and submitted to the ITASSER server (Roy et al. 2010; Yang et al. 2014; Yang and Zhang, 2015). The protein structure was modelled by comparing the PfCLAMP sequence to similar existing protein structures on the server. The output file was downloaded from the site and submitted to a molecular visualization software PYMOL to view the modelled structures. the best predicted structre was selected based on the confidence score (c-score) of greater than -1.5. The different domains as well as topology of the PfCLAMP protein was predicted using the Constrained Consensus TOPology prediction software (CCTOP) by submitting the amino acid sequences into the server. 32 University of Ghana http://ugspace.ug.edu.gh CHAPTER FOUR 4.0 RESULT 4.1 PfCLAMP is highly conserved in the population PfCLAMP has been shown to be essential for the growth of P. falciparum (Sidik et al. 2016) making it a potential target for vaccine or drug development. For it to be a suitable candidate, it has to be conserved in the different circulating strains of the parasite. To investigate the diversity of PfCLAMP in the population, gene sequences of the protein were retrieved from the MalariaGEN database from 2,512 clinical isolates from 14 different countries. These sequences were compared to determine either similarity or differences and a heat map (fig. 4.1) generated. It was observed on the heat map that with the exception of a few isolates from Ghana that had very diverse gene sequences, majority of the isolates showed high level of similarity in their sequences indicating high level of conservation. 33 University of Ghana http://ugspace.ug.edu.gh Figure 4.1. PfCLAMP is highly conserved in the population. PfCLAMP gene sequences were obtained from MalariaGEN and compared. The Heat map shows sequence similarity of the PfCLAMP gene among 2,512 samples from 14 countries. Regions of similarity appear in orange and increase in intensity with increasing similarity whilst regions of high diversity are shown in blue. 34 University of Ghana http://ugspace.ug.edu.gh 4.2 Some clinical isolates habour multiple copies of PfCLAMP gene To determine the variation of the PfCLAMP gene across endemic areas in Ghana, DNA was isolated from clinical samples obtained from Accra., Kintampo and Cape Coast. Using specific primers in a quantitative real time PCR, copy number variation studies was conducted in these isolates. It was observed the isolates from Kintampo as well as majority of the isolates from both Accra and Cape Coast possessed single copies of the PfCLAMP gene which was similar to that observed in all laboratory isolates screened (fig. 4.2). However, a few isolates from Accra and Cape Coast were seen to habour multiple copies of the gene Figure 4.2. Copy number variations of the PfCLAMP gene. A box and whiskers plot representing the copy number variations in 140 clinical isolated across three endemic areas in Ghana. The endemic areas are Accra (Green), Kintampo (Purple) and Cape Coast (Red). Majority of the isolates were found to have single copies of PfCLAMP with the exception of a few isolates from Accra and Cape Coast that had multiple copies of the gene. 35 University of Ghana http://ugspace.ug.edu.gh 4.3 PfCLAMP is differentially expressed in different P. falciparum strains To determine the stage in which PfCLAMP is expressed, tightly synchronized cultures of four laboratory stains (3D7, K1, W2mef and GB4) were obtained and parasites material collected every 8 hours throughout the intraerythrocytic cycle at 6 different time points. RNA was extracted from these parasites to determine the expression pattern at the different time points. Using qRT-PCR, it was observed that PfCLAMP was differentially expressed in the different P. falciparum strains (Fig. 4.3A, B, C, D) and that peak expression was in the late trophozoite and schizont stages (between 40-48 hpi). These were comparable to the expression pattern of both EBA 175 and AMA- 1 which are well characterized late stage expressed genes. A M A -1 P fC L A M P E B A 1 7 5 5 1 0 2 .5 4 8 2 .0 3 6 1 .5 2 4 1 .0 1 2 0 .5 0 0 0 .0 1 2 3 4 5 61 2 3 4 5 6 1 2 3 4 5 6 T im e p o in ts T im e p o in ts T im e p o in ts P fC L A M P A M A -1E B A 1 7 5 1 .5 8 3 0 61 .0 2 0 4 0 .5 1 02 0 .0 0 0 1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6 T im e p o in ts T im e p o in ts T im e p o in ts 36 F o ld d iffe re n c e F o ld d iffe re n c e F o ld d iffe re n c e F o ld d iffe re n c e F o ld d iffe re n c e F o ld d iffe re n c e University of Ghana http://ugspace.ug.edu.gh P fC L A M P E B A 1 7 5 A M A -1 2 0 4 0 2 5 1 5 3 0 2 0 1 5 1 0 2 0 1 0 5 1 0 5 0 0 0 1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6 T im e p o in ts T im e p o in ts T im e p o in ts A M A -1 E B A 1 7 5 2 0 5 1 5 4 3 1 0 2 5 1 0 0 1 2 3 4 5 6 1 2 3 4 5 6 T im e p o in ts T im e p o in ts Figure 4.3. PfCLAMP is expressed at the late stage of P. falciparum. Differential expression of PfCLAMP, EBA175 and AMA-1 in different P. falciparum strains at six different time points of 8 hours difference using qRT- PCT A)3D7 B) GB4 C) K1 D) W2mef 4.4 Endogenously tagged PfCLAMP To confirm the late stage expression of the PfCLAMP gene, it was endogenously tagged with a 3x HA tag (fig. 4.4A) to determine the expression pattern by following it up in the IDC. Successful integrants were selected by the on and off treatment with the blasticidin drug. Immunofluorescence staining of the transgenic parasite line using anti-HA antibodies showed PfCLAMP is has its peak expression in the late stage of the parasite (fig. 4.4B) and this was consistent with the expression profile (fig. 4.3). 37 F o ld d iffe re n c e F o ld d iffe re n c e F o ld d iffe re n c e F o ld d iffe re n c e F o ld d iffe re n c e University of Ghana http://ugspace.ug.edu.gh A B Figure 4.4 Endogenous Tagging of PfCLAMP confirms Late stage expression. A) schematics of the plasmid construct B) Identification of endogenously tagged PfCLAMP in the schizont stage using anti-HA antibodies. 38 University of Ghana http://ugspace.ug.edu.gh 4.5 PfCLAMP is expressed in clinical isolates After determining the peak expression of PfCLAMP to be in the late schizont stage of P. falciparum, transcript level of PfCLAMP gene was determined in clinical isolates by reverse transcriptase real-time PCR. The expression level of PfCLAMP was normalized to the endogenous control, L18 which is a 60s ribosomal RNA. To ensure that the parasites were indeed at that late stage, the expression was again normalized to AMA1 as a marker for schizogony. It was observed that the PfCLAMP transcript level of each isolate from the different endemic areas were similar, with about 1fold increase or less relative to the expression of AMA1. interestingly one isolate, A066, had about 8fold increase in its transcript level relative to AMA1. 10 8 6 4 2 0 61 6 4 8 6 0 2 4 5 9 4 2 2 4 1 4 2 2 5 5 1 9 7 70 06 17 19 01 02 04 04 13 23 33 46 46 47 52 52 19 20 21 25 26 28 29 D A A A A H H H H K K K K K K K K N N N N N N N 3 Figure 4.5 Transcript level of PfCLAMP gene in Clinical isolates. The expression level of PfCLAMP was determined in clinical isolates from Accra, Hohoe, Kintampo and Navrongo. The fold expression of the gene was calculated relative to the endogenous control and AMA1 as a measure of the late stage. 39 Fold expression relative to AMA1 University of Ghana http://ugspace.ug.edu.gh 4.6 PfCLAMP has four transmembrane domains and two extracellular loops Predicting the structure of a hypothetical gene is important in determining the function of that protein. It also provides insight on the different domains that the protein may possess. Therefore, to predict the structure of the PfCLAMP protein, amino acid sequences were retrieved from PlasmoDB and submitted to the I-TASSER software. This software compares the submitted amino acid sequences to sequences of similar fold already present in the database to predict the structure. Structures obtained were viewed with the Pymol software. It was observed that PfCLAMP has 4 transmembrane domains (fig. 4.2A) and a cytoplasmic domain with a fold similar to that of the mammalian tight junction protein Claudin as predicted by Sidik et al (2016). To determine how these domains are arranged on the parasite’s plasma membrane, the topology of the protein was predicted using the constrained consensus topology prediction (CCTOP) software. It was observed that the PfCLAMP protein has both its N and C terminus intracellular (fig. 4.2B). Again, the C terminal region was longer than the N terminal region. Furthermore, the protein had 2 extracellular loops that stretches from amino acid 40-140 and from 191-218. There is also a shorter intracellular loop that links the 2nd transmembrane to the 3rd. 40 University of Ghana http://ugspace.ug.edu.gh A B 41 University of Ghana http://ugspace.ug.edu.gh Figure 4.6 PfCLAMP has four transmembrane domains and two extracellular loops. A) Cartoon ribbon representing the secondary structure of PfCLAMP and the four transmembrane (TM) domains with TM1 shown in red, TM2 in yellow, TM3 in purple and TM4 blue B) Topology prediction of PfCLAMP showing the demarcation (shown in numbers) of the different TMs, the exposed domains as well as the cytoplasmic domains. 4.7 Generation of PfCLAMP conditional knockout lines PfCLAMP has been shown to be essential for the growth of P. falciparum (Sidik et al. 2016). Therefore, to determine its role during the growth of the parasite, the TM and CTD parasite lines were generated using the B11 parasites that expresses Dicre endogenously. In the Dicre system, the cre recombinase enzyme is expressed as two inactive polypeptides linked to a rapamycin binding protein. Upon addition of rapamycin, these polypeptides dimerize and recognize loxP sites, which are 32bp sequences that flank the gene of interest to cause excision (Collins et al. 2013). Using this system, two independent strategies were used to generate the cKO lines. This was based on which region of the protein the loxP sites were placed resulting in 2 different PfCLAMP mutant lines. In the first strategy, the loxP sites were placed flanking the cytoplasmic domain (CTD) (fig. 4.4A) and in the second, the loxP sites flanked both the transmembrane and cytoplasmic domains (TM) (fig. 4.4B). These strategies were used to determine the essentiality of the cytoplasmic domain in the overall function of PfCLAMP. In both instances, a synthetic construct was purchased containing recodonized CTD and TM gene sequences tagged with both myc and FLAG tags, a skip T2 peptide, neomycin resistant gene, GFP reporter gene and DHFR gene. Rapamycin induced truncation resulted in the loss of both tags as well as the T2 peptide and neomcycin resistant gene (Neo) leading to the expression of GFP (fig. 4.4A, B, F). After transfection into the B11 parasite line and two rounds of drug selection (WR99120 and G418) was conducted, the integrants were used for further studies. PCR on genomic DNA from both mutant lines confirmed integration under WR99120 (fig. 4.4C) and G418 (fig. 4.4D) drug selections. Excision (of the tags, T2 peptide and Neo) was confirmed at the DNA (fig. 4.4E) level after 42 University of Ghana http://ugspace.ug.edu.gh rapamycin and DMSO treatment (control) by PCR and at the protein level (fig. 4.4F) by probing with anti-GFP and anti-myc antibodies in an immunofluorescence assay. To determine whether these TM and CTD parasite lines can invade erythrocytes, an invasion inhibition assay was set up by incubating these parasites with uninfected erythrocytes overnight (fig. 4.4G). Percentage invasion was calculated relative to the DMSO treatment (control). It was observed that invasion was inhibited by about 30% in the rapamycin treated TM parasite line relative to the DMSO treatment whilst no inhibition was observed in the rapamycin treated CTD parasites. A 43 University of Ghana http://ugspace.ug.edu.gh C D E 44 University of Ghana http://ugspace.ug.edu.gh F G Figure 4.7. Conditional knockout of PfCLAMP. A and B) Schematics of plasmid design strategy C) Genotyping of WR19920 selected transgenic parasites. The alphabets depict the different primer pairs used. D) Genotyping of Neomycin selected transgenic parasites E) Genotyping of 3D7, CTD and TM parasites treated with both DMSO and Rapamycin F) Immunofluorescent assay (IFA) conducted using the rapamycin and DMSO treated parasite lines with either anti-GFP or anti-FLAG antibodies. Each IFA experiment was conducted at least 3 times G) invasion inhibition assay conducted by incubating the rapamycin and DMSO treated parasite lines with uninfected RBCs and incubated overnight. The experiment was run in triplicates and each error bar represents standard error of the mean. 45 University of Ghana http://ugspace.ug.edu.gh 4.8 PfCLAMP is apically concentrated in P. falciparum Polyclonal antibodies were generated in rabbits to three different peptides of the PfCLAMP protein. The peptides were made up of 14 amino acids and were located at the cytoplasmic domain (PfCLAMP-1), the extracellular loop (PfCLAMP-2) and intracellular loop (PfCLAMP-3). The optimal dilution of the antibody was determined in an ELISA at different dilutions of the antibody. The dilutions were from 1:1,000 to 1:512,000 in PBS. These antibodies were used in an immunofluorescence assay to determine the localization of the protein on both free merozoites and mature schizonts (fig. 4.8A, B). Similar staining pattern was observed for all three antibodies in both mature schizont and free merozoites. Due to the topology of peptide-2, antibody-2 was used in an immunofluorescence assay on free merozoites from 3D7 parasites. PfCLAMP was found to be apically concentrated in free merozoites. It co-localized with AMA-1 which shows that PfCLAMP is a micronemal protein. A 4 PfCLAMP-1 PfCLAMP-2 3 PfCLAMP-3 2 1 0 00 00 0 0 0 0 0 0 0 0 k 10 20 40 0 00 00 08 6 20 40 0 80 0 0 0 n : 6 0 20 la 1 1: 1: 1: :1 :3 :6 12 25 51 B1 1 1 1: 1: 1: Dilutions (1mg/ml) 46 Absorbance (OD 450nm) University of Ghana http://ugspace.ug.edu.gh PfCLAMP-1 DAPI B Merge BF C C C PfCLAMP-1 DAPI C Merge BF D PfCLAMP-3 DAPI Merge BF 47 Schizont Merozoites Schizont Merozoites Schizont Merozoites University of Ghana http://ugspace.ug.edu.gh E Figure 4.8. PfCLAMP is apically concentrated. A) Antibody titre dilutions to obtain optimum concentration for further experiments. Immunofluorescence assay was conducted on free merozoites and schizont of 3D7 parasite strain using antibodies against the three different epitopes B) PfCLAMP-1 C) PfCLAMP-2 D) PfCLAMP-3. PfCLAMP-2 antibody (green) was used in a colocalization study with AMA1(red). DAPI (blue) was used to stain the DNA of the parasites. E) PfCLAMP was found to be apically concentrated in free merozoites and colocalized with AMA1, a microneme protein. Each IFA was conducted at least three times and each had the same results. 4.9 Antibody to the extracellular epitope of PfCLAMP inhibits invasion To evaluate the invasion inhibitory activity of the anti-PfCLAMP antibodies, an invasion inhibition assay was set up using the parasite strains 3D7, Dd2 and FCR3 and 3 different anti- peptide antibodies. These parasites were incubated with uninfected erythrocytes and different concentrations of these antibodies (25, 50, 75 and 100 µg/ml) overnight. As a control, pre-immune sera of the of the rabbit used in the production of the antibodies was used in the assay. It was 48 University of Ghana http://ugspace.ug.edu.gh observed that among the 3 antibodies used, only anti-bodies to peptide 2 inhibited invasion in a concentration dependent manner. It inhibited invasion up to 50% at a concentration of 100ug/ul in the 3D7 strain (fig. 4.9A), 70% in Dd2 (fig. 4.9B) and 30% in FCR3. In all instances, the pre- immune sera did not show any form of inhibition.  -P re - im m u n e  -E p ito p e 1 F C R 3  -E p ito p e 2  -E p ito p e 3 1 0 0 7 5 5 0 2 5 0 -2 5 2 5 5 0 7 5 1 0 0 2 5 5 0 7 5 1 0 0 2 5 5 0 7 5 1 0 0 2 5 5 0 7 5 1 0 0 C o n c e n tra t io n ( g /m L ) 49 % In v a s io n In h ib it io n University of Ghana http://ugspace.ug.edu.gh  -P re - im m u n e  -E p ito p e 1  -E p ito p e 2 D d 2  -E p ito p e 3 1 0 0 7 5 5 0 2 5 0 -2 5 2 5 5 0 7 5 1 0 0 2 5 5 0 7 5 1 0 0 2 5 5 0 7 5 1 0 0 2 5 5 0 7 5 1 0 0 C o n c e n tra t io n ( g /m L )  -P re - im m u n e  -E p ito p e 1 3 D 7  -E p ito p e 2  -E p ito p e 3 1 0 0 7 5 5 0 2 5 0 -2 5 2 5 5 0 7 5 1 0 0 2 5 5 0 7 5 1 0 0 2 5 5 0 7 5 1 0 0 2 5 5 0 7 5 1 0 0 C o n c e n tra t io n ( g /m L ) Figure 4.9. Anti-PfCLAMP antibodies inhibits invasion. Invasion inhibition capacity of PfCLAMP antibodies was determined using Dd2, FCR3 and 3D7 parasite strains at different concentrations of the antibody (25-100µg/ml). Three different antibodies were used each against different peptides of the protein. Antibodies against peptide-2 was found to inhibit invasion in all parasite tested. 50 % In v a s io n In h ib it io n % In v a s io n In h ib it io n University of Ghana http://ugspace.ug.edu.gh CHAPTER FIVE 5.0 DISCUSSION AND CONCLUSION 5.1 DISCUSSION The biology of P. falciparum is not fully understood. This is because some of its protein coding genes have not been functionally annotated (Böhme et al. 2019; Gardner et al. 2002). To completely eradicate malaria by 2030 as stipulated by the Global Technical Strategy for Malaria 2016-2030, these genes must be functionally characterized in order to identify potential targets for vaccine or drug development. It has been shown recently that progress has been made in the characterization of these hypothetical/ putative genes (Böhme et al. 2019). However, about 33% of these protein coding genes (Böhme et al. 2019) remain to be characterized. Therefore, this study sought to functionally characterize and investigate the role of a newly identified protein, PfCLAMP, in the growth and invasion of P. falciparum. This study provides the first functional characterization of the PfCLAMP gene in the development of P. falciparum. It has been shown in this study that PfCLAMP is highly conserved in the population of circulating P. falciparum strains and has four transmembrane domains, two extracellular loops with both the N and C terminals intracellular. The fact that it is highly conserved in the population means that the gene has been evolutionarily preserved which suggests that it can be a good target for vaccine development. This confirms a recent study that found PfCLAMP to be highly conserved in apicomplexan species (Sidik et al. 2016). Topology prediction of PfCLAMP provided insight into the arrangement of the different domains of the protein which allowed antibodies to be generated against the extracellular loop. The fact that these antibodies inhibited invasion suggests that again, PfCLAMP is a good target for vaccine 51 University of Ghana http://ugspace.ug.edu.gh development. However, it is yet to be ascertained whether individuals in malaria endemic areas habour antibodies to PfCLAMP and in what quantity. Some studies have questioned the effectiveness of the use of growth/invasion inhibition assays as a method for predicting blood stage targets for vaccine development (Duncan et al. 2012). This is because it is still unclear whether results from this assay is a measure of protection or vaccine efficacy. Nonetheless, until a better method is developed, this assay will be used to determine the potential of a target as vaccine candidate. The late stage expression of PfCLAMP suggests that it may be involved in the invasion process of P. falciparum. This is because its expression pattern correlated with that of EBA-175 and AMA-1 which are well known invasion genes. This was further confirmed by observing a similar pattern in the expression of PfCLAMP in the schizont stage of HA tagged parasite lines. PfCLAMP was found to be apically concentrated in free merozoites specifically in the microneme as it colocalized with AMA-1. This observation is similar to what was observed in previous studies (Hu et al. 2010; Sidik et al. 2016). The similar transcript level of PfCLAMP observed in clinical isolates suggests that the protein is conserved in the population. Again, cKO of the protein inhibited invasion by up to 30% in the first cycle of the parasite’s development. This further confirms the idea that PfCLAMP may be involved in the invasion process of P. falciparum. This inhibition was observed in the parasite line that had the entire protein excised. The inhibition was not very profound because the excision was done at the DNA level meaning that they may have been residual levels of the protein present which may not have been depleted after just one cycle of parasite growth. There was no inhibition seen in the parasite 52 University of Ghana http://ugspace.ug.edu.gh line with just the cytoplasmic domain truncated. This could be due to the residual level of the protein or that the cytoplasmic domain is not important for the function of the protein. 53 University of Ghana http://ugspace.ug.edu.gh 5.2 CONCLUSION In conclusion, this study has shown that PfCLAMP is highly conserved in the population. It has also predicted the topology of PfCLAMP, and shown that the protein is differentially expressed in the different strains of P. falciparum. Additionally, it has been demonstrated that the cytoplasmic domain may not be important for the activity of the protein although further experiments would be required to confirm that. Altogether, PfCLAMP the study has discovered that PfCLAMP is a promising target for vaccine development. 54 University of Ghana http://ugspace.ug.edu.gh 5.3 RECOMMENDATION AND FUTURE WORK The data presented here suggests that PfCLAMP is good candidate for vaccine development. However, the immunogenicity of this protein was not determined. Therefore, in the future, it will be necessary determine whether there are natural antibodies to this protein and in what quantity in an ELISA. Furthermore, if PfCLAMP is found to be immunogenic, it would be necessary to determine which epitopes on the protein is able to induce B and T cell production. Again, it would be good to find out the interacting partners of PfCLAMP in a co- immunoprecipitation assay. This would help to know the associating partners of PfCLAMP and also help in confirming its function because proteins with similar functions often interact with each other. Lastly, the cKO mutants could be cultured for more than one cycle to determine if depletion of the residual protein would reduce the invasion in both mutants further. It would also be necessary to determine if the cKO of PfCLAMP would affect the morphology of the parasite. 55 University of Ghana http://ugspace.ug.edu.gh REFERENCES Agnandji, ST, Lell, B, Fernandes, JF, Abossolo, BP, Kabwende, AL, Adegnika, AA, Mordmüller, B, Issifou, S, Kremsner, PG, Loembe, MM, Sacarlal, J, Aide, P, Madrid, L, Lanaspa, M, Mandjate, S, Aponte, JJ, Bulo, H, Nhama, A, Macete, E, Alonso, P, … Schellenberg, D. (2014). Efficacy and Safety of the RTS,S/AS01 Malaria Vaccine during 18 Months after Vaccination: A Phase 3 Randomized, Controlled Trial in Children and Young Infants at 11 African Sites. PLoS Medicine, 11(7). https://doi.org/10.1371/journal.pmed.1001685 Aikawa, M, Miller, LH, Johnson, J, and Rabbege, J. (1978). Erythrocyte entry by malarial parasites. A moving junction between erythrocyte and parasite. Journal of Cell Biology. https://doi.org/10.1083/jcb.77.1.72 Alexander, DL, Mital, J, Ward, GE, Bradley, P, and Boothroyd, JC. (2005). Identification of the moving junction complex of Toxoplasma gondii: A collaboration between distinct secretory organelles. PLoS Pathogens. https://doi.org/10.1371/journal.ppat.0010017 Amaratunga, C, Lim, P, Suon, S, Sreng, S, Mao, S, Sopha, C, Sam, B, Dek, D, Try, V, Amato, R, Blessborn, D, Song, L, Tullo, GS, Fay, MP, Anderson, JM, Tarning, J, and Fairhurst, RM. (2016). Dihydroartemisinin-piperaquine resistance in Plasmodium falciparum malaria in Cambodia: A multisite prospective cohort study. The Lancet Infectious Diseases, 16(3), 357–365. https://doi.org/10.1016/S1473-3099(15)00487-9 Amoah, LE, Abankwa, J, and Oppong, A. (2016). Plasmodium falciparum histidine rich protein- 2 diversity and the implications for PfHRP 2: Based malaria rapid diagnostic tests in Ghana. Malaria Journal, 15(1). https://doi.org/10.1186/s12936-016-1159-z 56 University of Ghana http://ugspace.ug.edu.gh Arama, C, and Troye-Blomberg, M. (2014). The path of malaria vaccine development: Challenges and perspectives. Journal of Internal Medicine. https://doi.org/10.1111/joim.12223 Awandare, GA, Nyarko, PB, Aniweh, Y, Ayivor-Djanie, R, and Stoute, JA. (2018). Plasmodium falciparum strains spontaneously switch invasion phenotype in suspension culture. Scientific Reports. https://doi.org/10.1038/s41598-018-24218-0 Bannister, LH, Butcher, GA, and Dennis, ED. (1986). Lamellar Membranes Associated With Rhoptries In Erythrocytic Merozoites Of Plasmodium Knowlesi: A Clue To The Mechanism Of Invasion. Parasitology. https://doi.org/10.1017/S0031182000064064 Bannister, LH, Butcher, GA, Dennis, ED, and Mitchell, GH. (1975). Structure and invasive behaviour of Plasmodium knowlesi merozoites in vitro. Parasitology, 71(3), 483–491. https://doi.org/10.1017/S0031182000047247 Bannister, LH, Hopkins, JM, Fowler, RE, Krishna, S, and Mitchell, GH. (2000). A brief illustrated guide to the ultrastructure of Plasmodium falciparum asexual blood stages. Parasitology Today. https://doi.org/10.1016/S0169-4758(00)01755-5 Bargieri, DY, Andenmatten, N, Lagal, V, Thiberge, S, Whitelaw, JA, Tardieux, I, Meissner, M, and Ménard, R. (2013). Apical membrane antigen 1 mediates apicomplexan parasite attachment but is dispensable for host cell invasion. Nature Communications, 4. https://doi.org/10.1038/ncomms3552 Barnwell, JW, and Galinski, MR. (1991). The adhesion of malaria merozoite proteins to erythrocytes: a reflection of function? Research in Immunology. 57 University of Ghana http://ugspace.ug.edu.gh https://doi.org/10.1016/0923-2494(91)90147-B Baum, J, Chen, L, Healer, J, Lopaticki, S, Boyle, M, Triglia, T, Ehlgen, F, Ralph, SA, Beeson, JG, and Cowman, AF. (2009). Reticulocyte-binding protein homologue 5 - An essential adhesin involved in invasion of human erythrocytes by Plasmodium falciparum. International Journal for Parasitology. https://doi.org/10.1016/j.ijpara.2008.10.006 Besteiro, S, Michelin, A, Poncet, J, Dubremetz, JF, and Lebrun, M. (2009). Export of a Toxoplasma gondii rhoptry neck protein complex at the host cell membrane to form the moving junction during invasion. PLoS Pathogens. https://doi.org/10.1371/journal.ppat.1000309 Birkett, AJ. (2010). PATH malaria vaccine initiative (MVI): Perspectives on the status of malaria vaccine development. Human Vaccines. https://doi.org/10.4161/hv.6.1.10462 Boddey, JA, Carvalho, TG, Hodder, AN, Sargeant, TJ, Sleebs, BE, Marapana, D, Lopaticki, S, Nebl, T, and Cowman, AF. (2013). Role of Plasmepsin V in Export of Diverse Protein Families from the Plasmodium falciparum Exportome. Traffic. https://doi.org/10.1111/tra.12053 Böhme, U, Otto, TD, Sanders, M, Newbold, CI, and Berriman, M. (2019). Progression of the canonical reference malaria parasite genome from 2002–2019. Wellcome Open Research. https://doi.org/10.12688/wellcomeopenres.15194.1 Boyle, MJ, Richards, JS, Gilson, PR, Chai, W, and Beeson, JG. (2010). Interactions with heparin-like molecules during erythrocyte invasion by Plasmodium falciparum merozoites. Blood. https://doi.org/10.1182/blood-2009-09-243725 58 University of Ghana http://ugspace.ug.edu.gh Bozdech, Z, Zhu, J, Joachimiak, MP, Cohen, FE, Pulliam, B, and DeRisi, JL. (2003). Expression profiling of the schizont and trophozoite stages of Plasmodium falciparum with a long- oligonucleotide microarray. Genome Biology. Bushell, E, Gomes, AR, Sanderson, T, Anar, B, Girling, G, Herd, C, Metcalf, T, Modrzynska, K, Schwach, F, Martin, RE, Mather, MW, McFadden, GI, Parts, L, Rutledge, GG, Vaidya, AB, Wengelnik, K, Rayner, JC, and Billker, O. (2017). Functional Profiling of a Plasmodium Genome Reveals an Abundance of Essential Genes. Cell, 170(2). https://doi.org/10.1016/j.cell.2017.06.030 Campeotto, I, Goldenzweig, A, Davey, J, Barfod, L, Marshall, JM, Silk, SE, Wright, KE, Draper, SJ, Higgins, MK, and Fleishman, SJ. (2017). One-step design of a stable variant of the malaria invasion protein RH5 for use as a vaccine immunogen. Proceedings of the National Academy of Sciences. https://doi.org/10.1073/pnas.1616903114 Camus, D, and Hadley, TJ. (1985). A Plasmodium falciparum antigen that binds to host erythrocytes and merozoites. Science. https://doi.org/10.1126/science.3901257 Carter, R, and Chen, DH. (1976). Malaria transmission blocked by immunisation with gametes of the malaria parasite. Nature. https://doi.org/10.1038/263057a0 Carter, R, and Mendis, KN. (2002). Evolutionary and historical aspects of the burden of malaria. Clinical Microbiology Reviews. https://doi.org/10.1128/CMR.15.4.564-594.2002 Chen, L, Lopaticki, S, Riglar, DT, Dekiwadia, C, Uboldi, AD, Tham, WH, O’Neill, MT, Richard, D, Baum, J, Ralph, SA, and Cowman, AF. (2011). An egf-like protein forms a complex with pfrh5 and is required for invasion of human erythrocytes by plasmodium 59 University of Ghana http://ugspace.ug.edu.gh falciparum. PLoS Pathogens. https://doi.org/10.1371/journal.ppat.1002199 Chen, L, Xu, Y, Healer, J, Thompson, JK, Smith, BJ, Lawrence, MC, and Cowman, AF. (2014). Crystal structure of PfRh5, an essential P. falciparum ligand for invasion of human erythrocytes. ELife. https://doi.org/10.7554/eLife.04187 CLYDE, DF, MOST, H, McCARTHY, VC, and VANDERBERG, JP. (1973). Immunization of man against sporozite-induced falciparum malaria. The American Journal of the Medical Sciences, 266(3), 169–177. https://doi.org/10.1097/00000441-197309000-00002 Cohen, S, McGregor, IA, and Carrington, S. (1961). Gamma-globulin and acquired immunity to human malaria. Nature. https://doi.org/10.1038/192733a0 Collins, CR, Das, S, Wong, EH, Andenmatten, N, Stallmach, R, Hackett, F, Herman, J, Müller, S, Meissner, M, and Blackman, MJ. (2013). Robust inducible Cre recombinase activity in the human malaria parasite Plasmodium falciparum enables efficient gene deletion within a single asexual erythrocytic growth cycle. 88(March), 687–701. https://doi.org/10.1111/mmi.12206 Collins, CR, Withers-Martinez, C, Hackett, F, and Blackman, MJ. (2009). An inhibitory antibody blocks interactions between components of the malarial invasion machinery. PLoS Pathogens. https://doi.org/10.1371/journal.ppat.1000273 Corbel, V, N’Guessan, R, Brengues, C, Chandre, F, Djogbenou, L, Martin, T, Akogbéto, M, Hougard, JM, and Rowland, M. (2007). Multiple insecticide resistance mechanisms in Anopheles gambiae and Culex quinquefasciatus from Benin, West Africa. Acta Tropica, 101(3), 207–216. https://doi.org/10.1016/j.actatropica.2007.01.005 60 University of Ghana http://ugspace.ug.edu.gh Cowman, AF, Berry, D, and Baum, J. (2012). The cellular and molecular basis for malaria parasite invasion of the human red blood cell. Journal of Cell Biology, 198(6), 961–971. https://doi.org/10.1083/jcb.201206112 Cowman, AF, and Crabb, BS. (2006). Invasion of red blood cells by malaria parasites. Cell. https://doi.org/10.1016/j.cell.2006.02.006 Cowman, AF, Tonkin, CJ, Tham, WH, and Duraisingh, MT. (2017). The Molecular Basis of Erythrocyte Invasion by Malaria Parasites. Cell Host and Microbe. https://doi.org/10.1016/j.chom.2017.07.003 Crick, AJ, Theron, M, Tiffert, T, Lew, VL, Cicuta, P, and Rayner, JC. (2014). Quantitation of malaria parasite-erythrocyte cell-cell interactions using optical tweezers. Biophysical Journal. https://doi.org/10.1016/j.bpj.2014.07.010 Crompton, PD, Pierce, SK, and Miller, LH. (2010). Advances and challenges in malaria vaccine development. Journal of Clinical Investigation. https://doi.org/10.1172/JCI44423 Crosnier, C, Bustamante, LY, Bartholdson, SJ, Bei, AK, Theron, M, Uchikawa, M, Mboup, S, Ndir, O, Kwiatkowski, DP, Duraisingh, MT, Rayner, JC, and Wright, GJ. (2011). Basigin is a receptor essential for erythrocyte invasion by Plasmodium falciparum. Nature, 480(7378), 534–537. https://doi.org/10.1038/nature10606 Das, S, Hertrich, N, Perrin, AJ, Withers-Martinez, C, Collins, CR, Jones, ML, Watermeyer, JM, Fobes, ET, Martin, SR, Saibil, HR, Wright, GJ, Treeck, M, Epp, C, and Blackman, MJ. (2015). Processing of Plasmodium falciparum Merozoite Surface Protein MSP1 Activates a Spectrin-Binding Function Enabling Parasite Egress from RBCs. Cell Host and Microbe. 61 University of Ghana http://ugspace.ug.edu.gh https://doi.org/10.1016/j.chom.2015.09.007 Dasgupta, S, Auth, T, Gov, NS, Satchwell, TJ, Hanssen, E, Zuccala, ES, Riglar, DT, Toye, AM, Betz, T, Baum, J, and Gompper, G. (2014). Membrane-wrapping contributions to malaria parasite invasion of the human erythrocyte. Biophysical Journal. https://doi.org/10.1016/j.bpj.2014.05.024 Desimone, TM, Jennings, C V., Bei, AK, Comeaux, C, Coleman, BI, Refour, P, Triglia, T, Stubbs, J, Cowman, AF, and Duraisingh, MT. (2009). Cooperativity between Plasmodium falciparum adhesive proteins for invasion into erythrocytes. Molecular Microbiology. https://doi.org/10.1111/j.1365-2958.2009.06667.x Dondorp, AM, Nosten, F, Yi, P, Das, D, Phyo, AP, Tarning, J, Lwin, KM, Ariey, F, Hanpithakpong, W, Lee, SJ, Ringwald, P, Silamut, K, Imwong, M, Chotivanich, K, Lim, P, Herdman, T, An, SS, Yeung, S, Singhasivanon, P, Day, NPJ, Lindegardh, N, Socheat, D, and White, NJ. (2009). Artemisinin resistance in Plasmodium falciparum malaria. The New England Journal of Medicine, 361(5), 455–467. https://doi.org/10.1056/NEJMoa0808859 Douglas, AD, Baldeviano, GC, Jin, J, Miura, K, Diouf, A, Zenonos, ZA, Ventocilla, JA, Silk, SE, Marshall, JM, Alanine, DGW, Wang, C, Edwards, NJ, Leiva, KP, Gomez-Puerta, LA, Lucas, CM, Wright, GJ, Long, CA, Royal, JM, and Draper, SJ. (2019). A defined mechanistic correlate of protection against Plasmodium falciparum malaria in non-human primates. Nature Communications. https://doi.org/10.1038/s41467-019-09894-4 Douglas, AD, Baldeviano, GC, Lucas, CM, Lugo-Roman, LA, Crosnier, C, Bartholdson, SJ, Diouf, A, Miura, K, Lambert, LE, Ventocilla, JA, Leiva, KP, Milne, KH, Illingworth, JJ, Spencer, AJ, Hjerrild, KA, Alanine, DGW, Turner, A V., Moorhead, JT, Edgel, KA, Wu, Y, 62 University of Ghana http://ugspace.ug.edu.gh Long, CA, Wright, GJ, Lescano, AG, and Draper, SJ. (2015). A PfRH5-based vaccine is efficacious against heterologous strain blood-stage plasmodium falciparum infection in Aotus monkeys. Cell Host and Microbe. https://doi.org/10.1016/j.chom.2014.11.017 Douglas, AD, Williams, AR, Illingworth, JJ, Kamuyu, G, Biswas, S, Goodman, AL, Wyllie, DH, Crosnier, C, Miura, K, Wright, GJ, Long, CA, Osier, FH, Marsh, K, Turner, A V., Hill, AVS, and Draper, SJ. (2011). The blood-stage malaria antigen PfRH5 is susceptible to vaccine-inducible cross-strain neutralizing antibody. Nature Communications. https://doi.org/10.1038/ncomms1615 Doumbo, OK, Niaré, K, Healy, SA, Sagara, I, and Duffy, PE. (2018). Malaria Transmission- Blocking Vaccines: Present Status and Future Perspectives. In Towards Malaria Elimination - A Leap Forward. https://doi.org/10.5772/intechopen.77241 Draper, SJ, Sack, BK, King, CR, Nielsen, CM, Rayner, JC, Higgins, MK, Long, CA, and Seder, RA. (2018). Malaria Vaccines: Recent Advances and New Horizons. Cell Host and Microbe. https://doi.org/10.1016/j.chom.2018.06.008 Duncan, CJA, Hill, AVS, and Ellis, RD. (2012). Can growth inhibition assays (GIA) predict blood-stage malaria vaccine efficacy? Human Vaccines and Immunotherapeutics. https://doi.org/10.4161/hv.19712 Duraisingh, MT, Triglia, T, Ralph, SA, Rayner, JC, Barnwell, JW, McFadden, GI, and Cowman, AF. (2003). Phenotypic variation of Plasmodium falciparum merozoite proteins directs receptor targeting for invasion of human erythrocytes. EMBO Journal. https://doi.org/10.1093/emboj/cdg096 63 University of Ghana http://ugspace.ug.edu.gh Dvorak, JA, Miller, LH, Whitehouse, WC, and Shiroishi, T. (1975). Invasion of erythrocytes by malaria merozoites. Science. https://doi.org/10.1126/science.803712 Efficacy and safety of RTS,S/AS01 malaria vaccine with or without a booster dose in infants and children in Africa: Final results of a phase 3, individually randomised, controlled trial. (2015). The Lancet. https://doi.org/10.1016/S0140-6736(15)60721-8 Esposito, A, Choimet, JB, Skepper, JN, Mauritz, JMA, Lew, VL, Kaminski, CF, and Tiffert, T. (2010). Quantitative imaging of human red blood cells infected with Plasmodium falciparum. Biophysical Journal. https://doi.org/10.1016/j.bpj.2010.04.065 Foquet, L, Schafer, C, Minkah, NK, Alanine, DGW, Flannery, EL, Steel, RWJ, Sack, BK, Camargo, N, Fishbaugher, M, Betz, W, Nguyen, T, Billman, ZP, Wilson, EM, Bial, J, Murphy, SC, Draper, SJ, Mikolajczak, SA, and Kappe, SHI. (2018). Plasmodium falciparum liver stage infection and transition to stable blood stage infection in liver- humanized and blood-humanized FRGN KO mice enables testing of blood stage inhibitory antibodies (reticulocyte-binding protein homolog 5) in vivo. Frontiers in Immunology. https://doi.org/10.3389/fimmu.2018.00524 Foth, BJ, Zhang, N, Chaal, BK, Sze, SK, Preiser, PR, and Bozdech, Z. (2011). Quantitative Time-course Profiling of Parasite and Host Cell Proteins in the Human Malaria Parasite Plasmodium falciparum . Molecular & Cellular Proteomics. https://doi.org/10.1074/mcp.m110.006411 Furuse, M, Sasaki, H, and Tsukita, S. (1999). Manner of interaction of heterogeneous claudin species within and between tight junction strands. Journal of Cell Biology. https://doi.org/10.1083/jcb.147.4.891 64 University of Ghana http://ugspace.ug.edu.gh Galaway, F, Drought, LG, Fala, M, Cross, N, Kemp, AC, Rayner, JC, and Wright, GJ. (2017). P113 is a merozoite surface protein that binds the N terminus of Plasmodium falciparum RH5. Nature Communications. https://doi.org/10.1038/ncomms14333 Gardner, MJ, Hall, N, Fung, E, White, O, Berriman, M, Hyman, RW, Carlton, JM, Pain, A, Nelson, KE, Bowman, S, Paulsen, IT, James, K, Eisen, JA, Rutherford, K, Salzberg, SL, Craig, A, Kyes, S, Chan, M, Nene, V, Shallom, SJ, Suh, B, Peterson, J, Angiuoli, S, Pertea, M, Allen, J, Selengut, J, Haft, D, Mather, MW, Vaidya, AB, Martin, DMA, Fairlamb, AH, Fraunholz, MJ, Roos, DS, Ralph, SA, McFadden, GI, Cummings, LM, Subramanian, GM, Mungall, C, Venter, JC, Carucci, DJ, Hoffman, SL, Newbold, C, Davis, RW, Fraser, CM, and Barrell, B. (2002). Genome sequence of the human malaria parasite Plasmodium falciparum. Nature, 419(6906), 498–511. https://doi.org/10.1038/nature01097 Garg, S, Agarwal, S, Dabral, S, Kumar, N, Sehrawat, S, and Singh, S. (2015). Visualization and quantification of Plasmodium falciparum intraerythrocytic merozoites. Systems and Synthetic Biology. https://doi.org/10.1007/s11693-015-9167-9 Gilberger, TW, Thompson, JK, Triglia, T, Good, RT, Duraisingh, MT, and Cowman, AF. (2003). A novel erythrocyte binding antigen-175 paralogue from Plasmodium falciparum defines a new trypsin-resistant receptor on human erythrocytes. Journal of Biological Chemistry, 278(16), 14480–14486. https://doi.org/10.1074/jbc.M211446200 Gilson, PR, and Crabb, BS. (2009). Morphology and kinetics of the three distinct phases of red blood cell invasion by Plasmodium falciparum merozoites. International Journal for Parasitology, 39(1), 91–96. https://doi.org/10.1016/j.ijpara.2008.09.007 Gilson, PR, Nebl, T, Vukcevic, D, Moritz, RL, Sargeant, T, Speed, TP, Schofield, L, and Crabb, 65 University of Ghana http://ugspace.ug.edu.gh BS. (2006). Identification and Stoichiometry of Glycosylphosphatidylinositol-anchored Membrane Proteins of the Human Malaria Parasite Plasmodium falciparum . Molecular & Cellular Proteomics. https://doi.org/10.1074/mcp.m600035-mcp200 Günzel, D, and Yu, ASL. (2013). Claudins and the Modulation of Tight Junction Permeability. Physiological Reviews. https://doi.org/10.1152/physrev.00019.2012 Gwadz, RW. (1976). Malaria: Successful immunization against the sexual stages of Plasmodium gallinaceum. Science. https://doi.org/10.1126/science.959832 Hall, N, Karras, M, Raine, JD, Carlton, JM, Kooij, TWA, Berriman, M, Florens, L, Janssen, CS, Pain, A, Christophides, GK, James, K, Rutherford, K, Harris, B, Harris, D, Churcher, C, Quail, MA, Ormond, D, Doggett, J, Trueman, HE, Mendoza, J, Bidwell, SL, Rajandream, MA, Carucci, DJ, Yates, JR, Kafatos, FC, Janse, CJ, Barrell, B, Turner, CMR, Waters, AP, and Sinden, RE. (2005). A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. https://doi.org/10.1126/science.1103717 Harris, KS, Casey, JL, Coley, AM, Masciantonio, R, Sabo, JK, Keizer, DW, Lee, EF, McMahon, A, Norton, RS, Anders, RF, and Foley, M. (2005). Binding hot spot for invasion inhibitory molecules on Plasmodium falciparum apical membrane antigen 1. Infection and Immunity. https://doi.org/10.1128/IAI.73.10.6981-6989.2005 Hjerrild, KA, Jin, J, Wright, KE, Brown, RE, Marshall, JM, Labbé, GM, Silk, SE, Cherry, CJ, Clemmensen, SB, Jørgensen, T, Illingworth, JJ, Alanine, DGW, Milne, KH, Ashfield, R, De Jongh, WA, Douglas, AD, Higgins, MK, and Draper, SJ. (2016). Production of full-length soluble Plasmodium falciparum RH5 protein vaccine using a Drosophila melanogaster Schneider 2 stable cell line system. Scientific Reports. https://doi.org/10.1038/srep30357 66 University of Ghana http://ugspace.ug.edu.gh Hoffman, SL, Billingsley, PF, James, E, Richman, A, Loyevsky, M, Li, T, Chakravarty, S, Gunasekera, A, Chattopadhyay, R, Li, M, Stafford, R, Ahumada, A, Epstein, JE, Sedegah, M, Reyes, S, Richie, TL, Lyke, KE, Edelman, R, Laurens, MB, Plowe, C V., and Sim, BKL. (2010). Development of a metabolically active, non-replicating sporozoite vaccine to prevent Plasmodium falciparum malaria. Human Vaccines. https://doi.org/10.4161/hv.6.1.10396 Hu, G, Cabrera, A, Kono, M, Mok, S, Chaal, BK, Haase, S, Engelberg, K, Cheemadan, S, Spielmann, T, Preiser, PR, Gilberger, T-W, and Bozdech, Z. (2010). Transcriptional profiling of growth perturbations of the human malaria parasite Plasmodium falciparum. Nature Biotechnology, 28(1), 91–98. https://doi.org/10.1038/nbt.1597 Huff, CG, Marchbank, DF, and Shiroishi, T. (1958). Changes in infectiousness of malarial gametocytes. II. Analysis of the possible causative factors. Experimental Parasitology. https://doi.org/10.1016/0014-4894(58)90036-5 Imwong, M, Madmanee, W, Suwannasin, K, Kunasol, C, Peto, TJ, Tripura, R, Von Seidlein, L, Nguon, C, Davoeung, C, Day, NPJ, Dondorp, AM, and White, NJ. (2019). Asymptomatic natural human infections with the simian malaria parasites plasmodium cynomolgi and plasmodium knowlesi. Journal of Infectious Diseases, 219(5), 695–702. https://doi.org/10.1093/infdis/jiy519 Iyer, J, Grüner, AC, Rénia, L, Snounou, G, and Preiser, PR. (2007). Invasion of host cells by malaria parasites: A tale of two protein families. Molecular Microbiology. https://doi.org/10.1111/j.1365-2958.2007.05791.x Kadekoppala, M, and Holder, AA. (2010). Merozoite surface proteins of the malaria parasite: 67 University of Ghana http://ugspace.ug.edu.gh The MSP1 complex and the MSP7 family. International Journal for Parasitology, Vol. 40, pp. 1155–1161. https://doi.org/10.1016/j.ijpara.2010.04.008 Kaushal, DC, Carter, R, Rener, J, Grotendorst, CA, Miller, LH, and Howard, RJ. (1983). Monoclonal antibodies against surface determinants on gametes of Plasmodium gallinaceum block transmission of malaria parasites to mosquitoes. Journal of Immunology, 131(5), 2557–2562. Koch, M, and Baum, J. (2016). The mechanics of malaria parasite invasion of the human erythrocyte - towards a reassessment of the host cell contribution. Cellular Microbiology. https://doi.org/10.1111/cmi.12557 Koita, OA, Doumbo, OK, Ouattara, A, Tall, LK, Konaré, A, Diakité, M, Diallo, M, Sagara, I, Masinde, GL, Doumbo, SN, Dolo, A, Tounkara, A, Traoré, I, and Krogstad, DJ. (2012). False-negative rapid diagnostic tests for malaria and deletion of the histidine-rich repeat region of the hrp2 gene. American Journal of Tropical Medicine and Hygiene, 86(2), 194– 198. https://doi.org/10.4269/ajtmh.2012.10-0665 Kooij, TWA, Carlton, JM, Bidwell, SL, Hall, N, Ramesar, J, Janse, CJ, and Waters, AP. (2005). A Plasmodium whole-genome synteny map: Indels and synteny breakpoints as foci for species-specific genes. PLoS Pathogens. https://doi.org/10.1371/journal.ppat.0010044 Langreth, SG, Jensen, JB, Reese, RT, and Trager, W. (1978). Fine Structure of Human Malaria In Vitro. The Journal of Protozoology. https://doi.org/10.1111/j.1550-7408.1978.tb04167.x Le Roch, KG, Zhou, Y, Blair, PL, Grainger, M, Moch, JK, Haynes, JD, De la Vega, P, Holder, AA, Batalov, S, Carucci, DJ, and Winzeler, EA. (2003). Discovery of gene function by 68 University of Ghana http://ugspace.ug.edu.gh expression profiling of the malaria parasite life cycle. Science. https://doi.org/10.1126/science.1087025 Liew, KJL, Hu, G, Bozdech, Z, and Peter, PR. (2010). Defining species specific genome differences in malaria parasites. BMC Genomics. https://doi.org/10.1186/1471-2164-11-128 Lin, CS, Uboldi, AD, Marapana, D, Czabotar, PE, Epp, C, Bujard, H, Taylor, NL, Perugini, MA, Hodder, AN, and Cowman, AF. (2014). The merozoite surface protein 1 complex is a platform for binding to human erythrocytes by plasmodium falciparum. Journal of Biological Chemistry, 289(37), 25655–25669. https://doi.org/10.1074/jbc.M114.586495 Lopaticki, S, Maier, AG, Thompson, J, Wilson, DW, Tham, W-H, Triglia, T, Gout, A, Speed, TP, Beeson, JG, Healer, J, and Cowman, AF. (2011). Reticulocyte and Erythrocyte Binding-Like Proteins Function Cooperatively in Invasion of Human Erythrocytes by Malaria Parasites. Infection and Immunity. https://doi.org/10.1128/iai.01021-10 Mahdi Abdel Hamid, M, Remarque, EJ, van Duivenvoorde, LM, van der Werff, N, Walraven, V, Faber, BW, Kocken, CH, and Thomas, AW. (2011). Vaccination with Plasmodium knowlesi AMA1 formulated in the novel adjuvant co-vaccine HTTM protects against blood- stage challenge in rhesus macaques. PLoS ONE. https://doi.org/10.1371/journal.pone.0020547 Maier, AG, Duraisingh, MT, Reeder, JC, Patel, SS, Kazura, JW, Zimmerman, PA, and Cowman, AF. (2003). Plasmodium falciparum erythrocyte invasion through glycophorin C and selection for Gerbich negativity in human populations. Nature Medicine, 9(1), 87–92. https://doi.org/10.1038/nm807 69 University of Ghana http://ugspace.ug.edu.gh Manske, M, Miotto, O, Campino, S, Auburn, S, Almagro-Garcia, J, Maslen, G, O’Brien, J, Djimde, A, Doumbo, O, Zongo, I, Ouedraogo, JB, Michon, P, Mueller, I, Siba, P, Nzila, A, Borrmann, S, Kiara, SM, Marsh, K, Jiang, H, Su, XZ, … Kwiatkowski, DP. (2012). Analysis of Plasmodium falciparum diversity in natural infections by deep sequencing. Nature. https://doi.org/10.1038/nature11174 Marsh, K, and Kinyanjui, S. (2006). Immune effector mechanisms in malaria. Parasite Immunology. https://doi.org/10.1111/j.1365-3024.2006.00808.x Mawson, AR. (2013). The pathogenesis of malaria: a new perspective. Pathogens and Global Health, 107(3), 122–129. https://doi.org/10.1179/2047773213y.0000000084 Mayer, DCG, Cofie, J, Jiang, L, Hartl, DL, Tracy, E, Kabat, J, Mendoza, LH, and Miller, LH. (2009). Glycophorin B is the erythrocyte receptor of Plasmodium falciparum erythrocyte- binding ligand, EBL-1. Proceedings of the National Academy of Sciences, 106(13), 5348– 5352. https://doi.org/10.1073/pnas.0900878106 McFadden, GI, Reith, ME, Munholland, J, and Lang-Unnasch, N. (1996). Plastid in human parasites. Nature. https://doi.org/10.1038/381482a0 Meissner, M, Schlüter, D, and Soldati, D. (2002). Role of Toxoplasma gondii myosin a in powering parasite gliding and host cell invasion. Science. https://doi.org/10.1126/science.1074553 Mensah-Brown, HE, Amoako, N, Abugri, J, Stewart, LB, Agongo, G, Dickson, EK, Ofori, MF, Stoute, J a., Conway, DJ, and Awandare, G a. (2015). Analysis of erythrocyte invasion mechanisms of Plasmodium falciparum clinical isolates across three endemic areas within 70 University of Ghana http://ugspace.ug.edu.gh one country. Journal of Infectious Diseases. https://doi.org/10.1093/infdis/jiv207 Nikolaeva, D, Draper, SJ, and Biswas, S. (2015). Toward the development of effective transmission-blocking vaccines for malaria. Expert Review of Vaccines. https://doi.org/10.1586/14760584.2015.993383 Nussenzweig, RS, Vanderberg, J, Most, H, and Orton, C. (1967). Protective immunity produced by the injection of X-irradiated sporozoites of plasmodium berghei. Nature. https://doi.org/10.1038/216160a0 Odenwald, MA, and Turner, JR. (2017). The intestinal epithelial barrier: A therapeutic target? Nature Reviews Gastroenterology and Hepatology. https://doi.org/10.1038/nrgastro.2016.169 Olotu, A, Fegan, G, Wambua, J, Nyangweso, G, Leach, A, Lievens, M, Kaslow, DC, Njuguna, P, Marsh, K, and Bejon, P. (2016). Seven-Year Efficacy of RTS,S/AS01 Malaria Vaccine among Young African Children. New England Journal of Medicine, 374(26), 2519–2529. https://doi.org/10.1056/nejmoa1515257 Organization, WH. (2017). World Malaria Report. In World Health Organization (WHO). https://doi.org/10.1016/S0264-410X(07)01183-8 Otto, TD, Böhme, U, Jackson, AP, Hunt, M, Franke-Fayard, B, Hoeijmakers, WAM, Religa, AA, Robertson, L, Sanders, M, Ogun, SA, Cunningham, D, Erhart, A, Billker, O, Khan, SM, Stunnenberg, HG, Langhorne, J, Holder, AA, Waters, AP, Newbold, CI, Pain, A, Berriman, M, and Janse, CJ. (2014). A comprehensive evaluation of rodent malaria parasite genomes and gene expression. BMC Medicine. https://doi.org/10.1186/s12915-014-0086-0 71 University of Ghana http://ugspace.ug.edu.gh Partey, FD, Castberg, FC, Sarbah, EW, Silk, SE, Awandare, GA, Draper, SJ, Opoku, N, Kweku, M, Ofori, MF, Hviid, L, and Barfod, L. (2018). Kinetics of antibody responses to pfrh5- complex antigens in ghanaian children with plasmodium falciparum malaria. PLoS ONE. https://doi.org/10.1371/journal.pone.0198371 Payne, RO, Silk, SE, Elias, SC, Miura, K, Diouf, A, Galaway, F, de Graaf, H, Brendish, NJ, Poulton, ID, Griffiths, OJ, Edwards, NJ, Jin, J, Labbé, GM, Alanine, DGW, Siani, L, Di Marco, S, Roberts, R, Green, N, Berrie, E, Ishizuka, AS, Nielsen, CM, Bardelli, M, Partey, FD, Ofori, MF, Barfod, L, Wambua, J, Murungi, LM, Osier, FH, Biswas, S, McCarthy, JS, Minassian, AM, Ashfield, R, Viebig, NK, Nugent, FL, Douglas, AD, Vekemans, J, Wright, GJ, Faust, SN, Hill, AVS, Long, CA, Lawrie, AM, and Draper, SJ. (2017). Human vaccination against RH5 induces neutralizing antimalarial antibodies that inhibit RH5 invasion complex interactions. JCI Insight. https://doi.org/10.1172/jci.insight.96381 Preiser, P, Kaviratne, M, Khan, S, Bannister, L, and Jarra, W. (2000). The apical organelles of malaria merozoites: Host cell selection, invasion, host immunity and immune evasion. Microbes and Infection. https://doi.org/10.1016/S1286-4579(00)01301-0 Rayner, J. C., Galinski, MR, Ingravallo, P, and Barnwell, JW. (2000). Two Plasmodium falciparum genes express merozoite proteins that are related to Plasmodium vivax and Plasmodium yoelii adhesive proteins involved in host cell selection and invasion. Proceedings of the National Academy of Sciences. https://doi.org/10.1073/pnas.160469097 Rayner, Julian C., Vargas-Serrato, E, Huber, CS, Galinski, MR, and Barnwell, JW. (2002). A Plasmodium falciparum Homologue of Plasmodium vivax Reticulocyte Binding Protein (PvRBP1) Defines a Trypsin-resistant Erythrocyte Invasion Pathway . The Journal of 72 University of Ghana http://ugspace.ug.edu.gh Experimental Medicine. https://doi.org/10.1084/jem.194.11.1571 Reddy, KS, Amlabu, E, Pandey, AK, Mitra, P, Chauhan, VS, and Gaur, D. (2015). Multiprotein complex between the GPI-anchored CyRPA with PfRH5 and PfRipr is crucial for Plasmodium falciparum erythrocyte invasion. Proceedings of the National Academy of Sciences, 112(4), 1179–1184. https://doi.org/10.1073/pnas.1415466112 Remarque, EJ, Faber, BW, Kocken, CHM, and Thomas, AW. (2008). A diversity-covering approach to immunization with Plasmodium falciparum apical membrane antigen 1 induces broader allelic recognition and growth inhibition responses in rabbits. Infection and Immunity. https://doi.org/10.1128/IAI.00170-08 Richard, D, MacRaild, CA, Riglar, DT, Chan, JA, Foley, M, Baum, J, Ralph, SA, Norton, RS, and Cowman, AF. (2010a). Interaction between Plasmodium falciparum apical membrane antigen 1 and the rhoptry neck protein complex defines a key step in the erythrocyte invasion process of malaria parasites. Journal of Biological Chemistry. https://doi.org/10.1074/jbc.M109.080770 Richard, D, MacRaild, CA, Riglar, DT, Chan, JA, Foley, M, Baum, J, Ralph, SA, Norton, RS, and Cowman, AF. (2010b). Interaction between Plasmodium falciparum apical membrane antigen 1 and the rhoptry neck protein complex defines a key step in the erythrocyte invasion process of malaria parasites. Journal of Biological Chemistry, 285(19), 14815– 14822. https://doi.org/10.1074/jbc.M109.080770 Rieckmann, A, Villumsen, M, Sørup, S, Haugaard, LK, Ravn, H, Roth, A, Baker, JL, Benn, CS, and Aaby, P. (2017). Vaccinations against smallpox and tuberculosis are associated with better long-term survival: a Danish case-cohort study 1971-2010. International Journal of 73 University of Ghana http://ugspace.ug.edu.gh Epidemiology, 46(2), 695–705. https://doi.org/10.1093/ije/dyw120 Rieckmann, KH, Carson, PE, Beaudoin, RL, Cassells, JS, and Sell, KW. (1974). Sporozoite induced immunity in man against an ethiopian strain of plasmodium falciparum. Transactions of the Royal Society of Tropical Medicine and Hygiene. https://doi.org/10.1016/0035-9203(74)90129-1 Riglar, DT, Richard, D, Wilson, DW, Boyle, MJ, Dekiwadia, C, Turnbull, L, Angrisano, F, Marapana, DS, Rogers, KL, Whitchurch, CB, Beeson, JG, Cowman, AF, Ralph, SA, and Baum, J. (2011). Super-resolution dissection of coordinated events during malaria parasite invasion of the human erythrocyte. Cell Host and Microbe, 9(1), 9–20. https://doi.org/10.1016/j.chom.2010.12.003 Roos, DS, Crawford, MJ, Donald, RG, Kissinger, JC, Klimczak, LJ, and Striepen, B. (1999). Origin, targeting, and function of the apicomplexan plastid. Current Opinion in Microbiology. https://doi.org/10.1016/S1369-5274(99)80075-7 Roy, A, Kucukural, A, and Zhang, Y. (2010). I-TASSER: A unified platform for automated protein structure and function prediction. Nature Protocols. https://doi.org/10.1038/nprot.2010.5 Sabchareon, A, Burnouf, T, Ouattara, D, Attanath, P, Bouharoun-Tayoun, H, Chantavanich, P, Foucault, C, Chongsuphajaisiddhi, T, and Druilhe, P. (1991). Parasitologic and clinical human response to immunoglobulin administration in falciparum malaria. American Journal of Tropical Medicine and Hygiene. https://doi.org/10.4269/ajtmh.1991.45.297 Sidik, SM, Huet, D, Ganesan, SM, Huynh, M-H, Wang, T, Nasamu, AS, Thiru, P, Saeij, JPJ, 74 University of Ghana http://ugspace.ug.edu.gh Carruthers, VB, Niles, JC, and Lourido, S. (2016). A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell, 166(6), 1423-1435.e12. https://doi.org/10.1016/j.cell.2016.08.019 Sinden, RE. (1983a). Sexual Development of Malarial Parasites. Advances in Parasitology. https://doi.org/10.1016/S0065-308X(08)60462-5 Sinden, RE. (1983b). The Cell Biology of Sexual Development in Plasmodium. Parasitology. https://doi.org/10.1017/S0031182000050824 Singh, S, Miura, K, Zhou, H, Muratova, O, Keegan, B, Miles, A, Martin, LB, Saul, AJ, Miller, LH, and Long, CA. (2006). Immunity to recombinant Plasmodium falciparum merozoite surface protein 1 (MSP1): Protection in Aotus nancymai monkeys strongly correlates with anti-MSP1 antibody titer and in vitro parasite-inhibitory activity. Infection and Immunity, 74(8), 4573–4580. https://doi.org/10.1128/IAI.01679-05 Sony Reddy, K, Pandey, AK, Singh, H, Sahar, T, Emmanuel, A, Chitnis, CE, Chauhan, VS, and Gaur, D. (2014). Bacterially expressed full-length recombinant Plasmodium falciparum RH5 protein binds erythrocytes and elicits potent strain-transcending parasite-neutralizing antibodies. Infection and Immunity. https://doi.org/10.1128/IAI.00970-13 Stoute, J a, Slaoui, M, Heppner, DG, Momin, P, Kester, KE, Desmons, P, Wellde, BT, Garçon, N, Krzych, U, and Marchand, M. (1997). A preliminary evaluation of a recombinant circumsporozoite protein vaccine against Plasmodium falciparum malaria. RTS,S Malaria Vaccine Evaluation Group. The New England Journal of Medicine. https://doi.org/10.1056/NEJM199701093360202 75 University of Ghana http://ugspace.ug.edu.gh Stubbs, J, Simpson, KM, Triglia, T, Plouffe, D, Tonkin, CJ, Duraisingh, MT, Maier, AC, Winzeler, EA, and Cowman, AF. (2005). Microbiology: Molecular mechanism for switching of P. falciparum invasion pathways into human erythrocytes. Science. https://doi.org/10.1126/science.1115257 Tham, W-H, Wilson, DW, Lopaticki, S, Schmidt, CQ, Tetteh-Quarcoo, PB, Barlow, PN, Richard, D, Corbin, JE, Beeson, JG, and Cowman, AF. (2010). Complement receptor 1 is the host erythrocyte receptor for Plasmodium falciparum PfRh4 invasion ligand. Proceedings of the National Academy of Sciences, 107(40), 17327–17332. https://doi.org/10.1073/pnas.1008151107 The WHO. (2017). World Malaria Report 2017. In World Health Organization. https://doi.org/10.1071/EC12504 Theisen, M, Roeffen, W, Singh, SK, Andersen, G, Amoah, L, van de Vegte-Bolmer, M, Arens, T, Tiendrebeogo, RW, Jones, S, Bousema, T, Adu, B, Dziegiel, MH, Christiansen, M, and Sauerwein, R. (2014). A multi-stage malaria vaccine candidate targeting both transmission and asexual parasite life-cycle stages. Vaccine. https://doi.org/10.1016/j.vaccine.2014.03.020 Tonkin, ML, Roques, M, Lamarque, MH, Pugnière, M, Douguet, D, Crawford, J, Lebrun, M, and Boulanger, MJ. (2011). Host cell invasion by apicomplexan parasites: Insights from the co- structure of AMA1 with a RON2 peptide. Science. https://doi.org/10.1126/science.1204988 Treeck, M, Zacherl, S, Herrmann, S, Cabrera, A, Kono, M, Struck, NS, Engelberg, K, Haase, S, Frischknecht, F, Miura, K, Spielmann, T, and Gilberger, TW. (2009). Functional analysis of the leading malaria vaccine candidate AMA-1 reveals an essential role for the cytoplasmic 76 University of Ghana http://ugspace.ug.edu.gh domain in the invasion process. PLoS Pathogens. https://doi.org/10.1371/journal.ppat.1000322 Tsukita, S, Furuse, M, and Itoh, M. (2001). Multifunctional strands in tight junctions. Nature Reviews Molecular Cell Biology, Vol. 2, pp. 285–293. https://doi.org/10.1038/35067088 Vaughan, AM, Wang, R, and Kappe, SHI. (2010). Genetically engineered, attenuated whole-cell vaccine approaches for malaria. Human Vaccines. https://doi.org/10.4161/hv.6.1.9654 Vaughan, JA. (2007). Population dynamics of Plasmodium sporogony. Trends in Parasitology. https://doi.org/10.1016/j.pt.2006.12.009 Volz, JC, Yap, A, Sisquella, X, Thompson, JK, Lim, NTY, Whitehead, LW, Chen, L, Lampe, M, Tham, WH, Wilson, D, Nebl, T, Marapana, D, Triglia, T, Wong, W, Rogers, KL, and Cowman, AF. (2016). Essential Role of the PfRh5/PfRipr/CyRPA Complex during Plasmodium falciparum Invasion of Erythrocytes. Cell Host and Microbe, 20(1), 60–71. https://doi.org/10.1016/j.chom.2016.06.004 Weiss, GE, Gilson, PR, Taechalertpaisarn, T, Tham, WH, de Jong, NWM, Harvey, KL, Fowkes, FJI, Barlow, PN, Rayner, JC, Wright, GJ, Cowman, AF, and Crabb, BS. (2015a). Revealing the Sequence and Resulting Cellular Morphology of Receptor-Ligand Interactions during Plasmodium falciparum Invasion of Erythrocytes. PLoS Pathogens. https://doi.org/10.1371/journal.ppat.1004670 Weiss, GE, Gilson, PR, Taechalertpaisarn, T, Tham, WH, de Jong, NWM, Harvey, KL, Fowkes, FJI, Barlow, PN, Rayner, JC, Wright, GJ, Cowman, AF, and Crabb, BS. (2015b). Revealing the Sequence and Resulting Cellular Morphology of Receptor-Ligand Interactions during 77 University of Ghana http://ugspace.ug.edu.gh Plasmodium falciparum Invasion of Erythrocytes. PLoS Pathogens. https://doi.org/10.1371/journal.ppat.1004670 White, J, and Rathod, PK. (2018). Indispensable malaria genes. Science. https://doi.org/10.1126/science.aat5092 WHO. (2016). World Malaria Report 2016. In World Health Organization. https://doi.org/10.1071/EC12504 Woo, YH, Ansari, H, Otto, TD, Linger, CMK, Olisko, MK, Michálek, J, Saxena, A, Shanmugam, D, Tayyrov, A, Veluchamy, A, Ali, S, Bernal, A, Del Campo, J, Cihlář, J, Flegontov, P, Gornik, SG, Hajdušková, E, Horák, A, Janouškovec, J, Katris, NJ, Mast, FD, Miranda-Saavedra, D, Mourier, T, Naeem, R, Nair, M, Panigrahi, AK, Rawlings, ND, Padron-Regalado, E, Ramaprasad, A, Samad, N, Tomčala, A, Wilkes, J, Neafsey, DE, Doerig, C, Bowler, C, Keeling, PJ, Roos, DS, Dacks, JB, Templeton, TJ, Waller, RF, Lukeš, J, Oborník, M, and Pain, A. (2015). Chromerid genomes reveal the evolutionary path from photosynthetic algae to obligate intracellular parasites. ELife. https://doi.org/10.7554/eLife.06974 World Health Organization. (2018). World malaria Report 2018. Wright, GJ, and Rayner, JC. (2014). Plasmodium falciparum Erythrocyte Invasion: Combining Function with Immune Evasion. PLoS Pathogens. https://doi.org/10.1371/journal.ppat.1003943 Wurtz, N, Fall, B, Bui, K, Pascual, A, Fall, M, Camara, C, Diatta, B, Fall, KB, Mbaye, PS, Diémé, Y, Bercion, R, Wade, B, Briolant, S, and Pradines, B. (2013). Pfhrp2 and pfhrp3 78 University of Ghana http://ugspace.ug.edu.gh polymorphisms in Plasmodium falciparum isolates from Dakar, Senegal: Impact on rapid malaria diagnostic tests. Malaria Journal, 12(1). https://doi.org/10.1186/1475-2875-12-34 Yang, J, Yan, R, Roy, A, Xu, D, Poisson, J, and Zhang, Y. (2014). The I-TASSER suite: Protein structure and function prediction. Nature Methods. https://doi.org/10.1038/nmeth.3213 Yang, J, and Zhang, Y. (2015). I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Research. https://doi.org/10.1093/nar/gkv342 Yap, A, Azevedo, MF, Gilson, PR, Weiss, GE, O’Neill, MT, Wilson, DW, Crabb, BS, and Cowman, AF. (2014). Conditional expression of apical membrane antigen 1 in Plasmodium falciparum shows it is required for erythrocyte invasion by merozoites. Cellular Microbiology. https://doi.org/10.1111/cmi.12287 Zaim, M, Aitio, A, and Nakashima, N. (2000). Safety of pyrethroid-treated mosquito nets. Medical and Veterinary Entomology, Vol. 14, pp. 1–5. https://doi.org/10.1046/j.1365- 2915.2000.00211.x Zhang, M, Wang, C, Otto, TD, Oberstaller, J, Liao, X, Adapa, SR, Udenze, K, Bronner, IF, Casandra, D, Mayho, M, Brown, J, Li, S, Swanson, J, Rayner, JC, Jiang, RHY, and Adams, JH. (2018). Uncovering the essential genes of the human malaria parasite Plasmodium falciparum by saturation mutagenesis. Science. https://doi.org/10.1126/science.aap7847 Zuccala, ES, Gout, AM, Dekiwadia, C, Marapana, DS, Angrisano, F, Turnbull, L, Riglar, DT, Rogers, KL, Whitchurch, CB, Ralph, SA, Speed, TP, and Baum, J. (2012). Subcompartmentalisation of Proteins in the Rhoptries Correlates with Ordered Events of Erythrocyte Invasion by the Blood Stage Malaria Parasite. PLoS ONE. 79 University of Ghana http://ugspace.ug.edu.gh https://doi.org/10.1371/journal.pone.0046160 80 University of Ghana http://ugspace.ug.edu.gh APPENDIX Table 1: Primers for Copy number variation studies by qPCR and gene expression analysis by RT-qPCR Target Forward Primer (5’ – 3’) Reverse Primer (5’ – 3’) PfCLAMP CATGTAGAGACTTGGACACA CTCTACAACCTTCAGGACAT StRNA AAGTAGCAGGTCATCGTGGTT TTCGGCACATTCTTCCAT AA L18 ATTCTGAAATGGCTGGTAGG TGGTAAATGCAATGCTGGA EBA 175 TTCGTGATGAGTGGTGGAAA GGCAATAATCATCACCCCATT AMA1 CAATCAACGAACATAGGGAAC TGGTCTATTGGATATGCGTG Table 2: RT-qPCR reaction set up Component Volume for 10 µl reaction Final concentration Luna Universal One-Step 5 1x reaction mix Luna WarmStart® RT Enzyme 0.5 1x Mix (20x) Forward Primer 0.4 0.4µM Reverse Primer 0.4 0.4µM Template RNA 2.5 5µg Nuclease-free water 1.2 Table 3: RT-qPCR reaction conditions Cycle step Temperature Time Cycles Reverse Transcription 55oC 10 minutes 1 Initial denaturation 95oC 1 minute 1 Denaturation 95oC 10 seconds 45 Extension 60oC 30 seconds Melt curve 60 – 95oC various 1 81 University of Ghana http://ugspace.ug.edu.gh Table 4: qPCR reaction set up Cycle step Temperature Time Cycles Initial Denaturation 95oC 10 minutes 1 Denaturation 95oC 15 seconds 45 Extension 60oC 30 seconds Melt curve 60 – 95oC various 1 Table 5: qPCR reaction set up Component Volume for 10 µl reaction Final concentration Luna Universal qPCR mix 5 1x Forward Primer 0.5 0.25µM Reverse Primer 0.5 0.25µM Template DNA 2 Nuclease-free water 2 82 University of Ghana http://ugspace.ug.edu.gh Table 6: Primers for genotyping PfCLAMP mutants Target Forward Primer (5’ – 3’) Reverse Primer (5’ – 3’) Wild type AAAGCCATGCCCGTAATGTC TTGGGAATCCTTGTTGTTGT PfCLAMP GGC 5’ Integration AAAGCCATGCCCGTAATGTC ACCTTCACCCTCTCCACTGA junction C * 3’ Integration GGAATTGTGAGCGGATAACAATTTCA TTGGGAATCCTTGTTGTTGT junction CACAGG * GGC Excised CTD AAAGCCATGCCCGTAATGTC GCCAGCCACGATAGC locus *Primer sequences were adopted from Birnbaum et al. (2017) 83