University of Ghana http://ugspace.ug.edu.gh
GENETIC DIVERSITY AND POPULATION STRUCTURE OF COWPEA 
(VIGNA UNGUICULATA (L.) WALP) ACCESSIONS. 
 
 
 
 
                                 PEARL DZORGBENYUIE AKU ZORYEKU 
10432865 
 
A THESIS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN 
PARTIAL FULFILMENT OF THE REQUIREMENT FOR THE AWARD 
OF MPHIL BOTANY DEGREE. 
 
JULY, 2019 
 
University of Ghana http://ugspace.ug.edu.gh
DECLARATION 
 
I certify that, this work was carried out under the supervision of Professor I. K. Asante and 
Professor (Mrs.) E. T. Blay, and that this thesis does not contain any material previously 
published or written by another person except where due reference is made in the text, and to the 
best of my knowledge this work does not contain any material previously submitted for a degree 
or diploma in any university. 
 
…………………….                                                                                   …………………….. 
    Pearl D.A Zoryeku                                                                                                        Date 
            
         (Student) 
 
 
 
 
…………………….                                                                                   …………………….. 
    Prof. Isaac K. Asante                                                                                            Date 
            
        (Supervisor) 
 
 
 
 
…………………….                                                                                   …………………….. 
    Prof. E.T Blay                                                                                                                   Date 
            
    (Supervisor) 
 
 
 
 
 
 
i 
 
University of Ghana http://ugspace.ug.edu.gh
DEDICATION 
 
 
This work is dedicated to my Supervisor, Professor Isaac K. Asante. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
ii 
 
University of Ghana http://ugspace.ug.edu.gh
 
ACKNOWLEDGEMENTS 
 
I express my gratitude to God Almighty for His immeasurable grace and mercies which sustained 
me throughout the programme. 
I am deeply indebted to Professor Isaac K. Asante and Professor E. T. Blay for their supervision, 
guidance, insight and support. 
My appreciation to the Head of Department and the entire staff of the Department of Plant and 
Environmental Biology who in diverse ways contributed to the success of this work. 
I am thankful to Mrs. Felicia Oppong, Mr. Prince Owusu and Mr. James Ghansah for their 
technical support and assistance. 
I am grateful to the staff of the Ecological laboratory, University of Ghana; the Biotechnology 
Laboratory, University of Ghana and the Ghana Standards Authority. To my mates, Ekow 
Ghunney, John Kupagme and Delight Klutsey who made this journey eventful, I am really grateful. 
My final but not the least thanks go to my parents, Mr. Philemon Zoryeku and Madam Janet 
Wormenor and my siblings, Makafui Adzo Zoryeku and Deborah Yenam Zoryeku for their 
financial and moral support. 
 
 
 
 
 
 
iii 
 
University of Ghana http://ugspace.ug.edu.gh
ABSTRACT 
 
The research was carried out to study diversity (phenotypic and genetic) and population structure 
of cowpea germplasm assembled from the DPEB and SARI. A total of 78 cowpea accessions from 
these two sources were used for the study. Data was collected on twelve vegetative and 
reproductive traits, four polyphenols, crude protein, seven mineral elements, nineteen amino acids 
and three SSR markers. Methanolic extracts of pulverized cowpea seeds were used to determine 
concentrations of polyphenols, crude protein, mineral elements and amino acids. Cowpea 
Descriptor of the IBPGR (1983) was used for data collection on morphological traits. Data analysis 
involved descriptive statistics, Fisher’s test of association, Pearson’s pairwise correlation, 
phenotypic and genetic diversity, Nei’s diversity of subdivided population, principal component 
analysis and cluster analysis. Mean percent crude protein was 13.52+0.245%. Mean sodium 
concentration was (35.66+0.58) x 10-3 ppm. Mean potassium concentration was 10.41+0.259 ppm. 
Mean concentration for magnesium was (0.288+7.69) x 10-3 ppm. Mean concentration for iron 
was 0.048+0.0041 ppm. Mean nickel concentration was 0.033+0.0021 ppm. Mean concentration 
for lead was 0.038+0.006 ppm. Mean concentration for cadmium was (7.0+2.0) x 10-4 ppm. 
Concentration mean for manganese was (0.0187+9.0) x 10-4 ppm. Mean concentration for zinc 
was (0.00402+8.34) x 10-4 ppm. Mean concentration for gallic acid was 6.97+22.94 mg/l. Mean 
concentration for syringic acid was 104.25+12.04 mg/l. Mean concentration for quercetin was 
69.58+2.34 mg/l. Mean concentration for vanillic acid was 52.79+13.75 mg/l. Mean concentration 
for L-Histidine was (365.0+42.9) x 10-8 ppm. Mean glycine concentration was (260.0+50.7) x 10-
8 ppm. Mean concentration for L-Asparagine was (2400.0+360) x 10-8 ppm. Mean DL-Alpha-
Alanine concentration was (2490.0+296.0) x 10-8 ppm. Mean concentration for L-Aspartic acid 
was 791.0 x 10-8 ppm. L-Valine mean concentration was (831.0+85.7) x 10-8 ppm. Mean 
iv 
 
University of Ghana http://ugspace.ug.edu.gh
concentration for L-Proline was 957.0+131.0) x 10-8 ppm. L-Methionine mean concentration was 
(293.0+16.9) x 10-8 ppm. Isoleucine mean concentration was (841.0+15.1) x 10-8 ppm. Mean 
concentration of Trans-4-Hydroxy-L-Proline was (856.0+13.9) x 10-8 ppm. Mean concentration 
for L-Tyrosine was (6350.0+933.0) x 10-8 ppm. DL-Beta-Phenyl-Alanine mean concentration was 
(29840.0 +10040) x 10-8 ppm. L-Tryptophan mean concentration was (646400.0+8700) x 10-8 
ppm. Six morphological traits associated significantly with source of cowpea genotype collection: 
Twenty-two test of associations among the twelve morphological traits were observed. A total of 
sixty-three significant pairwise correlations were observed among all quantitative traits. Mean total 
phenotypic diversity (Ht) for percent crude protein and each of the mineral elements was 
0.162+0.314. Mean intra-population diversity (Hs) was 0.132+0.021. Mean phenotypic diversity 
among populations (Gst) was 0.187. Gene flow (Nm) among population’s estimates had a mean 
of 2.181. Nei’s analysis of phenotypic diversity in subdivided population for polyphenols indicated 
that mean total phenotypic diversity for each trait (Ht) was 0.121. Mean intra-population diversity 
(Hs) was 0.105. Mean phenotypic diversity among populations (Gst) was 0.434. Gene flow (Nm) 
estimate among population for each of the traits ranged from 1.316 to 118.498. The eight SSRs 
loci had frequencies that ranged from 0.067 to 0.803 and mean Nei’s genetic diversity for the SSR 
markers was 0.542. Population structure analysis grouped the cowpea genotypes into 4 clusters.  
Average distance between individual cowpea genotypes in the same cluster ranged from 0.084 to 
0.26. Mean genetic differentiation among the four clusters ranged from 0.374 to 0.687. Mean gene 
flow ranged from 0.228 to 0.837. Eighteen cowpea genotypes were identified to be of economic 
importance based on concentrations of their phytochemical compounds. 
 
v 
 
University of Ghana http://ugspace.ug.edu.gh
TABLE OF CONTENTS 
 
 
DECLARATION.......................................................................................................................................... i 
DEDICATION............................................................................................................................................. ii 
ACKNOWLEDGEMENTS ...................................................................................................................... iii 
ABSTRACT ................................................................................................................................................ iv 
TABLE OF CONTENTS .......................................................................................................................... vi 
LIST OF TABLES ..................................................................................................................................... ix 
LIST OF FIGURES ................................................................................................................................... xi 
CHAPTER ONE ......................................................................................................................................... 1 
1.0 INTRODUCTION ........................................................................................................................... 1 
1.1 Main objective ..........................................................................................................................3 
1.2 Specific objectives ....................................................................................................................3 
CHAPTER TWO ........................................................................................................................................ 4 
2.0 LITERATURE REVIEW............................................................................................................... 4 
2.1 Taxonomy and origin ................................................................................................................4 
2.2 Cowpea cultivation in Ghana .....................................................................................................5 
2.3 Cowpea genebanks in Ghana ....................................................................................................6 
2.4 Cowpea germplasm characterization .........................................................................................7 
2.4.1 Morphological characterization ................................................................................................ 7 
2.4.2 DNA based characterization ..................................................................................................... 8 
2.4.3 Phytochemical characterization of cowpea seeds .................................................................... 9 
2.5 Population structure ............................................................................................................... 11 
2.6 Diversity ................................................................................................................................. 12 
CHAPTER THREE .................................................................................................................................. 13 
3.0 MATERIALS AND METHODS ................................................................................................. 13 
3.1 Sources of Cowpea Accessions ................................................................................................ 13 
3.2 Site and Experimental Design .................................................................................................. 13 
3.3 Phenotyping ........................................................................................................................... 13 
3.3.1 Qualitative traits characterization.......................................................................................... 13 
3.3.2 Phytochemical Characterization............................................................................................. 14 
vi 
 
University of Ghana http://ugspace.ug.edu.gh
3.3.2 Phytochemical Characterization............................................................................................. 16 
3.4 Genotyping ............................................................................................................................. 21 
3.5.1 Morphological characterization .............................................................................................. 23 
3.5.2 Phenotypic Diversity ................................................................................................................ 23 
3.5.3 Population Genetic Structure of Collection ........................................................................... 23 
4.0 RESULTS ............................................................................................................................................ 24 
4.1 Frequency Distribution of Morphological Traits ....................................................................... 24 
4.2 Phytochemical Traits ............................................................................................................... 29 
4.2.1 Crude Protein ........................................................................................................................... 29 
4.2.2 Mineral elements ...................................................................................................................... 30 
4.2.3 Concentration Frequency distribution of Polyphenolic compounds ................................... 35 
4.2.4 Concentration frequency distribution of amino acids .......................................................... 36 
4.3 Distribution of mean concentrations of phytochemicals across morphological traits................. 43 
4.3.1 Phenolic compounds ................................................................................................................ 43 
4.3.2 Crude protein and mineral elements ...................................................................................... 53 
4.3.3 Amino acids .............................................................................................................................. 75 
4.4 Fisher’s Exact test of Association ............................................................................................. 87 
4.4.1 Association between Source of collection and 12 morphological traits ............................... 87 
4.4.2 Association among Morphological traits ............................................................................... 87 
  4.5 Pearson’s Correlation Among 12 Traits in Cowpea Collections. ................................................. 91 
4.5.1 Correlation Among Traits in cowpea accessions from DPEB .............................................. 91 
4.5.2 Correlation among traits in cowpea accessions from SARI ................................................. 91 
4.5.3 Correlation among traits in the total collection .................................................................... 92 
4.6 Phenotypic diversity of cowpea population ............................................................................. 99 
4.6.1 Nei’s diversity index ................................................................................................................. 99 
4.6.2 Nei’s analysis of phenotypic diversity in subdivided population ....................................... 106 
4.7 Principal Component Analysis ............................................................................................... 109 
4.7.1 Polyphenols ....................................................................................................................... 109 
4.7.2 Crude protein and Mineral elements ................................................................................... 112 
4.7.3 Amino acids ............................................................................................................................ 115 
4.7.3 Combined traits ...................................................................................................................... 118 
4.8 Cluster Analysis .................................................................................................................... 122 
vii 
 
University of Ghana http://ugspace.ug.edu.gh
4.9 Genetic diversity and population structure ............................................................................ 127 
4.9.1 Genetic diversity ..................................................................................................................... 127 
4.9.2 Population structure .............................................................................................................. 127 
4.10 Principal Component Analysis ............................................................................................. 135 
4.11 Cluster analysis ................................................................................................................... 135 
CHAPTER FIVE .................................................................................................................................... 140 
DISCUSSION .......................................................................................................................................... 140 
5.1 Morphological Characterization ............................................................................................ 140 
5.2 Variability of crude protein and mineral elements ................................................................. 142 
5.3 Variability of polyphenols ..................................................................................................... 143 
5.4 Variability of amino acids ...................................................................................................... 143 
5.5 Test of association and pairwise correlation. ......................................................................... 144 
5.6 Distribution of mean concentrations of phytochemicals across morphological traits............... 145 
5.7 Variability of traits in relation to source of cowpea accessions ............................................... 147 
5.8 Phenotypic diversity within subdivided population ................................................................ 148 
5.9 Classification of the Total Cowpea Population. ...................................................................... 148 
5.10 Genetic diversity ................................................................................................................. 149 
CHAPTER SIX ....................................................................................................................................... 151 
CONCLUSIONS AND RECOMMENDATIONS ................................................................................ 151 
6.1 Conclusions .......................................................................................................................... 151 
6.2 Recommendations ................................................................................................................ 152 
REFERENCES ........................................................................................................................................ 153 
APPENDICES ......................................................................................................................................... 160 
Appendix 1.   Standard equations of Phenols and Flavonoids ....................................................... 160 
Appendix 2. Morphological traits and sources of cowpea accessions ........................................... 161 
Appendix 3.  Sources, percent crude protein and mineral elements content (ppm) of cowpea 
accessions. ................................................................................................................................. 169 
Appendix 4. Sources and polyphenol concentration (mg/l) of cowpea accessions ........................ 172 
Appendix 5.  Sources and amino acids concentration (ppm) of cowpea accessions ....................... 178 
Appendix 6. Highest mean amino acids concentrations in some cowpea accessions. .................... 190 
 
viii 
 
University of Ghana http://ugspace.ug.edu.gh
LIST OF TABLES 
 
 
Table 1: List of Cowpea accessions used for the research 
 
Table 2: List of three cowpea SSR markers. 
 
Table 3:  Frequency distribution of cowpea morphological traits. 
 
Table 4a: Population means and their standard errors of polyphenols,  
                mineral elements and percent crude protein of cowpea genotypes Table 4b: Means and  
 
Table 5a: Population means and their standard errors of amino acids of cowpea genotypes. 
 
Table 5b: Means and their standard errors of amino acids of cowpea genotypes                
               across source of collection. 
 
Table 6:  Means and their standard errors of polyphenols of cowpea genotypes across    
               morphological traits. 
 
Table 7: Means and their standard errors of mineral elements of cowpea genotypes across   
              morphological traits 
 
Table 8: Means and their standard errors of amino acids of cowpea genotypes according to  
              morphological traits 
 
Table 9: Fisher’s exact test of association between cowpea morphological  
            traits and source of collection. 
 
Table 10: Fisher’s test of association among morphological traits of cowpea 
 
Table 11: Pearson’s correlation coefficients DPEB 
 
Table 12: Pearson’s correlation coefficients SARI 
 
Table 13: Pearson’s correlation coefficients COMBINED 
 
Table 14: Nei’s diversity indices for cowpea qualitative traits for sources of collection 
 
Table 15: Nei’s diversity indices for cowpea crude protein and mineral elements 
 
Table 16: Nei’s diversity indices for cowpea polyphenols. 
 
Table 17: Nei’s diversity indices for cowpea amino acids traits 
 
ix 
 
University of Ghana http://ugspace.ug.edu.gh
Table 18: Total phenotypic diversity (Ht), mean intra-population diversity (Hs) and among 
                population diversity (Gst) and geneflow values in cowpea accessions for crude protein 
                and mineral element traits. 
 
Table 19: Total phenotypic diversity (Ht), mean intra-population diversity (Hs) and among 
                 population diversity (Gst) and geneflow values in cowpea accessions for polyphenols. 
 
Table 20: Principal Component Analysis among Cowpea genotypes showing the relative     
                 importance of polyphenol traits. 
 
Table 21: Principal Component Analysis among Cowpea genotypes showing the relative  
                 importance of crude protein and mineral elements traits. 
 
Table 22: Principal Component Analysis among Cowpea genotypes showing relative importance   
                of amino acid traits. 
 
Table 23: Principal Component Analysis among Cowpea genotypes showing relative importance 
of the combined traits of polyphenols, amino acids, crude protein and mineral elements. 
 
Table 24: Genetic variation statistics for three cowpea SSR loci 
 
Table 25: Overall proportion of membership of the sample in each of the 4 clusters 
 
Table 26: Membership probabilities of Inferred ancestry of individual cowpea genotypes  
 
Table 27: Estimated Allele Frequencies in each cluster  
 
Table 28 Allele-frequency divergence among pops (Net nucleotide distance), computed using 
                point estimates of P. 
 
Table 29: Average distances (expected heterozygosity) between individual cowpea genotypes in 
                the same cluster: 
 
Table 30: Estimated mean genetic differentiation (Fst) and gene flow among the four clusters. 
 
Table 31: Principal Component Analysis among Cowpea genotypes based on polyphenol traits. 
 
 
 
 
 
 
 
x 
 
University of Ghana http://ugspace.ug.edu.gh
LIST OF FIGURES 
 
  
Fig. 1: Scree plot of eigenvalues for cowpea polyphenols 
 
Fig.2: Scatter plot of PC1 and PC2 of cowpea for poltphenols 
 
Fig.3: Scree plot of eigenvalues of cowpea for mineral elements and crude protein. 
 
Fig. 4: Scatter plot of PC1 and PC2 of cowpea genotypes for mineral elements and crude protein 
 
Fig. 5: Scree plot of eigenvalues of cowpea genotypes for amino acids 
 
Fig. 6: Scatter plot of PC1 and PC2 of cowpea genotypes for amino acids 
 
Fig. 7: Scree plot of eigenvalues of cowpea genotypes for combined data 
 
Fig. 6: Scatter plots of PC1, P C2, PC3 and PC4 of cowpea genotypes for combined data 
 
Fig. 9: Dendrogram of cowpea genotypes for polyphenols 
 
Fig. 10: Dendrogram of cowpea genotypes for mineral elements and crude protein 
 
Fig. 11: Dendrogram of cowpea genotypes for amino acids 
 
Fig. 12: Dendrogram of cowpea genotypes for combined data 
 
Fig. 13: Population structure of cowpea genotypes in K=4 clusters. Red = cluster 1; Green = 
             cluster 2; Yellow = cluster 3; Blue = cluster 4. 
 
Fig. 14: Scree plot of eigenvalues of cowpea genotypes for SSR markers. 
 
Fig. 15: Scatter plolts of PC1, PC2, PC3 and PC4 of cowpea gentyopes 
 
Fig. 16: Dendrogram of cowpea genotypes for SSR markers. 
xi 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER ONE 
1.0 INTRODUCTION 
 
Cowpea is a fabaceous plant that supports the lives of several people in less developed countries 
in the tropics. Its protein content ranges between 18 and 29 percent. Cowpea is also rich in vitamins 
and minerals. It is particularly rich in folic acid, an important vitamin B that helps prevent birth 
defects such as neural defects in unborn babies (Hall et al., 2003). Cowpea is high in fibre and low 
in fat with additional health benefits. It has been reported that cowpea grain protein, like other 
grain legumes reduces low-density lipoproteins which are associated with heart disease, like other 
grain legumes (Phillips et al., 2003). Cowpea grain protein isolates have been found to have good 
functional properties including solubility, emulsifying and foaming activities (Rangel et al., 2004). 
Cowpea protein isolates can therefore serve as an alternate for soy protein isolates for people with 
soy protein allergies (especially infants). Cowpea grain starch is digested more slowly compared 
to starch from tubers and cereals, and therefore its consumption produces fewer changes in blood 
glucose levels (Phillips et al., 2003). 
Cowpea does not only serve as food for humans but it also provides hay, forage, feed and silage 
for livestock. Cowpea has the potential of restoring soil fertility when cultivated in rotation with 
cereal crops (Carsky et al., 2002; Tarawali et al., 2002; Sanginga et al., 2003). It is therefore a 
remarkable element of farming systems in many cowpea growing communities. It also serves as a 
cover crop and manure for maintaining soil productivity (Onwueme and Sinha, 1991). 
Worldwide production of cowpea is estimated at 4.5 million (mt) on 12 to 14 million hectares. The 
drier Savanna and Sahelian zones of West Africa and Central Africa contribute almost 70% of this 
production. In these zones the crop is intercropped with any of the following crops: pearl millet, 
1 
 
University of Ghana http://ugspace.ug.edu.gh
sorghum, maize, cassava and cotton and sometimes cultivated as a sole crop (Langyintuo et al., 
2003).  The lower elevation areas of Eastern and Southern Africa and South America, parts of 
India and the Southeastern regions of North America also serve as important areas of cowpea 
production. The world’s largest producer and consumer of cowpea is Nigeria where annual 
production is over 2 million metric tonnes on 5 million hectares. Nigeria is followed by Niger 
(650,000 mt) and Brazil (490,000 mt) (Singh et al., 2002).  
Genetic diversity plays a critical role in food security and rural development. Plant breeders depend 
on genetic diversity to select crops or plants with desirable traits to develop new varieties. 
Genetic diversity research is of paramount importance for breeding as it allows researchers to 
know the level of diversity within germplasm. The knowledge of genetic diversity enhances the 
efficiency and effectiveness of cowpea improvement programs within local, regional and national 
germplasm collection.  Genetic diversity research gives clues to genetic variation and genetic 
relationships among genotypes. Genetic diversity is essential to decrease crop vulnerability 
ensuring long-term selection gain in genetic improvement, and promotes rational use of genetic 
resources (Barrett and Kidwell, 1998).  Such clues are important for the utilization and 
preservation of germplasm resources and improvement.    
There is the need to carry out genetic diversity research into cowpea. This is to address changing 
conditions, including environmental conditions, agronomic practices, climatic changes, new pest 
and disease threats, new knowledge of human nutritional requirements, and changing market 
conditions (Tan et al., 2012).  
  
2 
 
University of Ghana http://ugspace.ug.edu.gh
1.1 Main objective 
The main objective of this study was to research into the genetic diversity and population structure 
of cowpea accessions held at the Department of Plant and Environmental Biology (DPEB) and 
Savanna Agricultural Research Institute (CSIR-SARI). 
 
1.2 Specific objectives 
The specific objectives of the study were to: 
 
1. Characterize cowpea accessions by using agro-morphological and molecular markers; 
2. Evaluate seed phytochemical variation among cowpea accessions; 
3. Determine population structure of the cowpea accessions assembled; 
4. Assess genetic diversity of the cowpea accessions assembled. 
 
 
 
 
                                                                    
                                                            
 
 
3 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER TWO 
2.0 LITERATURE REVIEW 
 
2.1 Taxonomy and origin 
Cowpea belongs to the class Dicotyledonea, order Fabales, family Fabaceae, subfamily 
Faboideae, tribe Phaseoleae, subtribe Phaseoline, and genus Vigna (Padulosi and Ng, 1997). It is 
further subdivided into four cultivar groups: unguiculata, the common form, biflora or catjang, 
which is characterized by small erect pods, sesquipedalis, the yard-long bean characterized by its 
very long pods and consumed as a green bean; and textilis, which was used for fibers acquired 
from its long peduncles (Padulosi and Ng, 1997).  
 The sub-species unguiculata is the most diverse of the four cultivar groups and is widely grown 
in Asia, Africa and Latin America (Ehlers et al., 2002).  Subspecies unguiculata is the only 
cultivated cowpea, while the other three are wild relatives. Cowpea used to be a source of hay for 
cattle in the south-eastern United States and also in other parts of the world, which probably lead 
to its name “cowpea” (Timko et al., 2007).  
There have been speculations on the origin and domestication of cowpea (Vigna unguiculata [L] 
Walp) based on cytological and botanical evidence, information on geographical distribution as 
well as cultural practices and historical records (Ng and Maréchal, 1985). Several studies have 
shown that cowpea was probably domesticated by African farmers and is assumed to have 
originated in Africa, because wild cowpeas only exist in Africa and Madagascar (Steele, 1976). 
Although south-eastern Africa is known to be the center of diversity of wild Vigna sp, the major 
center of diversity of cultivated cowpea is found in West Africa (Padulosi and Ng, 1997).  
4 
 
University of Ghana http://ugspace.ug.edu.gh
However, Huynh et al. (2013) reported that cowpea first moved from Western Africa to the New 
World with the African slaves, during the era of slave-trading, although there is little or no 
documentation to support the extent of the movement. Hitherto, many studies have indicated that 
the highest genetic diversity of primitive wild cowpea can be located within the African continent 
(Timko and Singh, 2008). Other researchers also believe that cowpea originated from West Africa, 
even though the precise location of the centre of origin of the species is rather difficult to 
determine. Several studies have provided further evidence that West Africa was the primary centre 
of domestication of cowpea. The centre of maximum diversity of cultivated cowpea is found in 
the following areas of West Africa: the Savana regions of Nigeria, Togo, Southern Benin, and 
North-West part of Cameroon (Ng and Maréchal, 1985).   
 
2.2 Cowpea cultivation in Ghana 
Cowpea is cultivated in all the six agro-ecological zones of Ghana. Areas of greatest production 
are the Savanna zones and the margins of the semi-deciduous forest zone (Bennet-Lartey, 1991). 
Cultivation is mostly done by rural smallholder farmers though commercial farming of the crop is 
on the ascendency (Bennet-Lartey, 1991). Cowpea is considered drought and heat tolerant and 
usually intercropped with cassava, sorghum, millet and yams. Cowpea farming plays an important 
role in sustainable cropping systems in Ghana due to its ability to fix nitrogen in the soil and its 
socio-cultural values (Quaye et al., 2011). It fixes up to 240 kg/ha and leaves about 60–70 kg 
nitrogen for succeeding crops (FCDP, 2005). 
Landraces form the greatest proportion of cowpea varieties planted by farmers. Cowpea farmers 
are faced with the following five major problems associated with constraints on cropping, storage 
5 
 
University of Ghana http://ugspace.ug.edu.gh
and  consumption of cowpea: (1) Abiotic constraints: high soil temperatures, low soil fertility, 
erratic rainfall and degraded fragile soils; (2) Biotic constraints: parasitic weed, insect pests, 
diseases caused by viruses, fungi and nematodes; (3) Related Socio-economic and political 
challenges: capacity of farmer to acquire inputs is limited and poor input delivery systems (Bell 
and Muck, 2000). 
 
2.3 Cowpea genebanks in Ghana 
Plant genebanks are very important resource centres where collections of plant materials are 
maintained. Plants maintained in genebanks generally include economically important food crops 
(Painting et al., 1995). Other types of plants maintained in genebanks include horticultural plants, 
forages, medicinal plants and trees. The main objectives of a national genebank include the 
following: 
(1) Long-term conservation of national plant genetic resources 
(2) Germplasm regeneration 
(3) Characterisation and evaluation work on specific germplasm and  
(4) Organisation of germplasm exploration and collection at a national level (Painting et al., 
1995). 
In Ghana, the Plant Genetic Resources Research Institute (PGRRI) at Bunso is the main plant 
genebank with the mission to collect and conserve plant genetic resources of Ghana and those from 
abroad to ensure that such plants do not get extinct. PGGRI has a large collection of cowpea which 
is mostly landraces.  However, institutes such as the Savanna Research Institute (SARI) and the 
relevant public universities have small cowpea gene banks. These cowpea genebank collections 
serves as source for selection and improvement of cowpea in Ghana.  
6 
 
University of Ghana http://ugspace.ug.edu.gh
2.4 Cowpea germplasm characterization 
Germplasm characterization is the documentation of traits that are distinctly identifiable and highly 
heritable. Such traits and their attributes are referred to as descriptors (Painting et al., 1995). A 
descriptor can be either qualitative or quantitative. Qualitative descriptors involve physiological, 
morphological and molecular (biochemical and DNA) traits. Quantitative descriptors including 
stress, yield and yield components, are usually influenced by environmental factors. 
Germplasm characterization is carried out mainly to: 
(i) describe accessions and establish their characteristics. 
(ii)  classify accessions into their natural groups. 
(iii) assess interrelationships among accessions or among traits and among geographic 
groups of accessions. 
(iv) estimate the extent of variation in the genebank collection. 
(v) identify duplicates in a collection. 
(vi) Monitor possible genetic changes in germplasm collection (Painting et al., 1995). 
 
2.4.1 Morphological characterization 
 
Cowpea descriptors compiled by IBPGR serves as a guide in cowpea germplasm characterization. 
They are primarily used by researchers for cowpea varietal characterization, estimation of genetic 
variability and divergence and character association in cowpea. 
One hundred cowpea genotypes were evaluated by Girish et al. (2001) using eleven morphological 
characters to quantify the genetic diversity. The hundred genotypes grouped into 11 clusters. 
Pandey (2007) used thirteen characters involving vegetative and floral traits to study 44 grain 
7 
 
University of Ghana http://ugspace.ug.edu.gh
cowpea genotypes to quantify the genetic diversity within them. These genotypes fell into nine 
clusters. By using Mahalanobis (D2) statistic, Kumari et al. (2000) carried out morphological 
characterization of fifty genotypes of cowpea which grouped the genotypes into thirteen clusters. 
He found number of branches, number of seeds per pod, pod length and number of pods per cluster 
as important traits that caused the divergence observed. 
In an experiment to study ten cowpea accessions Manggoel et al. (2012) observed significant 
variability in these accessions by using the following traits: number of flowers per plant, days to 
50 per cent flowering, grain yield, pods per plant, seeds per pod, pod length, 100-seed weight and 
number of peduncles per plant. 
 
2.4.2 DNA based characterization  
 
DNA based markers are described as sites where differences in DNA sequences occur among 
members of the same species. They have many advantages over morphological markers because 
they are relatively easy to assay, highly heritable and are not influenced by the environment. DNA 
markers help to produce acceptable classification of taxon by assessing the level of genetic 
relationships. The following are examples of DNA based markers that can be differentiated into 
two types: hybridization based markers and PCR based markers. Restriction Fragment Length 
Polymorphism (RFLP) is an example of hybridization based DNA markers (Karp et al., 1997). 
Examples of PCR based markers are: Amplified Fragment Length Polymorphism (AFLP), 
Cleaved Amplified Polymorphic Sequences (CAPS), Random Amplified Polymorphic DNA 
(RAPD), Simple Sequence Repeat (SSR) Length Polymorphism, Inter-simple sequence repeats 
(ISSRs), Single Strand Conformational Polymorphism (SSCP), Heteroduplex Analysis (HA), 
8 
 
University of Ghana http://ugspace.ug.edu.gh
Single Nucleotide Polymorphism (SNP), Sequence Tagged Sites (STS) and Expressed Sequenced 
Tags (EST) 
DNA- based markers have been used in cowpea research work. In a study by Zannou et al. (2008) 
RAPD markers were used for the evaluation of genetic diversity in 70 cowpea accessions from 
Benin where they observed large genetic diversity among them. Similarly, Malviya et al. (2012) 
used 18 sets of RAPD markers to estimate genetic diversity among 10 cowpea cultivars from India. 
Ba et al. (2004) also analysed 26 domesticated and 30 wild cowpea accessions from West, Eastern 
and Southern Africa where they observed more polymorphisms. SSR markers have been used to 
carry out research on cowpea from different sites especially Africa and Asia. Ogunkanmi et al. 
(2008) used SSR markers to prove that Africa is the centre of diversity of wild cowpea. AFLP 
markers have also been used for cowpea research. Coulibaly et al. (2002) applied AFLP markers 
to study genetic relationships within 117 cowpea accessions to find out the organization of their 
genetic diversity. AFLP markers were also used by Fang et al. (2007) to study genetic relationships 
among 60 advanced breeding lines from six breeding programs in West Africa and USA, 27 
landraces from Africa, Asia and South America. Egbadzor et al. (2017) used 458 SNP to 
characterize 113 cowpea accessions made up of 5 from abroad and 108 from Ghana. High level of 
genetic diversity was observed among the accessions. Haizheng et al. (2018) also employed SNP 
markers for estimation of the level of genetic diversity, population structure, and phylogenetic 
relationships in 768 cowpea accessions collected from 56 countries. 
 
2.4.3 Phytochemical characterization of cowpea seeds 
 
Cowpea seeds are known to be one of the main plant sources of protein in human diet. It is also a 
rich source of dietary fibre and carbohydrates. It is also rich in phytochemicals. Phytochemicals 
9 
 
University of Ghana http://ugspace.ug.edu.gh
are bioactive compounds found in fruits, cereal grains, vegetables and plant based drinks consisting 
of tea and wine. They have antioxidant and free radical scavenging properties that contribute to 
reduction in risk of different types of chronic diseases (Zhang et al., 2015). Phytochemical 
characterization of cowpea seeds has shown that they have good levels of mineral elements. They 
also contain significant amounts of polyphenolic compounds such as simple phenols, flavonoids 
and tannins (Olabanji et al., 2018).  
Amino acids have been used to characterize cowpea accessions. Cowpea amino acid analysis by 
Hussain and Basahy (1998) showed the existence of at least 17 amino acids including most of the 
essential ones. In a study of seven cowpea varieties, Ukpene and Imade (2015) identified 18 amino 
acids. Qualitative phytochemical screening of seeds also showed the presence of fructose, a-
glucose, P-glucose, mannitol, glycerol, inositol and some oligosaccharides, e.g. raffinose, 
verbascose and stachyose. 
Antioxidants are specific compounds that protect human, animal and plant cells against the 
damaging effects of free radicals. In addition, an imbalance between antioxidants and free radicals 
results in oxidative stress, leading to cellular damage (Kukic, 2006). Rice-Evans et al. (1997) 
reported that, polyphenolic compounds also have beneficial effects due to their antioxidant 
activity. Some phenolic compounds exist as natural antioxidants and represent an important group 
of bioactive compounds in foods which may prevent the development of many diseases, including 
cancer, arteriosclerosis (Kukic, 2006).   
10 
 
University of Ghana http://ugspace.ug.edu.gh
 
2.5 Population structure   
Natural populations are structured into sub-groups which does not permit total random mating 
making them genetically distinct from each other. Therefore, we get a set of individuals 
characterized by some measure of genetic distinction. Such genetic differences may be due to 
geographic ancestry. Structure in this sense refers to any deviation from random-mating, including 
inbreeding and assortative mating. It is important to know how much variation exists within each 
level of structure relative to other levels. Wright (1951) developed the following set of measures 
called F-statistics for departures from Hardy-Weinberg equilibrium in sub-divided populations; 
•  Fixation index (F) as a measure of increased homozygosity 
• Inbreeding coefficient (FIS). This is a correlation of uniting gametes relative to gametes 
drawn at random from within a sub-population (Individual within the Sub-population) 
• FST is a measure of population sub-structure which is beneficial for analyzing the overall 
genetic divergence amongst sub-populations. 
 
Elements of population structure assessment include similarity and dissimilarity measure, genetic 
distances between individuals, clustering and differentiation among clusters or groups (Panda et 
al., 2015).  Principal component analysis serves as a relevant and important tool for inferring 
population structure.  It is used for the study of comparative genetic distances between individuals. 
It can also be used to assess differentiation among groups classified by dendrogram (Panda et al., 
2015). The software STRUCTURE also employs Bayesian Clustering method to deduce 
population structure using genotype data consisting of unlinked markers (Khan et al., 2015). 
However, there are several softwares available for inferring population structure by using genotype 
data.  
11 
 
University of Ghana http://ugspace.ug.edu.gh
2.6 Diversity 
From the genetic point of view, there are two forms of diversity, namely: phenotypic and genetic 
diversities. The former refers to the situation where morphological markers are used to assess the 
diversity. Genetic diversity relates to the application of molecular markers. Genetic diversity plays 
a key role in the continued existence of species (Mafakheri, et al. (2017). An insight of the 
dynamics of genetic diversity within and among populations of species is key to the development 
of optimum genetic resource management strategies towards conservation, sustainable utilization 
and genetic improvement (Panda et al., 2015). Genetic diversity assessment is very vital to mitigate 
threats of environmental fluctuations. For the maximum exploitation of genetic resources in 
breeding programmes, knowledge about genetic diversity is paramount. Availability of genetic 
diversity within plant species aids in the selection of superior lines for crop improvement (Ali et 
al., 2007). Estimation of plant genetic resources has been done by using different types of 
methodologies. Such methodologies include the application of morphological, biochemical and 
molecular markers to estimate the level of genetic diversity.  Diversity assessment has for a long 
time depended on morphological characterization. However molecular markers have played more 
reliable role in the assessment of genetic diversity in most plant species. During assessment of 
genetic diversity, parameters that are estimated include allele and genotypic frequencies, 
percentage of polymorphic bands, Nei’s genetic diversity, Shannon’s index, gene flow and Nei’s 
genetic differentiation index among populations. 
 
 
 
12 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER THREE 
3.0 MATERIALS AND METHODS 
 
3.1 Sources of Cowpea Accessions 
Seventy-eight cowpea accessions were used for this research (Table 1). These accessions were 
obtained from CSIR-Savanna Research Institute (SARI) and the Department of Plant and 
Environmental Biology (DPEB), University of Ghana. 
 
3.2 Site and Experimental Design 
The field experiment was conducted at the West African Centre for Crop Improvement 
experimental plots at the University of Ghana, Legon under artificial irrigation. Cowpea accessions 
were planted in single row plots with 15 seeds per row at planting distance of 1 m x 1 m.  
 
3.3 Phenotyping  
3.3.1 Qualitative traits characterization 
 
The Cowpea Descriptor by the International Board of Plant Genetic Resources (1983) was used to 
characterize the traits. The traits studied were grouped under vegetative and reproductive 
parameters. 
Vegetative Traits: The vegetative traits scored were plant pigmentation, leaf colour, terminal 
leaflet shape, growth habit and leaf v-markings 
Reproductive Traits: Raceme position, flower bud tip colour, immature pod tip colour, main pod 
pigmentation, pod colour, seed coat colour and seed coat pattern were scored. 
13 
 
University of Ghana http://ugspace.ug.edu.gh
3.3.2 Phytochemical Characterization 
 
 Pulverised cowpea flour was used for all phytochemical characterization. Twenty (20) cowpea 
seeds from each accession were pulverized and stored in the refrigerator until required. The 
phytochemical analyses performed were determination of crude protein, mineral elements, 
polyphenols and amino acids. 
 Crude protein and mineral elements determination were carried out at the Ecological Laboratory 
of the Institute for Environment and Sanitation Studies, University of Ghana, Legon. Polyphenols 
determination was performed in the Department of Plant and Environmental Biology, while amino 
acids determination was done at the Pesticide Residue Laboratory, Ghana Standards Authority. 
 
 
 
 
 
 
 
 
 
 
 
 
 
14 
 
University of Ghana http://ugspace.ug.edu.gh
Table 1: List of Cowpea accessions used for the research 
 
Accession Source Accession Source 
ZAAYURA SARI ASOO7 DPEB 
PADI TUYA SARI BAWUTA SARI 
APAGBAALA SARI SONGOTRA SARI 
ASONTEM SARI SARI-5-5-5 SARI 
IT07K-299-6*** SARI IT07K-298-45*** SARI 
SARVX-09-002 SARI IT10K-817-3*** SARI 
IT98K-628*** SARI IT86D-610*** SARI 
GOLINGA DPEB 312 DPEB 
SARI-6-2-6 SARI RC-04 DPEB 
SARVX-09-004 SARI 6824 DPEB 
SARVX-07-001 SARI 442 DPEB 
SARI-13-17-2 SARI ASOO5 DPEB 
RC-01 DPEB AGRAC-216 DPEB 
IT08K*** SARI 4223 DPEB 
SARI-2-50-80 SARI BOTN 003 DPEB 
IT08K-150-24*** SARI BOTN 007 DPEB 
SARI-3-11-88 SARI BOTN 002 DPEB 
SARI-1-50-81 SARI ASOO4 DPEB 
IT08K-137-1*** SARI 2213 DPEB 
BELEDI-B DPEB ASOO8 DPEB 
SARI-1-3-90 SARI ASOO9 DPEB 
LADUNI 1B DPEB 6312 DPEB 
SARI-3-11-100 SARI ASO10 DPEB 
IT07K-299-69*** SARI EMS 30-02 DPEB 
SARI-6-2-9 SARI WACCI TONI DPEB 
111 DPEB ASOO6 DPEB 
ASOO3 DPEB F2RG009 DPEB 
RC-02 DPEB G41 DPEB 
COLMUT 10-01 DPEB G35 DPEB 
EMS 10-01 DPEB 422 DPEB 
L69 DPEB G24 DPEB 
212 DPEB G84 DPEB 
F2RG011 DPEB G18 DPEB 
F2RG004 DPEB G80 DPEB 
RC-03 DPEB G5 DPEB 
F2RG007 DPEB G22 DPEB 
BOTN 006 DPEB G7 DPEB 
F2RG012 DPEB G50 DPEB 
F2RG010 DPEB IT98K-503-1*** SARI 
*** = IITA accessions 
 
 
 
15 
 
University of Ghana http://ugspace.ug.edu.gh
3.3.2 Phytochemical Characterization 
 
 Pulverised cowpea flour was used for all phytochemical characterization. Twenty (20) cowpea 
seeds from each accession were pulverized and stored in the refrigerator until required. The 
phytochemical analyses performed were determination of crude protein, mineral elements, 
polyphenols and amino acids. 
 Crude protein and mineral elements determination were carried out at the Ecological Laboratory 
of the Institute for Environment and Sanitation Studies, University of Ghana, Legon. Polyphenols 
determination was performed in the Department of Plant and Environmental Biology, while amino 
acids determination was done at the Pesticide Residue Laboratory, Ghana Standards Authority. 
 
3.3.2.1 Crude Protein Determination 
 
The nitrogen content was determined by the application of a modified version of the Kjeldhal-N 
method (AOAC, 2000). The method involved the following three processes: digestion, distillation 
and titration.  
Digestion of samples: A measured quantity of (0.2 g) of the cowpea flour was placed in a labeled 
conical flask. Five millilitres of concentrated sulphuric acid was added and swirled gently to obtain 
a black solution which was allowed to stand for 24 hours. The solution was placed on a preheated 
electronic burner in a fume chamber until white fumes were observed. Drops of hydrogen peroxide 
were added until the solution turned colorless and allowed to cool. By filtration, the solution was 
transferred into a 100 ml volumetric flask and topped to the 100 ml mark with distilled water. 
16 
 
University of Ghana http://ugspace.ug.edu.gh
Distillation: Five millilitres of the digested sample was measured into a 50 ml conical flask and 5 
ml of boric acid solution (2%) was added to obtain a purple solution. Five millilitres of sodium 
hydroxide solution (40%) was gently poured into the digestion flask which was connected 
immediately to the distillation apparatus. A light green colour was observed at the end of the 
distillation process. 
Titration: The distillate was titrated against 0.1 M HCl until a change in colour was observed. 
The titre value obtained was used to calculate percentage nitrogen as follows (AOAC, 2000): 
𝒕𝒊𝒕𝒓𝒆 𝒗𝒂𝒍𝒖𝒆 𝒙 𝟎.𝟎𝟏 𝒙 𝟏𝟒 𝒙 𝑽 
            %N =  
𝟏𝟎𝟎𝟎 𝒙 𝑾 𝒙 𝒂𝒍𝒊𝒒𝒖𝒐𝒕 𝒑𝒊𝒑𝒆𝒕𝒕𝒆𝒅
where,  
            N represents nitrogen,  
           V represents the extraction volume (100 ml) and  
          W represents the weight of the powdered sample (0.2 g).  
 
Percentage crude protein was obtained by the equation below. 
                                  % Crude Protein = %N x 6.25 
 
3.3.2.2 Mineral Elements Determination 
 
The Atomic Absorption Spectrophotometer (AAS) was used for the determination of the 
following mineral elements: Manganese (Mn), calcium (Ca), iron (Fe), copper (Cu), magnesium 
(Mg), sodium (Na), manganese (Mn), nickel (Ni), potassium (K), Chromium (Cr), cadmium (Cd) 
and lead (Pb). 
17 
 
University of Ghana http://ugspace.ug.edu.gh
 Absorbance values for the standard solutions were read at specific wavelengths by the AAS. 
Standard calibration curves were prepared for each mineral element. Absorbance values for the 
sample solutions were read at specific wavelengths and used to calculate the corresponding 
mineral elements by the formula below (AOAC, 2000): 
           % A = 𝐴𝐴𝑆𝑟𝑒𝑎𝑑𝑖𝑛𝑔 X 𝑉  𝑋 100 
1000 1000 𝑤𝑡
where,  
          A represents the mineral element,  
         V represents volume of sample solution 
        wt represents the weight of the powdered sample 
 
 
3.3.2.3 Polyphenols Determination 
 
Two types of polyphenols were analysed, namely phenols and flavonoids. The phenols were 
syringic acid, vanillic acid, gallic acid, p-coumaric acid, ferulic acid, rosmarinic acid and catechin. 
The flavonoids were rutin and quercetin. Methanolic extracts of the samples were obtained by 
pouring 20 ml of 100% methanol on 0.5 g of the sample allowing it to stand for 24 hours. The 
solution was filtered and the filtrate stored in tightly corked MaCartney bottles at a temperature of 
4⁰C until ready for use. 
Preparation of standard curves for phenols:  A modified method of the Folin-Ciocalteu’s 
method (AOAC, 2000) was used in determining the phenol content. A weighted amount of (0.5 g) 
of each standard compound was dissolved in 20 ml of methanol and the solution was topped to 
100 ml to obtain a stock solution. Serial dilutions in the concentration range of 0-500 mg/L were 
prepared. Twenty microliters of each serial dilution was pipetted into separate cuvettes. A volume 
of 1.58 ml distilled water and 100 μl of Folin-Ciocalteu was added to each of the serial dilutions 
18 
 
University of Ghana http://ugspace.ug.edu.gh
and the content was votexed. After five minutes, 300 μl of 20 % sodium carbonate solution was 
added and votexed. The solutions were kept in an oven for 30 minutes at 40⁰C. Absorbance values 
were read against the blank at the following wavelengths: 415 nm and 510 nm. The absorbance 
values were plotted against the corresponding concentrations from which linear regression 
equations were obtained as presented in Appendix 1. 
Preparation of standard curves for flavonoids: A modified aluminium chloride colorimetric 
procedure was used in determining the flavonoid content. A weighed quantity of (0.5 g) of each 
standard compound was dissolved in 20 ml methanol. The standard solution was diluted with 100 
ml of distilled water to obtain a stock solution. Serial dilutions in the concentration range of 0-
500mg/L were prepared. Twenty microliters of each serial dilution was pipetted into separate 
cuvettes. Five hundred microliters of distilled water and 30 μl of 5% sodium nitrite were added. 
The solution was allowed to stand for 5 minutes after which 30 μl of aluminium chloride was 
added. The solution was allowed to stand for 6 minutes, 200 μl of sodium hydroxide and 110 μl of 
distilled water were then added and vortexed. The absorbance of the standard solution was read 
against the blank at 425 nm wavelength. The absorbance values were plotted against the 
corresponding concentrations from which linear regression equations were obtained as presented 
in Appendix 1. 
Determination of phenolic content: One milliliter of the methanolic extract was dispensed into 
a test tube and 10 ml of distilled water added. A volume of 1.58 ml distilled water and 100 μl 
Folin-Ciocalteu was added to each test tube and votexed. After five minutes, 300 μl of 20 % sodium 
carbonate solution was added and votexed again. The solutions were kept in an oven for 30 minutes 
at 40⁰C. The absorbance of each extract was read against the blank at wavelengths of 415 nm and 
19 
 
University of Ghana http://ugspace.ug.edu.gh
510 nm. The concentration for the phenolic compounds for each extract was determined from the 
standard curves of linear regression equations. 
Determination of flavonoid content: For each accession, 1 ml of the sample extract was pipetted 
into a test tube and 500 μl of distilled water added. Thirty microliters (30 μl) of 5% sodium nitrite 
was added and allowed to stand for five minutes and 30 μl of 10 % aluminium chloride solution 
was added. The solution was allowed to stand for 6 minutes after which 200 μl of 1 M sodium 
hydroxide and 110 μl of distilled water were added and vortexed. The absorbance values were read 
against the blank at 415 nm, 425 nm and 510 nm wavelengths. The flavonoids content of the 
sample extract was determined from the standard curves of linear regression equations. 
 
3.3.2.4 Amino Acid Analysis 
 
The following nineteen amino acids were analysed: L-Aspartic acid, Glutamine, 
 Glycine, L-Histidine, Isoleucine, L-Lysine, L-Cysteine, L-Methionine,  
DL-Beta-Phenyl-Alanine, D-Proline, L-Serine, L-Threonine, L-Tyrosine, L-Valine, DL-Alpha-
Alanine, B-Threonine, Trans-4-Hydroxyl-Proline, L-Asparagine and L-Tryptophan. 
 Sample preparation: Standard solution was prepared by weighing 2.5 mg of the standard 
compound into 25 ml of methanol and diluted to a concentration of 100 ppm. A mixed standard 
solution of 10 ppm was prepared from the stock solution which was diluted to 1ppm as the working 
solution. A weight of 0.5 g of cowpea flour was extracted in 20 ml of 100 % methanol. 
Chromatography: Column used was Agilent Poroshell 120 bonus RP 2.7 um, 2.1 x 100 mm; flow 
rate was 0.15 ml/min. Mobile phases were: 100 % water, 0.1 % formic acid (A) and 100 % 
methanol, 0.1 % formic acid (B). The gradient was 0 to 5 % B over 5 minutes and 5 to 50 % B 
over 15 minutes. The injection volume was 6 µL.  
20 
 
University of Ghana http://ugspace.ug.edu.gh
Mass spectrometry: MS-Aligent Tripple quadrupole 6420 was used to identify and quantify the 
compounds. 
 
3.4 Genotyping 
Genotyping was carried out at the Biotechnology Laboratory of the College of Basic and Applied 
Sciences, University of Ghana. 
Collection of leaf samples: The first trifoliate leaves of one plant per accession was harvested two 
weeks after planting and stored at -80o prior to DNA extraction.  
 DNA extraction: The leaf samples were manually grinded using a micropestle. Genomic DNA 
was extracted using the cetyltrimethyl ammonium bromide (CTAB) method. DNA quality and 
quantity were checked using Nano-drop spectrophotometer. DNA was stained with a blue dye and 
run using 1.5% agarose gel electrophoresis. 
PCR amplification: Fifty cowpea derived SSR primers were screened with seven cowpea 
accessions to obtain optimal primer performance that showed polymorphism were selected. Three 
primers that showed polymorphism and reproducible band patterns were selected for the study. 
The sequences for the three SSR primers were as shown in the Table 2. 
 
 
 
 
 
21 
 
University of Ghana http://ugspace.ug.edu.gh
Table 2: List of three cowpea SSR markers. 
Name Code Sequence 
SSR-6206 (F) SSR21 AGGCATGCATTCATCTTTCC 
SSR-6206 (R) GCAGTCATAACCCCAAAACAA 
SSR-6218 (F) SSR34 GTGGAAGGAATGGGTCCAG 
SSR-6218 (R) AGGAAATTTGCATTCCTTTGT 
SSR-6219 (F) SSR35 ACAATGCACAAAATGTGAATCTC 
SSR-6219 (R) GGGAAGCTTAGGAAAAGTTTGA 
 
 
 PCR cocktail prepared for amplification contained the following:  2 µl template DNA, 6.25 µl 
master mix, 0.5 µl of primer (forward and backward), and 3.25 µl of double distilled water.   
 The PCR tubes were placed in a thermocycler and programmed for initial denaturation at 
95°C for 3 minutes, followed by 30 cycles for 30 seconds at 94°C, 30 seconds at 53°C, 2 
minutes at 72°C, and final extension for 15 minutes at 72°C.                                                                                                                                                                                                                                                                 
Electrophoresis: The PCR product was electrophoresed in 1.5% agarose gel in TAE buffer at a 
voltage of 100 V for 2 hours 30 minutes. The agarose gel was stained with ethidium bromide and 
visualized and scored under UV. 
 
 
 
22 
 
University of Ghana http://ugspace.ug.edu.gh
3.5 Data analysis 
3.5.1 Morphological characterization 
 
Morphological data collected were analysed using Stata 14 (StataCorp., 2015). The following 
analyses were performed: descriptive statistics, test for association, t-test, one-way anova, 
Pearson’s correlation coefficient and partial correlation. Analyses performed were based on the 
collection source of cowpea genotypes and a composite of the two-collection source. 
 
3.5.2 Phenotypic Diversity  
 
Qualitative variables were coded as present (1) or absent (0). The quantitative variables were put 
into classes of equal intervals and assigned ordinal values. The software POPGENE version 1.32 
was used to analyse for trait frequency, Nei’s genetic diversity (He) statistics (Nei, 1973) and 
geneflow. STATA software was used to perform principal component and cluster analyses. 
 
3.5.3 Population Genetic Structure of Collection 
 
The dataset generated from SSR genotyping were used for population genetic structure analyses. 
The software STRUCTURE version 2.2. (Pritchard et al. 2000) was used to determine 
memberships of samples, number and membership of clusters, allele frequency distribution in the 
clusters, allele frequency divergence among clusters and gene flow. 
 
 
23 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER FOUR 
4.0 RESULTS 
 
4.1 Frequency Distribution of Morphological Traits 
The frequency distribution of the different classes of the qualitative traits is presented in Table 1.   
Growth habit: Growth habit had four different phenotypic classes. The total population frequency 
for the four phenotypic classes ranged between 1.5% (prostrate) and 64.6% (erect). Frequency 
distribution based on source of collection ranged from 2.5% (prostrate) to 67.5% (erect) for 
cowpea accessions from DPEB, while for SARI the range was between 0.00% (prostrate) and 
64.6% (erect). 
Main pod pigmentation: Three different phenotypic classes were identified for this trait. 
Population frequency ranged from 1.6% (uniformly pigmented) to 11.29% (splashes of pigments). 
Source of collection frequency distribution for DPEB ranged from 0.00% (uniformly pigmented) 
to 8.3% (splashes of pigments), that for SARI ranged from 3.9% (uniformly pigmented) to 15.4% 
(splashes of pigments). 
Pod colour: There were eight different phenotypic classes for pod colour. The lowest population 
frequency of 1.6% was scored for four different classes and the highest of 39.1% was scored for 
brown. Frequency distribution for DPEB accessions ranged from 2.5% (which was scored for four 
different classes) to 32.50% which was scored for ligh pod colourt. Frequency distribution for 
SARI accessions ranged from 0.00% (for four different classes) to 75.0% for brown pod colour. 
 
24 
 
University of Ghana http://ugspace.ug.edu.gh
Seedcoat colour: Seedcoat colour had ten different phenotypic classes. Population frequency 
ranged between 1.6% (scored for three different classes) and 51.6% (cream). Frequency 
distribution for DPEB accessions ranged from 0.00% (brick red) and 32.5% (cream), that for SARI 
accessions ranged from 0.00% (scored for five different classes) to 83.3% (cream).   
Seedcoat pattern: Seven different phenotypic classes were identified for seedcoat pattern. 
Frequency distribution for the total population ranged between 1.6% (scored for two different 
classes) and 50.0% (solid). Frequency distribution for DPEB accessions ranged between 0.00% 
(black eye seedcoat pattern) and 70.0% (solid) that for SARI accessions ranged between 0.00% 
(scored for three different classes) and 41.7% (small black eye). 
Leaf colour: There were three different phenotypic classes for leaf colour. Population frequency 
distribution ranged from 3.0% (pale green) to 80.3% (intermediate green). Frequency distribution 
for DPEB accessions ranged from 5.0% (pale green) to 85.0% (intermediate green), that for SARI 
accessions ranged between 0.0% (pale green) and 79.1% (intermediate green). 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
25 
 
University of Ghana http://ugspace.ug.edu.gh
Table 3:  Frequency distribution of cowpea morphological traits. 
 
   Frequency (%)  
Trait Phenotypic DPEB SARI Total 
Class population 
Growth Habit Erect 67.50 60 64.6 
 Prostrate 2.50 0 1.5 
 Semi-erect  22.50 40 29.3 
 Semi-prostrate 7.50 0 4.6 
Main pod No pigment 91.7 80.8 87.1 
pigmentation 
 Splashes of 8.3 15.4 11.29 
pigments 
 Uniformly 0 3.9 1.6 
 pigmented  
Pod colour Brown 17.5 75 39.1 
 Buff  20.0 20.8 20.3 
 Dark brown 2.50 0 1.6 
 Dark mottled 2.50 0 1.6 
 Dark purple 2.50 0 1.6 
 Flesh 2.50 0 1.6 
 Light brown 32.50 4.2 21.9 
 Purple 20.0 0 12.5 
Seedcoat colour Black 5.0 0 3.1 
 Black mottled 2.50 0 1.6 
 Brick red 0 8.3 3.1 
 Brown 17.50 4.2 12.5 
 Brown mottled 10.0 4.2 7.8 
 Cream 32.5 83.3 51.6 
 Dark mottled 15.0 0 9.4 
 Dirty white 2.5 0 1.6 
 Flesh 2.5 0 1.6 
 Red 12.5 0 7.8 
 
 
 
 
 
 
 
 
 
 
 
 
26 
 
University of Ghana http://ugspace.ug.edu.gh
Table 3 cont’d 
 
   Frequency (%)  
Trait Phenotypic Class DPEB SARI Total population 
Seedcoat pattern Black eye 0 25.0 9.4 
 Black Holstein 2.5 0 1.6 
 Brown eye 5.0 0 3.1 
 Golden eye 2.5 0 1.6 
 Small black eye 7.5 41.7 20.3 
 Small brown eye 12.5 16.7 14.1 
 Solid 70.0 16.7 50.0 
Leaf colour Dark green    
10.0 26.9 16.7 
  
    
 Intermediate green 85.0 79.1 80.3 
    
 
 Pale green 5.0 0 3.0 
   
Plant Moderate base tip 35.0    50.0           40.9 
pigmentation petiole 
 None  7.5 3.9 6.1 
 Very slight 57.5 46.2 53.0 
     
Immature pod tip Non-pigmented 54.3 62.50 57.6 
colour 
 Pigmented 45.7 37.5 42.4 
 
V-marking Absent 59.5 100 76.2 
 Present 40.5 0 23.8 
Raceme position Below upper 52.6 3.9 32.8 
canopy 
 In upper canopy 42.1 50.0 45.3 
 Mostly above 5.3 46.2 21.9 
canopy 
Terminal leaflet Globose 44.7 15.4 32.8 
shape 
 Hastate 2.6 19.2 9.3 
 Sub-globose 47.4 46.2 46.9 
 Sub-hastate 5.3 19.2 10.9 
Flower bud tip Non-pigmented 55.6 68.0 60.7 
 Pigmented 44.4 32.0 39.4 
 
 
 
27 
 
University of Ghana http://ugspace.ug.edu.gh
 
Plant pigmentation: Three different phenotypic classes were identified for plant pigmentation. 
The lowest population frequency of 6.1% was scored for no pigmentation and the highest 
population frequency of 53.0% was scored for very slight plant pigmentation. Frequency 
distribution for DPEB accessions ranged from 7.5% (no pigmentation) to 57.5% (very slight 
pigmentation). Frequency for SARI accessions ranged from 3.9% (no pigmentation) to 50.0% 
(moderate base tip petiole pigmentation). 
Immature pod tip colour: Two different phenotypic classes were observed. Population frequency 
distribution ranged from 42.4% (pigmented) to 57.6% (non-pigmented). Frequency distribution 
for DPEB accessions ranged from 45.7% (pigmented) to 54.3% (non-pigmented) and for SARI 
accessions the range was between 37.5% (pigmented) to 62.5% (non-pigmented). 
V-marking: V-marking among the accessions existed in two phenotypic classes. The lowest 
population frequency of 23.8% was scored for present and the highest of 76.2% was scored for 
absent. Frequency distribution in the DPEB accessions ranged from 40.5% (present) to 59.5% 
(absent) and that for SARI accessions ranged from 0.00% (present) to 100% (absent). 
Raceme position: There were three phenotypic classes for this trait. Population frequency 
distribution ranged from 21.9% (mostly above canopy) to 45.3% (in upper canopy). Frequency for 
DPEB accessions ranged between 5.3% (mostly above canopy) to 52.6% (below upper canopy). 
Frequency for SARI accessions ranged from 3.9% (below upper canopy) to 50.0% (in upper 
canopy) 
           Terminal leaflet shape: Four different phenotypic classes were observed for the trait.  Population 
frequency distribution ranged from 9.3% (hastate) to 46.9% (sub-globose). Frequency distribution 
28 
 
University of Ghana http://ugspace.ug.edu.gh
for DPEB accessions ranged from 2.6% (hastate) to 47.4% (sub-globose). Frequency for SARI 
accessions ranged from 15.4% (globose) to 46.2% (sub-globose). 
Flower bud tip: Two classes were observed for this trait. Population frequency distribution ranged 
from 39.4% (pigmented) to 60.7% (non-pigmented). Frequency distribution for DPEB accessions 
ranged from 44.4% (pigmented flower bud tip) to 55.6% (non-pigmented). Frequency distribution 
for SARI accessions ranged between 32.0% (pigmented) and 68.0% (non-pigmented) 
4.2 Phytochemical Traits 
Population and sources of collection mean values and their standard errors for the phytochemical 
traits: crude protein, mineral elements and polyphenolic compounds are presented in Tables 4a 
and 4b, respectively. Appendix 1  
 
4.2.1 Crude Protein 
 
Mean percent crude protein for the population was 13.52+0.245% which ranged from 9.63 
(accession 4223) to 16.98 (accession GOLINGA). Crude protein was below detection for 12.2% 
of the accessions. Mean percent crude protein for DPEB accessions was 13.52+0.334% which 
ranged from 9.63% (accession 4223) to 16.98% (accession GOLINGA). Mean percent crude 
protein for SARI accessions was 14.21+0.342 which ranged from 10.33% (SARVX-09-002) to 
16.8% (accession Songotra). T-test analysis showed that there was no significant mean difference 
between the two sources of collection (P = 0.918). 
 
 
29 
 
University of Ghana http://ugspace.ug.edu.gh
4.2.2 Mineral elements 
 
Calcium: Population mean value for calcium was 1.59+1.589 ppm. Concentration values for 
accessions ranged between 0.0738 ppm (accession F2RG010) and 86.2 ppm (accession EMS10-
01). Calcium was below detection in 12.2% of the accessions. Mean value for DPEB accessions 
was 2.705+2.609 ppm which ranged between 0.0338 ppm (accession F2RG010) and 86.21 ppm 
(accession EMS 10-01). Frequency distribution for SARI accessions ranged from 0.0758 ppm 
(accession SARVX-09-0004) to 0.2063 ppm (accession SARI-5-5-3) with a mean of 0.114+0.196 
ppm. There was no significant mean difference between the two collection sources (P = 0.196). 
Sodium: Mean value for the population frequency was (35.66+0.58) x 10-3 ppm. Among the 
accessions, sodium concentrations ranged from 0.00005 ppm (scored for three different 
accessions) to 0.02345 ppm (accession 4223). Sodium was below detection in 18.2% of the 
accessions. For DPEB accessions mean value was 0.003+0.000 ppm which ranged from 0.00005 
ppm to 0.0234 ppm. Within SARI accessions sodium concentration ranged between 0.00025 ppm 
(accession IT98K-629) and 0.01235 ppm (accession SARI-1-50-08) with a mean value of 
0.005+0.000 ppm. There was no significant difference between the two collection sources for 
sodium content (P = 0.957). 
Potassium: Concentrations for the accessions ranged from 5.76 ppm (accession F2RG010) to 
16.98 ppm (accession 4223) with a population mean of 10.41+0.259 ppm. Potassium was below 
detection in 12.2% of the accessions. Frequency distribution for DPEB accessions ranged between 
5.76 ppm and 16.98 ppm with a mean of 9.82+0.350 ppm. Frequency distribution for SARI 
accessions ranged between 8.66 ppm and 14.99 ppm with a mean of 11.18+0.332 ppm. There was 
no significant mean difference between the two collection sources (P = 0.996) 
30 
 
University of Ghana http://ugspace.ug.edu.gh
      Table 4a: Population means and their standard errors for polyphenols,  
          mineral elements and percent crude protein of cowpea genotypes  
 
 Population Means Standard error 
Polyphenols (mg/l)   
Gallic acid  60.97 22.94 
Syringic acid  104.25 12.04 
Quercetin  69.58 2.34 
Vanillic acid 52.79 13.75 
   
Mineral elements (ppm)   
Ca  1.59 1.589 
Na 3.56 x 10-3 0.58 x 10-3 
K 10.405 0.259 
Mg 0.288 7.69 x 10-3 
Fe  0.048 0.0041 
Cu nd nd 
Ni 0.033 0.0021 
Pb 0.038 0.0059 
Cd 7.0 x 10-4 2.0 x 10-4 
Mn 0.0187 9.0 x 10-4 
Cr 0.00168 0.00138 
Zn  0.00402 8.34 x 10-4 
   
Crude protein (%) 13.82 0.245 
 
31 
 
University of Ghana http://ugspace.ug.edu.gh
        Table 4b: Means and their standard errors for polyphenols, mineral elements  
        and percent crude protein of cowpea genotypes across source of collection. 
 
 Source of collection  
 DPEB SARI  
 Mean se Mean se t-test  
Polyphenols (mg/l)      
Gallic acid  87.0 37.39 21.0 3.36 0.081 
Syringic acid  118.6 19.6 82.2 2.33 0.070 
Quercetin  73.5 3.04 63.6 3.42 0.021 
Vanillic acid 69.2 22.36 27.5 2.67 0.070 
Mineral elements (ppm)      
Ca  2.705 2.609 0.114 0.006 0.196 
Na 0.003 0.000 0.005 0.00 0.957 
K 9.819 0.350 11.179 0.332 0.996 
Mg 0.272 0.008 0.308 0.013 0.991 
Fe  0.050 0.004 0.044 0.008 0.238 
Cu Nd nd nd nd  
Ni 0.041 0.003 0.022 0.002 0.000 
Pb 0.046 0.010 0.028 0.004 1.000 
Cd 0.0003 0.0001 0.0001 0.0003 1.000 
Mn 0.022 0.001 0.016 0.00 0.0002 
Cr 0.002 0.001 0.00 0.00  
Zn  0.005 0.001 0.002 0.00 0.017 
Crude protein (%) 13.523 0.334 14.214 0.342 0.918 
 
32 
 
University of Ghana http://ugspace.ug.edu.gh
Magnesium: Mean concentration of magnesium for the population was (0.288+7.69) x 10-3. 
Concentration values among accessions ranged from 0.178 ppm (accession IT86D-610) to 0.425 
ppm (accession ITD8K-150-241). Magnesium was below detection in 12.2% of the accessions. 
Frequency distribution for accessions collected from DPEB ranged from 0.202 ppm to 0.411 ppm 
with a mean value of 0.272+0.008 ppm. Among accessions from SARI, frequency distribution 
ranged from 0.178 ppm to 0.425 ppm with a mean of 0.308+0.013 ppm. The two collection sources 
did not differ significantly in their mean concentrations for magnesium (P = 0.991). 
Iron: Mean concentration of iron for the population was 0.048+0.0041 ppm. Concentration values 
for the accessions ranged from 0.0012 ppm (accession SARI-6-2-6) to 0.109 ppm (accession 
ITO8K). Concentration values for DPEB accessions had a mean value of 0.05+0.004 ppm with a 
range from 0.008 ppm to 0.089 ppm and those for SARI ranged between 0.0012 ppm and 0.109 
ppm with a mean of 0.044+0.008 ppm. The two collection sources did not differ significantly in 
their iron mean concentrations (P = 0.238). 
Copper: Copper was detected in only one accession (accession F2RG010) at a concentration of 
0.0008 ppm.  
Nickel: Mean concentration of nickel for the population was 0.033+0.0021 ppm. Concentration 
values among accessions ranged from 0.0104 ppm (accession LADUNI B) to 0.066 ppm 
(COLMU10-01). Nickel was below detection in 12.2% of the accessions. Frequency distribution 
for accessions from DPEB ranged from 0.0104 ppm to 0.066 ppm with a mean of 0.041+0.003 
ppm. Frequency distribution for accessions from SARI ranged between 0.0083 ppm and 0.032 
ppm and a mean of 0.022+0.002 ppm. There was a highly significant mean difference between the 
two collection sources (P = 0.000). 
33 
 
University of Ghana http://ugspace.ug.edu.gh
Lead: Mean concentration of lead for the population was 0.038+0.006 ppm. Concentration values 
ranged from 0.0003 ppm (accession G7) to 0.0201 ppm (accession AS008). Lead was below 
detection in 18.2% of the accessions. Among accessions from DPEB mean concentration was 
0.046+0.010 ppm ranging from 0.0003 ppm to 0.0201 ppm. Concentration values for accessions 
from SARI ranged between 0.0007 ppm and 0.060 ppm with a mean of 0.028+0.004 ppm. The 
two collection sources did not differ significantly (P = 1.000). 
Cadmium: Mean concentration of cadmium for the population was (7.0+2.0) x 10-4 ppm. 
Concentration values ranged from 0.0001 ppm (accession GOLINGA) to 0.00285 ppm (accession 
IT08K-). Cadmium was below detection in 77.3% of the accessions. Mean frequency distribution 
for accessions from DPEB ranged between 0.0001 ppm and 0.0016 ppm with a mean value of 
(3.0+1.0) x 10-4ppm. Mean frequency distribution for accessions from SARI ranged from 0.0003 
ppm to 0.00285 ppm with a mean value of (1.0+3.0) x 10-4ppm. The two collection sources did 
not differ significantly (P = 1.000). 
Manganese: Concentration mean of population for manganese was (0.0187+9.0) x 10-4. Among 
the accessions, concentration frequency ranged from 0.0061 ppm (accession SARI-2-50-80) to 
0.0284 ppm (accession AS008). Manganese was below detection in 30.3% of the accessions. 
Concentration frequency distribution for accessions from DPEB ranged from 0.0093 ppm to 
0.0284 ppm with a mean of 0.022+0.001 ppm. Concentration frequency distribution for accessions 
from SARI ranged from 0.00605 ppm to 0.026 ppm with a mean of 0.016+0.00 ppm. There was a 
highly significant mean difference between the collection sources (P = 0.0002). 
34 
 
University of Ghana http://ugspace.ug.edu.gh
Chromium: Chromium was detected in two accessions with mean concentration values of 
0.00168+0.00138 ppm ranging between 0.00305 ppm (accession G35) and 0.0033 ppm (accession 
G22). The two accessions were from DPEB. 
Zinc: Mean concentration of zinc for the population was (0.00402+8.34) x 10-4 ppm. Among 
accessions, concentration values ranged from 0.00155 ppm (accession G7) to 0.01315 ppm 
(accession G24). Zinc was below detection in 22.7% of the accessions. Concentration frequency 
for accessions from DPEB ranged from 0.00155 ppm to 0.01315 ppm with a mean of 0.005+0.001 
ppm. Frequency for accessions from SARI ranged from 0.00075 ppm to 0.00375 ppm with a mean 
of 0.002+0.00 ppm. There was significant mean difference between the two collection sources (P 
= 0.017) 
 
4.2.3 Concentration Frequency distribution of Polyphenolic compounds 
 
Gallic acid: Mean concentration of gallic acid for population was 6.97+22.94 mg/l. Among the 
accessions, concentration values ranged from 8.5 mg/l (scored for two accessions, WACCI TONI 
and COLMUT10-01) to 1463.5 mg/l (accession EMS10-01). Frequency distribution of gallic acid 
for accessions from DPEB ranged from 8.5 mg/l to 1463.5 mg/l with a mean of 87.0+37.39 mg/l. 
Gallic acid frequency distribution for accessions from SARI ranged between 6.0 mg/l and 98.5 
mg/l with a mean of 21.0+3.36 mg/l. The two collection sources did not differ significantly (P = 
0.081). 
Syringic acid: Mean concentration for syringic acid in population was 104.25+12.04 mg/l. 
Distribution of concentration values among accessions ranged between 68.4 mg/l (accession 
COLMUT10-01) and 795.3 mg/l (accession EMS10-01). Concentration values for accessions from 
35 
 
University of Ghana http://ugspace.ug.edu.gh
DPEB ranged from 68.4 mg/l to 795.3 mg/l with a mean of 118.6+19.8 mg/l and those from SARI 
ranged from 74.1 mg/l to 132.8 mg/l with a mean value of 82.2+2.33 mg/l. There was no significant 
difference between the two collection sources (P = 0.070). 
Quercetin: Mean value was 69.58+2.34 m/l. Among accessions, concentration values ranged 
between 43.8 mg/l (accession AGRAC-216) and 122.2 mg/l (accession RC-03). Concentration 
values for accessions from DPEB ranged from 43.8 mg/l to 122.2 mg/l with a mean of 73.5+3.04 
mg/l and those from SARI ranged between 45.5 mg/l and 112.2 mg/l with a mean value of 
63.6+3.42 mg/l. The two collection sources differed significantly (P = 0.021). 
Vanillic acid: Mean concentration of vanillic acid for the population was 52.79+13.75 mg/l. 
Concentration values among accessions ranged between 11.9 mg/l (accession COLMUT10-01) 
and 842.6 mg/l (accession EMS10-01). Concentration values for accessions from DPEB ranged 
from 11.9 mg/l and 842.6 mg/l with a mean value of 69.2+22.36 mg/l. Concentration frequency 
distribution for accessions from SARI ranged between 18.3 mg/l and 85.4 mg/l with a mean value 
of 27.5+2.67 mg/l. The two collection sources did not differ significantly (P = 0.070). 
 
4.2.4 Concentration frequency distribution of amino acids 
 
Results for mean concentration distribution of amino acids are presented in Table 5a, Table 5b and 
Appendix 5. 
L-Histidine: Mean concentration of L-Histidine for the population was (365.0+42.9) x 10-8 ppm. 
Frequency distribution for accessions ranged from 140.0 x 10-8 ppm (accession 312) to 17200.0 x 
10-8 ppm (accession Songotra).  L-Histidine was below detection for 3.0% of the accessions. 
Concentration values for DPEB accessions ranged from 140.0 x 10-8 ppm to 1230.0 x 10-8 ppm 
with a mean value of (3190.0+456.0) x 10-8 ppm while mean concentration values for accessions 
36 
 
University of Ghana http://ugspace.ug.edu.gh
from SARI ranged from 310.0 x 10-8 ppm to 17200.0 x 10-8 ppm with a mean value of 
(4320.0+813.0) x 10-8 ppm. The two collection sources did not differ significantly (P = 0.901). 
Glycine: Glycine was detected in only two (3.0%) accessions. Concentration values for the two 
accessions were 6.1 x 10-8 ppm (accession G35) and 600.0 x 10-8 ppm (accession F2RG011) with 
a population mean of (260.0+50.7) x 10-8 ppm. The only two accessions were from DPEB. 
L-Asparagine: L-Asparagine was below detection in 80.3% of the accessions. Concentration 
values for accessions ranged from 82.0 x 10-8 ppm (accession SARVX-07-SARI) to 4900.0 x 10-8 
ppm (accession G7) with a population mean of (2400.0+360) x 10-8 ppm. Accessions from DPEB 
had concentration values ranging from 390.0 x 10-8 ppm to 4900.0 x 10-8 ppm with a mean of 
(2890.0+467) x 10-8 ppm. SARI accessions had mean concentration value of (1280.0+342.0) x 10-
8 ppm with a range from 82.0 x 10-8 ppm to 4900.0 x 10-8 ppm.  The two collection sources differed 
significantly in mean distribution of L-Asparagine concentration (P = 0.018). 
DL-Alpha-Alanine: DL-Alpha-Alanine was below detection in 24.2% of the accessions. Mean 
concentration for the population was (2490.0+296.0) x 10-8 ppm. Concentration values ranged 
from 5.80 x 10-8 ppm (accession 442) to 8800.0 x 10-8 ppm (accession G80). Mean concentration 
value for DPEB accessions was (2880.0+404.0) x 10-8 ppm, values ranged from 5.80 x 10-8 ppm 
to 8800.0 x 10-8 ppm. SARI accessions had concentration values that ranged from 110.0 x 10-8 
ppm to 3900.0 x 10-8 ppm with a mean value of (1759.0+326.0) x 10-8 ppm. The two collection 
sources differed significantly in concentration distribution of DL-Alpha-Alanine (P = 0.035). 
 
 
 
 
37 
 
University of Ghana http://ugspace.ug.edu.gh
Table 5a: Population means and their standard errors for amino acids of cowpea 
genotypes. 
 
 (x10-8) ppm 
Amino Acid Mean  Standard error 
L-Histidine 365 429 
Glycine 260 50.7 
L-Serine nd nd 
L-Cysteine nd nd 
L-Asparagine 2400 360 
DL-Alpha-Alanine 2490 296 
Glutamine  nd nd 
L-Lysine nd nd 
L-Aspartic 791 71.4 
B-Threonine nd nd 
L-Threonine nd nd 
L-Valine 831 85.7 
D-Proline 957 131 
L-Methionine 293 16.9 
Iso-Leucine 841 15.1 
Trans-4-Hydroxy-L-Proline 856 13.9 
L-Tyrosine 6350 933 
DL-Beta-Phenyl-Alanine 29840 10040 
L-Tryptophan 64600 8700 
 
 
                
38 
 
University of Ghana http://ugspace.ug.edu.gh
               Table 5b: Means and their standard errors for amino acids of cowpea genotypes                
             across source of collection. 
 
 Source of collection  
 DPEB (x10-8) SARI (x10-8)  
Amino Acid Mean  se Mean se t-test 
L-Histidine 3190 456 4320 813 0.901 
Glycine 260 51 nd nd 0.901 
L-Serine nd nd nd nd  
L-Cysteine nd nd nd nd  
L-Asparagine 2890 467 1280 342 0.018 
DL-Alpha-Alanine 2880 404 1750 326 0.035 
Glutamine  nd nd nd nd  
L-Lysine nd nd nd nd  
L-Aspartic 941 77.6 495 122 0.001 
B-Threonine nd nd nd nd  
L-Threonine nd nd nd nd  
L-Valine 822 115 840 129 0.543 
D-Proline 848 105 1150 309 0.865 
L-Methionine 333 24.7 231 12.3 0.001 
Iso-Leucine 805 8.08 893 32.6 0.999 
Trans-4-Hydroxy-L- 823 7.37 907 30.6 0.999 
Proline 
L-Tyrosine 6510 11.30 5810 1580 0.176 
DL-Beta-PhenylAlanine 23880 7400 34660 17270 0.701 
L-Tryptophan 58610 14880 70070 973 0.742 
 
39 
 
University of Ghana http://ugspace.ug.edu.gh
L-Aspartic acid: L-Aspartic acid was detected in 77.3% of the accessions. The mean 
concentration value among accessions was 791.0 x 10-8 ppm. Concentration values ranged 
between 9.3 x 10-8 ppm (accession Apagbaala) and 1800.0 x 10-8 ppm (accession COLMUT10-
01). Mean concentration for accessions from DPEB was (941.0+77.6) x 10-8 ppm; concentration 
values ranged from 57.0 x 10-8 ppm to 1800.0 x 10-8 ppm. Mean concentration for SARI 
accessions was (495.0+112.0) x 10-8 ppm; the concentration values ranged from 9.30 x 10-8 ppm 
to 1700.0 x 10-8 ppm. The two collection sources showed highly significant difference in mean 
concentration values for L-Aspartic acid (P= 0.001). 
L-Valine: L-Valine was below detection in 7.6% of the accessions. Population mean was 
(831.0+85.7) x 10-8 ppm, concentration values ranged from 65.00 x 10-8 ppm (accession 422) to 
2900.0 x 10-8 ppm (accession F2RG012). Mean concentration value of (822.0+115.0) x 10-8 ppm 
was recorded for DPEB accessions and values ranged from 65.00 x 10-8 ppm to 2900.0 x 10-8 ppm. 
Concentration values for SARI accessions ranged between 170.0 x 10-8 ppm to 2900.0 x 10-8 ppm 
with a mean of (840.0+120.0) x 10-8 ppm. The two collection sources did not differ in mean 
concentration of L-Valine (P = 0.543). 
L-Proline: L-Proline was detected in 84.8% of the accessions. Mean concentration for the 
population was 957.0+131.0) x 10-8 ppm for concentration values that ranged from 31.0 x 10-8 
ppm (accession IT98K-628) to 4800.0 x 10-8 ppm (accession SARVX-09-004). Mean 
concentration for DPEB accessions was (848.0+105.0) x 10-8 ppm for values that ranged from 68.0 
x 10-8 ppm to 2800.0 x 10-8 ppm. Mean concentration of (1150.0+309.0) x 10-8 ppm was scored 
for accessions from SARI for values that ranged from 31.0 x 10-8 ppm to 4800.0 x 10-8 ppm. The 
two collection sources did not differ in mean concentration of L-Proline (P = 0.865). 
40 
 
University of Ghana http://ugspace.ug.edu.gh
L-Methionine: L-Methionine was detected in all accessions. Concentration values for the 
population ranged from 180.0 x 10-8 ppm (accession 422) to 780.0 x 10-8 ppm (accession 
F2RG011) with a population mean of (293.0+16.9) x 10-8 ppm. Concentration values for 
accessions from DPEB ranged from 180.0 x 10-8 ppm to 780.0 x 10-8 ppm with mean value of 
(333.0+24.7) x 10-8 ppm. Mean concentration for accessions from SARI was (231.0+12.3) x 10-8 
ppm for concentration values that ranged from 180.0 x 10-8 ppm to 4400.0 x 10-8 ppm. The 
collection sources were highly significantly different in mean concentration of L-Methionine (P = 
0.001). 
Iso-Leucine: Iso-Leucine was detected in all accessions. Concentration values ranged from 760.0 
x 10-8 ppm (AGRAC-21) to 1400.0 x 10-8 ppm (accession IT07K-298-45) with a population mean 
of (841.0+15.1) x 10-8 ppm. A mean value of (805.0+8.08) x 10-8 ppm was scored for DPEB 
accessions for concentration values that ranged from 760.0 x 10-8 ppm to 1000.0 x 10-8 ppm. SARI 
accessions had a mean concentration value of (893.0+32.6) x 10-8 ppm. The concentration values 
ranged from 760.0 x 10-8 ppm to 1400.0 x 10-8 ppm. The two collection sources did not differ in 
mean Iso-Leucine concentration (P = 0.999). 
Trans-4-Hydroxy-L-Proline:  Trans-4-Hydroxy-L-Proline was detected in all accessions. 
Concentration values for the accessions ranged from 780.0 x 10-8 ppm (accession BELEDI) to 
1400.0 x 10-8 ppm (accession IT07K-298-45) with a population mean of (856.0+13.9) x 10-8 ppm. 
Mean concentration for DPEB accessions was (823.0+7.37) x 10-8 ppm, concentration values 
ranged from 780.0 x 10-8 ppm and 1000.0 x 10-8 ppm. Mean concentration for SARI accessions 
was (907.0+30.6) x 10-8 ppm with concentration values ranging from 780.0 x 10-8 ppm to 1400.0 
x 10-8 ppm. The two collection sources did not differ in concentration values for Trans-4-Hydroxy-
L-Proline (P = 0.999). 
41 
 
University of Ghana http://ugspace.ug.edu.gh
L-Tyrosine: L-Tyrosine was detected in 71.2% of the accessions. Concentration values ranged 
between 21.0 x 10-8 ppm (accession SARI-6-2-6) and 28700.0 x 10-8 ppm (accession G80) with a 
mean of (6350.0+933.0) x 10-8 ppm. Mean concentration for DPEB accession was (6510.0+11.30) 
x 10-8 ppm for concentration values that ranged between 200.0 x 10-8 ppm and 28700.0 x 10-8 ppm. 
Mean concentration for SARI accessions was 5810.0+1580.0) x 10-8 ppm for concentration values 
that ranged from 21.0 x 10-8 ppm to 14500.0 x 10-8 ppm. The two collection sources did not differ 
in mean concentration values for L-Tyrosine (P = 0.701). 
DL-Beta-Phenyl-Alanine: DL-Beta-Phenyl-Alanine was below detection in 25.8% of the 
accessions studied. Concentration values for the accessions ranged between 2000.0 x 10-8 ppm 
(accession SARI-3-11-88) and 456600.0 x 10-8 ppm (accession SARI-6-299) with a population 
mean of (29840.0 +10040) x 10-8 ppm. Concentration values for DPEB accessions ranged from 
1600.0 x 10-8 ppm to 152200.0 x 10-8 ppm with a mean value of (23880.0+7400.0) x 10-8 ppm. 
Mean concentration of DL-Beta-Phenyl-Alanine for SARI accessions was (34660.0+17270.0) x 
10-8 ppm. Concentration values ranged between 2000.0 x 10-8 ppm and 456600.0 x 10-8 ppm. The 
two collecting sources did not differ in mean concentration of DL-Beta-Phenyl-Alanine (P = 
0.701).  
L-Tryptophan: L-Tryptophan was below detection in 24.0% of the accessions. Population mean 
concentration was (646400.0+8700) x 10-8 ppm for concentration values that ranged between 
8300.0 x 10-8 ppm (accession 442) and 376900.0 x 10-8 ppm (accession F2RG012). Mean 
concentration for accessions from DPEB was (58610.0+14880.0) x 10-8 ppm; concentration values 
ranged from 8300.0 x 10-8 ppm to 376900.0 x 10-8 ppm. Accessions from SARI had mean 
concentration value of (70070.0+0.742) x 10-8 ppm for values that ranged between 12000.0 x 10-8 
42 
 
University of Ghana http://ugspace.ug.edu.gh
ppm and 227100.0 x 10-8 ppm.  The two collecting sources did not differ in mean concentration of 
L-Tryptophan (P = 0.742).  
The following amino acids were below detection for all the accessions: B-Threonine, 
Glutamine, L-Threonine, L-Lysine, L-Serine and L-Cysteine. 
 
4.3 Distribution of mean concentrations of phytochemicals across morphological traits 
4.3.1 Phenolic compounds 
 
Mean concentrations of phenolic compounds in each of the morphological traits are presented in 
Table 6. 
Gallic Acids: Gallic acid was detected in all the 12 morphological traits analyzed.  
Growth habit: accessions with prostrate growth habit scored the lowest mean concentration of 
14.3+0.00 mg/l, while the semi-prostrate accessions scored the highest concentration of 
497.7+482.9 mg/l.  
Main pod pigmentation: accessions with uniformly pigmented main pod pigmentation had the 
lowest mean concentration of 26.0+0.00 mg/l, however those with no pigment had the highest 
mean concentration of 65.5+27.9 mg/l.  
Pod colour: among the different classes, accessions in the dark mottled class scored the lowest 
mean concentration of 8.5+0.00 mg/l, while those with purple pod colour scored the highest mean 
concentration of 253.6+180.9 mg/l. 
43 
 
University of Ghana http://ugspace.ug.edu.gh
Seedcoat colour: among the classes of seed coat colour, gallic acid mean concentration ranged 
from 10.2+0.00 mg/l for accessions with dark white seed coat colour to 306.0+289.4 mg/l for those 
with brown mottled seed coat colour.  
Seedcoat pattern: mean concentration for seed coat pattern ranged between 8.5+0.00 mg/l, for 
accessions with golden eye seed coat pattern, and 99.0+46.6 mg/l for accessions with solid seed 
coat pattern.  
Leaf colour: among the leaf colour classes accessions with pale green leaf colour scored the lowest 
mean gallic concentration of 19.8+3.0 mg/l, while those with intermediate scored the highest mean 
concentration of 70.0+28.4 mg/l. 
Plant pigmentation: mean gallic acid concentration ranged between 16.02+1.6 mg/l for accessions 
with non-plant pigmentation and 85.3+53.4 mg/l for accessions with moderate base tip petiole 
plant pigmentation.  
Immature pod tip colour: the non-pigmented accessions scored a concentration mean value of 
37.0+7.4 mg/l while the pigmented accessions scored the highest mean concentration of 99.9+59.4 
mg/l. 
V-marking: mean gallic acid concentration for v-marking trait ranged from 27.0+3.4 mg/l for the 
absent accessions to 155.9+97.8 mg/l for the present accessions.   
Raceme position: mean gallic acid concentration ranged from 15.7+1.5 mg/l for the mostly above 
canopy accessions to 136.4+69.7 mg/l for the below upper canopy accessions.  
44 
 
University of Ghana http://ugspace.ug.edu.gh
Terminal leaflet shape: cowpea accessions with hastate terminal leaflet shape scored the lowest 
mean gallic acid concentration of 23.7+3.7 mg/l, while accessions with globose terminal leaflet 
shape scored the highest mean concentration of 117.1+68.3 mg/l. 
Flower bud tip colour: Mean gallic acid concentration for flower bud tip ranged from 34.7+6.9 
mg/l for accessions with non-pigmented to 103.9+61.8 mg/l for those with pigmented flower bud 
tip. 
Syringic Acid: Syringic acid was detected at all levels of the 12 morphological traits.  
Growth habit: syringic acid mean concentration ranged from 76.6+0.00 mg/l for cowpea 
accessions with prostrate to 314.7+240.34 mg/l for those with semi-prostrate.  
Main pod pigmentation: the uniformly pigmented accessions scored the lowest mean concentration 
of 85.9+0.00 mg/l while no pigment accessions scored the highest of 107.1+14.64 mg/l. 
Pod colour: mean concentration values for pod colour ranged from 68.4+0.00 mg/l for cowpea 
accessions with dark mottled to 208.0+92.77 mg/l for accessions with purple po dcolour.   
Seedcoat colour: cowpea accessions with dark mottled seedcoat colour scored the lowest mean 
syringic acid concentration value of 73.4+0.00 mg/l, while those with brown mottled seedcoat 
colour scored the highest of 220.2+143.80 mg/l. 
Seedcoat pattern: the lowest mean syringic acid concentration was scored by accessions with 
golden eye seedcoat pattern, while the highest mean concentration of 126.2+24.28 mg/l was scored 
by those with solid seedcoat pattern.  
Leaf colour: mean syringic acid concentrations ranged between 81.6+1.85 mg/l for cowpea 
accessions with pale green and 109.6+14.89 mg/l for accessions with intermediate green Plant 
45 
 
University of Ghana http://ugspace.ug.edu.gh
pigmentation: mean syringic acid concentration ranged between 75.3+2.06 mg/l for accessions 
with non-plant pigmentation and 115.0+26.49 mg/l for accessions with moderate base tip petiole 
plant pigmentation.  
Immature pod tip colour: non-pigmented cowpea accessions scored the lowest mean syringic acid 
concentration value of 92.9+5.45 mg/l, while pigmented accessions scored the highest of 
124.3+30.77 mg/l. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
46 
 
University of Ghana http://ugspace.ug.edu.gh
Table 6:  Means and their standard errors of polyphenols of cowpea genotypes across 
morphological traits. 
  Mean (se) ppm 
Trait Class Gallic acid Syringic Quercetin  Vanillic 
acid acid 
Growth Habit Erect 39.1 (6.59) 92.7 (4.53) 68.3 (2.94) 39.6 (5.18) 
 Prostrate 14.3 (0.00) 76.6 (0.00) 53.8 (0.00) 21.1 (0.00) 
 Semi-erect  45.4 (23.09) 99.5 73.5 (4.88) 47.3 
(17.03) (19.47) 
 Semi-prostrate 497.7 314.7 70.5 (1.67) 293.3 
(482.93) (240.34) (274.68) 
Main pod      
pigmentation No pigment 65.5 (27.92) 107.1 69.4 (2.64) 56.0 
(14.64) (16.74) 
 Splashes of 33.5 (10.61) 89.4 (7.05) 69.8 (7.03) 35.8 (8.06) 
pigments 
 Uniformly 26.0 (0.00) 85.9 (0.00) 47.2 (0.00) 31.9 (0.00) 
pigmented  
 
Pod colour Brown 22.5 (4.02) 81.7 (2.69) 66.8 (3.45) 27.0 (3.08) 
 Buff  46.5 (15.20) 102.0 67.4 (6.05) 50.2 
(11.30) (12.91) 
 Dark brown 11.8 (0.00) 72.2 (0.00) 80.5 (0.00) 16.1 (0.00) 
 Dark mottled 8.5 (0.00) 68.4 (0.00) 72.2 (0.00) 11.9 (0.00) 
 Dark purple 38.5 (0.00) 90.9 (0.00) 72.2 (0.00) 37.6 (0.00) 
 Flesh 19.3 (0.00) 82.2 (0.00) 67.2 (0.00) 27.6 (0.00) 
 Light brown 51.9 (12.81) 98.8 (7.90) 71.8 (4.63) 46.4 (9.04) 
 Purple 253.6 208.0 76.7 171.4 
(180.88) (92.77) (11.12) (106.03) 
 
Seedcoat colour Black 85.6 (72.90) 108.8 101.3 58.0 
(35.95) (17.50) (41.05) 
 Black mottled 14.3 (0.00) 73.4 (0.00) 67.2 (0.00) 17.6 (0.00) 
 Brick red 27.3 (8.75) 93.2 65.5 40.1 (13.2) 
(11.55) (11.70) 
 Brown 49.4 (14.63) 100.2 63.6 (5.40) 48.1 
(10.45) (11.96) 
 Brown mottled 306.0 220.2 77.9 105.3 
(289.38) (143.80) (11.50) (164.35) 
 Cream 26.1 (4.04) 84.2 (2.67) 67.1 (3.06) 29.8 (3.05) 
 Dark mottled 66.3 (31.27) 115.1 83.0 (9.54) 65.2 
(23.95) (27.37) 
 Dirty white 10.2 (0.00) 74.1 (0.00) 60.5 (0.00) 18.3 (0.00) 
 Flesh 19.3 (0.00) 82.2 (0.00) 67.2 (0.00) 27.6 (0.00) 
 Red 109.2 145.2 60.5 (7.30) 99.6 
(85.34) (63.37) (72.43) 
47 
 
University of Ghana http://ugspace.ug.edu.gh
Table 6 cont’d 
                                                     Mean (se) ppm 
Trait Class Gallic acid Syringic Quercetin Vanillic 
acid acid 
Seedcoat pattern Black eye 22.0 (2.34) 79.5 (1.73) 66.05 (7.81) 24.5 (1.99) 
 Black holstein 20.2 (0.00) 75.9 (0.00) 60.5 (0.00) 20.4 (0.00) 
 Brown eye 13.1 (2.9) 75.0 (0.9) 62.2 (1.65) 19.35 (1.05) 
 Golden eye 8.5 (0.00) 69.7 (0.00) 77.2 (0.00) 13.3 (0.00) 
 Small black eye 22.8 (6.07) 83.5 (3.71) 62.2 (5.32) 29.1 (4.25) 
 Small brown eye 38.6 (11.22) 92.3 (7.49) 73.5 (6.01) 39.2 (8.56) 
Leaf colour Dark green 24.8 (7.47) 82.7 (5.16) 61.1 (5.15) 28.1 (5.90) 
 Intermediate 70.0 (28.44) 109. 6 70.8 (2.63) 58.9 (17.02) 
green (14.89) 
 Pale green 19.8 (2.95) 81.6 (1.85) 84.7 (10.85) 26.9 (2.15) 
Plant Moderate base 85.3 (53.36) 115.0 71.5 (4.56) 65.1 (30.28) 
pigmentation tip petiole (26.49) 
 None  16.02 (1.56) 75.3 (2.06) 58.9 (3.26) 19.7 (2.37) 
 Very slight 47.3 (13.86) 99.28 69.3 (2.59) 47.1 (11.55) 
(10.11) 
Immature pod tip      
colour Non-pigmented 37.0 (7.35) 92.9 (5.45) 67.2 (4.30) 75.7 (35.16) 
 pigmented 99.9 (59.42) 124.3 67.2 (4.30) 75.7 (35.16) 
(30.77)  
V-markings Absent 27.0 (3.41) 85.2 (2.31) 67.1 (2.41) 31.00 (2.64) 
 Present 155.9 (97.84) 155.8 76.5 (6.14) 111.7 
(50.54) (57.77) 
      
Raceme position Below upper 136.4 (69.66) 145.8 77.34 (3.86) 100.3 
canopy (35.95) (41.09) 
 In upper canopy 31.5 (7.17) 88.2 (5.50) 68.0 (3.88) 34.47 (6.28) 
 Mostly above 15.7 (1.58) 79.4 (1.06) 60.8 (3.28) 24.3 (1.20) 
canopy 
Terminal leaflet      
shape Globose 117.1 (68.32) 132.9 73.8 (3.62) 85.5 (38.97) 
(34.09) 
 Hastate 23.7 (3.74) 83.3 (4.78) 58.8 (4.68) 28.8 (5.47) 
 Sub-globose 36.8 (14.77) 92.5 (10.86) 68.3 (3.88) 39.3 (12.42) 
 Sub-hastate 40.0 (14.16) 94.9 (9.52) 69.3 (7.98) 42.2 (10.88) 
      
Flower bud tip Non-pigmented 34.7 (6.87) 91.2 (5.08) 69.7 (3.07) 37.9 (5.81) 
 Pigmented 103.9 (61.82) 126.5 68.6 (4.22) 78.2 (36.57) 
(32.00)  
 
      
      
48 
 
University of Ghana http://ugspace.ug.edu.gh
V-marking: cowpea accessions with absent v-marking scored the lowest mean syringic acid 
concentration of 85.2+2.31 mg/l, while the highest mean concentration of 155.8+50.54 mg/l was 
scored by accessions with present v-marking. 
Raceme position: mean syringic acid concentration ranged from 79.4+1.05 mg/l for cowpea 
accessions with mostly above canopy to 145.8+35.95 mg/l for accessions with below upper 
canopy.  
Terminal leaflet shape: the cowpea accessions with hastate terminal leaflet shape scored the 
lowest mean syringic acid concentration of 83.3+4.76 mg/l, while accessions with globose 
terminal leaflet shape scored the highest mean concentration of 132.9+34.08 mg/l. 
Flower bud tip colour: mean syringic acid concentration for flower bud tip ranged from 
91.2+5.08 mg/l for accessions with non-pigmented flower bud tip to 126.5+32.00 mg/l for 
accessions with pigmented flower bud tip. 
Quercetin: Quercetin was present in all the classes of the 12 morphological traits.  
Growth habit: mean concentration of quercetin from 53.8+0.00 mg/l for cowpea accessions with 
prostrate growth habit to 73.5+4.88 mg/l for accessions with semi-erect growth habit.  
Main pod pigmentation: accessions that were uniformly pigmented scored the lowest mean 
quercetin concentration of 47.2+0.00 mg/l, while accessions that had splashes of pigments scored 
the highest mean concentration of 69.8+7.03 mg/l.  
Pod colour: the brown pod coloured cowpea accessions scored the lowest mean quercetin 
concentration of 66.8+3.45 mg/l while the dark brown coloured accessions scored the highest the 
highest mean concentration of 80.5+0.00 mg/l.   
49 
 
University of Ghana http://ugspace.ug.edu.gh
Seedcoat colour: the lowest mean quercetin concentration of 60.5+7.81 mg/l was scored for 
cowpea accessions with red and dirty white seed coat colours, while the highest mean 
concentration of 101.3+17.50 mg/l was scored for accessions with black seed coat colour. 
Seedcoat pattern: cowpea accessions with black Holstein seedcoat pattern had the lowest mean 
quercetin concentration of 60.5+0.00 mg/l, while accessions with golden eye seedcoat pattern 
had the highest mean concentration of 77.2+0.00 mg/l. 
Leaf colour: mean quercetin concentrations ranged between 61.1+5.15 mg/l for dark green leaf 
coloured cowpea accessions and 84.7+10.5 mg/l for pale green leaf coloured accessions.  
Plant pigmentation: mean quercetin concentration ranged between 58.9+3.26 mg/l for cowpea 
accessions that had non-plant pigmentation and 71.5+4.56 mg/l for accessions that had moderate 
base tip petiole plant pigmentation.  
 
Non-pigmented and pigmented cowpea accessions scored a mean concentration value of 
67.2+4.30 mg/l respectively. 
v-marking: mean quercetin concentration for v-marking trait ranged from 67.1+2.41 mg/l for 
cowpea accessions with absent v-marking to 76.5+6.14 mg/l for accessions with present v-
marking.   
Raceme position: cowpea accessions with mostly above canopy scored the lowest mean 
quercetin concentration of 60.8+3.28 mg/l, accessions with below upper canopy scored the 
highest mean concentration of 77.34+3.56 mg/l. 
50 
 
University of Ghana http://ugspace.ug.edu.gh
Terminal leaflet shape: mean quercetin concentration ranged between 58.8+4.68 mg/l for cowpea 
accessions that had hastate terminal leaflet shape and 73.8+3.62 mg/l for the accessions with 
globose terminal leaflet shape. 
Flower bud tip colour: non-pigmented flower bud tip coloured cowpea accessions scored the 
lowest mean concentration of 68.6+4.22 mg/l, while pigmented flower bud tip coloured 
accessions scored the highest of 69.7+3.07 mg/l.  
Vanillic acid: Vanillic acid was detected in all classes of the 12 morphological traits.  
Growth habit: mean vanillic acid concentration ranged from 21.1+0.00 mg/l for cowpea 
accessions with prostrate growth habit to 293.3+274.68 mg/l for accessions with semi-prostrate 
growth habit. 
Main pod pigmentation: cowpea accessions that had uniformly pigmented main pod 
pigmentation scored the lowest mean vanillic acid concentration of 31.9+0.00 mg/l, while 
accessions with no pigment main pod pigmentation scored the highest mean concentration of 
56.0+16.74 mg/l. 
Pod colour: dark mottled pod coloured cowpea accessions scored the lowest vallinic acid 
concentration of 11.9+0.00 mg/l, while purple pod coloured accessions scored the highest mean 
concentration of 171.4+106.03 mg/l. 
Seedcoat colour: black mottled seedcoat coloured accessions scored the lowest mean 
concentration of 17.6+0.00 mg/l, while brown mottled seedcoat coloured accessions scored the 
highest concentration of 105.3+164.35. 
51 
 
University of Ghana http://ugspace.ug.edu.gh
Seedcoat pattern: mean concentration for seed coat pattern ranged between 13.3+0.00 mg/l for 
cowpea accessions that had golden eye seed coat pattern to 77.9+27.73 mg/l for the accession 
which had solid seedcoat pattern.  
Leaf colour: the lowest mean vanillic acid mean concentration 26.9+2.15 mg/l which was scored 
for accessions with pale green leaf colour, while accessions with intermediate leaf colour scored 
the highest of mean concentration of 58.9+17.02 mg/l. 
Plant pigmentation: vanillic acid mean concentration in plant pigmentation ranged from 
19.7+2.37 mg/l which was scored for accessions with non-plant pigmentation to 65.1+30.28 mg/l 
which was also scored for accessions that had moderate base tip petiole plant pigmentation.  
Immature pod tip colour: both non-pigmented accessions and pigmented accessions scored a 
mean concentration value of 75.7+35.16 mg/l each. 
V-marking: absent v-marking cowpea accessions scored the lowest mean vanillic acid 
concentration of 31.0+2.64 mg/l, while the highest mean concentration was scored for present v-
marking accessions. 
Raceme position: cowpea accessions which had mostly above canopy raceme position scored the 
lowest mean vanillic acid concentration of 24.3+1.20 mg/l, while accessions with mostly above 
canopy scored the highest mean concentration of 100.3+41.09 mg/l. 
Terminal leaflet shape: mean vanillic acid concentration ranged between 28.8+5.47 mg/l which 
was scored for accessions with hastate terminal leaflet shape and 42.2+10.88 mg/l which was 
aslo scored for accessions with sub-hastate terminal leaflet shape.  
52 
 
University of Ghana http://ugspace.ug.edu.gh
Flower bud tip pigment: accessions with non-pigmented bud tip scored the lowest mean 
concentration of 37.9+5.81 mg/l, while accessions which had pigmented flower bud tip scored 
the highest mean concentration of 78.2+36.57 mg/l.  
 
4.3.2 Crude protein and mineral elements  
 
Mean concentrations of percent crude protein and mineral elements in each of the classes of 
morphological traits are presented in Table 7. 
Calcium: Calcium was detected in all the classes of the 12 morphological traits.  
Growth habit: The lowest mean calcium concentration of 0.1 ppm was scored for accessions 
which had erect, prostrate and semi-erect growth habits, accessions which had semi-prostrate 
growth habit scored the highest mean concentration of 28.8+28.7 ppm.  
Main pod pigmentation: the lowest mean concentration score of 0.01 ppm was scored for 
accessions which had splashes of pigment and uniformly pigmented, whilst no pigmented 
accessions scored the highest mean concentration of 2.0+1.87. 
Pod colour: The lowest mean concentration of 0.1 ppm was scored for accessions that belonged 
to seven out of the eight classes, while the highest mean concentration of 14.4+14.35 ppm was 
scored by accessions which had purple pod colour.  
Seedcoat colour: Calcium mean concentration ranged from 0.1 ppm which was scored for 
accessions that belonged to six classes to 17.3+17.22 ppm which was scored for accessions 
which had brown mottled seedcoat colour.  
53 
 
University of Ghana http://ugspace.ug.edu.gh
Seedcoat pattern: mean concentration ranged from 0.1 ppm which was scored for accessions that 
belonged to for five classes to 3.3+3.312 ppm which was scored by accessions which had solid 
seed coat pattern.  
Leaf colour: accessions which had dark green leaf colour scored the lowest calcium mean 
concentration 0.1+0.005 ppm, while accessions with intermediate green leaf colour scored the 
highest concentration of 1.9+1.794 ppm. 
Plant pigmentation: the lowest mean concentration of 0.1 ppm was scored for accessions which 
belonged to two different classes, while the highest mean concentration of 3.6+3.443 ppm was 
scored for accessions which had moderate base tip petiole. 
Immature pod tip colour: Mean concentrations for the two classes of immature pod tip colour 
were 0.1+0.004 ppm which was scored for accessions which had non-pigmented immature pod 
tip colour and 4.0+3.913 ppm which was also scored for accessions which had pigmented 
immature pod tip colour.  
V-marking: mean concentrations for the two classes were 0.1+0.005 ppm which was scored for 
accessions with absent v-marking and 7.3+7.176 ppm which was also scored for accessions 
which had present v-markings.  
Raceme position: Mean concentrations for each of the three raceme position classes ranged 
between 0.1 ppm which was scored for accessions that belonged to two classes, while 4.9+4.8 
ppm was scored for accessions which had below upper canopy. 
Terminal leaflet shape:  highest mean concentration of 4.6+4.53 was scored by accessions which 
had globose terminal leaflet shape.  
54 
 
University of Ghana http://ugspace.ug.edu.gh
Flower bud tip pigment: mean concentrations for the flower bud tip classes were 0.1+0.005 ppm 
which was scored for accessions which had non-pigmented flower bud tip and 4.2+4.1 ppm 
which was also s cored for accessions which had pigmented flower bud tip.  
Sodium: Mean sodium concentration for growth habit ranged from 0.0004+0.00 ppm which was 
scored for accessions which were prostrate to 0.004 ppm which was also scored for accessions 
that belonged to each of the remaining three classes.  
Pod pigmentation: Mean concentration for main pod pigmentation ranged from 0.1 ppm to 
2.0+1.87 ppm (no pigment main pod pigmentation).  
Pod colour: Sodium was beyond detection in four classes. Accessions with light brown pod 
colour had the highest mean concentration of 0.1+0.001 ppm.  
Seedcoat colour: Sodium was not detected in five classes. The highest mean concentration of  
0.05+0.00 ppm was scored for accessions with cream seed coat colour.  
Seedcoat pattern: Mean concentration for seedcoat pattern ranged from 0.001 ppm to 
0.005+0.001 ppm which was scored for accessions which had small black eye seed coat pattern.  
Leaf colour: accessions with intermediate green leaf colour scored the lowest mean 
concentration of 0.003+0.001 ppm, while the highest concentration of 0.01+0.005 ppm was 
scored for accessions which had pale green leaf colour.  
Plant pigmentation: mean sodium concentration for plant pigmentation ranged from 0.003+0.001 
ppm which was scored for accessions which had moderate base tip petiole to 0.01+0.00 ppm 
which was also scored for accessions with none plant pigmentation. 
55 
 
University of Ghana http://ugspace.ug.edu.gh
Immature pod tip colour: mean concentrations for the two classes of immature pod tip colour 
were 0.003+0.001 which was scored for accessions with pigmented immature pod tip colour and 
0.004+0.001 ppm which was also scored for accessions with non-pigmented immature pod tip 
colour. 
Mean concentrations for the two classes of v-marking were 0.004+0.001 ppm which was scored 
for accessions with present v-marking and 0.001 ppm which was also scored for accessions with 
absent v-marking. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
56 
 
University of Ghana http://ugspace.ug.edu.gh
Table 7: Means and their standard errors of mineral elements of cowpea genotypes according to 
morphological traits 
                                                              Mean (se) ppm 
Trait Class Ca Na K Mg 
Growth Habit Erect 0.1 (0.004) 0.004 (0.001) 10.5 (0.34) 0.3 (0.009) 
 Prostrate 0.1 (0.00) 0.0004 (0.00) 8.0 (0.00) 0.2 (0.00) 
 Semi-erect  0.1 (0.01) 0.004 (0.001) 10.1 (0.49) 0.3 (0.02) 
 Semi-prostrate 28.8 (28.70) 0.001 (0.001) 10.4 (0.19) 0.3 (0.01) 
Main pod No pigment 2.0 (1.87) 0.004 (0.002) 10.4 (0.25) 0.3 (0.01) 
pigmentation 
 Splashes of 0.1 (0.01) 0.01 (0.001) 11.1 (1.24) 0.3 (0.03) 
pigments 
 Uniformly 0.1 (0.00) 0.003 (0.00) 10.9 (0.00) 0.3 (0.00) 
pigmented 
Pod colour Brown 0.1 (0.01) 0.005 (0.001) 11.0 (0.45) 0.3 (0.13) 
 Buff  0.1 (0.01) 0.003 (0.001) 10.1 (0.58) 0.3 (0.02) 
 Dark brown 0.1 (0.00) 0.001 (0.00) 10.1 (0.00) 0.3 (0.00) 
 Dark mottled 0.1 (0.00) 0.00 (0.00) 10.5 (0.00) 0.3 (0.00) 
 Dark purple 0.1 (0.00) 0.00 (0.00) 10.8 (0.00) 0.3 (0.00) 
 Flesh 0.1 (0.00) 0.00 (0.00) 10.8 (0.00) 0.3 (0.00) 
 Light brown 0.1 (0.01) 0.01 (0.001) 9.4 (0.64) 0.29 (0.02) 
 Purple 14.4 (14.35) 0.001 (0.00) 9.7 (0.21) 0.3 (0.01) 
Seedcoat Black 0.1 (0.00) 0.00 (0.00) 9.9 (0.00) 0.3 (0.00) 
colour 
 Black mottled 0.1 (0.00) 0.00 (0.00) 10.1 (0.00) 0.2 (0.00) 
 Brick red 0.1 (0.02) 0.00 (0.00) 10.9 (0.21) 0.3 (0.02) 
 Brown 0.1 (0.01) 0.003 (0.02) 10.4 (1.0) 0.3 (0.02) 
 Brown mottled 17.3 (17.22) 0.002 (0.001) 10.0 (0.25) 0.3 (0.23) 
 Cream 0.1 (0.01) 0.05 (0.00) 10.7 (0.42) 0.29 (0.01) 
 Dark mottled 0.09 (0.01) 0.00 (0.00) 8.5 (0.32) 0.24 (0.01) 
 Dirty white 0.1 (0.00) 0.001 (0.00) 9.3 (0.00) 0.3 (0.00) 
 Flesh 0.08 (0.00) 0.00 (0.00) 10.8 (0.00) 0.3 (0.00) 
 Red 0.09 (0.02) 0.002 (0.001) 9.8 (0.34) 0.3 (0.02) 
Seedcoat Black eye 0.1 (0.02) 0.004 (0.001) 11.3 (0.39) 0.3 (0.024) 
pattern 
 Black holstein 0.1 (0.000) 0.001 (0.00) 10.4 (0.00) 0.3 (0.00) 
 Brown eye 0.1 (0.001) 0.001 (0.001) 7.7 (1.65) 0.3 (0.02) 
 Golden eye 0.1 (0.00) 0.001 (0.00) 9.62 (0.00) 0.3 (0.00) 
 Small black 0.1 (0.007) 0.005 (0.001) 11.3 (0.650) 0.3 (0.023) 
eye 
 Small brown 0.1 (0.014) 0.004 (0.001) 9.8 (0.634) 0.3 (0.027) 
eye 
 Solid 3.4 (3.312) 0.003 (0.001) 10.2 (0.379) 0.3 (0.009) 
 
 
 
57 
 
University of Ghana http://ugspace.ug.edu.gh
Table 7 cont’d 
                                                     Mean (se) ppm 
Trait Class Ca Na K Mg 
Leaf colour Dark green 0.1 (0.005) 0.005 (0.001) 10.8 (0.435) 0.3 (0.029) 
 Intermediate 1.9 (1.794) 0.003 (0.001) 10.3 (0.303) 0.3 (0.008) 
green 
 Pale green 0.2 (0.023) 0.01 (0.005) 10.5 (0.865) 0.3 (0.102) 
Plant Moderate base 3.6 (3.443) 0.003 (0.001) 10.3 (0.368) 0.3 (0.012) 
pigmentation tip petiole 
 None  0.1 (0.00) 0.01 (0.00) 9.6 (0.00) 0.2 (0.00) 
 Very slight 0.1 (0.006) 0.004 (0.001) 10.5 (0.374) 0.3 (0.010) 
Immature pod Non-pigmented 0.1 (0.004) 0.004 (0.001) 10.6 (0.011) 0.3 (0.011) 
tip colour 
 Pigmented 4.0 (3.913) 0.003 (0.001) 10.4 (0.424) 0.3 (0.012) 
V-markings Absent 0.1 (0.005) 0.004 (0.001) 10.6 (0.324) 0.3 (0.010) 
 Present 7.3 (7.176) 0.001 (0.00) 9.6 (0.23) 0.3 (0.008) 
Raceme Below upper 4.9 (4.8( 0.001 (0.00) 9.8 (0.27) 0.3 (0.007) 
position canopy 
 In upper canopy 0.1 (0.007)  0.004 (0.001) 10.5 (0.34) 0.3 (0.01) 
 Mostly above 0.1 (0.007) 0.006 (0.002) 11.4 (0.71) 0.3 (0.02) 
canopy 
Terminal Globose 4.6 (4.53) 0.002 (0.00) 10.2 (0.29) 0.3 (0.12) 
leaflet shape 
 Hastate 0.1 (0.02) 0.01 (0.001) 11.6 (0.58) 0.3 (0.02) 
 Sub-globose 0.1 (0.006) 0.004 (0.001) 10.5 (0.46) 0.3 (0.01) 
 Sub-hastate 0.1 (0.005) 0.004 (0.001) 10.4 (0.83) 0.3 (0.029) 
Flower bud tip Non-pigmented 0.1 (0.005) 0.004 (0.00) 10.7 (0.38) 0.3 (0.01) 
 Pigmented 4.2 (4.10) 0.00 (0.00) 10.2 (0.33) 0.3 (0.01) 
 
 
 
 
 
 
 
 
 
 
58 
 
University of Ghana http://ugspace.ug.edu.gh
Table 7 cont’d 
                                                  Mean (se) ppm 
Trait Class Fe Ni Pb Cd 
Growth Erect 0.04 (0.005) 0.03 (0.002) 0.03 (0.007) 0.00 (0.00) 
Habit 
 Prostrate 0.04 (0.00) 0.03 (0.00) 0.05 (0.00) 0.00 (0.00) 
 Semi-erect  0.1 (0.01) 0.03 (0.00)  0.03 (0.004) 0.00 (0.00) 
 Semi-prostrate 0.01 (0.003) 0.06 (0.004) 0.1 (0.03) 0.00 (0.00) 
Main pod No pigment 0.04 (0.005) 0.03 (0.002) 0.4 (0.005) 0.00) (0.00) 
pigmentation 
 Splashes of 0.04 (0.004) 0.03 (0.006) 0.02 (0.005) 0.00 (0.00) 
pigments 
 Uniformly 0.1 (0.1 0.03 (0.00) nd nd 
pigmented 
Pod colour Brown 0.5 (0.01) 0.02 (0.00) 0.03 (0.005) 0.00 (0.00) 
 Buff  0.04 (0.01) 0.03 (0.002) 0.03 (0.006) 0.00 (0.00) 
 Dark brown 0.1 (0.00) 0.05 (0.00) 0.03 (0.00) nd 
 Dark mottled 0.1 (0.00) 0.07 (0.00) 0.2 (0.00) nd  
 Dark purple 0.1 (0.00) 0.05 (0.00) 0.04 (0.00) nd 
 Flesh 0.1 (0.00) 0.04 (0.00) 0.01 (0.00) nd 
 Light brown 0.05 (0.01) 0.04 (0.005) 0.1 (0.025) 0.00 (0.00) 
 Purple 0.1 (0.01) 0.05 (0.005) 0.04 (0.02) 0.00 (0.00) 
Seedcoat Black 0.1 (0.00) 0.05 (0.00) 0.07 (0.00) nd 
colour 
 Black mottled 0.04 (0.00) 0.04 (0.00) nd nd 
 Brick red 0.01 (0.004) 0.02 (0.01) 0.02 (0.01) nd 
 Brown 0.07 (0.01) 0.03 (0.01) 0.06 (0.03) 0.00 (0.00) 
 Brown mottled 0.05 (0.01) 0.05 (0.01) 0.1 (0.03) nd 
 Cream 0.05 (0.01) 0.03 (0.002) 0.03 (0.004) 0.00 (0.00) 
 Dark mottled 0.04 (0.02) 0.04 (0.009) 0.03 (0.01) 0.00 (0.00) 
 Dirty white 0.06 (0.00) 0.04 (0.00) 0.04 (0.00) nd 
 Flesh 0.06 (0.00) 0.04 (0.00) 0.1 (0.00) nd 
 Red 0.04 (0.01) 0.04 (0.004) 0.03 (0.002) nd 
Seedcoat Black eye 0.04 (0.018) 0.03 (0.002) 0.04 (0.10) 0.002 (0.00) 
pattern 
 Black holstein 0.001 (0.00) 0.02 (0.00) nd nd 
 Brown eye 0.04 (0.01) 0.03 (0.005) 0.04 (0.00) nd 
 Golden eye 0.1 (0.00) 0.04 (0.00) 0.06 (0.00) nd 
 Small black eye 0.1 (0.010) 0.03 (0.003) 0.03 (0.005) 0.001 (0.00) 
 Small brown eye 0.05 (0.009) 0.001 (0.00) 0.03 (0.006) 0.001(0.00) 
 Solid 0.1 (0.006) 0.04 (0.003) 0.05 (0.011) 0.0004 
(0.003) 
 
 
 
59 
 
University of Ghana http://ugspace.ug.edu.gh
Table 7 cont’d 
                                                         Mean (se) ppm 
Trait Class Fe Ni Pb Cd 
Leaf colour Dark green 0.1 (0.005) 0.005 10.8 (0.435) 0.3 (0.029) 
(0.001) 
 Intermediate 1.9 (1.794) 0.003 10.3 (0.303) 0.3 (0.008) 
green (0.001) 
 Pale green 0.2 (0.023) 0.01 (0.005) 10.5 (0.865) 0.3 (0.102) 
Plant Moderate base 0.05 (0.007) 0.03 (0.003) 0.03 (0.005) 0.001 
pigmentation tip petiole (0.002) 
 None  0.03 (0.00) 0.03 (0.00) nd nd 
 Very slight 0.05 (0.005) 0.03 (0.003) 0.05 (0.09) 0.001 
(0.0002) 
Immature Non-pigmented 0.05 (0.006) 0.03 (0.003) 0.03 (0.007) 0.001 
pod tip (0.0002) 
colour 
 Pigmented 0.05 (0.007) 0.03 (0.003) 0.03 (0.006) 0.001 
(0.0002) 
V-markings Absent 0.05 (0.005) 0.03 (0.002) 0.03 (0.006) 0.001 
(0.0002) 
 Present 0.5 (0.007) 0.05 (0.004) 0.05 (0.016) 0.00001 
(0.00002 
Raceme Below upper 0.05 (0.006) 0.05 (0.003) 0.05 (0.016) nd 
position canopy 
 In upper canopy 0.04 (0.006) 0.03 (0.002) 0.03 (0.005) 0.001 
(0.0002) 
 Mostly above 0.05 (0.01) 0.02 (0.002) 0.04 (0.004) 0.001 
canopy (0.0003) 
Terminal Globose 0.04 (0.006) 0.04 (0.003) 0.05 (0.01) 0.0003 
leaflet shape (0.0002) 
 Hastate 0.05 (0.02) 0.02 (0.005) 0.02 (0.005) 0.002 
(0.001) 
 Sub-globose 0.05 (0.006) 0.03 (0.004) 0.04 (0.008) 0.001 
(0.0002) 
 Sub-hastate 0.04 (0.02) 0.03 (0.004) 0.02 (0.00) 0.001 
(0.001) 
Flower bud Non-pigmented 0.05 (0.01) 0.03 (0.003) 0.03 (0.007) 0.001 
tip (0.0002) 
 Pigmented 0.05 (0.01) 0.04 0.03 (0.006) 0.001 
(0.0003) (0.0002) 
 
 
 
 
60 
 
University of Ghana http://ugspace.ug.edu.gh
Table 7 cont’d 
                                                                                           Mean (se) ppm 
Trait Class Mn Cr Zn CP 
Growth Habit Erect 0.02 (0.001) 0.003 (0.00) 0.003 (0.001) 13.7 (0.33) 
 Prostrate 0.02 (0.00) nd nd 17.0 (0.00) 
 Semi-erect  0.02 (0.001) 0.0003 (0.00) 0.004 (0.001) 13.6 (0.29) 
 Semi- 0.03 (0.00) nd nd 14.6 (1.6) 
prostrate 
Main pod No pigment 0.02 (0.00) 0.003 (0.00) 0.004 (0.001) 13.9 (0.29) 
pigmentation 
 Splashes of 0.01 (0.002) 0.003 (0.00) 0.004 (0.001) 13.4 (0.43) 
pigments 
 Uniformly 0.02 (0.00) nd nd 13.6 (0.00) 
pigmented 
Pod colour Brown 0.02 (0.001) nd 0.003 (0.001) 14.0 (0.41) 
 Buff  0.02 (0.001) nd 0.01 (0.003) 12.7 (0.50) 
 Dark brown 0.03 (0.00) nd nd 14.2 (0.00) 
 Dark mottled 0.03 (0.00) nd nd 15.6 (0.00) 
 Dark purple 0.03 (0.00) nd nd 16.8 (0.00) 
 Flesh 0.03 (0.00) nd nd 13.7 (0.00) 
 Light brown 0.02 (0.002) 0.002 (0.001) 0.004 (0.001) 13.7 (0.39) 
 Purple 0.02 (0.004) nd 0.004 (0.00) 114.0 (0.08) 
Seedcoat Black 0.03 (0.00) nd nd 13.9 (0.00) 
colour 
 Black mottled nd nd 0.002 (0.00) 13.0 (0.00) 
 Brick red 0.01 (0.00) nd 0.001 (0.00) 14.6 (1.05) 
 Brown 0.02 (0.003) 0.003 (0.00) 0.002 (0.001) 13.2 (0.58) 
 Brown 0.03 (0.001) Nd nd 13.8 (1.00) 
mottled 
 Cream 0.02 (0.001) 0.0003 (0.00) 0.004 (0.001) 13.6 (0.34) 
 Dark mottled 0.02 (0.004) nd 0.01 (0.00) 14.4 (0.88) 
 Dirty white 0.03 (0.00) nd nd 15.9 (0.00) 
 Flesh 0.03 (0.00) nd nd 13.7 (0.00) 
 Red 0.02 (0.005) nd 0.005 (0.00) 14.1 (1.37) 
Seedcoat Black eye 0.02 (0.001) nd 0.004 (0.00) 15.1 (0.59) 
pattern 
 Black holstein 0.02 (0.00) nd nd 15.8 (0.00) 
 Brown eye 0.03 (0.00) 0.0003 (0.00) 0.001 (0.00) 14.1 (1.8) 
 Golden eye 0.02 (0.00) nd nd 12.3 (0.00) 
 Small black 0.02 (0.002) nd 0.004 (0.001) 13.7 (0.59) 
eye 
 Small brown 0.02 (0.002) nd 0.002 (0.001) 13.0 (0.54) 
eye 
 Solid 0.02 (0.001) 0.003 (0.00) 0.004 (0.002) 13.7 (0.37) 
 
61 
 
University of Ghana http://ugspace.ug.edu.gh
Table 7cont’d 
                                                Mean (se) ppm 
Trait Class Mn Cr Zn CP 
Leaf colour Dark green 0.01 nd 0.004 (0.00) 13.9 (0.37) 
(0.001) 
 Intermediate 0.02 0.002 0.004 13.9 (0.28) 
green (0.001) (0.001) (0.001) 
 Pale green 0.02 nd nd 11.2 (0.66) 
(0.006) 
Plant pigmentation Moderate 0.02 0.002 0.004 13.5 (0.36) 
base tip (0.002) (0.001) (0.001) 
petiole 
 None  0.02 (0.00) nd nd 13.0 (0.00) 
 Very slight 0.02 nd 0.004 14.1 (0.34) 
(0.001) (0.002) 
Immature pod tip Non- 0.02 0.003 (0.00) 0.004 13.7 (0.33) 
colour pigmented (0.001) (0.002) 
 Pigmented 0.02 0.0003 0.004 14.0 (0.39) 
(0.001) (0.00) (0.001) 
V-markings Absent 0.02 0.0003 0.004 13.8 (0.30) 
(0.001) (0.00) (0.001) 
 Present 0.02 0.003 (0.00) 0.003 14.0 (0.54) 
(0.002) (0.001) 
Raceme position Below upper 0.02 0.003 (0.00) 0.004 13.9 (0.43) 
canopy (0.002) (0.0001) 
 In upper 0.02 0.0003 0.005 13.7 (0.32) 
canopy (0.001) (0.00) (0.002) 
 Mostly above 0.02 nd 0.003 13.9 (0.63) 
canopy (0.001) (0.0003) 
Terminal leaflet Globose 0.02 0.003 (0.00) 0.006 13.7 (0.44) 
shape (0.002) (0.003) 
 Hastate 0.02 nd 0.001 (0.00) 13.6 (0.70) 
(0.001) 
 Sub-globose 0.02 0.0003 0.004 13.8 (0.41) 
(0.001) (0.00) (0.001) 
 Sub-hastate 0.01 nd 0.004 14.5 (0.39) 
(0.001) (0.0003) 
Flower bud tip Non- 0.02 0.003 (0.00) 0.004 13.9 (0.33) 
pigmented (0.001) (0.002) 
 Pigmented 0.02 0.0003 0.004 13.9 (0.39) 
(0.002) (0.00) (0.001)  
 
62 
 
University of Ghana http://ugspace.ug.edu.gh
Raceme position: mean concentrations ranged between 0.001+0.00 ppm which was scored for 
accessions which had below upper canopy and 0.006+0.002 ppm which was also scored for 
accessions with mostly above canopy.  
Terminal leaflet shape: mean concentration ranged between 0.002+0.00 ppm which was scored for 
accessions with globose terminal leaflet shape and 0.01+0.001 ppm which was also scored for 
accessions with hastate terminal leaflet shape.  
Sodium was beyond detection limit in pigmented flower bud tip.  
Potassium: Potassium was present in all classes of the 12 morphological traits.  
Growth habit: mean potassium concentration ranged from 8.0+0.00 ppm which was scored for 
prostrate accessions to 10.5+0.34 ppm which was also scored for erect accessions. 
Main pod pigmentation: accessions with no pigment scored the lowest mean concentration of 
10.4+0.25 ppm. while accessions with splashes of pigments scored the highest of 11.1+1.24 ppm.  
Pod colour: mean concentration ranged from 9.4+0.64 ppm which was scored for light brown pod 
coloured accessions to 11.0+0.45 ppm which was also scored for brown pod coloured accessions. 
Seedcoat colour: dark mottled seedcoat coloured accessions scored the lowest mean concentration 
of 8.5+0.32 ppm, while the highest of 10.9+0.21 ppm was scored for brick red seed coat coloured 
accessions.  
Seedcoat pattern: accessions which had brown eye scored the lowest mean concentration of 
7.7+1.65 ppm, while accessions which had brown small black eye scored the highest mean 
concentration of 11.3+0.650 ppm. 
63 
 
University of Ghana http://ugspace.ug.edu.gh
Leaf colour: accessions which had intermediate green leaf colour scored the lowest mean 
concentration of 10.3+0.303 ppm, while accessions which had dark green leaf colour scored the 
highest mean concentration of 10.8+0.435 ppm.  
Plant pigmentation: accessions with no plant pigmentation scored the lowest mean potassium 
concentration of 9.6+0.00 ppm, while those with very slight plant pigmentation scored the highest 
concentration of 10.5+0.374 ppm. 
Immature pod tip colour:  Mean concentrations for the two classes of immature pod tip colour 
were 10.6+0.011 ppm which was scored for accessions which had non-pigmented immature pod 
tip and 10.4+0.424 ppm which was also scored for accessions with pigmented immature pod tip.  
V-marking: accessions which had absent v-marking scored mean concentration of 10.6+0.324 
ppm, while those which had present v-marking scored mean concentration of 9.6+0.23 ppm  
Raceme position: mean concentration ranged between 9.8+0.27 ppm which was scored for 
accessions with below upper canopy and 11.4+0.71 ppm which was also scored for those with 
mostly above canopy.  
Terminal leaflet shape: accessions which had sub-hastate terminal leaflet shape scored the lowest 
mean concentration of 10.4+0.83 ppm, while those with hastate scored 11.6+0.58 ppm. 
Flower bud tip pigment: mean concentrations for the two flower bud tip classes were 10.7+0.38 
ppm which was scored for accessions with non-pigmented flower bud tip and 10.2+0.33 ppm 
which was also scored for those with pigmented flower bud tip.  
Magnesium: Magnesium was detected in all the classes of the 12 morphological traits.  
64 
 
University of Ghana http://ugspace.ug.edu.gh
Growth habit: accessions with prostrate growth habit scored the lowest mean concentration of 
0.2+0.00 ppm, while the highest mean concentration of 0.3 ppm was scored for accessions which 
had the other three growth habit forms.   
Main pod pigmentation: accessions that had the three classes of main pod pigmentation had mean 
concentration of 0.3 ppm respectively.  
Pod colour: light brown pod coloured accessions scored mean concentration of 0.29+0.02 ppm 
accessions in the remaining seven classes scored mean concentration of 0.3 ppm each,  
Seedcoat colour: mean concentration ranged between 0.2+0.00 ppm which was scored for the 
accessions with black mottled seedcoat colour and 0.3 ppm which was scored for accessions in 
each of the other classes.  
Seedcoat pattern: mean concentration value of 0.3 ppm was scored for accessions in each of the 
six different classes of seedcoat pattern.  
Leaf colour: accessions in each of the three classes had mean concentration value of 0.3 ppm.  
Plant pigmentation: mean potassium concentration ranged between 0.2+0.00 ppm which was 
scored for accessions which had non plant pigmentation and 0.3 ppm which was also scored for 
accessions in each of the other two classes.  
Accessions in each of the each of the individual classes for the following morphological traits 
scored mean concentration value of 0.3 ppm: immature pod pigmentation, V-markings, raceme 
position, terminal leaflet shape and flower bud tip colour.  
Iron: Iron was detected in all classes of the 12 morphological traits.  
65 
 
University of Ghana http://ugspace.ug.edu.gh
Growth habit: Mean iron concentration for growth habit ranged from 0.01+0.003 ppm which was 
scored for accessions with semi-prostrate growth habit to 0.1+0.01 ppm which was also scored for 
those which were semi-erect.  
Main pod pigmentation: Uniformly pigmented accessions had the highest mean concentration. Pod 
colour: accessions which had brown pod colour scored the highest mean concentration of 0.5+0.01 
ppm. 
Seedcoat colour: accessions which had black and black mottled seedcoat had the highest mean 
concentration value of 0.1 ppm respectively.  
Seedcoat pattern: accessions which had golden eye, small black eye and solid classes had the 
highest mean concentration of 0.1 ppm respectively. 
Leaf colour: accessions which had pale green leaf cololur had the highest mean concentration of 
0.1 ppm.  
Plant pigmentation: accessions with non-plant pigmentation scored the highest mean concentration 
of 0.03 ppm.  
Immature pod tip colour: accessions which belonged to the two classes had mean concentration of 
0.05 ppm respectively.  
V-marking: mean concentrations for the two classes of v-marking were 0.05+0.005 ppm which 
was scored for accessions with absent v-marking and 0.5+0.00 ppm which was also scored foe 
accessions with present v-marking.  
66 
 
University of Ghana http://ugspace.ug.edu.gh
Raceme position: mean concentration ranged between 0.05 ppm which was scored for accessions 
with upper canopy and 0.05+0.00 ppm which was also scored for accessions which belonged to 
the other two classes.  
Terminal leaflet shape: mean concentration ranged between 0.04+0.01 ppm which was scored for 
accessions which had sub-hastate terminal leaflet shape and 0.05 ppm which was also scored for 
accessions which belonged to the other two remaining classes.  
Flower bud tip pigment: Mean concentration for each of the two flower bud tip classes was 
0.05+0.01 ppm, respectively.  
Nickel: Nickel was present in all classes of the 12 morphological traits.  
Growth habit: Nickel mean concentration of 0.03 ppm was scored for three different classes of 
growth habit and the semi-prostrate accessions scored a mean concentration of 0.06+0.004 ppm. 
 Main pod pigmentation: accessions in each of the three classes scored mean concentration of 0.03 
ppm.  
Pod colour: mean concentration distribution ranged from 0.02+0.00 ppm to 0.07+0.00 ppm which 
was scored for accessions with dark mottled colour.  
Seed coat colour: mean nickel concentration ranged from 0.02+0.00 ppm which was scored for 
accessions with brick red seed coat colour to 0.05 ppm which was scored by accessions for two 
different classes. 
Seedcoat pattern: accessions which had small brown eye scored the lowest mean nickel 
concentration of 0.001+0.00 ppm, while golden eye and solid accessions scored the highest mean 
concentration of 0.04 ppm. 
67 
 
University of Ghana http://ugspace.ug.edu.gh
Leaf colour: the dark green leaf coloured accessions scored the lowest mean concentration of 
0.02+0.002 ppm, while the accessions for the remaining two classes had the highest mean 
concentration of 0.03 ppm. 
Plant pigmentation: accessions for each of the three classes scored mean concentration value of 
0.03 ppm.  
Immature pod tip colour: the accessions for each of the two classes scored mean concentration 
value of 0.03 ppm.  
V-marking: nickel mean concentration for the two classes of v-marking were 0.03+0.002 ppm 
which was scored for the accessions with absent v-marking and 0.05+0.004 ppm which was also 
scored for the accessions with present v-marking. 
Raceme position: the accessions with mostly above canopy scored the lowest mean concentration 
of 0.02+0.002 ppm, while those accessions with below upper canopy scored the highest mean 
concentration of 0.05+0.003 ppm. 
Terminal leaflet shape: the accessions which had hastate terminal leaflet shape scored the lowest 
mean concentration of 0.02+0.005 ppm, while those accessions with globose terminal leaflet shape 
scored the highest of mean concentration of 0.04+0.003 ppm. 
Flower bud tip pigment: nickel mean concentration for the two classes of flower bud tip were 
0.03+0.003 ppm which was scored for the accessions with non-pigment, while the pigmented 
accessions scored the highest mean concentration of 0.04+0.0.0003 ppm. 
Lead: Lead was beyond detection in some of the classes of the 12 morphological traits.  
68 
 
University of Ghana http://ugspace.ug.edu.gh
Growth habit: mean lead concentration ranged between 0.03 ppm and 0.1+0.03 ppm which was 
scored for the accessions with semi-prostrate growth habit.  
Main pod pigmentation: Lead was beyond detection for the uniformly pigmented accessions. The 
accessions with splashes of pigments scored a mean concentration value of 0.02+0.005 ppm, while 
those with no pigment scored 0.4+0.005 ppm. 
Pod colour: mean concentration values ranged from 0.02+0.00 ppm which was scored for the 
accessions with brown pod colour to 0.07+0.00 ppm which also scored for the dark mottled pod 
coloured accessions.   
Seedcoat colour: the brick red seedcoat coloured accessions had the lowest mean concentration of 
0.02+0.01 ppm, while the accessions with the black seedcoat scored the highest of 0.05+0.00 ppm. 
Seedcoat pattern: the accessions with the black Holstein scored the lowest mean concentration of 
0.02+0.00, while those with golden eye scored the highest of 0.04+0.00 ppm. 
Leaf colour: the accessions with the dark green leaf scored the lowest mean concentration of 
0.02+0.002 ppm, while accessions for the remaining classes scored the highest of 0.03 ppm. Plant 
pigmentation: nickel mean concentration was beyond detection in the non-pigmented accessions. 
The remaining two classes had mean concentrations of 0.03+0.005 ppm which was scored for the 
accessions with moderate base tip petiole, while the accessions with very slight plant pigmentation 
scored the highest of 0.05+0.0.09 ppm. 
Immature pod tip colour: the non-pigmented accessions and the pigmented ones scored mean 
concentration values of 0.03+0.007 ppm and 0.03+0.006 ppm, respectively. 
69 
 
University of Ghana http://ugspace.ug.edu.gh
V-marking: the accessions with absent v-marking had a mean concentration of 0.03+0.005 ppm, 
while those with present v-marking scored 0.05+0.016 ppm. 
Raceme position: the accessions with upper canopy scored a mean nickel concentration of 
0.03+0.005 ppm, while those with below canopy scored mean concentration of 0.4+0.004 ppm. 
Terminal leaflet shape: mean nickel concentration ranged between 0.02 ppm and 0.04+0.003 ppm 
which was scored for the accessions with globose terminal leaflet shape.  
Flower bud tip pigment: mean nickel concentration for the two classes of flower bud tip were 
0.03+0.003 ppm which was scored for the accessions with non-pigment. While the accessions with 
pigment scored the highest of 0.03+0.006 ppm.  
Cadmium: Cadmium was beyond detection in all classes of the following: growth habit, main pod 
pigmentation, pod colour and seed coat colour.  
Seedcoat pattern: accessions with black eye seed coat pattern had a mean concentration of 
(0.002+0.00 ppm), while those with small black eye scored mean concentration of 0.001+0.00 
ppm.  
Leaf colour: the intermediate green leaf coloured accessions scored the lowest cadmium mean 
concentration of 0.0005+0.0002 ppm, while those with dark green and pale green leaf colours 
scored the highest of 0.002+0.00 ppm. 
Plant pigmentation: cadmium mean concentration was 0.001+0.002 ppm which was scored for the 
accessions with moderate base tip petiole and very slight plant pigmentation.  
Immature pod tip colour: the accessions for each of the two classes had cadmium mean 
concentration of 0.001+0.0002 ppm.  
70 
 
University of Ghana http://ugspace.ug.edu.gh
V-marking: the accessions with absent v-marking had a mean concentration of 0.001+0.0002 ppm 
(absent V-marking) while those with present v-marking scored a mean concentration of 
0.00001+0.00002 ppm. 
Raceme position: the accessions with upper canopy and mostly above canopy scored mean 
concentrations of 0.001+0.0002 ppm (in upper canopy) and 0.001+0.0003 ppm, respectively. 
Terminal leaflet shape: mean cadmium concentration ranged between 0.0003+0.0002 ppm which 
was scored for the globose terminal leaflet shape, while those with hastate terminal leaflet shape 
scored 0.002+0.001 ppm. 
Flower bud tip pigment: the accessions for each of the two classes had mean cadmium 
concentrations of 0.001+0.0002 ppm.  
Manganese: Manganese was detected in all classes of the 12 morphological traits.  
Growth habit: the accession for each of the three classes erect, prostrate and semi-erect growth 
habit had mean manganese concentration of 0.02 ppm, while those with semi-prostrate scored 
0.03+0.00 ppm.  
Main pod pigmentation: manganese mean concentration ranged between 0.01+0.00 ppm which 
was scored for the accessions with splashes of pigments and 0.02+0.00 ppm which was also scored 
for accessions with no pigmentation and uniformly pigmented. 
Pod colour: Mean concentration for pod colour ranged from 0.02 ppm and 0.03+0.00 ppm.  
Seedcoat colour: manganese mean concentration ranged from 0.01+0.00 ppm which was scored 
for accessions with brick red seed coat colour to 0.03 ppm.  
71 
 
University of Ghana http://ugspace.ug.edu.gh
Seedcoat pattern: mean concentration ranged between 0.02 ppm and 0.03+0.00 ppm which was 
scored for the accessions with brown eye seed coat pattern.  
Leaf colour: the accessions with intermediate leaf colour had mean concentration of 
0.0005+0.0002 ppm (intermediate green leaf colour), while those for each of the other two classes 
scored 0.002+0.00 ppm. 
Immature pod tip colour: the accessions for each of the classes had mean concentration of 0.02 
ppm.  
V-marking and raceme position: the accessions for each of the classes for v-marking and raceme 
position had mean concentration of 0.02 ppm.  
Terminal leaflet shape: mean concentration ranged from 0.01+0.001 ppm for the accessions which 
had sub-hastate to 0.02 ppm which was scored for the remaining classes of the accessions. 
Flower bud tip pigment: the non-pigmented and pigmented accessions scored mean concentrations 
of 0.02+0.001 ppm and 0.02+0.002 ppm, respectively.  
Chromium:  Chromium was beyond detection in most of the classes of the 12 morphological 
traits.  
Growth habit: chromium was present in only the accessions that had erect and semi-erect growth 
habits at mean concentration of 0.003+0.00 ppm. 
Main pod tip colour: Chromium was beyond detection in accessions which were uniformly 
pigmented. 
72 
 
University of Ghana http://ugspace.ug.edu.gh
Pod colour: chromium was detected in only the accessions which had light brown colour at a mean 
concentration of 0.002+0.001 ppm.  
Seedcoat colour: the accessions with brown and cream had mean chromium concentration of 
0.003+0.00 ppm respectively.  
Seedcoat pattern: the accessions with brown eye and small brown eye patterns scored mean 
chromium concentration of 0.003 ppm 
Leaf colour: mean concentration of 0.002+0.001 ppm was scored for the accessions which had 
intermediate green leaf colour.  
Plant pigmentation: chromium was present in the accessions which had moderate base tip petiole 
colour at mean concentration of 0.002+0.001 ppm.  
Immature pod tip colour and V-marking: chromium was present at mean concentration of 
0.003+0.00 ppm in all accessions for all classes for immature pod tip colour and v-marking. 
 In the following traits: in all the accessions for raceme position, terminal leaflet shape and flower 
bud tip colour, mean chromium concentration was either 0.003+0.00 ppm or 0.0003+0.00 ppm.   
Zinc: Zinc was beyond detection in some of the classes of the 12 morphological traits.  
Growth habit: zinc was absent in accessions which were prostrate and semi-prostrate. 
Main pod pigmentation: zinc was also absent in the uniformly pigmented accessions. 
Pod colour: accessions in four classes did not show the presence of zinc. 
Seedcoat colour: the accessions for four different classes did not show the presence of zinc. 
73 
 
University of Ghana http://ugspace.ug.edu.gh
Seedcoat pattern: zinc was present in only accessions which had brown eye and solid seed coat 
patterns at mean concentration of 0.0003+0.00 ppm and 0.003+0.00 ppm, respectively. 
Leaf colour: zinc was present in only the accessions which had intermediate green leaf colour at 
mean concentration of 0.002+0.001 ppm.  
Plant pigmentation: zinc was detected in only the accessions with moderate base tip petiole at 
mean concentration of 0.002+0.001 ppm.  
Immature pod tip colour: accessions for the following morphological traits:  immature pod tip 
colour v-markings and raceme position, where zinc was detected, the mean concentration was 
either 0.003 ppm or 0.004 ppm.  
Terminal leaflet shape: mean concentration ranged from 0.001+0.00 ppm which was scored for 
the accessions with hastate terminal leaflet shape to 0.006+0.003 ppm which was also scored for 
the accessions which had globose terminal leaflet shape.  
Flowere bud tip pigment: mean zinc concentrations scored for accessions in each of the two classes 
was 0.004 ppm.  
Crude protein: Crude protein was detected in all the classes for the morphological traits. In 
growth habit the accessions which were prostrate had the highest mean protein concentration of 
17.0+0.00%.  Mean protein concentration of 16.8+0.00% was scored for the accessions which had 
dark purple pod colour. The accessions which had the dark mottled pod colour, dirty white seed 
coat colour, black eye and black Holstein seed coat patterns had mean protein concentration of 
15.6+0.00%, 15.9+0.00%, 15.1+0.59% and 15.8+0.00%, respectively.   
74 
 
University of Ghana http://ugspace.ug.edu.gh
Growth habit: the accessions which were semi-erect had the highest mean concentration of 
(4390.0+682.0) x 10-8 ppm.  
Pod colour: the accessions with Dark mottled pod colour had the highest mean concentration of 
(5820.0+0.00) x 10-8 ppm. The accessions which had Flesh pod colour also had mean concentration 
of (4530.0+0.00) x 10-8 ppm. 
Seedcoat colour: the accessions with seedcoat colours black, brown and flesh had mean 
concentrations of (4680.0+4350) x 10-8 ppm, (4290.0+1000) x 10-8 ppm and (4530.0+0.00) x 10-8 
ppm, respectively.  
Seedcoat pattern: the accessions with black eye had mean concentration of (4090.0+1130) x 10-8 
ppm.  
Plant pigmentation: the accessions which had moderate base tip petiole scored mean concentration 
of (4030.0+587) x 10-8 ppm.  
Terminal leaflet shape: the accessions which had sub-hastate scored mean concentration of 
(4650.0+1780) x 10-8 ppm. 
 
 
4.3.3 Amino acids 
 
Table 8 shows results for mean amino acid concentration for the morphological traits. 
L-Histidine: L-histidine was detected in all the classes for the morphological traits.  
Glycine: Glycine was below detection in some of the classes for the morphological traits. It was 
below detection in the accessions which had the following phenotypic traits: prostrate growth 
75 
 
University of Ghana http://ugspace.ug.edu.gh
habit, uniformly pigmented main pod pigmentation, dark brown and dark purple pod colours; 
black, brick red, dirty white and red seed coat colours; black eye and black Holstein seed coat 
patterns; pale green leaf colour, mostly above canopy raceme position and hastate terminal leaflet 
shape. However, its highest concentration of (603.0+0.00) x 10-8 ppm occurred in the accessions 
with black mottled seedcoat colour  
L-Asparagine: L-Asparagine was beyond detection in the accessions with prostrate growth habit, 
black Holstein seed coat pattern and pale green leaf colour. The highest mean concentration of 
(6070.0+0.00) x 10-8 ppm was scored for the accessions which had flesh pod colour and flesh seed 
coat colour, respectively.  
DL-Alpha-Alanine: Dl-Alpha-Alanine was beyond detection in the accessions which had 
prostrate growth habit, dark purple pod colour, dirty white seed coat colour and black Holstein 
seed coat pattern. The highest mean concentration of (7820.0+0.00) x 10-8 ppm, (8260.0+0.00) x 
10-8 ppm and (7820.0+0.00) x 10-8 ppm were scored for the accessions which had flesh pod colour, 
black mottled seed coat colour and flesh seed coat colour, respectively. 
 
 
 
 
 
 
 
 
76 
 
University of Ghana http://ugspace.ug.edu.gh
Table 8: Means and their standard errors of amino acids of cowpea genotypes according to 
morphological traits 
                                                         Mean (se) ppm x 10-8 
Trait Class L-Histidine Glycine L-Asparagine 
Growth Habit Erect 3460 (592) 191 (5.6) 2140 (335) 
 Prostrate 337 (0.00) nd nd 
 Semi-erect  4390 (682) 322 (92.6) 2960 (894) 
 Semi-prostrate 3300 (1270) 293 (0.00) 1880 (603) 
Main pod No pigment 3750 (502) 254 (60.5) 2290 (445) 
pigmentation 
 Splashes of 2720 (835) 290 (12.5) 3100 (804) 
pigments 
 Uniformly 2590 (0.00) nd 837 (0.00) 
pigmented 
Pod colour Brown 3600 (748) 356 (247) 2130 (538) 
 Buff  3180 (747) 129 (89.1) 947 (165) 
 Dark brown 3140 (0.00) nd 830 (0.00) 
 Dark mottled 5820 (0.00) 293 (0.00) 3090 (0.00) 
 Dark purple 2810 (0.00) nd 516 (0.00) 
 Flesh 4530 (0.00) 346 (0.00) 6070 (0.00) 
 Light brown 3940 (767) 279 (76.8) 3630 (936) 
 Purple 2410 (746) 94.3 (0.00) 25.60 (848) 
Seedcoat Black 4680 (4350) nd 2650 (285) 
colour 
 Black mottled 12320 (0.00) 603 (0.00) 3950 (0.00) 
 Brick red 3360 (2750) nd 101 (0.00) 
 Brown 4290 (1000) 300 (294) 3760 (1450) 
 Brown mottled 2440 (912) 293 (0.00) 1980 (438) 
 Cream 3510 (524) 236 (33.8) 1680 (368) 
 Dark mottled 2000 (921) 118 (52.7) 2420 (1180) 
 Dirty white 3610 (0.00) nd 4230 (0.00) 
 Flesh 4530 (0.00) 346 (0.00) 6070 (0.00) 
 Red 2050 (1020) nd 516 (0.00) 
Seedcoat Black eye 4090 (1130) nd 837 (0.00) 
pattern 
 Black holstein 1660 (0.00) nd nd 
 Brown eye 370 (160) 278 (0.00) 3230 (1000) 
 Golden eye 7730 (0.00) 108 (0.00) 2059 (0.00) 
 Small black eye 3750 (999) 255 (0.00) 170 (637) 
 Small brown eye 2870 (900) 296 (33.5) 1800 (823) 
 Solid 3300 (559) 274 (82.2) 2760 (561) 
Leaf colour Dark green 4280 (1380) 255 (0.00) 1390 (591) 
 Intermediate green 3640 (456) 260 (55.4) 2480 (383) 
 Pale green 807 (143) nd nd 
 
77 
 
University of Ghana http://ugspace.ug.edu.gh
Table 8 cont’d 
                                                             Mean (se) ppm x 10-8 
Trait Class L-Histidine Glycine L-Asparagine 
Plant Moderate base 4030 (587) 294 (77.4) 2390 (587) 
pigmentation tip petiole 
 None  2630 (2030) 255 (0.00) 2570 (0.00) 
 Very slight 3440 (645) 226 (84.2) 2390 (408) 
Immature pod Non-pigmented 3950 (688) 230 (67.0) 2230 (616) 
tip colour 
 Pigmented 3210 (586) 307 (82.6) 2520 (468) 
V-markings Absent 3650 (502) 335 (54.1) 2480 (501) 
 Present 3520 (936) 191 (91.9) 2420 (496) 
Raceme Below upper 3880 (538) 241 (60.0) 3210 (698) 
position canopy 
 In upper canopy 3570 (678) 302 (106) 1700 (319) 
 Mostly above 3680 (1230) nd 1570 (641) 
canopy 
Terminal Globose 3240 (576) 144 (62.2) 2060 (430) 
leaflet shape 
 Hastate 3420 (1090) nd 982 (471) 
 Sub-globose 3900 (722) 294 (57.9) 2460 (411) 
 Sub-hastate 4650 (1780) 594 (0.00) 4690 (4570) 
Flower bud tip Non-pigmented 3670 (645) 214 (74.9) 2340 (562) 
 Pigmented 3340 (593) 307 (82.6) 2210 (478) 
 
 
 
 
 
 
 
 
 
 
 
 
78 
 
University of Ghana http://ugspace.ug.edu.gh
Table 8 cont’d 
                            Mean (se) ppm x 10-8 
Trait Class DL-Alpha- L-Valine D-Proline L-Aspartic 
Alanine 
Growth Erect 2220 (303) 871 (95.6) 983 (178) 737 (87.9) 
Habit 
 Prostrate Nd 549 (0.00) 261 (0.00) nd 
 Semi-erect  3180 (709) 877 (207) 937 (199) 914 (125) 
 Semi-prostrate 2410 (8840 347 (135) 981 (567) 9.66 (427) 
Main pod No pigment 2460 (346) 863 (99.7) 1020 (156) 789 (86.40) 
pigmentation 
 Splashes of 2940 (620) 579 (224) 669 (30.1) 805 (158) 
pigments 
 Uniformly 3850 (0.00) 584 (0.00) 219 (0.00) 186 (0.00) 
pigmented 
Pod colour Brown 2080 (0.00) 8110 (116) 944 (233) 623 (135) 
 Buff  1890 (395) 1020 (235) 1010 (418) 581 (134) 
 Dark brown 2720 (0.00) 409 (0.00) 316 (0.00) 1020 (0.00) 
 Dark mottled 4170 (0.00) 608 (0.00) 2100 (0.00) 1810 (0.00) 
 Dark purple Nd 1510 (0.00) 447 (0.00) 946 (0.00) 
 Flesh 7820 (0.00) 1060 (0.00) 1730 (0.00) 1040 (0.00) 
 Light brown 3340 (661) 713 (167) 1080 (198) 1090 (90.0) 
 Purple 1670 (491) 885 (435) 571 (122) 916 (207) 
Seedcoat Black 1320 (312) 979 (0.00) 978 (540) 1240 (44.9) 
colour 
 Black mottled 8260 (0.00) 2290 (0.00) 1440 (0.00) 1730 (0.00) 
 Brick red 859 (650) 576 (345) 2280 (0.00) nd 
 Brown 3210 (1030) 871 (366) 1180 (311) 1230 (136) 
 Brown mottled 2130 (684) 272 (88.9) 794 (336) 1100 (331) 
 Cream 2270 (326) 871 (92.0) 1000 (236) 623 (88.6) 
 Dark mottled 3360 (499) 389 (79.9) 651 (153) 909 (235) 
 Dirty white Nd 588 (0.00) 489 (0.00) 806 (0.00) 
 Flesh 7820 (0.00) 1060 (0.00) 1730 (0.00) 1040 (0.00) 
 Red 754 (244) 1320 (445) 344 (53.3) 539 (222) 
 Black eye 1840 (852) 1230 (270) 2050 (876) 367 (163) 
Seedcoat 
pattern 
 Black holstein Nd 666 (0.00) nd 56.6 (0.00) 
 Brown eye 2690 (0.00) 358 (230) 1250 (758) 775 (31.6) 
 Golden eye 2340 (0.00) 404 (0.00) 764 (0.00) 1040 (0.00) 
 Small black eye 2450 (626) 644 (112) 629 (124) 531 (119) 
 Small brown 2430 (628) 1210 (93.6) 628 (163) 848 (203) 
eye 
 Solid 2690 (484) 791 (155) 910 (134) 1030 (99.3) 
 
79 
 
University of Ghana http://ugspace.ug.edu.gh
Table 8 cont’d 
                                                                                    Mean (se) ppm x 10-8 
Trait Class DL-Alpha- L-Valine D-Proline L-Aspartic 
Alanine 
Leaf colour Dark green 2770 (1020) 703 (145) 510 (141) 681 (191) 
 Intermediate 2530 (319) 864 (103) 1050 (151) 833 (79.9) 
green 
 Pale green 702 (111) 702 (404) 395 (0.00) 419 (213) 
Plant Moderate base 2760 (480) 848 (142) 971 (206) 892 (100) 
pigmentation tip petiole 
 None  3420 (1980) 588 (316) 806 (170) 964 (60.9) 
 Very slight 2150 (360) 846 (115) 967 (193) 692 (107) 
Immature Non-pigmented 2540 (403) 795 (118) 11.10 (194) 753 (109) 
pod tip 
colour 
 Pigmented 2650 (521) 931 (152) 802 (220) 813 (110) 
V-markings Absent 2390 (348) 789 (87.5) 10.50 (177) 708 (82.9) 
 Present 2760 (66.8) 915 (258) 762 (153) 989 (149) 
Raceme Below upper 3350 (561) 880 (172) 968 (151) 996 (97.7) 
position canopy 
 In upper canopy 2070 (390) 946 (142) 1000 (214) 749 (118) 
 Mostly above 1720 (488) 532 (92.3) 879 (453) 324 (128) 
canopy 
Terminal Globose 2270 (420) 716 (96.9) 96.2 (228) 786 (85.7) 
leaflet shape 
 Hastate 835(485 1420 (470) 1160 (401) 664 (423) 
 Sub-globose 2770 (444) 846 (136) 934 (204) 887 (127) 
 Sub-hastate 4030 (1710) 511 (118) 907 (426) 667 (216) 
Flower bud Non-pigmented 2230 (336) 744 (113) 988 (179) 745 (102) 
tip 
 Pigmented 2750 (578) 970 (156) 874 (238) 816 (118) 
 
 
 
 
 
 
 
 
80 
 
University of Ghana http://ugspace.ug.edu.gh
Table 8 cont’d 
                                                          Mean (se) ppm x 10-8 
Trait Class L-Methionine Trans-4-Hydroxy- Iso-Leucine 
L-Proline 
Growth Erect 267 (16.7) 866 (19.7) 850 (21.0) 
Habit 
 Prostrate 190 (0.00) 886 (0.00) 870 (0.00) 
 Semi-erect  347 (39.3) 841 (18.7) 824 (19.8) 
 Semi-prostrate 372 (120) 804 (6.80) 7.82 (7.27) 
Main pod No pigment 296 (19.3) 812 (10.8) 845 (17.3) 
pigmentation 
 Splashes of 320 (52.4) 949 (0.00) 792 (10.9) 
pigments 
 Uniformly 204 (0.00) 949 (0.00) 937 (0.00) 
pigmented 
Pod colour Brown 254 (25.8) 882 (27.6) 869 929.3) 
 Buff  251 (18.4) 876 (39.6) 859 (42.3) 
 Dark brown 412 (0.00) 805 (0.00) 784 (0.00) 
 Dark mottled 595 (0.00) 817 (0.00) 796 (0.00) 
 Dark purple 456 (0.00) 821 (0.00) 801 (0.00) 
 Flesh 554 (0.00) 809 (0.00) 787 (0.00) 
 Light brown 359 (44.3) 812 (5.31) 792 (5.55) 
 Purple 280 (35.1) 834 (25.1) 851 (26.8) 
Seedcoat Black 233 (44.7) 812 (1.30) 790 (1.40) 
colour 
 Black mottled 779 (0.00) 802 (0.00) 791 (0.00) 
 Brick red 223 (8.50) 999 (150) 990 (160) 
 Brown 293 (51.8) 812 (7.77) 791 (8.2) 
 Brown mottled 331 (74.7) 813 (8.38) 792 (8.96) 
 Cream 287 (21.3) 868 (24.2) 853 (25.7) 
 Dark mottled 286 (45.6) 843 (17.4) 824 (18.6) 
 Dirty white 205 (0.00) 979 (0.00) 969 (0.00) 
 Flesh 554 (0.00) 809 (0.00) 787 (0.00) 
 Red 251 (51.6) 853 (39.0) 835 (41.7) 
Seedcoat Black eye 279 (37.6) 1060 (94.4) 1050 (100) 
pattern 
 Black holstein 241 (0.00) 828 (0.00) 880 (0.00) 
 Brown eye 368 (163) 910 (69.3) 895 (73.9) 
 Golden eye 348 (0.00) 812 (0.00) 791 (0.00) 
 Small black 258 (29.2) 839 (18.7) 820 (19.9) 
eye 
 Small brown 303 (52.4) 813 (18.4) 792 (19.5) 
eye 
 Solid 306 (27.3) 835 (12.60) 816 (13.4) 
 
81 
 
University of Ghana http://ugspace.ug.edu.gh
Table 8 cont’d 
                                                                                         Mean (se) ppm x 10-8 
Trait Class L-Methionine Trans-4-Hydroxy- Iso-Leucine 
L-Proline 
Leaf colour Dark green 235 (30.2) 833 (16.8) 820 (18.8) 
 Intermediate 305 (19.6) 864 (16.6) 846 (17.7) 
green 
 Pale green 291 (82.8) 792 (9.95) 769 (10.7) 
 
Plant Moderate base 316 (27.0) 842 (20.1) 8234 (21.4) 
pigmentation tip petiole 
 None  288 (81.8) 829 (13.7) 809 (14.6) 
 Very slight 293 (18.7) 871 (20.6) 856 (21.9) 
Immature pod Non-pigmented 293 (23.6) 853 (19.7) 835 (21.0) 
tip colour 
 Pigmented 309 (30.1) 864 (23.9) 850 (25.4) 
V-markings Absent 282 (17.9) 866 (18.1) 850 (19.3) 
 Present 333 (45.9) 836 (14.6) 818 (15.5) 
Raceme Below upper 358 (35.2) 818 (8.71) 798 (9.29) 
position canopy 
 In upper canopy 286 (24.2) 870 (24.2) 856 (25.7) 
 Mostly above 216 (14.2) 879 (36.2) 863 (38.5) 
canopy 
Terminal Globose 283 (23.9) 869 (29.1) 852 (31.1) 
leaflet shape 
 Hastate 265 (37.4) 878 (44.4) 862 (47.3) 
 Sub-globose 312 (29.7) 845 (19.7) 826 (21.0) 
 Sub-hastate 276 (58.7) 860 (29.2) 843 (30.8) 
Flower bud Non-pigmented 277 (20.9) 857 (18.3) 839 (19.7) 
tip 
 Pigmented 318 (30.6) 864 (25.0) 851 (26.5) 
 
 
 
 
 
 
 
 
82 
 
University of Ghana http://ugspace.ug.edu.gh
Table 8 cont’d 
                                                                                      Mean (se) ppm x 10-8 
Trait Class L-Tyrosine DL-Beta-phenyl- L-Tryptophan 
Alanin 
Growth Habit Erect 4700 (844) 24180 (5380) 56570 (68200) 
 Prostrate 1270 (0.00) 5810 (0.00) 38030 (0.00) 
 Semi-erect  9780 (2210) 54230 (40450) 92220 (30360) 
 Semi-prostrate 9580 (5860) 8320 (1860) 51710 (18880) 
Main pod No pigment 65100 (1020) 34340 (11990) 68250 (10150) 
pigmentation 
 Splashes of 10910 (3440) 6350 (1610) 56910 (15590) 
pigments 
 Uniformly nd 9730 (0.00) 42090 (0.00) 
pigmented 
Pod colour Brown 5310 (1460) 13800 (1950) 56700 (8290) 
 Buff  5050 (1640) 40870 (15750) 51120 (7330) 
 Dark brown 4870 (0.00) nd 99820 (0.000 
 Dark mottled 21280 (0.00) nd 60670 (0.00) 
 Dark purple 6010 (0.00) 30600 (0.00) 122730 (0.00) 
 Flesh 7080 (0.00) 3680 (0.00) 43870 (0.00) 
 Light brown 8430 (24000) 100000 (89220) 69790 (39740) 
 Purple 4340 (1390) 16590 (8370) 109730 (67920) 
Seedcoat Black 1890 (58.1 5240 (0.00) 35380 (0.00) 
colour 
 Black mottled 15750 (0.00) nd nd 
 Brick red 4180 (4060) 19200 (14550) 42790 (20070) 
 Brown 7370 (3820) 71490 (32780) 45600 (15210) 
 Brown mottled 98000 (4150) 9580 (1650) 42770 (16070) 
 Cream 7140 (1280) 31230 (17130) 68050 (9410) 
 Dark mottled 4010 (1580) 4640 (1180) 32790 (5240) 
 Dirty white 204 (0.00) 1580 (0.00) 16950 (0.00) 
 Flesh 7080 (0.00) 36800 (0.00) 43870 (0.00) 
 Red 2320 (1330) 31700 (10820) 12261 (66030) 
Seedcoat Black eye 11260 (1690) 20580 (3990) 59650 (8340) 
pattern 
 Black holstein nd 10570 (0.00) 55960 (0.00) 
 Brown eye 8610 (8410) 15800 (0.00) 16950 (0.00) 
 Golden eye 4340 (0.00) nd 35240 (0.00) 
 Small black eye 5780 (1930) 10600 (2570) 68570 (14590) 
 Small brown eye 5180 (2680) 79090 (63070) 83970 (32180) 
 Solid 5920 (1310) 30030 (8800) 62390 (16390) 
 
 
 
83 
 
University of Ghana http://ugspace.ug.edu.gh
Table 8 cont’d 
                                               Mean (se) ppm x 10-8 
Trait Class L-Tyrosine DL-Beta-phenyl- L-Tyrptophan 
Alanine 
Leaf colour Dark green 7960 (4320) 9510 (14.90) 48580 (12760) 
 Intermediate 6330 (982) 33820 (12990) 69360 (10690) 
green 
 Pale green 2110 (0.00) 49670 (11940) 43060 (6890) 
 
Plant Moderate base tip 8770 (1670) 24160 (8650) 64660 (7330) 
pigmentation petiole 
 None  7960 (4320) 13600 (1520) 12130 (3800) 
 Very slight 4480 (1050) 35240 (17120) 68130 (14090) 
Immature pod Non-pigmented 64.20 (1530) 44850 (18410) 60820 (9470) 
tip colour 
 Pigmented 7240 (1350) 13270 (3030) 73860 (20050) 
V-markings Absent 6910 (1230) 29700 (11910) 61520 (7110) 
 Present 5480 (1650) 16620 (6520) 83760 (38240) 
Raceme Below upper 7470 (1720) 16280 (48800 76810 (28540) 
position canopy 
 In upper canopy 6320 (1230) 28260 (7850) 53420 (6200) 
 Mostly above 4370 (2110) 44890 (31760) 75780 (16530) 
canopy 
Terminal Globose 41.80 (938) 18160 (4440) 51160 (6780) 
leaflet shape 
 Hastate 6770 (2310) 51230 (24500) 55720 (11470) 
 Sub-globose 7450 (1400) 38910 (22150) 86160 (19660) 
 Sub-hastate 11280 (8840) 6770 (1780) 38830 (14210) 
Flower bud tip Non-pigmented 5950 (1500) 24250 (6320) 52880 (6870) 
 Pigmented 7690 (1320) 41660 (27850) 87950 (23010) 
 
 
 
 
 
 
 
84 
 
University of Ghana http://ugspace.ug.edu.gh
L-Aspartic acid: L-Aspartic acid was beyond detection in the accessions which had prostrate 
growth habit and brick red seed coat colour. The highest mean concentration of (1810.0+0.00) x 
10-8 ppm and (1730.0+0.00) x 10-8 ppm were scored for the accessions with dark mottled pod 
colour and black mottled seed coat colour. 
L-Valine: L-Valine was present in all the phenotypic classes. The highest mean concentrations 
of (8110.0+116) x 10-8 ppm, (2290.0+0.00) x 10-8 ppm and (1320.0+445) x 10-8 ppm were 
scored for the accessions which had brown pod colour, black mottled seed coat colour and red 
seed coat pattern, respectively.  
D-Proline: D-Proline was beyond detection in accessions which had black Holstein seed coat 
pattern. The highest mean concentrations of (2100.0+0.00) x 10-8 ppm, (1730.0+0.00) x 10-8 
ppm, (2280.0+0.00) x 10-8 ppm, (1730.0+0.00) x 10-8 ppm and (2050.0+876) x 10-8 ppm were 
scored for the accessions which had dark mottled pod colour, flesh pod colour, brick red seed 
coat colour, flesh seed coat colour and black eye seed coat colour, respectively.   
L-Methionine: L-Methionine was present in all the phenotypic classes. The highest mean 
concentration of (779.0+0.00) x 10-8 ppm was scored for the accessions which had black mottled 
seed coat colour. 
Iso-Leucine: Iso-Leucine was detected in all the phenotypic classes. The highest mean 
concentration of (936.0+0.00) x 10-8 ppm, (990.0+160) x 10-8 ppm, (969.0+0.00) x 10-8 ppm and 
(1050.0+100) x 10-8 ppm were scored for the accessions with uniformly pigmented main pod 
pigmentation, brick red seedcoat colour, dirty white seedcoat colour and red seedcoat colour, 
respectively. 
85 
 
University of Ghana http://ugspace.ug.edu.gh
Trans-4-Hydroxy-L-Proline:  Trans-4-Hydroxy-L-Proline was present in all the phenotypic 
classes. The highest mean concentration of (949.0+0.00) x 10-8 ppm, (999.0+1500) x10-8 ppm, 
(979.0+0.00) x 10-8 ppm, (1060.0+94.4) x 10-8 ppm and (910.0+69.3) x 10-8 ppm were scored for 
the accessions with splashes of pigments and uniformly pigmented for main pod pigmentation, 
brick red and dirty white for seedcoat colour, black eye and brown eye for seedcoat pattern, 
respectively. 
L-Tyrosine: L-Tyrosine was beyond detection in accessions with uniformly pigmented main pod 
pigmentation and black Holstein seedcoat pattern. The highest mean concentration of 
(98000.0+4150) x 10-8 ppm was scored for accessions with brown mottled seedcoat colour and 
mean concentration of (65100.0+1020) x 10-8 ppm was scored for accessions with no pigment. 
DL-Beta-phenyl-Alanine: DL-Beta-phenyl-Alanine was beyond detection in   the accessions with 
dark brown and dark mottled for pod colour, black mottled for seedcoat colour and golden eye for 
seedcoat pattern. The accessions with light brown pod colour had the highest mean concentration 
of (100000.0+89220.0) x 10-8 ppm, and mean concentration of (79090.0+63070.0) x 10-8 ppm was 
scored for accessions with small brown eye seedcoat pattern. 
L-Tryptophan: L-Tryptophan was present in all the phenotypic classes. The highest mean 
concentration of (1222730.0+0.00) x 10-8 ppm was scored for accessions which had dark purple 
pod colour. 
B-Threonine, Glutamine, L-Cysteine, L-Serine, L-Threonine and Lysine: These amino acids 
were beyond detection in all phenotypic classes. 
 
 
86 
 
University of Ghana http://ugspace.ug.edu.gh
4.4 Fisher’s Exact test of Association  
4.4.1 Association between Source of collection and 12 morphological traits 
Results for Fisher’s exact test of association between source of collection and the 12 morphological 
traits are presented in Table 9.The following six morphological traits associated significantly with 
source of cowpea accession collection: pod colour (P = 0.000), seedcoat colour (P = 0.001), 
seedcoat pattern (P = 0.000), V-marking (P = 0.000), raceme position (0.000) and terminal leaflet 
shape (P = 0.009).   
4.4.2 Association among Morphological traits 
Results for Fisher’s exact test of association among the 12 morphological traits are presented in 
Table 10. Growth habit was significantly associated with three different morphological traits as 
follows: seedcoat colour (P = 0.032), immature pod tip colour (P = 0.003) and flower bud tip 
pigment (P = 0.000). Main pod pigmentation was significantly associated with the following four 
morphological traits: seedcoat pattern (P = 0.003), immature pod tip colour (P = 0.000), terminal 
leaflet shape (P = 0.020) and flower bud tip pigment (P = 0.005).  
Pod colour was associated with six morphological traits, seedcoat colour (P = 0.000), seedcoat 
pattern (P = 0.001), v-marking (P = 0.002), raceme position (P = 0.001), leaf colour (0.000) and 
flower bud tip pigment (0.040). 
Seedcoat colour was significantly associated with seedcoat pattern (P = 0.000), immature pod tip 
colour (P = 0.048), v-marking (P = 0.000) and raceme position (P = 0.022). 
Seedcoat pattern was associated with immature pod tip colour (P =0.000), v-marking (P = 0.005) 
and terminal leaflet shape and raceme position (P=0.014). 
Leaf colour was significantly associated with plant pigmentation (P = 0.000) and terminal leaflet 
shape (P = 0.010). 
87 
 
University of Ghana http://ugspace.ug.edu.gh
Immature pod tip colour was significantly associated with flower bud tip pigment (P = 0.000), v-
marking was associated with raceme position (P = 0.005). Raceme position was significantly 
associated with terminal leaflet shape (P = 0.030).  
   
 
 
            Table 9: Fisher’s exact test of association between cowpea morphological  
            traits and source of collection. 
 
Trait  Fisher’s exact 
Growth Habit 0.243 
Main pod pigmentation 0.309 
Pod colour 0.000 
Seedcoat colour 0.001 
Seedcoat pattern 0.000 
Leaf colour 0.109 
Plant pigmentation 0.504 
Immature pod tip colour 0.598 
V-markings 0.000 
Raceme position 0.000 
Terminal leaflet shape 0.009 
Flower bud tip 0.427 
 
        
 
 
88 
 
University of Ghana http://ugspace.ug.edu.gh
 Table 10: Fisher’s test of association among morphological traits of cowpea 
Trait Class Fisher’s exact 
Growth Habit   
 Main pod pigmentation 0.326 
 Pod colour 0.096 
 Seedcoat colour 0.032 
 Seedcoat pattern 0.443 
 Leaf colour 0.950 
 Plant pigmentation 0.968 
 Immature pod tip colour 0.003 
 V-markings 0.066 
 Raceme position 0.176 
 Terminal leaflet shape 0.121 
 Flower bud tip pigment 0.000 
Main pod pigmentation   
 Pod colour 0.509 
 Seedcoat colour 0.837 
 Seedcoat pattern 0.003 
 Leaf colour 0.150 
 Plant pigmentation 0.745 
 Immature pod tip colour 0.000 
 V-markings 0.381 
 Raceme position 0.538 
Terminal leaflet shape 0.020 
Flower bud tip  0.005 
Pod colour   
 Seedcoat colour 0.000 
 Seedcoat pattern 0.001 
 Leaf colour 0.000 
 Plant pigmentation 0.103 
 Immature pod tip colour 0.598 
 V-markings 0.002 
 Raceme position 0.001 
 Terminal leaflet shape 0.299 
Seedcoat colour   
 Seedcoat pattern 0.000 
 Leaf colour 0.852 
 Plant pigmentation 0.078 
 Immature pod tip colour 0.048 
 V-markings 0.000 
 Raceme position 0.022 
 Terminal leaflet shape 0.313 
 Flower bud tip 0.065 
 
 
89 
 
University of Ghana http://ugspace.ug.edu.gh
        Table 10 cont’d 
Trait Class Fisher’s exact 
Seedcoat pattern   
 Leaf colour 0.320 
 Plant pigmentation 0.956 
 Immature pod tip colour 0.000 
 v-marking 0.005 
 Raceme position 0.014 
 Terminal leaflet shape 0.014 
 Flower bud tip 0.457 
Leaf colour   
 Plant pigmentation 0.000 
 Immature pod tip colour 0.665 
 V-markings 0.103 
 Raceme position 0.091 
 Terminal leaflet shape 0.010 
 Flower bud tip 0.572 
Plant pigmentation   
 Immature pod tip colour 0.846 
 V-markings 0.156 
 Raceme position 0.868 
 Terminal leaflet shape 0.374 
 Flower bud tip 1.000 
 
Immature pod tip colour   
 V-markings 0.067 
 Raceme position 0.434 
 Terminal leaflet shape 0.661 
 Flower bud tip 0.000 
v-marking   
 Raceme position 0.005 
 Terminal leaflet shape 0.079 
 Flower bud tip 0.127 
Raceme position   
 Terminal leaflet shape 0.030 
 Flower bud tip 0.656 
 
Terminal leaflet shape   
 Flower bud tip 0.586 
   
 
 
            
90 
 
University of Ghana http://ugspace.ug.edu.gh
4.5 Pearson’s Correlation Among 12 Traits in Cowpea Collections. 
 
4.5.1 Correlation Among Traits in cowpea accessions from DPEB 
 
Significant Pearson’s correlation coefficients of traits among cowpea genotypes collected from 
DPEB are presented in Table 11. These comprised 24 pairwise correlation coefficient values 
among amino acids and 4 and 2 correlation coefficients within mineral elements and polyphenols 
respectively; 7 between polyphenols and mineral elements, 5 between mineral elements and amino 
acids and 2 between crude protein and amino acids. 
Syringic acid correlated significantly with the mineral element calcium (r = 0.891, P < 0.001); 
Vanillic acid correlated significantly with the mineral element calcium (r = 0.891, P < 0.001) and 
chromium (r = 1.000, P < 0.001). Gallic acid correlated significantly with mineral elements 
calcium (r = 0.946, P < 0.001) and chromium (r = 1.000, P < 0.001). 
L-Aspartic acid also correlated significantly with the mineral elements nickel (r = 0.503, P < 0.01) 
and manganese (r = 0.641, P < 0.001). There was perfect correlation between L-Isoleucine and 
Chromium (r = 1.000, P < 0.001). Trans-4-Hydroxy-L-Proline negatively correlated with iron (r = 
-0.497, P < 0.05) and cadmium (r = -0.946, P < 0.01). L-Tyrosine negatively correlated with iron 
(r = -0.430, P < 0.05) and positively correlated with cadmium (r = 0.571, P < 0.01). 
 
4.5.2 Correlation among traits in cowpea accessions from SARI 
 
Table 12 shows significant Pearson’s correlation coefficients with reference to traits collected from 
cowpea accessions from SARI. A total of 30 significant pairwise correlation coefficients were 
estimated. Among the amino acids, six (6) different pairwise correlations were observed, ten (10) 
91 
 
University of Ghana http://ugspace.ug.edu.gh
among mineral elements and two (2) among polyphenols. Eight (8) pairwise correlations were 
observed between mineral elements and the amino acids, two (2) between crude protein and amino 
acids, and one (1) between crude protein and phenols and crude protein and mineral elements, 
respectively. 
L-Aspartic correlated significantly with the mineral element iron (r = 0.661, P < 0.001). Trans-4-
Hydroxy-L-Proline negatively correlated with the mineral element sodium (r = -0.468, P < 0.01), 
iron (r = -0.458, P < 0.01) and cadmium (r = -0.619, P < 0.001). L-Tyrosine negatively correlated 
with the mineral element sodium (r = -0.462, P < 0.01), iron (r = -0.451, P < 0.01) and cadmium 
(r = -0.586, P < 0.05). 
 
 
4.5.3 Correlation among traits in the total collection   
 
Table 13 presents Pearson’s correlation coefficients for the total population. Sixty (60) different 
significant pairwise correlations were observed.   Among the amino acids, 28 pairwise correlations 
were observed, three (3) were observed among polyphenols, four (4) for between polyphenols and 
mineral elements, twenty-two (22) between mineral elements and amino acids and three (3) 
between crude protein and amino acids. 
Syringic acid and Vanillic acid correlated significantly with the mineral element calcium (r = 
0.886, P < 0.001). Gallic acid correlated significantly with the mineral element calcium (r = 0.942, 
P < 0.001). Quercetin correlated with the mineral element nickel (r = 0.252, P < 0.05). 
L-Asparagine negatively correlated with the mineral element potassium (r = -0.350, P < 0.05). DL-
Alpha-Alanine negatively correlated with the mineral element sodium (r = -0.330, P < 0.05). L-
92 
 
University of Ghana http://ugspace.ug.edu.gh
Aspartic correlated with the mineral element iron (r = 0.439, P < 0.01), nickel (r = 0.460, P < 0.01) 
and manganese (r = 0.357, P < 0.05). 
L-Valine correlated significantly with the mineral element chromium (r = 1.000, P < 0.001). L-
Methionine correlated with the mineral elements nickel (r = 0.433, P < 0.001), cadmium (r = -
0.400, P < 0.05), and manganese (r = 0.370, P < 0.05). L-Isoleucine negatively correlated with the 
mineral elements iron (r = -0.454, P < 0.001) and cadmium (r = -0.453, P < 0.05). Trans-4-
Hydroxy-L-Proline negatively correlated with the mineral elements nickel (r = -0.436, P < 0.001) 
and cadmium (r = -0.428, P < 0.05). Dl-Beta-Phenyl-Alanine also positively correlated with the 
mineral element magnesium (r = 0.370, P < 0.01) and iron (r = 0.303, P < 0.05). Trans-4-Hydroxy-
L-Proline negatively correlated with sodium (r = -0.460, P < 0.05), iron (r = -0.458, P < 0.01) and 
cadmium (r = -0.619, P < 0.05). L-Tyrosine negatively correlated with sodium (r = -0.462, P < 
0.05), iron (r = -0.451, P < 0.05) and cadmium (r = -0.586, P < 0.05). 
 
 
 
 
 
 
 
 
93 
 
University of Ghana http://ugspace.ug.edu.gh
Table 11: Pearson’s correlation coefficients among traits in DPEB accessions 
 Syringic acid Vanillic acid Gallic acid L-Histidine Glycine 
Vanillic acid 1.000***     
Gallic acid 0.989***     
Quercetin      
L-Histidine      
Glycine    0.650*  
L-Asparagine    0.487** 0.841*** 
DL-Alpha-    0.610** 0.820*** 
Alanine 
L-Aspartic     0.567*** 0.646** 
L-Methionine    0.419*** 0.790*** 
L-Tyrosine    0.422** 1.000*** 
Ca 0.891*** 0.891*** 0.946***   
Cr  1.000*** 1.000***   
 L-Asparagine DL-Alpha- L-Aspartic   
 Alanine  
 
DL-Alpha- 0.736***     
Alanine 
L-Aspartic 0.577** 0.464**    
L-Methionine 0.427* 0.818*** 0.455**   
L-Isoleucine   0.374*   
L-Tyrosine 0.519** 0.708*** 0.482**   
Ni   0.503**   
Mn   0.641***   
 
 Ni Pb    
Cd -0.549**     
Mn 0.757** 0.485*    
Cr 1.000***     
 
 
 
 
 
 
 
 
94 
 
University of Ghana http://ugspace.ug.edu.gh
Table 11 cont’d  
 L- L- L- Trans-4- L-Tyrosine 
Isoleucine Methionine Isoleucine Hydroxy-L-
Proline 
Trans-4-   0.974***   
Hydroxy-
L-Proline 
L-  0.762***    
Tyrosine 
DL-Beta- 0.520**     
Phenyl-
Alanine 
Cp    0.404* 0.368* 
Fe    -0.497* -0.430* 
Cd    -0.634** 0.571** 
Cr 1.000***     
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
95 
 
University of Ghana http://ugspace.ug.edu.gh
Table 12: Pearson’s correlation coefficients among traits in SARI accessions 
 Syringic acid Vanillic Gallic acid L-Histidine Glycine  
acid 
Vanillic acid 1.000***     
Gallic acid 0.923***     
Quercetin      
 L-Asparagine DL-Alpha- L-Aspartic    
Alanine 
Valine   0.571**   
Cp   -0.590**   
Fe   0.661**   
      
 Valine L- Trans-4- L-Tyrosine DL-Beta-
Isoleucine Hydroxy- Phenyl-Alanine 
L-Proline 
L-Methionine 0.499**     
Trans-4-  0.992***    
Hydroxy-L-
Proline 
L-Tyrosine 0.631* 0.846***    
DL-Beta-    0.688*  
Phenyl-
Alanine 
L-Tryptophan     0.692*** 
Cp   0.531** 0.537**  
Na   -0.468** -0.462*  
Fe   -0.458** -0.451*  
Cd   -0.619*** -0.586**  
 Cp Na K Mg  
K  0.689***    
Mg  0.616*** 0.714***   
Fe  0.724*** 0.566** 0.668***  
Cd -0.723***     
 Ni Pb    
Pb 0.512*     
Mn 0.545** 0.681**    
Zn 0.984***     
 
 
 
 
 
96 
 
University of Ghana http://ugspace.ug.edu.gh
 
 
Table 13: Pearson’s correlation coefficients among traits in the total cowpea accessions 
 Syringic acid Vanillic acid Gallic acid Quercetin  L- Glycine  
Histidine 
Vanillic acid 1.000***      
Gallic acid 0.989*** 0.989***     
Glycine      0.650**  
L-Asparagine      0.641** 
DL-Alpha-     0.339** 0.820*** 
Alanine 
L-Aspartic       0.646** 
L-Methionine      0.790 
L-Tyrosine      0.761*** 
DL-Beta-      1.000*** 
Phenyl-
Alanine 
Ca 0.886*** 0.886*** 0.942***    
Ni    0.252*   
 L- DL-Alpha- L-Aspartic     
Asparagine Alanine 
DL-Alpha- 0.736***      
Alanine 
L-Aspartic 0.462** 0.739**     
L-Methionine 0.480** 0.732*** 0.449***    
L-Isoleucine   -0.461***    
L-Tyrosine 0.557*** 0.607*** 0.441**    
L-Tryptophan -0.409*      
Na  -0.330*     
K -0.350*      
Fe   0.439**    
Ni   0.460**    
Mn    0.357*    
       
 
 
 
 
 
97 
 
University of Ghana http://ugspace.ug.edu.gh
 
Table 13 cont’d: Pearson’s correlation coefficients among traits in the total cowpea accessions. 
 L-Valine L- L- Trans-4- L- DL-Beta-
Methionine Isoleucine Hydroxy- Tyrosine Phenyl-
L-Proline Alanine 
Trans-4-   0.992***    
Hydroxy-
L-Proline 
L-Tyrosine  0.718***    0.433** 
Cp   0.473***    
Na  -0.338**     
Mg       0.370** 
Fe    -0.454*** -0.436***  0.303* 
Ni  0.433***     
Cd  -0.400* -0.453* -0.428*   
Mn  0.370*     
Cr 1.000***      
 L-Valine  L- L- Trans-4- L- DL-Beta-
Methionine Isoleucine Hydroxy- Tyrosine Phenyl-
L-Proline Alanine 
L- 0.499**      
Methionine 
Trans-4-   0.922***    
Hydroxy-
L-Proline 
L-Tyrosine 0.631*  0.846***    
DL-Beta-     0.688***  
Phenyl-
Alanine 
Tryptophan      0.692*** 
Cp    0.531** 0.537**  
Na    -0.460* -0.462*  
Fe    -0.458** -0.451*  
Cd    -0.619* -0.586*  
 
 
 
 
 
 
98 
 
University of Ghana http://ugspace.ug.edu.gh
 
4.6 Phenotypic diversity of cowpea population 
4.6.1 Nei’s diversity index 
 
Morphological traits: Table 14 shows Nei’s diversity for each of the morphological traits for 
the two sources of collection.  Phenotypic diversity ranged from 0.00 to 0.495 for cowpea 
accessions from DPEB with a mean of 0.172+0.185. Erect growth habit, splashes of pigment of 
main pod pigmentation, dark green leaf colour, solid plant pigmentation, absence of v-marking, 
and raceme position in upper canopy showed the highest diversity values with 0.487, 0.487, 
0.495, 0.487, 0.454, 0.442, 0.414 and 0.414 respectively. Phenotypic diversity in the SARI 
accessions ranged between 0.00 and 0.494 with a mean of 0.171+0.167. Erect growth habit, 
splashes of pigment of main pod pigmentation, brown pod colour, none plant pigmentation, non-
pigmented immature pod tip colour, mostly above canopy raceme position and non-pigmented 
flower bud tip showed the highest diversity with 0.471, 0.492, 0.494, 0.414, 0.455, 0.414 and 
0.494, respectively.  
 
 
 
 
 
 
 
 
 
99 
 
University of Ghana http://ugspace.ug.edu.gh
Table 14: Nei’s diversity indices for cowpea qualitative traits for sources of collection 
 Trait  Class  Nei’s Diversity 
  DPEB  SARI 
Growth Habit Erect 0.483 0.471 
 Prostrate 0.211 0.338 
 Semi-erect  0.025 0.000 
 Semi-prostrate 0.025 0.000 
 
Main pod No pigment 0.000 0.038 
pigmentation 
 Splashes of pigments 0.487 0.492 
 Uniformly pigmented 0.383 0.182 
 
Pod colour Black purple 0.189 0.000 
 Brown  0.167 0.494 
 Buff 0.000 0.000 
 Dark brown 0.025 0.000 
 Dark mottled 0.025 0.000 
 Dark purple 0.189 0.182 
 Flesh 0.293 0.038 
 Light brown 0.025 0.000 
 Purple 0.000 0.000 
 
Seedcoat colour Black 0.495 0.147 
 Black mottled 0.000 0.216 
 Brick red 0.000 0.000 
 Brown 0.121 0.391 
 Brown mottled 0.025 0.000 
 Cream 0.049 0.000 
 Dark mottled 0.000 0.000 
 Dirty white 0.097 0.075 
 Flesh 0.000 0.000 
 Red 0.000 0.075 
 White 0.293 0.492 
 Wine 0.097 0.000 
 
Seedcoat pattern Black Holstein   0.144 0.038 
 Brown eye 0.000 0.000 
 Golden eye 0.000 0.000 
 Holstein 0.121 0.000 
 Large black eye 0.189 0.000 
 Small black eye 0.049 0.000 
 Small brown eye 0.049 0.000 
 Solid 0.049 0.000 
 
100 
 
University of Ghana http://ugspace.ug.edu.gh
Table 14 cont’d   
  Nei’s Diversity 
Trait Class DPEB SARI 
    
Leaf colour Dark green 0.487 0.499 
 Intermediate green 0.121 0.216 
 Pale green 0.025 0.000 
    
    
Plant pigmentation Moderate base tip petiole 0.000 0.000 
 None  0.313 0.414 
 Solid 0.454 0.391 
 Very slight 0.074 0.038 
 
Immature pod tip colour Non-pigmented 0.399 0.455 
 pigmented 0.349 0.310 
 
V-markings Absent 0.442 0.000 
 Present 0.331 0.000 
 
Raceme position Below upper canopy 0.049 0.391 
 In upper canopy 0.414 0.038 
 Mostly above canopy 0.349 0.414 
 
Terminal leaflet shape Globose 0.097 0.248 
 Hastate 0.349 0.338 
 Sub-globose 0.025 0.182 
 Sub-hastate 0.367 0.147 
 
Flower bud tip Non-pigmented 0.414 0.494 
 Pigmented 0.349 0.248 
Mean    0.172 0.171 
Standard deviation  0.185 0.167 
 
 
 
 
 
 
101 
 
University of Ghana http://ugspace.ug.edu.gh
Crude protein and Mineral elements: Nei’s diversity values for cowpea accessions from DPEB 
and SARI are shown in Table 15. Phenotypic diversity values in the DPEB accessions varied 
between 0.00 and 0.483 with a mean of 0.187+190. Among the SARI accessions, diversity varied 
from 0.00 to 0.499 with a mean of 0.077+0.160. Lead had the highest diversity of 0.499. 
Polyphenol traits: Table 16 shows Nei’s diversity values for polyphenol traits in the two 
collection sites. Among the DPEB accessions diversity ranged from 0.00 to 0.495. Syringic acid 
(class 63.0 – 135.0), vanillic acid (class 12.00 – 87.0) and gallic acid (class 82.0 – 96.0) with the 
highest diversity of 0.495, 0.475 and 0.495, respectively. Among the SARI accessions diversity 
varied from 0.00 to 0.455. The highest diversity with 0.455 was scored for quercetin (class 44.0 – 
60.0). 
 Amino acid traits: Nei’s diversity index for amino acids is presented in Table 17. Diversity in 
cowpea accessions varied between 0.00 and 0.493 with a mean of 0.207+0.226. Diversity in 
cowpea accessions from SARI ranged from 0.00 to 0.499 with a mean of 0.117+0.20. 
 
 
 
 
 
 
 
 
 
 
102 
 
University of Ghana http://ugspace.ug.edu.gh
Table 15: Nei’s diversity indices for cowpea crude protein and mineral elements 
 Nei’s diversity 
Trait  DPEB SARI 
Crude protein 0.000 0.000 
Calcium 0.000 0.000 
Sodium  0.483 0.000 
Potassium 0.000 0.000 
Magnesium  0.261 0.000 
Iron  0.261 0.000 
Copper  0.024 0.000 
Nickel  0.000 0.000 
Lead  0.440 0.499 
Cadmium  0.093 0.334 
Manganese  0.428 0.000 
Chromium  0.093 0.000 
Zinc  0.353 0.164 
Mean 0.187 0.077 
Standard deviation 0.190 0.160 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
103 
 
University of Ghana http://ugspace.ug.edu.gh
Table 16: Nei’s diversity indices for cowpea polyphenols. 
Trait Class  Nei’s Diversity 
  DPEB SARI 
Syringic acid 63 .0 – 135.0 0.494 0.338 
 136.0 – 202.0 0.025 0.000 
 203.0 – 269.0 0.025 0.000 
 270.0 – 336.0 0.000 0.000 
 337.0 – 403.0 0.025 0.000 
Vanillic acid 12.0 –     87.0 0.475 0.000 
 88.0 – 162.0 0.074 0.000 
 163.0 – 237.0 0.025 0.000 
 238.0 – 312.0 0.000 0.000 
 313 – 386.0 0.000 0.000 
 387.0 – 461.0 0.025 0.000 
Gallic acid 82.0 – 96.0 0.494 0.315 
 97.0 – 184.0 0.121 0.038 
 185.0 – 272.0 0.025 0.000 
 273.0 – 360.0 0.000 0.000 
 361.0 – 448.0 0.000 0.000 
 449.0 – 535.0 0.000 0.000 
Quercetin  44.0 – 60.0 0.211 0.455 
 61.0 – 76.0 0.331 0.216 
 77.0 – 92.0 0.211 0.112 
 93.0 – 107.0 0.074 0.038 
 108.0 – 123.0 0.074 0.038 
Mean               0.123              0.070 
Standard deviation               0.171              0.134 
 
 
 
 
 
 
 
 
 
 
104 
 
University of Ghana http://ugspace.ug.edu.gh
Table 17: Nei’s diversity indices for cowpea amino acids traits 
Trait  Nei’s diversity 
 DPEB SARI 
Amino acid   
Histidine  0.344 0.000 
Glycine  0.306 0.000 
L-Serine 0.024 0.000 
L-Cysteine 0.000 0.000 
L-Asparagine 0.492 0.391 
DL-Alpha-Alanine 0.493 0.484 
Glutamine  0.000 0.000 
L-Lysine 0.000 0.000 
L-Aspartic acid 0.472 0.484 
B-Threonine 0.000 0.000 
L-Threonine 0.000 0.000 
l-Valine 0.472 0.000 
D-Proline 0.472 0.499 
L-Methionine 0.000 0.000 
Iso-Leucine 0.000 0.000 
Trans-4-Hydroxyl-L-Proline 0.000 0.000 
L-Tyrosine 0.430 0.365 
DL-Beta—PhenylAlanine 0.421 0.000 
L-Tryptophan 0.000 0.000 
Mean  0.207 0.117 
Standard deviation 0.226 0.203 
 
 
 
 
 
 
 
 
 
 
105 
 
University of Ghana http://ugspace.ug.edu.gh
 
4.6.2 Nei’s analysis of phenotypic diversity in subdivided population 
 
Crude protein and Mineral elements traits: Table 18 shows Nei’s analysis of phenotypic 
diversity in subdivided population for crude protein and mineral elements traits. Total phenotypic 
diversity (Ht) ranged from 0.000 to 0.492 with a mean of 0.162+0.314. 
The intra-population diversity (Hs) ranged from 0.000 to 0.468 with a mean of 0.132+0.021. The 
highest was scored for lead.  
Phenotypic diversity among populations (Gst) varied between 0.006 and 0.527 with a mean of 
0.187. Gene flow (Nm) among population’s estimates ranged from 0.449 to 82.497 with a mean 
of 2.181. 
 
Polyphenol traits: Table 19 shows Nei’s analysis of phenotypic diversity in subdivided 
population. Total phenotypic diversity for each trait (Ht) ranged from 0.000 to 0.499 with a mean 
of 0.121. Intra-population diversity (Hs) ranged between 0.000 and 0.474 with a mean of 0.105. 
Phenotypic diversity among populations (Gst) ranged from 0.000 to 0.560 with a mean of 0.434. 
Phenotypic diversity ranged from 0.004 to 0.288 for syringic acid, 0.009 to 0.225 for vanillic acid, 
0.017 to 0.275 for gallic acid and 0.006 to 0.560 for quercetin.  
Gene flow (Nm) estimate among population for each of the traits ranged from 1.316 to 118.498. 
Gene flow estimates for syringic acid ranged from 9.430 to 116.498, 1.716 to 57.496 for vanillic 
acid, 1.316 to 118.498 for gallic acid and 3.101 to 89.115 for quercetin. 
 
 
106 
 
University of Ghana http://ugspace.ug.edu.gh
Table 18: Total phenotypic diversity (Ht), mean intra-population diversity (Hs) and among 
population diversity (Gst) and geneflow values in cowpea accessions for crude protein and 
mineral element traits. 
Trait  Ht Hs Gst Nm 
Cp 0.000 0.000 - - 
Ca 0.000 0.000 - - 
Na 0.325 0.242 0.252 1.450 
K 0.000 0.000 - - 
Mg 0.142 0.131 0.084 5.481 
Fe 0.142 0.131 0.084 5.481 
Cu 0.012 0.012 0.006 82.497 
Ni 0.000 0.000 - - 
Pb 0.492 0.468 0.048 9.875 
Cd 0.227 0.214 0.059 8.004 
Mn 0.462 0.214 0.527 0.449 
Cr 0.048 0.050 0.025 19.488 
Zn 0.268 0.258 0.036 13.530 
Mean 0.162 0.132 0.125 16.251 
Standard 0.031 0.021 0.167 23.534 
deviation 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
107 
 
University of Ghana http://ugspace.ug.edu.gh
Table 19: Total phenotypic diversity (Ht), mean intra-population diversity (Hs) and among 
population diversity (Gst) and geneflow values in cowpea accessions for polyphenols. 
Trait  Class  Ht Hs Gst Nm 
Syringic acid   63 .0 – 0.499 0.474 0.050 9.430 
135.0 
 136.0 – 202.0 0.256 0.248 0.031 15.442 
 203.0 – 269.0 0.348 0.247 0.288 1.234 
 270.0 – 336.0 0.017 0.017 0.009 57.496 
 337.0 – 403.0 0.040 0.008 0.004 116.498 
 
Vanillic acid  12.0 –     0.000 0.000 - - 
87.0 
   88.0 – 162.0 0.051 0.050 0.027 18.153 
 163.0 – 237.0 0.300 0.233 0.225 1.716 
 238.0 – 312.0 0.017 0.017 0.009 57.496 
 313 – 386.0 0.000 0.000 - - 
 387.0 – 461.0 0.000 0.000 - - 
 
Gallic acid 82.0 – 96.0 0.000 0.000 - - 
 97.0 – 184.0 0.050 0.049 0.026 18.487 
 185.0 – 272.0 0.339 0.245 0.275 1.316 
 273.0 – 360.0 0.033 0.033 0.017 28.491 
 361.0 – 448.0 0.000 0.000 - - 
 449.0 – 535.0 0.008 0.008 0.004 118.498 
 
Quercetin  44.0 – 60.0 0.000 0.000 - - 
 61.0 – 76.0 0.017 0.017 0.09 68.496 
 77.0 – 92.0 0.483 0.416 0.139 3.101 
 93.0 – 107.0 0.197 0.196 0.006 89.115 
 108.0 – 123.0 0.100 0.094 0.560 8.412 
 124.0 – 139.0 0.058 0.057 0.031 15.627 
 Mean 0.121 0.105 0.434 3.221 
 Standard 0.003 0.002 0.152 40.098 
deviation 
 
 
 
 
 
 
108 
 
University of Ghana http://ugspace.ug.edu.gh
4.7 Principal Component Analysis 
4.7.1 Polyphenols 
Results from principal component analysis of polyphenols are presented in Table 20. From the 
scree plot (Fig. 1) the first two principal components were more informative. The first principal 
component (PC1) showed 74.99% variability among the cowpea accessions. The second principal 
component (PC2) showed 24.87% variation among. The first two principal components therefore 
accounted for a total of 99.86% variability. Syringic acid, vanillic acid and gallic acid were highly 
correlated with PC1; quercetin was however highly correlated with PC2. Scatter plot of the first 
two principal components (Fig. 2) showed one major group made up of about three sub-groups. 
Accessions RC-03, F2RG004 and IT9K-150-241 formed the smaller sub-group. Accession 
EMS10-01 was an outlier. 
 
 
 
Table 20: Principal Component Analysis among Cowpea genotypes showing relative importance 
of polyphenol traits. 
 PC1 PC2 PC3 
Eigenvalue 2.99949 0.99462 0.00589846 
% Total variance 74.99 24.87 00.15 
% Cumulative 74.99 99.86 100.0 
    
Trait  Eigen vectors   
Syringic 0.5769 -0.0273 -0.4077 
Vanillic 0.5769 -0.0272 -0.4082 
Gallic 0.5759 -0.0357 0.8167 
Quercetin 0.0520 0.9986 0.0069 
 
 
 
109 
 
University of Ghana http://ugspace.ug.edu.gh
 
 
1 2 3 4
Eigenvalues Mean
Fig 1: Scree plot of eigenvalues for cowpea polyphenols
 
 
 
 
 
110 
 
0 1 2 3
University of Ghana http://ugspace.ug.edu.gh
RC-03
F2RG004
2IT1028K-150-241
SARI-3-11-10G0 24
BAESL0E0D7I B
F2RG010
LADUNI 1B
G35
SARI-3-E1M1-S8380-02
2S2A13RI-6-2-6
WITA1C0CKI--8T1O7N-3I
CS1OOA1LRSN1MI0G-U026O
G8-T52T
8
109R
0
0-98-A001
SAASROI-O5-35-5
GS5ARIV-1X3--0177--01021BFBA24AOSR2WOT2GGNU3O070T410A126
G52A02SOO
G941
4R2C2--041
EMS10-01
IITO8F672DKR-62G190080-475
AGSPO4S4AA
ARLSGIVNBGAA LA2RI-O1X-N5-0T09E-8-M0104
6824
ZITAO0AYIUTSAR8F7V2KX-R-
R2098A9K--6137-1
PADI-T-0GU9Y0-0A0902
I3ITT109278KK--269298-69
AGRAC-216
0 5 10 15
PC 1
Fig 2: Scatter plot of PC1 and PC2 of cowpea genotypes for polyphenols
 
 
 
 
 
 
111 
 
PC 2
-1
0 1 2 3
University of Ghana http://ugspace.ug.edu.gh
4.7.2 Crude protein and Mineral elements 
 
Results of principal component analysis for crude protein and the mineral elements are shown in 
Table 21. From the scree plot (Fig. 3) the first two principal components were more informative. 
The first principal component (PC1) showed 41.31% variability among the cowpea accessions 
while the second principal component (PC2) showed 20.57%. The first two principal components 
therefore showed a total of 61.88% variability. PC1 was highly and positively correlated to sodium, 
potassium, magnesium and iron. PC2 was highly and positively correlated to calcium, and nickel. 
Scatter plot of the first two principal components (Fig. 4) showed two major groups with two 
outliers. The two outliers were accessions EMS10-01 and 4223. 
 
 
 
Table 21: Principal Component Analysis among Cowpea genotypes showing relative importance 
of crude protein and mineral elements traits. 
 PC1 PC2 PC3 
Eigenvalue 2.89163 1.43964 1.04293 
% Total variance 41.31 20.57 14.90 
% Cumulative 41.31 61.88 88.47 
Trait  Eigen vectors   
CP (%) -0.1195 -0.4937 0.7009 
Ca (ppm) -0.0451 0.5429 0.0413 
Na (ppm) 0.5246 -0.0482 -0.2666 
K 0.5159 -0.0535 0.0967 
Mg 0.4786 -0.0801 0.3829 
Fe 0.4185 0.3900 0.2083 
Ni  -0.1951 0.5457 0.4864 
 
 
 
112 
 
University of Ghana http://ugspace.ug.edu.gh
 
0 2 4 6 8
Eigenvalues Mean
Fig. 3 Scree plot of eigenvalues of cowpea genotypes for mineral elements and crude protein
 
 
 
 
 
 
 
 
113 
 
0 1 2 3
University of Ghana http://ugspace.ug.edu.gh
 
 
 
EMS10-01
BOTN006
G7 RGC3-115
03
1
SAWRAFV2C2X2RC-10GI39-T0-0O07N2I
F2RG010 BOTNA0S0O2O9 AGRAC-216 4223
G50 F2RG01A1SOO4 IT08
G22 F2RG009 IT07SKA-R29I-92--6590-80 SAR
KI--135-101-2-8140810
F2RG012 IT08K- SARI-6-299
G24 BELEDI BG80 IT86D-610
RC-04LADUNI 1B ITO7K-299-6
AS007 IT98PKAA-SD6O2II-8TNT0UT8EYKMA-137-1
3G1O2 LINGA SAITRAPAGBO
I-75K-5-5AALA-298-45 SARI-1-50-81
SRZAACRA-0YV1UX-R0SA7A-R00V1X-09-004
SOSNAGRI-6-2
BAWUTA
OTIRT1A-60K-817-3
-2 0 2 4 6
PC 1
Fig.4 Scatter plot of PC1 and PC2 of cowpea genotypes for mineral elements and crude protein
 
 
 
 
114 
 
PC 2
-2
0 2 4 6
University of Ghana http://ugspace.ug.edu.gh
4.7.3 Amino acids 
 
Principal component analysis results for amino acid traits are shown in Table 22. From the scree 
plot (Fig. 5) the first two principal components were more informative. The first principal 
component (PC1) explained 40.67% variability among the cowpea accessions. The second 
principal component (PC2) explained 28.01% variation among the cowpea accessions. The first 
two principal components therefore showed a total of 68.68% variability. PC1 was highly and 
positively correlated to L-Isoleucine and Trans-4-Hydroxy-L-Proline. PC2 was highly correlated 
with L-Histidine, L-Valine and L-Methionine. Scatter plot of the two principal components are 
presented in Fig.6. One major group with sub-groups were observed. Accessions F2RG011, 
SARVX-09-004 and IT07K-298-45 were outliers. 
 
 
 
Table 22: Principal Component Analysis among Cowpea genotypes showing relative importance 
of amino acid traits. 
 PC1 PC2 PC3 
Eigenvalue 2.03335 1.40041 0.794264 
% Total variance 40.67 28.01 15.89 
% Cumulative 40.67 68.68 84.56 
    
Trait  Eigen vectors   
L-Histidine 0.0563 0.6856 0.6820 
LValine 0.0679 0.5799 -0.7238 
L-Methionine -0.1592 0.5660 0.0414 
L-IsoLeucine 0.6949 0.0065 0.0031 
Trans-4-Hydroxy-L-Proline 0.6957 0.0191 0.0224 
 
 
115 
 
University of Ghana http://ugspace.ug.edu.gh
 
1 2 3 4 5
Eigenvalues Mean
Fig. 5 Scree plot of eigenvalues of cowpea genotypes for amino acids
 
 
 
 
 
 
 
 
 
116 
 
.5 1.5
0 1 2
University of Ghana http://ugspace.ug.edu.gh
 
F2RG011
IT08K-
G5
G50 F2RG012 SONGOTRA
GACS8OO0L
GOM74UT1S0A-0R1I-13-17-12 SARVX-09-004
ASITO0O7K3-299-69 ZAAYURA ITO7K-298-45
AWGGA
ERCMACCSI-3-T20O1-0622 N
2I
BEF2L2ER1D3GI0 
SITA0R8K
B07
SFA2RRI-GIS6-3
-150-
-0A2-1R19019V-X1
2-040019-002
SAIGRTA03I-A8S52SK-05O-10O3-8790-1SLADR0UI8-A1N-SI5 O10B-N8TEMG24 6824 1 RIT98BORTCN-00302 RC-01 SA C-04
K-628 SARI-5-5-5
SAPRAVD
RI-IT-6-2-6 IT10K-817-3
APAGBAALA X-037
U
1-0
Y0A2 1
SA1ER14MI12-3S2-11 GOLINGAI0T1--O081B78KA-W29U9T-6A
4223 IT86D-610
-2 0 2 4 6
PC 1
Fig.6 Scatter plot of PC1 and PC2 of cowpea genotypes for amino acids
 
117 
 
PC 2
-2
0 2 4 6
University of Ghana http://ugspace.ug.edu.gh
 
4.7.3 Combined traits 
 
Principal component analysis results for combined traits of polyphenols, crude protein, mineral 
elements and amino acids are shown in Table 23. From the scree plot (Fig. 7) the first four principal 
components were more informative. The first principal component (PC1) explained 27.00% 
variability among the cowpea accessions. The second principal component (PC2) explained 
20.67%. The third principal component (PC3) explained 15.41% variation and the fourth principal 
component (PC4) explained 9.07% variation. The first four principal components therefore 
showed a total of 72.35% variability. Relatively PC1 was highly and positively correlated with 
syringic acid, vanillic acid, gallic acid but calcium and sodium showed a high and negative 
correlation. PC2 was highly correlated with sodium and iron. PC3 was also correlated with 
isoleucine and trans-4-hydroxy-l-proline positively. PC4 was positively correlated with L-valine. 
Scatter plots of the first four principal components are presented in Fig.8. Scatter plot for the first 
two principal components showed two major groups, accessions 312, SARVX-09-004 and IT07-
298-45 formed a sub-group of the larger group. Accessions SARI-1-50-81 and IT08K- formed a 
sub-group of the smaller group. Accessions 4223 and EMS10-01 were outliers. Scatter plots for 
PC1 and PC3 showed one major group with sub-groups, four outliers were identified. One major 
group with sub-groups was observed for scatter plot for PC1 and PC4. There were three outliers. 
Two major groups with outliers were identified for PC2 and PC3. One major group with sub-
groups and two outliers were identified for scatter plot for PC2 and PC4. Scatter plot for PC3 and 
PC4 showed one major group with sub-groups and two outliers. 
 
118 
 
University of Ghana http://ugspace.ug.edu.gh
Table 23: Principal Component Analysis among Cowpea genotypes showing relative importance 
of the combined traits of polyphenols, amino acids, crude protein and mineral elements. 
 PC1 PC2 PC3 PC4 
Eigenvalue 4.31953 3.33915 2.4663 1.45123 
% Total variance 27.00 20.87 15.41 9.07 
% Cumulative 27.00 47.87 63.28 72.35 
Trait Eigen vectors    
Syringic 0.4608 -0.0356 0.1605 0.0513 
Vanillic 0.4609 -0.0356 0.1604 0.0513 
Gallic 0.4603 -0.0361 0.1700 0.0624 
Quercetin 0.0959 0.1167 -0.2166 -0.0742 
L-Histidine -0.0742 -0.1284 -0.0406 0.4794 
LValine -0.1033 0.0286 0.0412 0.6363 
L-Methionine 0.0119 -0.1435 -0.3828 0.3957 
L-IsoLeucine -0.1573 -0.3071 0.4177 0.0688 
Trans-4-Hydroxy-L-Proline -0.1558 -0.3069 0.4145 0.0852 
CP (%) -0.1730 -0.2370 0.2554 0.0530 
Ca (ppm) 0.4468 -0.0284 0.2000 0.0799 
Na (ppm) -0.812 0.4581 0.1734 -0.1057 
K -0.0772 0.3926 0.3088 0.0791 
Mg -0.0892 0.3640 0.2298 0.2420 
Fe 0.0568 0.4419 -0.0171 0.2702 
Ni  0.1884 -0.0857 -0.2915 0.1546 
 
 
 
 
 
 
119 
 
University of Ghana http://ugspace.ug.edu.gh
0 5 10 15
Eigenvalues Mean
Fig.7 Scree plot of eigenvalues of cowpea genotypes for combined traits
 
 
120 
 
0 1 2 3 4
University of Ghana http://ugspace.ug.edu.gh
ISTAOR7VK4223 X
-2-0998--04054 ITO7K-298-EMS10-01 SARVXE-0M9
45
S-01004-01
IT10K-817-3 IT10K-817-3
ITBSSITO7K-299-6 ITO7K-AGAEA0RRLR8EIAIKI---D63C3--1-I--2 1152B911019---618208401 SSAARRII--15--
259-59-6 SARI-5-5-5 ITO7K-299-6
SARI-1-50-81 50-81 SARI-1-50-81
IT08K- SBI
422
PTAA9RW8DI312 K
3-U6-6T-22A-86 ITS9A8RKBI--6A62-W82-U6TA 4223
ZSRAAACGA
I-TUYA P
R-RY0VUA4XRC-0A-271-0601
31Z2RASCA
AYDI-TUYA
SONGOTRA SONA-R0
UV4RXA-0
IRTS0CA8-0K1- RCG-O01TRA
7-001AGRAC-216
IT08K-
GASSIATIPOA
ATS0AR0
RLO8G8I
IIN-6-299 SA I-6-299I-K-KB3
3TG--11-8-1-A1E5AA310M7L--12-A10
80 SARI-3-11-8841 GOALAIPSNAOIGTGNA0B8TAKEA-M1L3A7SI-T1A0R8KI-3-1-1510--120401
SAIL1TAS10RDO18IUKO-2-N91-5I3 017-B-810 I
BTITE087L6KED-D2-6I9 1B90-69 ITI8T60D7-K6-12099-6B9ELEDI B
BIAT2BF0WR2O721CKTUR3-N-T0G23A0900907
ALASDOUON9I 1B LAASDOUON9I 1B
AASWSSAAOGOIT8R6CN
3VODC
5
-TX
4
6IE-1-0T
2-
M09O
69
-NI SARVX-09-002 SARVX-09-002APAGGB24AALA
002 EMS10-01 SBFAO2RGTRING2-204111 0-
050207 G2B4FO2TRNG000027
SRPFAGAC2FRD5R-20GI0V
R
7I
1-TGU0Y1A0 -80 1S1A1RI-2-50-80
RC-0-G46X0--210-176-001
AW2GS2AG1O7C3OC54I-TONI G7 GWA2S32A5O1C3O4
ITSSZIG1TOA09OARNK8YLIG-K-U8I5-ON1-6R5GT72A-R8
CI-TONI
G22 A53G80 A GGFRG52C02R8-0G03010 G820G2F25R312 0R
GC0-1003
F2RG011 F2RG011
SARVX-09-004
ITO7K-298-45
-5 0 5 10 15 -5 0 5 10 15 -4 -2 0 2 4 6
PC1 PC1 PC2
F2RG011 F2RG011 F2RG011
IT08K- IT08K- IT08K-
ISTAOR7VXAGKR-2
-0998--0404 SARAC-2516 ITO7K-
V2X9-80-94-5004 SARAGRAC-216 AGRAC-216 ITO7
VKX--20998--04054
AGGS5O70 O4 GG75A0SOO4 G5G0A7SOO4
IITT0078KK--219590--62941 IT07K-299-6IT908K-150-241 IT08K-150-241SONGOTRA IT07K-299-69EMS10-01 SONEGMOS1T0R-A01 SONGOTRA EMS10-01
SARI-3-11-100 SARI-3-11-100 SARI-3-11-100
SARI-6-299 SARI-6-299 SARI-6-299
ZSABW2AER2
G
SYLAI1-
80 G80
OEU1C3D-ORC5I9A0I -B-T8O1NI ZAAYWU2A2R
G80
A1CSA3COIO-T9OSNABIRELI-E1-D5I0 B-81 W22A1C3CABIS-ETOLOOENZ9DIAI ABSYAURRI-A1-50-81
IRTSCB9AF8O-2R0KTR4I--N6G320-01800127-88 IRT9C8-0KB4F-O622TR8NG000027 SARI-3-11-88 FB2ORTGN002G35 G35 G35 00S7ARRCITI--90384K-628ITS1AG0IRTK20I--2885K1-57-1--5337-1 GSIT2A12R0KI--58I-T1507-58-3K-137-1 G22 IT08K-1S
-
3A
11-
7R-1II
8-T581-50-K5-817-3
SIRPTAASSACOFSRAAD-27O0ICRRI-K1-6N-VIT-G0--2TXU2309-E--Y15690MA0-96--80002 SPFRAA2SACRDAS-RI0GI-ROS-16CT0VNA--U12X0TR0-Y3-6EI0A-M29--5000I-2T8O0 7K-299-6 RFC2-R0SG3AS0RA10RI-2VA-X5RS-0C0O-P98-SN0A-A01TD0IRETI2-MIOT-6U7-K2Y-A6299-6
3SG1ALO2RALVDGINXU2G-N40A7I -10B01 312GSOGALR2IN4VGLXA-DUNI 1B G24LADGUON3LI1I N12BGAAPAGBAALA APAGB07A-A0L0A1 APSAAGRBVAXA-L07-001
B4A2W23UTA BAWUTA 4223 B4A2W23
A
UTA
111 111 111
IT86D-610 IT86D-610 IT86D-610
-5 0 5 10 15 -4 -2 0 2 4 6 -4 -2 0 2 4
PC1 PC2 PC3
Fig.8 Scatter plots of PC1,PC2,PC3 and PC4 of cowpea genotypes for combined traits
 
 
121 
 
PC4 PC2
-2 -4 -2
0 2 4 0 2 4 6
PC4 PC3
-2 -4 -2
0 2 4 0 2 4
PC4 PC3
-2 -4 -2
0 2 4 0 2 4
University of Ghana http://ugspace.ug.edu.gh
4.8 Cluster Analysis 
Polyphenols: Figure 9 shows a dendrogram of cowpea accessions constructed from polyphenol 
data. The scale for measure of dissimilarity ranged between 0 and 2000. Two major clusters were 
observed at a dissimilarity measure of 1500. Accessions EMS10-01 formed one group. 
Mineral elements and crude protein: Dendrogram constructed from data mineral elements and 
crude protein is shown in Fig. 10. Scale of dissimilarity measure ranged between 0 and 80. At a 
dissimilarity measure of 80, two clusters were identified. The major cluster was made up of 54 
cowpea accessions, while the other cluster consisted of only accession EMS10-01. 
Amino acids: Figure 11 shows dendrogram of cowpea accessions constructed from amino acids 
data. The scale of dissimilarity measure ranged from 0 to 0.0002. At a dissimilarity measure of 
0.00015 two clusters were formed. The smaller cluster comprised the three cowpea accessions 
Songotra, Zaayura and F2RG011. 
Combined data: Dendrogram constructed from combined data is presented in Fig. 12. Scale of 
dissimilarity measure ranged from 0 to 2000. At a dissimilarity measure of 1500, two clusters were 
formed. One cluster consisted of only one accession (accession EMS10-01). The major cluster 
consisted of 49 accessions. 
 
 
 
 
122 
 
University of Ghana http://ugspace.ug.edu.gh
Fig.9 Dendrogram of cowpea genotypes for polyphenols
 
 
 
 
123 
 
Dissimilarity measure
1000 1500 2000
500
0
RC-01
422
G22
G5
F2RG011
BAWUTA
G50
SARI-13-17-12
111
BOTN006
BOTN002
ASOO4
SARVX-07-001
SARI-5-5-5
SONGOTRA
SARI-2-50-80
SARI-6-299
SARI-6-2-6
IT10K-817-3
SARI-3-11-88
2213
WACCI-TONI
COLMUT10-01
312
ITO7K-299-6
IT08K-
SARVX-09-004
IT86D-610
442
6824
ZAAYURA
SARVX-09-002
IT07K-299-69
RC-04
GOLINGA
APAGBAALA
ITO7K-298-45
SARI-1-50-81
AGRAC-216
PADI-TUYA
IT98K-628
4223
AS008
ASOO3
ASOO9
ASONTEM
AS007
SARI-3-11-100
BELEDI B
F2RG010
212
IT08K-150-241
F2RG004
RC-03
LADUNI 1B
F2RG007
F2RG009
G7
IT08K-137-1
EMS30-02
G41
G80
G35
G24
EMS10-01
University of Ghana http://ugspace.ug.edu.gh
Fig.10 Dendrogram of cowpea genotypes for mineral elements and crude protein
 
 
 
 
124 
 
Dissimilarity measure
20 40 60 80
0
RC-01
SARVX-07-001
ZAAYURA
SARI-5-5-5
APAGBAALA
2213
BOTN006
F2RG009
IT98K-628
312
RC-04
G50
GOLINGA
BOTN002
ITO7K-298-45
SONGOTRA
SARI-6-2-6
BAWUTA
SARI-1-50-81
SARVX-09-004
IT10K-817-3
AS007
G24
LADUNI 1B
G35
SARI-2-50-80
WACCI-TONI
RC-03
ASOO4
PADI-TUYA
ASONTEM
ASOO9
G7
F2RG012
F2RG011
IT08K-137-1
IT86D-610
IT07K-299-69
111
F2RG007
SARVX-09-002
F2RG010
G80
G22
AGRAC-216
SARI-6-299
BELEDI B
IT08K-
SARI-3-11-88
SARI-3-11-100
IT08K-150-241
4223
ITO7K-299-6
EMS10-01
University of Ghana http://ugspace.ug.edu.gh
Fig.11 Dendrogram of cowpea genotypes for amino acids
 
 
125 
 
Dissimilarity measure
.00005 .00015
.0001 .0002
0
RC-01
SARVX-07-001
EMS10-01
BAWUTA
BOTN002
G35
APAGBAALA
RC-03
SARI-2-50-80
F2RG007
PADI-TUYA
AGRAC-216
ASOO3
SARI-13-17-12
312
GOLINGA
IT10K-817-3
111
G24
422
4223
IT86D-610
ITO7K-299-6
SARI-3-11-88
BELEDI B
6824
F2RG010
SARI-6-2-6
SARI-5-5-5
LADUNI 1B
IT08K-137-1
G50
RC-04
IT98K-628
SARI-6-299
SARI-1-50-81
IT08K-150-241
ASOO4
2213
AS008
G22
ASOO9
SARI-3-11-100
COLMUT10-01
ASONTEM
G5
F2RG012
G7
ITO7K-298-45
IT08K-
EMS30-02
IT07K-299-69
SARVX-09-004
WACCI-TONI
G80
SARVX-09-002
F2RG011
ZAAYURA
SONGOTRA
University of Ghana http://ugspace.ug.edu.gh
Fig.12 Dendrogram of cowpea genotypes for combined traits
 
 
 
 
 
 
 
 
126 
 
Dissimilarity measure
1000 1500 2000
500
0
RC-01
G22
RC-04
F2RG011
G50
BAWUTA
2213
WACCI-TONI
SONGOTRA
SARI-2-50-80
SARI-6-299
SARI-3-11-88
312
ITO7K-299-6
IT08K-
SARVX-09-004
IT86D-610
GOLINGA
ITO7K-298-45
APAGBAALA
SARI-1-50-81
ZAAYURA
SARVX-09-002
IT07K-299-69
IT98K-628
AGRAC-216
PADI-TUYA
111
SARI-6-2-6
IT10K-817-3
BOTN002
SARVX-07-001
ASOO4
SARI-5-5-5
4223
BELEDI B
SARI-3-11-100
F2RG010
RC-03
IT08K-150-241
LADUNI 1B
F2RG007
G7
ASOO9
ASONTEM
G35
G80
IT08K-137-1
G24
EMS10-01
University of Ghana http://ugspace.ug.edu.gh
4.9 Genetic diversity and population structure 
4.9.1 Genetic diversity 
 
Allele Frequencies and Nei’s genetic diversity:  
Table 24 shows some aspect of genetic variation statistics for the three cowpea SSR markers. A 
total of eight loci were identified. The allele frequencies ranged from 0.067 (marker 34, SSR1-1) 
to 0.803 (marker 21, SSR2-1). Nei’s genetic diversity ranged between 0.246 (marker 34, SSR1) 
and 0.689 (marker 35, SSR1) with a mean of 0.542. 
 
4.9.2 Population structure 
 
Bayesian Clustering: Population structure analysis showed that K = 4 was the most suitable 
number of sub-populations. This implies that there were four sub-populations in the cowpea 
accessions as shown in Fig.13. Table 25 presents proportion of inferred ancestry of individual 
accessions in each of the four clusters. Cluster 1 had the lowest proportion of membership of 0.124, 
while Cluster 3 had the highest proportion of 0.317.  
 
127 
 
University of Ghana http://ugspace.ug.edu.gh
Fig. 13 Population structure of cowpea accessions in K=4 clusters. Red = cluster 1; Green = 
cluster 2; Yellow = cluster 3; Blue = cluster 4. 
 
 
Membership probabilities of accessions in each cluster: Table 26 shows membership 
probabilities for inferred ancestry of individual cowpea accessions in each of the four clusters.  
Membership probabilities ranged from 0.466 (GENO06, cluster 3) to 0.985 (GENO69, cluster 1). 
 
Estimated allele frequency in each cluster: Table 27 shows the estimated frequencies for 
ancestral alleles and those in each of the four clusters. Ancestral allele frequencies ranged between 
0.128 (SSR1-2, SSR21-2) and 0.802 (SSR8-1). Within Cluster 1 the allele frequencies ranged from 
0.008 (SSR7-2) to 0.993 (SSR8-1), while in Cluster 2 they ranged from 0.001 (SSR2-2, SSR7-2) 
to 0.998 (SSR8-2). The allele frequencies in Cluster 3 ranged from 0.012 (SSR2-2) to 0.913 
(SSR3-1), while in Cluster 4 they ranged between 0.003 (SSR7-2) to 0.997 (SSR5-1).   
 
128 
 
University of Ghana http://ugspace.ug.edu.gh
Allele-frequency divergence among clusters: Table 28 shows results for allele-frequency 
divergence among the four clusters. It ranged from 0.145 (between Clusters 2 and 4) to 0.466 
(between Clusters 1 and 3). 
 
Average distance (expected heterozygosity) between individual in the same cluster: Results 
for average distance between individual cowpea accessions in the same cluster are presented in 
Table 29. Average distance ranged from 0.084 (in Cluster 4) to 0.26 (in Cluster 3). 
 
Genetic differentiation (Fst) and geneflow (Nm): Table 30 shows results for mean genetic 
differentiation and gene flow among the four clusters. Mean Fst values ranged from 0.374 (Cluster 
3) to 0.687 (Clusters 2 and 4). Mean gene flow ranged from 0.228 (Clusters 2 and 4) to 0.837 
(Cluster 3). 
 
 
 
 
 
 
 
 
 
129 
 
University of Ghana http://ugspace.ug.edu.gh
Table 24: Genetic variation statistics for three cowpea SSR loci 
Marker Loci Allele Allele Nei’s diversity 
frequency 
34 SSR1 0 0.933  
  1 0.067 0.246 
 SSR2 0 0.739  
  1 0.261 0.545 
 SSR3 0 0.360  
  1 0.640 0.654 
     
35 SSR1 0 0.547  
  1 0.453 0.689 
 SSR2 0 0.378  
  1 0.622 0.663 
 SSR3 0 0.765  
  1 0.235 0.546 
     
21 SSR1 0 0.822  
  1 0.178 0.469 
 SSR2 0 0.197  
  1 0.803 0.497 
Mean    0.542 
Standard deviation    0.144 
 
Allele 0 = absent;  Allele 1 =  present 
 
 
 
 
Table 25: Overall proportion of membership of the sample in each of the 4 clusters 
Cluster Proportion of membership 
1 0.124 
2 0.317 
3 0.281 
4 0.278 
 
 
 
130 
 
University of Ghana http://ugspace.ug.edu.gh
Table 26: Membership probabilities of Inferred ancestry of individual cowpea genotypes  
Cluster Accession name Individual  Probability 
1 IT01K-298-45 GENO20 0.840 
1 6312 GENO52 0.547 
1 422 GENO67 0.969 
1 F2RG007 GENO68 0.984 
1 F2RG010 GENO69 0.985 
1 F2RG009 GENO70 0.967 
2 Padi-tuya GENO2 0.942 
2 Asontem  GENO4 0.952 
2 * GENO7 0.956 
2 BELEDI B GENO25 0.934 
2 IT07K-299-69 GENO26 0.913 
2 SARI-3-11-180 GENO27 0.917 
2 4228 GENO28 0.955 
2 IT08K- GENO36 0.918 
2 SARI-6-2-9 GENO37 0.902 
2 SARI-3-11-100 GENO39 0.956 
2 EMS10-01 GENO40 0.956 
2 BOTN003 GENO41 0.963 
2 AS006 GENO42 0.963 
2 EMS30-02 GENO43 0.901 
2 AS010 GENO47 0.915 
2 AS009 GENO53 0.954 
2 RC-02 GENO54 0.952 
2 AS003 GENO55 0.961 
2 F2RG004 GENO56 0.662 
2 684 GENO57 0.961 
2 BON006 GENO58 0.958 
2 RC-01 GENO60 0.500 
2 G80 GENO61 0.913 
2 G5 GENO76 0.961 
3 Zaayura  GENO1 0.863 
3 Apaagbala  GENO3 0.891 
3 Bawuta  GENO5 0.975 
3 Songotra GENO6 0.466 
3 * GENO22 0.912 
3 * GENO23 0.959 
3 * GENO24 0.883 
3 IT08K-150-24 GENO32 0.910 
 
 
 
 
131 
 
University of Ghana http://ugspace.ug.edu.gh
Table 26 cont’d  
Cluster Accession name Individual  Probability 
3 Agrac-216 GENO33 0.860 
3 SARI-1-50-81 GENO34 0.908 
3 AS005 GENO35 0.913 
3 IT08K GENO38 0.807 
3 WACCI TONI GENO44 0.913 
3 BOTN002 GENO45 0.857 
3 2213 GENO46 0.980 
3 AS010 GENO48 0.967 
3 L69 GENO49 0.867 
3 G41 GENO59 0.976 
3 G84 GENO62 0.965 
3 212 GENO63 0.941 
3 442 GENO72 0.943 
3 G35 GENO73 0.575 
3 G7 GENO74 0.514 
3 G22 GENO75 0.847 
4 * GENO7 0.941 
4 * GENO8 0.945 
4 * GENO9 0.968 
4 * GENO10 0.820 
4 * GENO11 0.942 
4 * GENO12 0.680 
4 SARVX-09-04 GENO13 0.967 
4 * GENO14 0.969 
4 * GENO15 0.946 
4 SARI-13-17-2 GENO18 0.970 
4 SARI-5-5-5 GENO19 0.944 
4 111 GENO29 0.968 
4 SARI-2-50-80 GENO30 0.584 
4 LUNDI 1B GENO31 0.969 
4 AS004 GENO50 0.968 
4 COLMUT10-01 GENO51 0.968 
4 Asontem GENO64 0.820 
4 F2RG004 GENO65 0.969 
4 RC-03 GENO66 0.588 
4 I98K-503-1 GENO71 0.969 
4 F2RG002 GENO77 0.846 
 
 
 
 
132 
 
University of Ghana http://ugspace.ug.edu.gh
Table 27: Estimated Allele Frequencies in each cluster  
Locus  Allele  Ancestral  Cluster 1 Cluster 2 Cluster 3 Cluster 4 
SSR1 1 0.295 0.616 0.005 0.130 0.053 
* 2 0.705 0.384 0.995 0.870 0.947 
SSR2 1 0.452 0.316 0.510 0.311 0.289 
 2 0.128 0.656 0.001 0.012 0.001 
* 3 0.420 0.028 0.489 0.677 0.710 
SSR3 1 0.757 0.240 0.994 0.913 0.992 
* 2 0.243 0.760 0.006 0.087 0.008 
SSR4 1 0.612 0.978 0.898 0.027 0.995 
* 2 0.388 0.022 0.102 0.973 0.005 
SSR5 1 0.781 0.984 0.998 0.430 0.997 
* 2 0.219 0.016 0.002 0.570 0.003 
SSR6 1 0.463 0.952 0.006 0.095 0.993 
* 2 0.537 0.048 0.994 0.905 0.007 
SSR7 1 0.382 0.972 0.394 0.146 0.024 
 2 0.128 0.008 0.001 0.048 0.003 
* 3 0.491 0.020 0.605 0.806 0.973 
SSR8 1 0.802 0.993 0.998 0.842 0.970 
* 2 0.198 0.007 0.002 0.158 0.030 
• Frequency of missing allele 
 
 
 
 
 
Table 28 Allele-frequency divergence among pops (Net nucleotide distance), computed using 
point estimates of P. 
 Cluster 1 Cluster 2 Cluster 3 
Cluster 1    
Cluster 2 0.314   
Cluster 3 0.466   
Cluster 4 0.280 0.145 0.265 
 
 
 
133 
 
University of Ghana http://ugspace.ug.edu.gh
Table 29: Average distances (expected heterozygosity) between individual cowpea genotypes in 
the same cluster: 
Cluster Average distance 
1 0.193 
2 0.131 
3 0.267 
4 0.084 
 
 
 
 
 
 
Table 30: Estimated mean genetic differentiation (Fst) and gene flow among the four clusters. 
Cluster Mean Fst value Gene Flow 
1 0.632 0.291 
2 0.687 0.228 
3 0.374 0.837 
4 0.687 0.228 
 
 
 
 
 
 
 
 
134 
 
University of Ghana http://ugspace.ug.edu.gh
4.10 Principal Component Analysis 
Table 31 shows the results for principal component analysis. The first two principal components 
explained 23.17% and 21.30% of the total variation, respectively. The first two principal 
components therefore explained 44.47% of the total variation. The first four principal components 
however explained a total of 71.11% of the total variation.  PC1 was positively correlated with 
markers SSR4 and SSR5. PC2 was negatively correlated with marker SSR3 but positively 
associated with SSR2 and SSR7. PC3 was positively associated with marker SSR6 but negatively 
associated with marker SSR8. PC4 was positively associated with markers SSR1, SSR3 and SSR8 
but negatively associated with marker SSR7. Scatter plots of the four principal components are 
presented in Fig.15. One major group with sub-groups was formed with an outlier GENO69 
(accession F2RG010) by scatter plot for PC1 and PC2. Scatterplot for PC1 and PC2 also formed 
one major group with outliers. PC1 and PC4 formed three major groups; the smallest group was 
made up of GEN062 (accession G84), GEN038 (IT08K) and GEN046 (accession 2213). PC2 and 
PC3 also formed three main groups with genotypes GEN024, GEN077 (F2RG002) and GEN023 
as outliers. PC2 and PC4 formed three main groups. PC3 and PC4 formed one major group with 
sub-groups. 
 
4.11 Cluster analysis 
Dendrogram of cowpea accessions based on genetic data is presented in Fig. 16. The scale for 
dissimilarity measure ranged between 0 and 2.5. Two major clusters were formed at a dissimilarity 
measure of 2.5. The larger cluster formed four sub-clusters, while the smaller main cluster formed 
three sub-clusters. 
 
135 
 
University of Ghana http://ugspace.ug.edu.gh
Table 31: Principal Component Analysis among Cowpea genotypes based on polyphenol traits. 
 PC1 PC2 PC3 PC4 
Eigenvalue 1.85396 1.70388 1.19082 0.940238 
% Total variance 23.17 21.30 14.89 11.75 
% Cumulative 23.17 44.47 59.36 71.11 
Trait Eigen vectors    
SSR1 -0.1434 0.3699 0.4419 0.5663 
SSR2 -0.1271 0.4554 -0.1648 0.2643 
SSR3 0.2959 -0.4131 0.0381 0.4769 
SSR4 0.5934 0.3162 -0.0137 -0.1547 
SSR5 0.6221 0.0711 -0.2218 -0.0426 
SSR6 0.2842 0.2914 0.6322 -0.1000 
SSR7 -0.2305 0.4301 -0.1184 -0.4302 
SSR8 0.0531 0.3321 -0.5596 0.4009 
 
 
 
 
 
136 
 
University of Ghana http://ugspace.ug.edu.gh
0 2 4 6 8
Eigenvalues Mean
Fig.14 Scree plot of eigenvalues of cowpea genotypes for SSR markers
 
 
 
 
137 
 
.5 1.5
0 1 2
University of Ghana http://ugspace.ug.edu.gh
GENO24 GENO24
GENO689
GENO77 GENO77
GEGNEON76O071260
GENO60
GENO52
GENO734 GENO56 GENO38 GENO23 GENO23 GENO38
GENO38 GEGNEOGN45EO13712GENOG4E9NO1 GGEEN
NNOOO366106127804159 GENO6140 GENO1640
GENGOE7N5O62 GGEENNOO5473657324159807
GENO75316299410538 GENO46 GENOG6E98NO1206 GENO46 GENOG12E06NO698
GGEENNOO674236 GENO43853
GENO62 GENO62
GENO2436176 GENO49 GENO57693120519348 GENGOEGENO12 G2753196
N1403895O49
GENO2453254 GGENENOO6306
E
1728519 GGEEN
NOO636012
GENO59 NO2871519
GENO77 GENO59 GGEENNOOG667E007NO52 GENO59 GEGNEONG5OE2N60O6707
GENOG7E5NO6723 GENOG76E23NO75
GENO24 GENO4325452 GENO3452425
GENO23 GENO734 GENO2634176 GENO3642176 GENO734
GENOG34835GEENNOO45735372643451257908 GEGNGOEENN34538OO41253574395807734256GENO1GE GENO1GNEON5O654173 GGEENNOO5471356
-4 -2 0 2 -4 -2 0 2 -4 -2 0 2 4
PC 1 PC 1 PC 2
GENO62 GENO62 GENO62
GENO38 GENO38 GENO38
GENO46 GENO46 GENO46
GENO6140 GENO6140 GENO1604
GENO60 GENO60 GENO60
GENO1206 GENO2160 GENO2160
GENO34853 GENO43583 GENO34853
GENO59 GENO3421575089 GENO59GENO5213458790 GENO1342509587GENO5423524 GENO8271159 GENO4235245 GENO7182915 GENGOEG3245N245EON5O91872519
GENO49 GENO2436671 GENO6423761GENO32517969130584 GENGOE6917235N9531084O49
GENO2436176
GGEENNOO5179632491803459
GENO6732 GENGOE6N98O45173GENO1 GENO52 GENO7623
GENO45137 GENO698 GENO45173 GENO689
GENGOE1NO52 GENOG1EGNEON76O2352
GENGOE5N6O4573235764 GENOG5743E352467NO56 GGEENNOO563754635427
GENO6360 GENO6360 GENO3606
GENO743 GENO743 GENO743
GENO2G3 ENO12 GENO12 GENO12GENO75 GENO24 GEGNEON2O324 GENO23 GENO24GENO6707 GENO75 GENO6707 GEGNEON7O57607
GENO77 GENO77 GENO77
-4 -2 0 2 -4 -2 0 2 4 -1 0 1 2 3 4
PC 1 PC 2 PCt 3
Fig.15 Scatter plots of PC1,PC2,PC3 and PC4 of cowpea genotypes for SSR markers
 
 
 
 
 
138 
 
PC 4 PC 2
-2 -1 -4 -2
0 1 2 3 0 2 4
PC 4 PC 3
-2 -1 -1
0 1 2 3 0 1 2 3 4
PC 4 PC 3
-2 -1 -1
0 1 2 3 0 1 2 3 4
University of Ghana http://ugspace.ug.edu.gh
 
 
 
 
 
Fig.16 Dendrogram of cowpea genotypes for SSR markers
 
139 
 
Dissimilarity measure
.5 1.5 2.5
0 1 2
GENO1
GENO3
GENO33
GENO45
GENO48
GENO56
GENO2
GENO6
GENO26
GENO27
GENO36
GENO47
GENO61
GENO4
GENO17
GENO25
GENO28
GENO39
GENO40
GENO58
GENO7
GENO8
GENO11
GENO15
GENO19
GENO21
GENO9
GENO13
GENO14
GENO18
GENO29
GENO31
GENO50
GENO51
GENO65
GENO71
GENO10
GENO64
GENO12
GENO77
GENO30
GENO66
GENO37
GENO42
GENO43
GENO54
GENO55
GENO76
GENO16
GENO20
GENO52
GENO41
GENO53
GENO57
GENO60
GENO67
GENO70
GENO68
GENO69
GENO5
GENO22
GENO32
GENO34
GENO35
GENO44
GENO23
GENO24
GENO46
GENO59
GENO38
GENO62
GENO49
GENO73
GENO74
GENO63
GENO72
GENO75
University of Ghana http://ugspace.ug.edu.gh
CHAPTER FIVE 
DISCUSSION 
 
5.1 Morphological Characterization 
Morphological markers can be classified under qualitative and quantitative markers. The use of 
such markers play a vital role in germplasm characterization and evaluation though some of them 
are influenced by environmental conditions and variation in developmental stages (Khan et al., 
2015). Most researchers have used morphological markers to characterize cowpea accessions. 
Lazaridi et al. (2017) used the following morphological markers to characterize and study 
phenotypic diversity in cowpea local populations from Greece: leaf colour, terminal leaflet shape, 
growth habit, plant pigmentation, immature pod pigmentation, immature pod colour, seedcoat 
colour and eye colour (seedcoat pattern). In the current study, the following morphological markers 
were used: growth habit, main pod pigment, pod colour, seedcoat colour, seedcoat pattern, leaf 
colour, plant pigmentation, immature pod tip colour, v-marking, raceme position, terminal leaflet 
shape and flower bud tip pigment. 
Four different types of growth habit were observed. The most frequent type was erect growth habit 
with a frequency of 64.8%. This observation was at variance with that of Lazaridi et al., (2017) 
who observed seven different forms of growth habit with 37% frequency for erect growth habit. 
The difference could be attributed to sample size and the different germplasm sources and cowpea 
accessions. The high frequency of the erect growth habit will be helpful in selection in breeding 
programs since it facilitates harvesting.  
Pigmentation is a very important trait to cowpea geneticists and breeders because it is inherited in 
a simple mendelian fashion and can therefore serve as a genetic marker. For instance, Asante and 
Laing (1991) in a study of genetic linkage observed that flower bud tip colour is inherited in a 
140 
 
University of Ghana http://ugspace.ug.edu.gh
simple mendelian manner. In the current study, pigmentation was analyzed under the following: 
plant pigmentation, immature pod tip colour and flower bud tip colour. Four different forms of 
plant pigmentation were observed in the current study out of which the most frequent was very 
slight plant pigmentation (53.0%). In a similar study Lazaridi et al. (2017) observed seven different 
forms of plant pigmentation with absence of plant pigmentation being the most frequent (78/0%). 
Asare et al. (2011) also in a similar study observed five different forms of plant pigmentation. 
However, in the current study absence of plant pigmentation occurred at a frequency of 6.1%. 
These differences between the current study and those of Lazaridi et al. may be due to differences 
in types of accessions and sample sizes studied. 
Seedcoat colour and seedcoat pattern are consumer traits which are consciously or  
unconsciously under selection by either farmers or consumers. Lazaridi et al. (2017) reported in a 
study on diversity in cowpea local populations from Greece seven (7) different forms of seedcoat 
colour and eleven (11) different types of seedcoat pattern (eye colour). Asare et al. (2011) in a 
similar study observed ten (10) different types of seedcoat colour and five (5) different forms of 
seedcoat pattern. Lazaridi et al. (2017) reported that white and cream seedcoat colour were most 
frequent with frequencies of 32.4% and 36.1%, respectively. In this study, ten (10) different types 
of seedcoat colour and seven (7) different types of seedcoat pattern were observed. Cream seedcoat 
colour was the most frequent, occurring at a frequency of 51.6% and solid seedcoat pattern was 
the most frequent at a frequency of 50.0%. The differences observed between the results of the 
current study and those of the previous studies could be due to sample size or different accessions 
used for the studies. 
Raceme position is a reflection on the position of pods on the cowpea plant. Raceme position can 
also enhance pod harvesting. Pods above canopy are easier to harvest than those below canopy 
141 
 
University of Ghana http://ugspace.ug.edu.gh
level (Bennet-Lartey,1991). In the present study three (3) different forms of raceme position were 
observed which was in accordance with that of Asare et al. (2011) who observed three (3) different 
forms of raceme position.  
 
5.2 Variability of crude protein and mineral elements 
Protein and mineral elements are very important dietary requirements in both humans and animals. 
Cowpea among other crops serves as an important source of protein and mineral elements. Crude 
protein and mineral elements compositions have been studied by researchers. Chikwendu et al. 
(2014) carried out a study on chemical composition of processed cowpea tender leaves and husks 
to determine crude protein and mineral elements profile. Boukar et al. (2011) evaluated cowpea 
germplasm lines for protein and mineral concentrations in cowpea grains. In the current study, 
percent crude protein and the following twelve mineral elements were analyzed: calcium, sodium, 
potassium, magnesium, iron, copper, nickel, lead, cadmium, manganese, chromium and zinc. 
Mean crude protein concentration was 13.80%. mean concentration for calcium was 1.59 ppm, 
sodium was 3.56 x 10-3 ppm, potassium was 10.405 ppm, magnesium was 0.288 ppm, iron was 
0.048 ppm, copper was not detected, nickel was 0.033 ppm, lead was 0.038 ppm, cadmium was 
17.0 x 10-4 ppm, manganese was 0.0187 ppm, Chromium was 0.00168 ppm and zinc were 0.00402 
ppm. These values were very low as compared to those of Boukar et al. (2011) who recorded the 
following mean concentrations: 24.8% (crude protein), 826 mg/kg (calcium), 14,880 mg/kg 
(potassium), 1915 mg/kg (magnesium), 53.2 mg/kg (iron) and 38.1 mg/kg (zinc). Lazaridi et al. 
(2017) also obtained the following: 24.17% (crude protein), 0.91 mg/g (calcium), 0.98 mg/g 
(magnesium), 27.54 mg/g (iron), 6.15 mg/g (potassium), 35.78 mg/g (manganese) and 40.09 mg/g 
(zinc). The discrepancies could be due to accession differences and edaphic factors. 
 
142 
 
University of Ghana http://ugspace.ug.edu.gh
5.3 Variability of polyphenols 
Phenolic compounds contribute to antioxidant activities of cowpea (Sombie et al., 2018). It is 
believed that cowpea seeds have positive health effects with regard to their antioxidants, 
hypoglycaemic, hypolipidaemic and antihypertensive properties (Kapravelou et al., 2015). In the 
present study, gallic acid, syringic acid, quercetin and vanillic acid were analysed. Their mean 
concentrations were 60.97 ppm, 104.25 ppm, 69.58 ppm and 52.79 ppm, respectively. In a similar 
study by Chikwendu et al. (2014) polyphenols and flavonoids were analysed in fresh leaves, dry 
leaves and husks. They recorded the following percent concentrations for flavonoids: 26.72%, 
3.77% and 1.13%, respectively and the following percent concentrations for polyphenols: 32.56%, 
9.55% and 9.05%, respectively. These values were higher than those of the present studies, though 
they did not carry out analysis on the individual polyphenols. 
 
5.4 Variability of amino acids 
Amino acids are end-products of protein digestion and are building blocks of proteins which are 
essential for life. There are two main groups of amino acids, essential and non-essential amino 
acids. In the present study nineteen amino acids were analyzed, seven essential and twelve non-
essential. The seven essential ones were valine, methionine, iso-leucine, phenylalanine, threonine 
(below detection), histidine and tryptophan. The non-essential ones were L-aspartic, glutamine 
(below detection), L-lysine (below detection), B-threonine (below detection), L-asparagine, DL-
alpha-alanine, (below detection), L-cysteine (below detection), D-proline, Trans-4-hydroxy-L-
alanine, glycine and L-serine. In a similar study Ukpene and Imade (2015) analysed amino acid 
profile of seven cowpea varieties from the International Institute of Tropical Agriculture. Eighteen 
(18) amino acids were analysed out of which eight were essential and ten were non-essential. None 
of the eighteen was below detection as occurred in the present study. Amino acid concentrations 
143 
 
University of Ghana http://ugspace.ug.edu.gh
for the current study were below those of Ukpene and Imade. The differences observed between 
the results of the present work and those of previous work may be explained on the basis of 
accession difference and sample sizes investigated.  
 
5.5 Test of association and pairwise correlation. 
Knowledge of association and pairwise correlation is extremely useful in breeding programmes 
and identification of traits. Association and pairwise correlation may be the result of either genetic 
linkage or pleiotropy. In this study, twenty-four significant associations were observed among the 
fifty-four different classes of morphological traits as follows: growth habit with two morphological 
traits, main pod colour with four traits, pod colour with six traits, seedcoat colour with three traits, 
seedcoat pattern with four traits, leaf colour with two traits, immature pod tip colour, v-marking 
and raceme position all with one trait each, respectively. Sixty-three different significant pairwise 
correlations were also recorded. Twenty-nine were observed among the nineteen amino acids, 
three among the four polyphenols, twenty-three between amino acid and polyphenol out of which 
thirteen were negative, four between amino acid and crude protein out of which one was negative 
and four between mineral and polyphenol. This implies that for traits in which positive correlations 
were observed their concentrations can be increased concurrently through breeding programme. 
No significant correlation was observed either among mineral elements or between mineral 
elements and crude protein in the study. However, Boukar et al. (2011) in a study to evaluate 
cowpea germplasm for protein and mineral concentrations in grains recorded positive and 
significant correlations among iron, zinc and magnesium. They also observed significant and 
positive correlation between crude protein and iron. Asante et al. (2007) in a study to determine 
mineral components of cowpea using instrumental neutron activation analysis reported significant 
and positive correlations between magnesium and calcium, copper and manganese; copper and 
144 
 
University of Ghana http://ugspace.ug.edu.gh
manganese. They also observed significant and negative correlation between sodium and calcium. 
Asante et al. (2006) also reported significant and positive correlation between percent crude 
protein and sodium and significant and negative correlation between percent crude protein and 
calcium. The difference between the current study and those of previous findings could be the 
result of differences in soil types and cowpea accessions investigated.  
 
5.6 Distribution of mean concentrations of phytochemicals across morphological traits 
Qualitative traits can sometimes serve as reliable genetic markers. Their association with desirable 
traits can therefore serve as a useful guide to select for traits of economic importance. Though 
there is not enough literature on cowpea phytochemical distribution across morphological traits, 
Asante, et al. (2006) reported in a study of variation in contents of crude protein and mineral 
elements in 32 cowpea accessions in Ghana that, black seedcoat colour had the highest 
concentration of crude protein while cream seedcoat colour had the highest concentration of 
magnesium. The current study reports on levels of phytochemical traits across some morphological 
traits.  
Polyphenols: The highest mean concentrations of gallic acid, syringic acid vanillic acid were 
observed in cowpea genotypes with semi-prostrate growth habit, while highest mean concentration 
of quercetin occurred in genotypes with black seedcoat colour. 
Crude protein and mineral elements: For these traits, the highest mean concentration of calcium 
occurred in accessions with semi-prostrate growth habit. Cowpea accessions with no pigmented 
main pod pigmentation had the highest mean sodium concentration. Accessions with hastate 
terminal leaflet shape had the highest potassium mean concentration. Highest mean iron 
concentration occurred in genotypes with prostrate growth habit and the highest mean percent 
crude protein concentration occurred in accessions with prostrate growth habit.   
145 
 
University of Ghana http://ugspace.ug.edu.gh
Amino acid: Highest mean concentration of L-histidine occurred in accessions with dark mottled 
pod colour. Glycine occurred in only accessions with black mottled seedcoat colour. Flesh pod 
colour and flesh seed coat colour had the highest mean concentration of L-asparagine, respectively. 
Highest mean concentration of DL-Alpha-Alanine occurred in accessions with black mottled seed 
coat colour. Highest concentration of L-aspartic acid was associated with dark mottled pod colour. 
Highest mean concentration of L-valine occurred in accessions with brown pod colour. Accessions 
with flesh seedcoat colour were associated with the highest mean concentration of D-proline. 
Accessions with black mottled seedcoat colour were associated with highest mean concentration 
of methionine. Highest concentration of Iso-Leucine occurred in accessions with red seedcoat 
colour. Accessions with black eye seedcoat pattern had highest mean concentration of Trans-4-
Hydroxy-L-Proline. Highest mean concentration of L-Tyrosine occurred in accession with brown 
mottled seedcoat colour. Accessions with light brown pod colour had highest mean concentration 
of DL-Beta-phenyl-Alanine. Highest mean concentration of L-tryptophan occurred in accessions 
with dark purple pod colour. Songotra had the highest mean concentration of L-histidine. The 
highest mean glycine concentration occurred in the accession F2RG011. Accession G80 scored 
the highest mean concentrations of L-Asparagine and DL-Alpha-Alanine. The highest mean 
concentration of L-Aspartic acid occurred in accession COLMUT10-01, while the highest 
concentration of L-Valine occurred in accession IT08K. The highest mean concentration of L-
Proline occurred in accession occurred in accession SARVX-09-009, while the highest 
concentration of methionine occurred in accession F2RG011. Accession IT07K-298-45 scored the 
highest mean concentration of Trans-4-Hydroxy-L-Proline, while accession G80 scored the 
highest mean concentration of L-Tyrosine.  The highest mean concentration of DL-Beta-phenyl-
Alanine occurred in accession SARI-6-299, while the highest of L-Tryptophan occurred in 
146 
 
University of Ghana http://ugspace.ug.edu.gh
accession F2RG012. The amino acid that scored the highest mean concentration was L-
Tryptophan.  
 
5.7 Variability of traits in relation to source of cowpea accessions 
The source of germplasm can have impact on its variability. For instance, cowpea accessions 
collected from Deciduous forest zone flowered late while those from Guinea savanna and Sudan 
savanna zones flowered early (Asante, 1998), percentage pod set was higher in accessions from 
Deciduous forest zone, while those from the Savanna zone had low percentage pod set per plant 
(Asante, 1998). In the current study, the DPEB and SARI germplasm differed in some 
morphological traits, for instance prostrate and semi-prostrate growth forms were absent in the 
germplasm from the SARI accessions. Brown, buff and light brown were the only pod colours 
present in the SARI collection, while a total of eight pod colours were observed in DPEB 
accessions. Four out of ten seedcoat colours were present in SARI germplasm, while nine were 
present in DPEB accessions. Four out of seven seedcoat patterns were present in SARI germplasm 
while six were present in DPEB. Pale green leaf colour was absent in SARI accessions however it 
was present in DPEB accessions. V-marking was also absent in SARI accessions but present in 
DPEB. The two sources differed significantly with reference to their mean differences for some of 
the phytochemical traits. They differed significantly with reference to phytochemical traits 
including quercetin, nickel, manganese, zinc and chromium. The differences observed between the 
two sources might be due to different accessions from the two sources. DPEB accessions are made 
up of landraces collected from the CSIR-Plant Genetic Resource Research Institute, Bunso and 
kept in the Department of Plant and Environmental Biology (DPEB) University of Ghana over the 
years for students’ project work, they also consist of accessions that have been treated with 
colchicine and EMS and five of the accessions were F2 generation from a bi-parental cross. The 
147 
 
University of Ghana http://ugspace.ug.edu.gh
SARI collection on the other hand consists of accessions from either the International Institute of 
Tropical Agriculture or CSIR-Savanna Research Institute where the accessions might have 
undergone some level of improvement and artificial selection leading to reduction in variability.  
 
5.8 Phenotypic diversity within subdivided population 
In the present study a relatively low average of total variation (Ht = 0.162; Ht = 0.121) based on 
crude protein and mineral elements and polyphenol data was observed respectively. Lead, 
manganese, syringic acid (class 63.0 - 135.0) and quercetin (class 77.0 – 92.0) showed Ht values 
greater than 0.460. Again, high level of within population diversity was shown by lead (Hs = 
0.468), syringic acid (class 63.0 - 135.0) and quercetin (class 77.0 – 92.0). Average within 
population diversity for polyphenol data (Hs = 0.105) was far lower than among population’s 
diversity (Gst = 0.434). This low within population diversity may be due to the fact that cowpea is 
a predominantly self-pollinating species. This result does not agree with that of Ghalmi et al. 
(2010) who reported no intra-landrace variation for qualitative and no inter landrace diversity for 
quantitative traits in Algerian on-farm cowpea landraces. This is in contrast to Lazaridi et al. 
(2017) who reported a high level of within population diversity (Hs = 0.34). The Gst value in this 
current work is higher than that reported by Lazaridi et al. (2017) and for other predominant self-
pollinating species (Nybom et al., 2004). Gst mean for the current study was higher than what was 
reported by other researchers who analyzed genetic diversity of cowpea using AFLPs (Polegri and 
Negri, 2010) and isozymes (Asante and Laing, 2001). 
 
5.9 Classification of the Total Cowpea Population. 
In the current study, population classification was based on PCA analysis for the phytochemical 
data. The first two axes of PCA for polyphenols explained 99.86% of total variation; this is 
148 
 
University of Ghana http://ugspace.ug.edu.gh
possibly due to high levels of inter-population and low levels of intra-population diversity of the 
cowpea accessions. This is in contrast to the findings of Lazaridi et al. (2017) who in a similar 
work found that the first three axes of PCA explained only 45.2% of the total variation. PCA 
grouped the populations into four main groups with one accession EMS10-01 as an outlier with 
extremely high levels of polyphenols. EMS10-01 is M1 generation of cowpea treated with EMS 
and might have accumulated mutations that resulted into high levels of polyphenols. The first 
two axes of PCA for crude protein and mineral elements explained 61.88% of total variation. 
This might be due to low level of intra-population and high level of inter-population diversity of 
the cowpea accessions. PCA grouped the accessions into two main groups with three outliers, 
EMS10-01, 4223 and SARI-1-50-81. EMS10-01 had the highest amount of calcium and lead. 
Accession 4223 had the lowest concentration of percent crude protein. First two axes of PCA for 
amino acids explained 68.68% of total variation. This is probably due to high inter-population 
and low intra-population diversity of the cowpea accessions. PCA grouped the genotypes into 
two main groups and three outliers, genotypes F2RG011, SARV-09-004 and IT07K-298-45. 
Accessions F2RG011 had the highest concentration of DL-Alpha-alanine. First two axes of PCA 
explained 47.87% of the total variation in the cowpea accessions. PCA grouped the accessions 
into two main groups with two outliers, accessions 4223 and EMS10-01. 
5.10 Genetic diversity 
In the current study, population structure analysis grouped the cowpea accessions into 4 gene pools 
(clusters 1, 2, 3 and 4) based on the peak of delta K (DK) at K = 4. Proportion of accessions that 
composed the clusters was 0.124, 0.317, 0.281 and 0.278, respectively. Intra-cluster diversity was 
high in cluster 3 and lowest in cluster 4. Genetic diversity among accessions was relatively high 
for clusters 1, 2 and 4. The first three axes of PCA for SSR data explained just 59.36% of total 
149 
 
University of Ghana http://ugspace.ug.edu.gh
variation. This implies that there was low inter-population and high intra-population SSR-based 
diversity of the cowpea accessions.   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
150 
 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER SIX 
CONCLUSIONS AND RECOMMENDATIONS 
 
6.1 Conclusions 
There were different levels of variation among the cowpea morphological traits. High frequencies 
were observed for the following farmer and consumer preferred traits: erect growth habit, cream 
seedcoat colour and in canopy raceme position. 
The phytochemical traits also showed different levels of variation. The following eighteen cowpea 
accessions were found to be of economic importance with reference to the phytochemical traits 
that they are associated with: accessions Golinga (crude protein), EMS10-01 (calcium, gallic acid, 
syringic acid and vanillic acid), 4223 (sodium and potassium), ITD8K-150-241 (magnesium), 
F2RG010 (copper), COLMUT10-01 (nickel, L-Aspartic acid), AS008 (lead and magnesium), 
IT08K- (cadmium), G22 (chromium) and G24 (zinc), RC-03 (quercetin), Songotra (L-Histidine), 
F2RG011 (Glycine and L-Methionine), G7 (L-Asparagine), G80 (DL-Alpha-Alanine), F2RG012 
(L-Valine and L-Tryptophan), SARVX-09-004 (L-Proline), IT07K-298-45 (Iso-Leucine and 
Trans-4-Hydroxy-L-Proline), G80 (L-Tyrosine), SARI-6-299 (DL-Beta-Phenyl-Alanine). 
 
Fisher’s test of association showed significant associations among the morphological traits. 
Significant levels of pairwise correlations were also observed among some of the phytochemical 
traits.  
The total cowpea accessions were structured into sub-populations ranging between 2 and 3 sub-
groups and outliers based on phytochemical data. 
Population structure analysis based on SSR markers grouped the total cowpea accessions into 4 
main gene pools. Different levels of genetic differentiation were observed for the 4 gene pools. 
151 
 
University of Ghana http://ugspace.ug.edu.gh
Different gene flow levels were also observed among the subgroups. High and low estimated 
ancestral alleles occurred in almost all the 4 different gene pools. Some of these alleles were 
approaching either extinction or fixation. 
Low inter-population and high intra-population SSR-based diversity of the cowpea accessions 
were observed. 
 
 
6.2 Recommendations 
The eighteen cowpea accessions identified to be of economic importance must be selected for 
improvement by the Department of Plant and Environmental Biology in collaboration with the 
Department of Crop Science and Department of Nutrition and Food Science. 
 
The high and low estimated ancestral alleles observed in some of the gene pools indicate that there 
is selection against some alleles. It is recommended that germplasm collection, and conservation 
must be intensified by the CSIR-Plant Genetic Resource Research Institute, Bunso. 
 
 
 
 
 
 
 
 
152 
 
University of Ghana http://ugspace.ug.edu.gh
REFERENCES 
 
1. AOACC (2000). Official methods of analysis of the AOAC (18th ed.) Washington, 
DC. 
 
2. Asante, I.K. (1998). Environmental predictors of three cowpea (Vigna unguiculata 
(L.) Walp) yield sub-charcaters. Ghana J. Sci 38: 101-106. 
 
3. Asante, I. K. and Laing, E. (1991). F2 linkage analysis in the cowpea (Vigna 
unguiculata (L.) Walp). Ghana J. Sci. 31-36: 87-94. 
 
4. Asante, I. K., Adu-Dapaah, H., and Acheampong, A. O. (2007). Determination of 
some mineral components of cowpea (Vigna unguiculata (L.) Walp) using 
instrumental neutron activation analysis. WAJAE Vol. 11, 165-171. 
 
5. Asante, I. K., Adu-Dapaah, H., and Addison, P (2006). Variation in contents of crude 
protein and mineral elements in 32 cowpea (Vigna unguiculata (L.) Walp) 
accessions in Ghana. Ghana Jnl agric. Sci. 39, 83-86.  
 
6. Asare, A.T., Akrong, C.K., Gowda, B.S., Galyuon, I.K.A., Aboagye, L.M., Takrama, J.F 
and Timko, M.P. (2011). Evaluation of agro-morphological diversity in some segregating 
lines of cowpea (Vigna unguiculata L. Walp). Journal of Ghana Science Association, Vol. 
13 No. 2: 1-11. 
 
 
7. Ba, F. S., Pasquet, R. S., Gepts, P. (2004). Genetic diversity in cowpea [Vigna unguiculata 
(L.) Walp.] as revealed by RAPD markers, Genetic Resources and Crop Evolution 51: 
539-550. 
 
8. Barrett, B. A., Kidwell, K. K., Fox, P. N. (1998). Comparison of AFLP and pedigree -
based genetic assessment methods using wheat cultivars from the Pacific Northwest. Crop 
Science 38: 1271–1278. 
 
 
9. Bell, A. & Muck, O. 2000. Analysis of post-harest systems: the GTZ concept. GTZ, 
Germany. pp: 7 (also aailable at www.fao.org/inpho/library/moe_rep/x0294e/2-
1.htm). 
 
153 
 
University of Ghana http://ugspace.ug.edu.gh
10. Bennet-Lartey, S. O. 1991. Variability and heterosis in cowpea (Vigna unguiculata 
(L) Walp) accessions from four main regions of Ghana. Ph.D. Thesis. University of 
Ghana. 
 
11. Boukar O, Massawe F, Muranaka S, Franco J, Maziya-Dixon B, Singh B, Fatokun 
C (2011) Evaluation of cowpea germplasm lines for protein and mineral 
concentrations in grains. Plant Genet Res 9:515–522. doi:10.1017/ 
S1479262111000815 
 
12. Carsky RJ, Vanlauwe B, Lyasse O (2002) Cowpea rotation as a resource management 
technology for cereal-based systems in the savannas of West Africa. In: Fatokun CA, 
Tarawali SA, Singh BB, Kormawa PM, Tamo M (eds) Challenges and Opportunities for 
Enhancing Sustainable Cowpea Production. International Institute of Tropical 
Agriculture, Ibadan, Nigeria, pp 252–266. 
 
13. Chikwendu, J. N., Igbatim, A.C., and Obizoba, I.C. (2014). Chemical Composition of 
Processed Cowpea Tender Leaves and Husks. International Journal of Scientific and 
Research Publications, Volume 4, Issue 5 ,5 pages. 
 
14. Coulibaly, S., Pasquet, R. S, Papa, R., Gepts, P (2001). AFLP analysis of the phenetic 
organization and genetic diversity of Vigna unguiculata (L.) Walp. reveals extensive gene 
flow between wild and domesticated types. Theoretical and Applied Genetics 104 (2002) 
358-366. 
 
15. Egbadzor, F., Ofori, Kwadwo., Yeboah, Martin., Aboagye, Lawrence, M, Opoku-
Agyeman, Michael O., Danquah, Eric Y and Offei, Samuel K (2017). Diversity in 113 
cowpea [Vigna unguiculata (L) Walp] accessions assessed with 458 SNP markers. 
Springer Plus, 3 (1): 541.doi:10.1/86/2193-180-3-541. 
 
16. Ehlers JD, Matthews WC, Hall AE, Roberts PA (2002) Breeding and evaluation of 
cowpeas with high levels of broad-based resistance to root-knot nematodes. In: Fatokun 
CA, Tarawali SA, Singh BB, Kormawa PM, Tamo M (eds) Challenges and Opportunities 
for Enhancing Sustainable Cowpea Production. International Institute of Tropical 
Agriculture, Ibadan, Nigeria, pp 41–51 
 
17. Fang, J. G., Chao, C. T., Roberts, P. A., Ehlers, J.D. (2007). Genetic diversity of cowpea 
[Vigna unguiculata (L.) Walp.] in four West African and USA breeding programs as 
determined by AFLP analysis, Genetic Resources and Crop Evolution 54 (6) (2007) 1197-
1209. 
 
154 
 
University of Ghana http://ugspace.ug.edu.gh
18. FCDP (2005). Cowpea Production Guide, Food Crops Development Project. Ministry of 
Food and Agriculture, Accra, Ghana. 
 
19. Girish, G., Viswanatha, K.P and Manjunath, A. 2001. Genetic diversity in cowpea (Vigna 
unguiculata). Indian Journal of Plant Genetic Resources. 14 (3): 358360. 
 
20. Haizheng Xiong1, Ainong Shi1, Beiquan Mou2, Jun Qin1, Dennis Motes, Weiguo Lu1, 
Jianbing Ma1, Yuejin Weng1, Wei Yang1, Dianxing Wu (2018). Genetic Diversity and 
Population Structure of Cowpea (Vigna unguiculate (L.) Walp). PLOS ONE 
DOI:10.1371/journal.pone.0160941. 
 
21. Hall AE, Cisse N, Thiaw S, Elawad HOA, Ehlers JD, Ismail A, Fery R, Roberts P, Kitch 
LW, Murdock LL, Boukar O, Phillips RD, McWatters KH (2003) Development of 
cowpea cultivars and germplasm by the Bean/Cowpea CRSP. Field Crops Res 82:103–
134 
 
22. Hussain, M, A. and Basahy, A.Y. (1998). Nutrient composition and amino acid pattern of 
cowpea (Vigna unguiculata (L.) Walp, Fabaceae) grown in the Giza area of Saudi Arabia. 
International Journal of Food Sciences and Nutrition (1998) 49: 117-124. 
 
23. Huynh, B., Close, T. J., Roberts, P. A., Hu, Z., Wanamaker, S., Lucas, M. R., Chiulele, 
R., Cissé, N., David. A., Hearne, S., Fatokun, C., Diop, N. N., Ehlers, J. D (2013). Gene 
Pools and the Genetic Architecture of Domesticated Cowpea. Plant Genome 6:3 
 
 
24. International Board for Plant Genetic Resources (1983). Descriptors for cowpea. IBPGR 
Secretariat, Rome. 
 
25. Kapravelou, G., Martínez, R., Andrade, A.M., Chaves, C.L., López-Jurado, M., Aranda, 
P., Arrebola, F., Cañizares, F.J., Galisteo, M., Porres, J.M. (2015) Improvement of the 
antioxidant and hypolipidaemic effects of cowpea flours (Vigna unguiculata) by 
fermentation: Results of in vitro and in vivo experiments. J. Sci. Food Agric. 95, 1207–
1216. [CrossRef] [PubMed] 
 
26. Karp, A., Kresvoch, S., Bhat, K.V., Ayad, W.G., and Hodgkin, T (1997). Molecular tools 
in plant genetic resources conservation: a guide to the technologies. IPGRI Technical 
Bulletin No.2 Rome, Italy. 
155 
 
University of Ghana http://ugspace.ug.edu.gh
 
27. Khan, H., Viswanatha, K. P., Sowmya, H. C. (2015). Study of genetic variability 
parameters in cowpea [Vigna unguiculata (L.) Walp.] germplasm lines. An international 
quarterly journal of life sciences. 10(2):747-750. 
 
28. Kukic, J., Petrovic, S and Niketic, M (2006). Antioxidant activity of four endemic Stachys 
taxa. Biol Pharm Bull.  29(4):725-9. 
 
29. Kumari, U., Backiyarani, S and Dhanakodi, C.V. 2000. Character contribution to diversity 
in cowpea. Legume Research. 23 (2): 122-125. 
 
30. Langyintuo AS, Lowenberg-DeBoer J, Faye M, Lambert D, Ibro G, Moussa B, Kergna A, 
Kushwaha S, Musa S, Ntoukam G (2003) Cowpea supply and demand in West Africa. 
Field Crops Res 82:215–231. 
31. Lazaridi, L., Ntatsi, G., Savvas, D. and Bebeli, P. J. (2017). Diversity in cowpea (Vigna 
unguiculata (L.) Walp.) local populations from Greece. Genet Resour Crop Evol. 
64:1529–1551 
 
32. Mafakheri, K, Bihamta, M. R and Abbasi, A. R (2017). Assessment of genetic diversity 
in cowpea (Vigna unguiculata L.) germplasm using morphological and molecular 
characterization.  Cogent Food and Agriculture. 3 (1). 
 
33. Malviya, N., Sarangi, B.K., Yadav, M.K., Yadav, D. (2012). Analysis of genetic diversity 
in cowpea (Vigna unguiculata (L.) Walp.) cultivars with random amplified polymorphic 
DNA markers, Plant Syst. Evol. 298: 523-526. 
 
34. Manggoel, M., Uguru, M.I., Ndam, O.N and Dasbak, M.A. (2012). Genetic variability, 
correlation and path coefficient analysis of some yield components of ten cowepa (Vigna 
ungiculata (L.) Walp) accessions. Journal of Plant Breeding and Crop Science. 4 (5): 80-
86. 
 
35. Nei, M. (1973) Analysis of Gene Diversity in Subdivided Populations. Proceedings of the 
National Academy of Sciences of the United States of America, 70, 3321-3323.  
 
36. Ng, N.Q and Marechal, R (1985) Cowpea taxonomy, origin and germplasm. In: 
Singh SR, Rachie KO (eds) Cowpea Research, Production and Utilization. John 
Wiley and Sons, Ltd., Chichester, NY, pp. 11–21. 
 
156 
 
University of Ghana http://ugspace.ug.edu.gh
37. Nybom H (2004). Comparison of different nuclear DNA markers for estimating 
intraspecific genetic diversity in plants. Mol Ecol 13:1143–1155. doi:10.1111/j.1365-
294X.2004. 02141.x 
 
38. Ogunkanmi, L.A., Ogundipe, O.T., Ng, N.g., and Fatokun, C.A (2008). Genetic diversity 
in wild relatives of cowpea (Vigna unguiculata (L.) Walp) as revealed by simple sequence 
repeats (SSR) markers. Journal of Food, Agriculture & Environment. 6: 263-268. 
 
 
39. Olabanji I.O. Ajayi O.S.1, Oluyemi E.A.1, Olawuni I.J., Adeniji A.O1, Olasupo O.F.1, 
Agboola R.O.1, Olusesi I.M (2018). Nutraceuticals in Different Varieties of Cowpeas.  
American Journal of Food Science and Technology. 6 (2): 68-75 
 
40. Onwueme, I.C. and Sinha, T.D (1991). Field crop production in Tropical Africa: 
Principles and Practice. CTA Field Crops – 480 pages. 
 
 
41. Padulosi, S. and Ng, N.Q. (1997). Origin, taxonomy, and morphology of Vigna 
unguiculata (L.) Walp. In: B.B. Singh, D.R. Mohan Raj, K.E. Dashiel and L.E.N. 
Jackai (eds.). Advances in cowpea research. Co-publication of International Institute 
of Tropical Agriculture (IITA) and Japan International Research Center for 
Agricultural Sciences (JIRCAS). IITA, Ibadan, Nigeria. Pp. 1-12. 
 
42. Painting, K.A., Perry, M.C., Denning, R.A., and Ayad, W.G. (1995) Guidebook Genetic 
Resources Documentation. A self-teaching approach to the understanding, analysis and 
development of genetic resources documentation. International Plant Genetic Resources 
Institute, Rome Italy.  
 
43. Panda, S., Naik, D. and Kamble, A. (2015). Population structure and genetic diversity of 
 the perennial medicinal shrub Plumbago AoB PLANT 
www.aobplants.oxfordjournals.org  
 
44. Pandey, I (2007), Genetic diversity in grain cowpea (Vigna unguiculata (L.) Walp.), 
Legume. Res., 30 (2): 92-97 
 
45. Phillips RD, McWatters KH, Chinannan MS, Hung Y, Beuchat LR, Sefa-Dedeh S, Saki-
Dawson E, Ngoddy P, Nnanyelugo D, EnwereJ, Komey NS, Liu K, Mensa-WilmotY, 
NnannaI, Okeke C, Prinyawiwatkul W, Saalia FK (2003) Utilization of cowpeas for 
human food. Field Crops Res 82:193–213 
157 
 
University of Ghana http://ugspace.ug.edu.gh
 
46. Polegri L, Negri V (2010) Molecular markers for promoting agro-biodiversity 
conservation: a case study from Italy. How cowpea landraces were saved from extinction. 
Genet Resour Crop Evol 57:867–880. doi:10.1007/s10722-0099526-z 
 
47. Pritchard, J. K., Stephen, M. J. and Donnelly (2000). Inference of Population Structure 
Using Multilocus Genotype Data. Genetics 155(2):945-59 
 
48. Quaye, W, Adofo, K, Buckman, S. E., Frempong, G., Jongerden, J., Ruivenkamp, G. 
(2011).  A socio-economic assessment of cowpea diversity on the Ghanaian market: 
implications for breeding. Int. J. Consum. Stud. 35:679–687 
 
49. Rangel A, Saraiva K, Schwengber P, Narciso MS, Domont GB, Ferreira ST, Pedrosa C 
(2004) Biological evaluation of a protein isolate from cowpea (Vigna unguiculata) seeds. 
Food Chem 87:491–499. 
 
 
50. Rice-Evans, C. A., Nicholas, J. M and Paganga, G (1997). Antioxidant properties of 
phenolic compounds. Trends in Plant Science Vol. 2, No. 4.    
 
 
51. Sanginga N, Dashiell KE, Diels J, Vanlauwe B, Lyasse O, Carsky RJ, Tarawali S, Asafo-
Adjei B, Menkir A, Schulz S, Singh BB, Chikoye D, Keatinge D, Ortiz R (2003) 
Sustainable resource management coupled to resilient germplasm to provide new 
intensive cereal–grain–legume–livestock systems in the dry savanna. Agric Ecosyst 
Environ 100:305–314. 
 
52. Singh, B. B., Ehlers, J. D., Sharma, B., Freire Filho, F. R. (2002). Recent progress in 
cowpea breeding. In: Fatokun, C. A., Tarawali, S.A., Singh, B. B., Kormawa, P. M., 
Tamo, M (eds) Challenges and Opportunities for Enhancing Sustainable Cowpea 
Production. International Institute of Tropical Agriculture, Ibadan, Nigeria, pp 22–40. 
 
53. Sombie, P.A.E.D.Compaore, M., Coulbaly, A.Y., Ouedraogo, J.T., Tignegre, J De La 
Salle and Kiendrebeogo, M. (2018) Antioxidant and phytochemical studies of 31 cowpeas 
(Vigna unguiculata (L.) Walp) Genotypes from Burkina Faso. Foods 7: 143: 
do:10.3390/foods 7090143. 
 
158 
 
University of Ghana http://ugspace.ug.edu.gh
54. Stata 14 (StataCorp. 2015) Stata Statistical Software: Release 14. College Station, TX: 
StataCorp LP. 
 
55. Steele, W. M (1976) Cowpea, Vigna unguiculata (Leguminosae-Papillionatae). In: 
Simmonds NW (ed) Evolution of Crop Plants. Longman, London, pp 183–185 
 
56. Tan, H, Tie, M., Luo, Q., Zhu, Y., Lai J. andLi, H (2012). A review of molecular markers 
applied in Cowpea (Vigna unguiculata (L.) Walp.) Breeding. J Life Sci. 6: 1190–9. 
 
57. Ukpene, A.O and Imade, F (2015). Amino acid profiles of seven cowpea varities grown 
in Agbor.  Nigerian Annals of Natural Sciences. 15 (1): 072-078. 
 
58. Tarawali, S. A., Singh, B. B., Gupta S. C., Tabo, R., Harris, F., Nokoe S, Fernández-
Rivera, S., Bationo. A., Manyong, V. M., Makinde, K. and Odion, E. C. (2002) Cowpea 
as a key factor for a new approach to integrated crop–livestock systems research in the 
dry savannas of West Africa. In: Fatokun CA, Tarawali SA, Singh BB, Kormawa PM, 
Tamo M (eds) Challenges and Opportunities for Enhancing Sustainable Cowpea 
Production. International Institute of Tropical Agriculture, Ibadan, Nigeria, pp 233–251. 
 
59. Timko, M. P and Singh, B. B (2008). Cowpea a multifunctional legume. In: More, P. H., 
Ming, R. (eds) Genomics of Tropical Crops Plants., pp 237–238. 
 
60. Timko, M. P., Ehlers, J. D and Roberts, P. A (2007). Cowpea. In: Kole C (ed) Genome 
Mapping and Molecular Breeding in Plants, Volume 3, Pulses, Sugar and Tuber Crops, 
Springer Verlag, Berlin Heidelberg. pp. 49–67 
 
61. Zannou, A., Kossou, D. K., Ahanchede, A.,Zoundjihekpon, J., Agbicodo, E. and  Struik, 
P. C. (2008).  Genetic variability of cultivated cowpea in Benin assessed by random 
amplified polymorphic DNA, African Journal of Biotechnology 7 (24): 4407-4414. 
 
62. Zhang, Y. J., et al. (2015). Antioxidant Phytochemicals for the Prevention and Treatment 
of Chronic Diseases. Molecules. 27; 20(12):21138-56. doi: 10.3390/molecules 201219753 
 
 
 
 
 
159 
 
University of Ghana http://ugspace.ug.edu.gh
APPENDICES 
 
Appendix 1.   Standard equations of Phenols and Flavonoids 
Polyphenol Type Equation Wavelength (nm) R2 
Catechin   Phenol  y = 0.0018x+0.0778 425 0.9714 
Ferrulic acid Phenol  y = 0.0019x +0.045 510 0.8842 
Gallic acid Phenol y = 0.002x + 0.0226 510 0.9721 
p-coumaric acid Phenol  y = 0.0003x + 0.1416 510 0.7599 
Quercetin  Flavonoid  y = 0.0006x – 0.0153 425 0.9189 
Rutin  Flavonoid  y = 0.003x + 0.1145 425 0.9848 
Rosmarinic acid Phenol  y = 0.0024x + 0.0973 510 0.9845 
Syringic acid Phenol  y = 0.0004x + 0.0407 415 0.9902 
Vanillic acid  Phenol  y = 0.0014x + 0.0124 510 0.9950 
 
 
 
 
 
 
 
 
 
 
160 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 2. Morphological traits and sources of cowpea accessions 
Acc Source Growth habit Main pod pigmentation Pod colour Seedcoat colour 
RC-01 DPEB erect no pigment brown cream 
AS007 DPEB erect no pigment buff dark mottled 
312 DPEB erect no pigment purple red 
RC-04 DPEB erect  brown dirty white 
AGRAC-216 DPEB erect no pigment buff brown 
BELEDI B DPEB erect no pigment buff cream 
LADUNI 1B DPEB erect no pigment brown cream 
111 DPEB erect no pigment buff red 
4223 DPEB erect no pigment brown cream 
212 DPEB semierect no pigment purple dark mottled 
BOTN002 DPEB semiprostrate no pigment purple brown mottled 
ASOO4 DPEB erect no pigment flesh flesh 
2213 DPEB erect no pigment dark brown cream 
AS008 DPEB erect  light brown brown 
ASOO9 DPEB erect no pigment light brown brown 
EMS30-02 DPEB erect  light brown black 
WACCI-
TONI DPEB semierect no pigment brown cream 
ASOO3 DPEB erect no pigment dark purple red 
COLMUT10-
01 DPEB semiprostrate no pigment dark motttled brown mottled 
EMS10-01 DPEB semiprostrate no pigment purple brown mottled 
442 DPEB erect no pigment light brown brown 
6824 DPEB erect no pigment purple red 
F2RG004 DPEB erect no pigment light brown black 
G5 DPEB semierect no pigment light brown cream 
F2RG011 DPEB semierect no pigment brown black mottled 
RC-03 DPEB semierect no pigment purple brown mottled 
F2RG007 DPEB erect no pigment buff cream 
BOTN006 DPEB semierect no pigment purple dark mottled 
F2RG012 DPEB semierect no pigment purple red 
F2RG010 DPEB erect  buff cream 
F2RG009 DPEB erect splashes of pigment light brown cream 
G41 DPEB erect no pigment buff dark mottled 
G35 DPEB erect no pigment light brown brown 
422 DPEB erect no pigment light brown brown 
G24 DPEB erect no pigment buff dark mottled 
G80 DPEB semierect no pigment light brown brown 
      
  
 
161 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 2 cont’d 
Acc Source Growth habit Main pod pigmentation Pod colour Seedcoat colour 
G22 DPEB semierect splashes of pigment light brown cream 
G7 DPEB erect splashes of pigment light brown cream 
G50 DPEB erect no pigment light brown cream 
GOLINGA DPEB prostrate no pigment brown dark mottled 
SONGOTRA SARI erect no pigment  
BAWUTA SARI  no pigment  
ZAAYURA SARI erect no pigment brown cream 
PADI-TUYA SARI semierect uniformly pigmented buff cream 
APAGBAALA SARI erect no pigment brown cream 
ASONTEM SARI semierect no pigment buff brick red 
ITO7K-299-6 SARI erect splashes of pigment brown cream 
SARVX-09-002 SARI erect no pigment brown cream 
IT98K-628 SARI semierect no pigment buff cream 
SARI-6-2-6 SARI erect no pigment brown cream 
SARVX-09-004 SARI erect no pigment buff cream 
SARVX-07-001 SARI erect no pigment brown cream 
SARI-5-5-5 SARI semierect no pigment brown cream 
ITO7K-298-45 SARI erect no pigment brown cream 
IT10K-817-3 SARI erect no pigment brown brick red 
IT86D-610 SARI erect no pigment brown brown mottled 
IT08K- SARI erect no pigment buff brown 
SARI-2-50-80 SARI semierect splashes of pigment brown cream 
SARI-3-11-88 SARI semierect splashes of pigment brown cream 
SARI-1-50-81 SARI semierect no pigment brown cream 
IT08K-137-1 SARI erect no pigment brown cream 
SARI-3-11-100 SARI semierect splashes of pigment brown cream 
IT07K-299-69 SARI erect no pigment brown cream 
SARI-6-299 SARI semierect no pigment light brown cream 
SARI-13-17-12 SARI semierect no pigment brown cream 
IT08K-150-241 SARI erect no pigment brown cream 
      
 
 
 
 
 
 
 
162 
 
University of Ghana http://ugspace.ug.edu.gh
 
Appendix 2 cont’d 
Acc Source Seedcoat pattern Leaf colour Plant pigmentation 
RC-01 DPEB black holstein dark green very slight 
AS007 DPEB solid intermediate green very slight 
312 DPEB solid intermediate green very slight 
RC-04 DPEB brown eye intermediate green very slight 
AGRAC-216 DPEB solid intermediate green moderate base tip petiole 
BELEDI B DPEB small brown eye pale green very slight 
LADUNI 1B DPEB small brown eye intermediate green very slight 
111 DPEB solid pale green very slight 
4223 DPEB solid intermediate green very slight 
212 DPEB solid intermediate green moderate base tip petiole 
BOTN002 DPEB solid intermediate green moderate base tip petiole 
ASOO4 DPEB solid intermediate green moderate base tip petiole 
2213 DPEB solid intermediate green moderate base tip petiole 
AS008 DPEB solid intermediate green very slight 
ASOO9 DPEB solid intermediate green very slight 
EMS30-02 DPEB solid intermediate green very slight 
WACCI-
TONI DPEB golden eye intermediate green very slight 
ASOO3 DPEB solid intermediate green very slight 
COLMUT10-
01 DPEB solid intermediate green very slight 
EMS10-01 DPEB solid intermediate green moderate base tip petiole 
442 DPEB solid dark green none 
6824 DPEB solid intermediate green very slight 
F2RG004 DPEB solid intermediate green moderate base tip petiole 
G5 DPEB small black eye dark green none 
F2RG011 DPEB solid intermediate green very slight 
RC-03 DPEB solid intermediate green moderate base tip petiole 
F2RG007 DPEB small black eye intermediate green moderate base tip petiole 
BOTN006 DPEB solid intermediate green very slight 
F2RG012 DPEB solid intermediate green very slight 
F2RG010 DPEB small brown eye intermediate green very slight 
F2RG009 DPEB small black eye intermediate green very slight 
G41 DPEB solid intermediate green very slight 
G35 DPEB solid intermediate green moderate base tip petiole 
422 DPEB solid dark green none 
G24 DPEB solid intermediate green very slight 
G80 DPEB solid intermediate green moderate base tip petiole 
     
 
163 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 2 con t’d 
Acc Source Seedcoat pattern Leaf colour Plant pigmentation 
G22 DPEB brown eye intermediate green moderate base tip petiole 
G7 DPEB small brown eye intermediate green moderate base tip petiole 
G50 DPEB small brown eye intermediate green moderate base tip petiole 
GOLINGA DPEB solid intermediate green very slight 
SONGOTRA SARI  intermediate green very slight 
BAWUTA SARI  intermediate green very slight 
ZAAYURA SARI small black eye dark green moderate base tip petiole 
PADI-TUYA SARI black eye dark green moderate base tip petiole 
APAGBAALA SARI small black eye intermediate green very slight 
ASONTEM SARI solid intermediate green very slight 
ITO7K-299-6 SARI small black eye intermediate green very slight 
SARVX-09-
002 SARI small black eye intermediate green moderate base tip petiole 
IT98K-628 SARI small black eye intermediate green very slight 
SARI-6-2-6 SARI small brown eye intermediate green moderate base tip petiole 
SARVX-09-
004 SARI black eye intermediate green moderate base tip petiole 
SARVX-07-
001 SARI small black eye intermediate green moderate base tip petiole 
SARI-5-5-5 SARI black eye intermediate green very slight 
ITO7K-298-45 SARI black eye intermediate green very slight 
IT10K-817-3 SARI solid intermediate green very slight 
IT86D-610 SARI solid dark green none 
IT08K- SARI solid intermediate green moderate base tip petiole 
SARI-2-50-80 SARI small black eye intermediate green moderate base tip petiole 
SARI-3-11-88 SARI small black eye dark green very slight 
SARI-1-50-81 SARI small black eye intermediate green moderate base tip petiole 
IT08K-137-1 SARI small brown eye dark green moderate base tip petiole 
SARI-3-11-
100 SARI black eye dark green moderate base tip petiole 
IT07K-299-69 SARI small brown eye dark green moderate base tip petiole 
SARI-6-299 SARI small brown eye intermediate green very slight 
SARI-13-17-
12 SARI black eye intermediate green very slight 
IT08K-150-
241 SARI small black eye intermediate green moderate base tip petiole 
     
 
 
 
 
164 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 2 cont’d 
Acc Source Immature pod tip colour v-markings 
RC-01 DPEB pigmented absence 
AS007 DPEB non pigmented presence 
312 DPEB pigmented presence 
RC-04 DPEB  absence 
AGRAC-216 DPEB non pigmented 
BELEDI B DPEB non pigmented absence 
LADUNI 1B DPEB non pigmented absence 
111 DPEB non pigmented absence 
4223 DPEB non pigmented absence 
212 DPEB  absence 
BOTN002 DPEB non pigmented absence 
ASOO4 DPEB non pigmented absence 
2213 DPEB non pigmented absence 
AS008 DPEB  absence 
ASOO9 DPEB non pigmented absence 
EMS30-02 DPEB   
WACCI-TONI DPEB non pigmented presence 
ASOO3 DPEB pigmented presence 
COLMUT10-01 DPEB non pigmented presence 
EMS10-01 DPEB pigmented presence 
442 DPEB non pigmented absence 
6824 DPEB pigmented presence 
F2RG004 DPEB pigmented presence 
G5 DPEB pigmented absence 
F2RG011 DPEB pigmented presence 
RC-03 DPEB pigmented presence 
F2RG007 DPEB pigmented absence 
BOTN006 DPEB pigmented presence 
F2RG012 DPEB pigmented presence 
F2RG010 DPEB  absence 
F2RG009 DPEB pigmented absence 
G41 DPEB non pigmented presence 
G35 DPEB non pigmented presence 
422 DPEB non pigmented absence 
G24 DPEB non pigmented 
G80 DPEB non pigmented absence 
    
 
 
165 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 2 cont’d 
Acc Source Immature pod tip colour v-markings 
G22 DPEB pigmented absence 
G7 DPEB pigmented absence 
G50 DPEB non pigmented absence 
GOLINGA DPEB pigmented presence 
SONGOTRA SARI non pigmented absence 
BAWUTA SARI  absence 
ZAAYURA SARI non pigmented absence 
PADI-TUYA SARI pigmented absence 
APAGBAALA SARI non pigmented absence 
ASONTEM SARI non pigmented absence 
ITO7K-299-6 SARI pigmented absence 
SARVX-09-002 SARI  absence 
IT98K-628 SARI pigmented absence 
SARI-6-2-6 SARI non pigmented absence 
SARVX-09-004 SARI pigmented absence 
SARVX-07-001 SARI non pigmented absence 
SARI-5-5-5 SARI pigmented absence 
ITO7K-298-45 SARI non pigmented absence 
IT10K-817-3 SARI non pigmented absence 
IT86D-610 SARI non pigmented absence 
IT08K- SARI non pigmented absence 
SARI-2-50-80 SARI pigmented absence 
SARI-3-11-88 SARI pigmented absence 
SARI-1-50-81 SARI pigmented absence 
IT08K-137-1 SARI non pigmented absence 
SARI-3-11-100 SARI pigmented absence 
IT07K-299-69 SARI non pigmented absence 
SARI-6-299 SARI non pigmented absence 
SARI-13-17-12 SARI non pigmented absence 
IT08K-150-241 SARI non pigmented absence 
    
 
 
 
 
 
 
166 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 2 cont’d 
Acc Source Raceme position Terminal leaflet shape Flower bud tip 
RC-01 DPEB in upper canopy pigmented 
AS007 DPEB below upper canopy globose non-pigmented 
312 DPEB in upper canopy globose pigmented 
RC-04 DPEB  globose non-pigmented 
AGRAC-216 DPEB in upper canopy hastate non-pigmented 
BELEDI B DPEB in upper canopy sub-globose non-pigmented 
LADUNI 1B DPEB in upper canopy sub-globose non-pigmented 
111 DPEB in upper canopy globose non-pigmented 
4223 DPEB mostly above canopy sub-globose non-pigmented 
212 DPEB in upper canopy sub-globose pigmented 
BOTN002 DPEB below upper canopy sub-globose non-pigmented 
ASOO4 DPEB below upper canopy globose   
2213 DPEB in upper canopy globose non-pigmented 
AS008 DPEB below upper canopy globose   
ASOO9 DPEB below upper canopy globose non-pigmented 
EMS30-02 DPEB below upper canopy globose   
WACCI-
TONI DPEB in upper canopy globose non-pigmented 
ASOO3 DPEB below upper canopy globose pigmented 
COLMUT10-
01 DPEB below upper canopy sub-globose non-pigmented 
EMS10-01 DPEB below upper canopy globose pigmented 
442 DPEB in upper canopy sub-globose non-pigmented 
6824 DPEB in upper canopy globose pigmented 
F2RG004 DPEB below upper canopy sub-globose non-pigmented 
G5 DPEB below upper canopy sub-globose pigmented 
F2RG011 DPEB in upper canopy sub-globose pigmented 
RC-03 DPEB below upper canopy sub-globose pigmented 
F2RG007 DPEB below upper canopy globose pigmented 
BOTN006 DPEB below upper canopy sub-globose pigmented 
F2RG012 DPEB below upper canopy sub-globose pigmented 
F2RG010 DPEB     
F2RG009 DPEB in upper canopy sub-hastate pigmented 
G41 DPEB below upper canopy globose non-pigmented 
G35 DPEB below upper canopy globose non-pigmented 
422 DPEB in upper canopy sub-globose non-pigmented 
G24 DPEB in upper canopy globose non-pigmented 
G80 DPEB below upper canopy sub-hastate non-pigmented 
     
 
 
167 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 2 cont’d 
Acc Source Raceme position Terminal leaflet shape Flower bud tip 
G22 DPEB in upper canopy sub-globose pigmented 
G7 DPEB below upper canopy sub-globose pigmented 
G50 DPEB below upper canopy sub-globose non-pigmented 
GOLINGA DPEB mostly above canopy sub-globose pigmented 
SONGOTRA SARI mostly above canopy sub-globose non-pigmented 
BAWUTA SARI in upper canopy hastate non-pigmented 
ZAAYURA SARI in upper canopy sub-hastate non-pigmented 
PADI-TUYA SARI in upper canopy sub-hastate pigmented 
APAGBAALA SARI mostly above canopy sub-globose non-pigmented 
ASONTEM SARI in upper canopy hastate non-pigmented 
ITO7K-299-6 SARI mostly above canopy sub-globose non-pigmented 
SARVX-09- sub-
002 SARI mostly above canopy globose  
IT98K-628 SARI mostly above canopy sub-globose pigmented 
SARI-6-2-6 SARI below upper canopy sub-hastate non-pigmented 
SARVX-09-
004 SARI mostly above canopy globose pigmented 
SARVX-07-
001 SARI mostly above canopy sub-globose non-pigmented 
SARI-5-5-5 SARI in upper canopy hastate pigmented 
ITO7K-298-45 SARI in upper canopy sub-globose non-pigmented 
IT10K-817-3 SARI in upper canopy globose non-pigmented 
IT86D-610 SARI mostly above canopy sub-globose non-pigmented 
IT08K- SARI in upper canopy hastate non-pigmented 
SARI-2-50-80 SARI mostly above canopy globose pigmented 
SARI-3-11-88 SARI mostly above canopy sub-hastate pigmented 
SARI-1-50-81 SARI mostly above canopy sub-globose non-pigmented 
IT08K-137-1 SARI in upper canopy sub-globose non-pigmented 
SARI-3-11-
100 SARI in upper canopy sub-hastate pigmented 
IT07K-299-69 SARI in upper canopy sub-globose non-pigmented 
SARI-6-299 SARI mostly above canopy sub-globose pigmented 
SARI-13-17-
12 SARI in upper canopy hastate non-pigmented 
IT08K-150-
241 SARI in upper canopy globose non-pigmented 
     
 
 
 
168 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 3.  Sources, percent crude protein and mineral elements content (ppm) of cowpea 
accessions.  
Acc Source CP Ca Na K Mg Fe 
RC-01 DPEB 15.75 0.1024 0.0008 10.425 0.29715 0.0079 
AS007 DPEB 13.475 0.11295 0.0016 8.66 0.23165 0.00755 
312 DPEB 15.4875 0.05715 0.00135 9.26 0.22655 0.0087 
RC-04 DPEB 15.925 0.08165 0.00105 9.32 0.2695 0.0553 
AGRAC-216 DPEB 12.425 0.12005 0.00965 13.61 0.3687 0.09445 
BELEDI B DPEB 11.8125 0.18935 0.0134 11.395 0.4107 0.068 
LADUNI 1B DPEB 11.9875 0.1054 0.0038 10.19 0.2087 0.04285 
111 DPEB 10.5 0.1435 0.0042 9.665 0.20755 0.04465 
4223 DPEB 9.625 0.13515 0.02345 16.975 0.3349 0.0921 
212 DPEB nd nd nd nd nd nd 
BOTN002 DPEB 16.7125 0.08935 0.0021 10.585 0.27615 0.07655 
ASOO4 DPEB 13.65 0.0758 0.00035 10.845 0.2881 0.05945 
2213 DPEB 14.175 0.10145 0.0011 10.085 0.2955 0.06725 
AS008 DPEB 15.75 0.0658 nd 11.15 0.32885 0.0732 
ASOO9 DPEB 13.475 0.0771 0.0016 9.93 0.32535 0.06665 
EMS30-02 DPEB 13.9125 0.06785 nd 9.86 0.2862 0.0645 
WACCI-
TONI DPEB 12.3375 0.0608 0.00125 9.62 0.25275 0.05885 
ASOO3 DPEB 16.8 0.0805 nd 10.815 0.28885 0.0663 
COLMUT10-
01 DPEB 15.575 0.0885 nd 10.525 0.29165 0.0709 
EMS10-01 DPEB 11.4625 86.2 0.00015 10 0.25835 0.06555 
442 DPEB nd nd nd nd nd nd 
6824 DPEB nd nd nd nd nd nd 
F2RG004 DPEB nd nd nd nd nd nd 
G5 DPEB nd nd nd nd nd nd 
        
 
 
 
 
 
 
 
 
169 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 3 cont’d 
Acc Source CP Ca Na K Mg Fe 
F2RG011 DPEB 13.0375 0.1004 0.0007 10.145 0.2428 0.04105 
RC-03 DPEB 12.25 0.14055 0.0019 9.335 0.3097 0.03135 
F2RG007 DPEB 10.0625 0.0845 0.00345 9.95 0.2366 0.035 
BOTN006 DPEB 14.2625 0.10475 0.0001 9.395 0.2607 0.08935 
F2RG012 DPEB 13.65 0.07195 0.0004 9.65 0.294 0.03285 
F2RG010 DPEB 11.025 0.0338 0.00055 5.75 0.2024 0.0367 
F2RG009 DPEB 15.1375 0.10515 0.0004 9.7 0.22565 0.0533 
G41 DPEB nd nd nd nd nd nd 
G35 DPEB 12.25 0.08265 0.00005 10.315 0.2936 0.03835 
422 DPEB nd nd nd nd nd nd 
G24 DPEB 13.0375 0.08355 0.0014 8.085 0.23585 0.0329 
G80 DPEB 13.3 0.08855 0.0005 6.175 0.2577 0.02185 
G22 DPEB 12.25 0.09655 0.00005 6.03 0.23575 0.0284 
G7 DPEB 13.475 0.10675 0.0007 10.16 0.23415 0.0237 
G50 DPEB 14.7 0.1293 0.00005 8.405 0.2531 0.05625 
GOLINGA DPEB 16.975 0.0728 0.00035 8.015 0.2433 0.04315 
SONGOTRA SARI 16.8 0.08845 0.00205 10.115 0.2826 0.00895 
BAWUTA SARI 15.4 0.1117 0.0046 12.03 0.32915 0.0087 
ZAAYURA SARI 14.875 0.1275 0.0031 10.415 0.2557 0.00175 
PADI-TUYA SARI 13.5625 0.08945 0.00315 10.92 0.2828 0.00645 
APAGBAALA SARI 14.875 0.1001 0.0017 10.68 0.25945 0.01485 
ASONTEM SARI 13.5625 0.1199 0.00295 10.715 0.2929 0.01485 
ITO7K-299-
6 SARI 12.3375 0.109 0.01065 16.62 0.32555 0.097 
SARVX-09-
002 SARI 10.325 0.1138 0.00325 8.66 0.22715 0.038 
IT98K-628 SARI 14.7 0.1025 0.00025 9.91 0.2769 0.03655 
SARI-6-2-6 SARI 16.275 0.08895 0.0035 10.32 0.2886 0.0012 
SARVX-09-
004 SARI 15.925 0.07745 0.00175 11.42 0.3329 0.01695 
        
 
 
 
 
 
 
170 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 3 cont’d 
Acc Source Cp Ca Na K Mg Fe 
SARVX-07-
001 SARI 15.6625 0.14015 0.0039 10.155 0.25975 0.0064 
SARI-5-5-5 SARI 14.875 0.2053 0.00435 10.33 0.28185 0.01525 
ITO7K-298-
45 SARI 16.8 0.1284 0.00185 10.955 0.3014 0.04095 
IT10K-817-3 SARI 15.6625 0.08745 0.0022 11.135 0.33335 0.00665 
IT86D-610 SARI 13.0375 0.0812 0.00535 9.575 0.17805 0.0296 
IT08K- SARI 11.725 0.13005 0.00515 11.495 0.3697 0.1088 
SARI-2-50-
80 SARI 12.25 0.147 0.00405 10.19 0.2475 0.0565 
SARI-3-11-
88 SARI 14.0875 0.10525 0.0087 12.67 0.4124 0.105 
SARI-1-50-
81 SARI 16.275 0.17335 0.01275 11.96 0.40085 0.0972 
IT08K-137-1 SARI 12.95 0.0945 0.0046 10.33 0.266 0.03395 
SARI-3-11-
100 SARI 14.0875 0.10525 0.0087 12.67 0.4124 0.105 
IT07K-299-
69 SARI 12.775 0.0842 0.00315 9.535 0.2431 0.0603 
SARI-6-299 SARI 12.3375 0.1218 0.0083 12.47 0.4198 0.0979 
SARI-13-17-
12 SARI       
IT08K-150-
241 SARI 14.175 0.11135 0.006 14.19 0.42525 0.09575 
        
 
 
 
 
 
 
 
 
 
171 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 4. Sources and polyphenol concentration (mg/l) of cowpea accessions 
Acc Source Syringic Vanillic Gallic Quercetin 
RC-01 DPEB 75.9 20.4 20.2 60.5 
AS007 DPEB 84.1 29.7 23.5 95.5 
312 DPEB 79.7 24.7 17.7 45.5 
RC-04 DPEB 74.1 18.3 10.2 60.5 
AGRAC-216 DPEB 87.8 34 26 43.8 
BELEDI B DPEB 79.7 24.7 16.8 95.5 
LADUNI 1B DPEB 114.1 64 71.8 90.5 
111 DPEB 83.4 29 22.7 73.8 
4223 DPEB 89.7 36.1 29.3 67.2 
212 DPEB 78.4 23.3 19.3 112.2 
BOTN002 DPEB 80.3 25.4 21 67.2 
ASOO4 DPEB 82.2 27.6 19.3 67.2 
2213 DPEB 72.2 16.1 11.8 80.5 
AS008 DPEB 92.8 39.7 40.2 73.8 
ASOO9 DPEB 99.1 46.9 50.2 65.5 
EMS30-02 DPEB 144.7 99 158.5 83.8 
WACCI-TONI DPEB 69.7 13.3 8.5 77.2 
ASOO3 DPEB 90.9 37.6 38.5 72.2 
COLMUT10-01 DPEB 68.4 11.9 8.5 72.2 
EMS10-01 DPEB 795.3 842.6 1463.5 72.2 
442 DPEB 72.2 16.1 15.2 52.2 
6824 DPEB 73.4 17.6 16.8 50.5 
F2RG004 DPEB 72.8 16.9 12.7 118.8 
G5 DPEB 72.2 16.1 12.7 67.2 
      
 
 
 
 
 
 
 
 
 
172 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 4 cont’d 
Acc Source Syringic Vanillic Gallic Quercetin 
F2RG011 DPEB 73.4 17.6 14.3 67.2 
RC-03 DPEB 75.9 20.4 16.8 122.2 
F2RG007 DPEB 109.1 58.3 70.2 57.2 
BOTN006 DPEB 82.8 28.3 23.5 67.2 
F2RG012 DPEB 398.4 389 450.2  
F2RG010 DPEB 75.3 19.7 16.8 92.2 
F2RG009 DPEB 115.9 66.1 71.8 48.8 
G41 DPEB 147.2 101.9 115.2 67.2 
G35 DPEB 148.4 103.3 115.2 88.8 
422 DPEB 75.9 20.4 16 60.5 
G24 DPEB 221.6 186.9 201.8 102.2 
G80 DPEB 143.4 97.6 111.8 75.5 
G22 DPEB 75.9 20.4 16 63.8 
G7 DPEB 117.2 67.6 76.8 68.8 
G50 DPEB 74.1 18.3 13.5 63.8 
GOLINGA DPEB 76.6 21.1 14.3 53.8 
SONGOTRA SARI 76.6 21.1 13.5 73.8 
BAWUTA SARI 74.7 19 11 67.2 
ZAAYURA SARI 76.6 21.1 13.5 48.8 
PADI-TUYA SARI 85.9 31.9 26 47.2 
APAGBAALA SARI 75.3 19.7 12.7 53.8 
ASONTEM SARI 104.7 53.3 36 53.8 
ITO7K-299-6 SARI 79.7 24.7 21 48.8 
SARVX-09-002 SARI 75.9 20.4 12.7 47.2 
      
 
 
 
 
 
 
 
 
 
173 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 4 cont’d 
Acc Source Syringic Vanillic Gallic Quercetin 
IT98K-628 SARI 85.3 31.1 7.7 45.5 
SARI-6-2-6 SARI 82.2 27.6 21.8 80.5 
SARVX-09-004 SARI 80.3 25.4 21 53.8 
SARVX-07-001 SARI 79.7 24.7 17.7 68.8 
SARI-5-5-5 SARI 76.6 21.1 31 70.5 
ITO7K-298-45 SARI 77.8 22.6 15.2 55.5 
IT10K-817-3 SARI 81.6 26.9 18.5 77.2 
IT86D-610 SARI 80.9 26.1 20.2 55.5 
IT08K- SARI 81.6 26.9 20.2 48.8 
SARI-2-50-80 SARI 76.6 21.1 13.5 73.8 
SARI-3-11-88 SARI 78.4 23.3 14.3 83.8 
SARI-1-50-81 SARI 77.2 21.9 6 52.2 
IT08K-137-1 SARI 132.8 85.4 98.5 50.5 
SARI-3-11-100 SARI 82.2 27.6 21 100.5 
IT07K-299-69 SARI 76.6 21.1 15.2 45.5 
SARI-6-299 SARI 79.1 24 16 73.8 
SARI-13-17-12 SARI 74.1 18.3 17.7 68.8 
IT08K-150-241 SARI 84.1 29.7 22.7 112.2 
      
 
 
 
 
 
 
 
 
 
 
 
 
 
174 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 4 cont’d 
Acc Source Cu Ni Pb Cd Mn Cr Zn 
RC-01 DPEB nd 0.0211  nd 0.01585 nd nd 
AS007 DPEB nd 0.026 0.00185 nd 0.013 nd nd 
312 DPEB nd 0.0315  nd 0.01625 nd nd 
RC-04 DPEB nd 0.03615 0.0388 nd 0.028 nd nd 
AGRAC-216 DPEB nd 0.0322 0.0167 0.00115 0.0184 nd nd 
BELEDI B DPEB nd 0.02125 0.03045 0.00155 0.02115 nd nd 
LADUNI 1B DPEB nd 0.01035 0.00585 0.00115 0.01245 nd nd 
111 DPEB nd 0.03645 0.0323 nd 0.0093 nd nd 
4223 DPEB nd 0.0194 0.05075 0.0007 0.02075 nd nd 
212 DPEB nd nd nd nd nd nd nd 
BOTN002 DPEB nd 0.0599 0.0544 nd 0.0294 nd nd 
ASOO4 DPEB nd 0.04245 0.01155 nd 0.02555 nd nd 
2213 DPEB nd 0.05295 0.0301 nd 0.0269 nd nd 
AS008 DPEB nd 0.0621 0.2014 nd 0.0284 nd nd 
ASOO9 DPEB nd 0.04235 0.0209 nd 0.02185 nd nd 
EMS30-02 DPEB nd 0.05395 0.0661 nd 0.02705 nd nd 
WACCI-
TONI DPEB nd 0.04335 0.0614 nd 0.0226 nd nd 
ASOO3 DPEB nd 0.05005 0.0366 nd 0.02645 nd nd 
COLMUT10-
01 DPEB nd 0.0655 0.16515 nd 0.027 nd nd 
EMS10-01 DPEB nd 0.052 0.0827 nd 0.02705 nd nd 
442 DPEB nd nd nd nd nd nd nd 
6824 DPEB nd nd nd nd nd nd nd 
F2RG004 DPEB nd nd nd nd nd nd nd 
G5 DPEB nd nd nd nd nd nd nd 
         
 
 
 
 
 
 
 
 
175 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 4 cont’d 
Acc Source Cu Ni Pb Cd Mn Cr Zn 
F2RG011 DPEB -0.0067 0.03905 nd nd nd nd 0.00215 
RC-03 DPEB -0.0011 0.05995 0.0097 nd nd nd nd 
F2RG007 DPEB -0.00405 0.0315 nd nd nd nd 0.00685 
BOTN006 DPEB nd 0.06315 0.02915 nd nd nd nd 
F2RG012 DPEB nd 0.03795 nd nd nd nd 0.00465 
F2RG010 DPEB 0.0008 0.0276 nd nd nd nd 0.0028 
F2RG009 DPEB nd 0.04405 nd nd nd nd 0.0029 
G41 DPEB nd nd nd nd nd nd nd 
G35 DPEB nd 0.05655 0.0584 nd nd 0.00305 0.0017 
422 DPEB nd nd nd nd nd nd nd 
G24 DPEB nd 0.02615 nd nd nd nd 0.01315 
G80 DPEB nd 0.02955 nd nd nd nd 0.0044 
G22 DPEB nd 0.02705 nd nd nd 0.0003 0.0079 
G7 DPEB nd 0.06495 0.0003 nd nd nd 0.00155 
G50 DPEB nd 0.04495 0.0193 nd 0.0235 nd nd 
GOLINGA DPEB nd 0.0303 0.04525 0.0001 0.02165 nd nd 
SONGOTRA SARI nd 0.0155 0.01805 nd 0.011 nd nd 
BAWUTA SARI nd 0.01415 nd nd 0.01345 nd nd 
ZAAYURA SARI nd 0.0147 nd nd 0.01465 nd nd 
PADI-TUYA SARI nd 0.02735 nd nd 0.01595 nd nd 
APAGBAALA SARI nd 0.0221 0.0179 nd 0.01645 nd nd 
ASONTEM SARI nd 0.0283 0.03595 nd 0.01765 nd nd 
ITO7K-299-
6 SARI nd 0.00775 0.0257 0.0011 0.01385 nd nd 
SARVX-09-
002 SARI nd 0.031 0.0599 nd 0.02235 nd nd 
IT98K-628 SARI nd 0.02735 0.0535 nd 0.02155 nd nd 
SARI-6-2-6 SARI nd 0.0163  nd 0.0119 nd nd 
SARVX-09-
004 SARI nd 0.02115 0.04615 nd 0.0191 nd nd 
         
 
 
 
 
 
 
176 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 4 cont’d 
Acc source Cu Ni Pb Cd Mn Cr Zn 
SARVX-07-
001 SARI nd 0.0216  nd 0.0143 nd 0.0031 
SARI-5-5-5 SARI nd 0.0282 0.01515 nd 0.0192 nd nd 
ITO7K-298-
45 SARI nd 0.03235 0.0599 nd 0.0221 nd nd 
IT10K-817-3 SARI nd 0.00825 0.00855 nd 0.01 nd 0.0009 
IT86D-610 SARI nd 0.0262  nd 0.0216 nd  
IT08K- SARI nd 0.00535 0.01355 0.00285 0.0165 nd 0.00075 
SARI-2-50-
80 SARI nd 0.0247 0.0321 0.0011 0.00605 nd nd 
SARI-3-11-
88 SARI nd 0.03215 0.023 0.0019 0.0148 nd 0.00375 
SARI-1-50-
81 SARI nd 0.01315 0.02145 0.00035 0.0145 nd nd 
IT08K-137-1 SARI nd 0.0151 0.0007 0.0015 0.0104 nd nd 
SARI-3-11-
100 SARI nd 0.03215 0.023 0.0019 0.0148 nd 0.00375 
IT07K-299-
69 SARI nd 0.02495 0.0098 0.0008 0.0087 nd nd 
SARI-6-299 SARI nd 0.0193 0.0393 0.002 0.0199 nd nd 
SARI-13-17-
12 SARI nd nd nd nd nd nd nd 
IT08K-150-
241 SARI nd 0.0396 0.0332 0.0003 0.026 nd nd 
         
  
 
 
 
 
 
 
 
 
 
177 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5.  Sources and amino acids concentration (ppm) of cowpea accessions 
   Acc Source lhistidine glycine lserine lcysteine lasparagine 
RC-01 DPEB 0.000017 nd nd nd nd 
AS007 DPEB  nd nd nd nd 
312 DPEB 1.40E-06 nd nd nd nd 
RC-04 DPEB 0.000036 nd nd nd 0.000042 
AGRAC-216 DPEB 0.000028 nd nd nd 0.000012 
BELEDI B DPEB 6.60E-06 nd nd nd nd 
LADUNI 1B DPEB 0.000016 nd nd nd nd 
111 DPEB 9.50E-06 nd nd nd nd 
4223 DPEB 3.40E-06 nd nd nd nd 
212 DPEB 0.000012 nd nd nd 0.000021 
BOTN002 DPEB 0.000023 nd nd nd 0.000012 
ASOO4 DPEB 0.000045 3.50E-06 nd nd 0.000061 
2213 DPEB 0.000031 nd nd nd 8.30E-06 
AS008 DPEB 0.000033 nd nd nd 0.000029 
ASOO9 DPEB 0.000057 nd nd nd 0.000041 
EMS30-02 DPEB 0.00009 nd nd nd 0.000029 
WACCI-TONI DPEB 0.000077 1.10E-06 nd nd 0.00002 
ASOO3 DPEB 0.000028 nd nd nd 5.20E-06 
COLMUT10-01 DPEB 0.000058 2.90E-06 nd nd 0.000031 
EMS10-01 DPEB 0.000018 nd nd nd 0.000013 
442 DPEB  nd nd nd nd 
6824 DPEB 6.20E-06 nd nd nd nd 
F2RG004 DPEB 3.30E-06 nd nd nd 0.000024 
G5 DPEB 0.000067 2.60E-06 nd nd nd 
       
 
 
 
 
 
 
 
 
 
178 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5. cont’d. 
   Acc Source lhistidine glycine lserine lcysteine lasparagine 
F2RG011 DPEB 0.000123 6.00E-06 nd nd 0.00004 
RC-03 DPEB 0.00002 nd nd nd 0.000023 
F2RG007 DPEB 0.000022 nd nd nd 3.90E-06 
BOTN006 DPEB 0.000055 9.40E-07 nd nd 0.000059 
F2RG012 DPEB 0.000057 nd nd nd nd 
F2RG010 DPEB 1.00E-05 nd nd nd 0.000014 
F2RG009 DPEB 0.000011 nd nd nd 0.00004 
G41 DPEB 0.000019 4.00E-07 nd nd 9.60E-06 
G35 DPEB 0.000022 6.10E-08 nd nd 0.000017 
422 DPEB 9.00E-06 nd nd nd 0.000026 
G24 DPEB 1.00E-05 2.20E-06 nd nd 7.70E-06 
G80 DPEB 0.000077 5.90E-06 nd nd 0.000122 
G22 DPEB 0.000039 2.80E-06 nd nd 0.000022 
G7 DPEB 0.000052 3.00E-06 nd nd 0.000049 
G50 DPEB 0.000016 2.40E-06 nd nd nd 
GOLINGA DPEB 3.40E-06 nd nd nd nd 
SONGOTRA SARI 0.000172 nd nd nd 0.000025 
BAWUTA SARI 0.000016 nd nd nd nd 
ZAAYURA SARI 0.000135 nd nd nd nd 
PADI-TUYA SARI 0.000026 nd nd nd 8.40E-06 
APAGBAALA SARI 0.000022 nd nd nd nd 
ASONTEM SARI 0.000061 nd nd nd 1.00E-06 
ITO7K-299-6 SARI 6.20E-06 nd nd nd nd 
SARVX-09-002 SARI 0.000073 nd nd nd nd 
IT98K-628 SARI 0.000035 nd nd nd 0.000012 
SARI-6-2-6 SARI 0.000014 nd nd nd 0.000018 
SARVX-09-004 SARI 0.00008 nd nd nd nd 
       
 
 
 
 
 
 
 
179 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5 cont’d. 
     Acc Source lhistidine glycine lserine lcysteine lasparagine 
SARVX-07-001 SARI 0.000017 nd nd nd 8.20E-07 
SARI-5-5-5 SARI 0.000011 nd nd nd nd 
ITO7K-298-45 SARI 0.000056 nd nd nd nd 
IT10K-817-3 SARI 6.10E-06 nd nd nd nd 
IT86D-610 SARI 3.10E-06 nd nd nd nd 
IT08K- SARI 0.000074 nd nd nd 0.000017 
SARI-2-50-80 SARI 0.000019 nd nd nd 0.000013 
SARI-3-11-88 SARI 5.20E-06 nd nd nd nd 
SARI-1-50-81 SARI 0.00004 nd nd nd 0.000042 
IT08K-137-1 SARI 0.000019 nd nd nd nd 
SARI-3-11-100 SARI 0.000057 nd nd nd nd 
IT07K-299-69 SARI 0.00009 nd nd nd 7.70E-06 
SARI-6-299 SARI 0.000036 nd nd nd 1.20E-06 
SARI-13-17-12 SARI 0.000015 nd nd nd nd 
IT08K-150-241 SARI 0.000036 nd nd nd 7.40E-06 
       
 
 
 
 
 
 
 
 
 
 
 
 
 
 
180 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5. cont’d. 
    Acc Source dlalphaalanine glutamine llysine laspartic bthreonine 
RC-01 DPEB nd nd nd 5.70E-07 nd 
AS007 DPEB nd nd nd 1.70E-06 nd 
312 DPEB nd nd nd 1.10E-06 nd 
RC-04 DPEB nd nd nd 8.10E-06 nd 
AGRAC-216 DPEB nd nd nd nd nd 
BELEDI B DPEB 8.10E-06 nd nd 6.30E-06 nd 
LADUNI 1B DPEB 0.000013 nd nd nd nd 
111 DPEB 5.90E-06 nd nd 2.10E-06 nd 
4223 DPEB 7.80E-06 nd nd nd nd 
212 DPEB nd nd nd 0.000015 nd 
BOTN002 DPEB 0.000014 nd nd 4.40E-06 nd 
ASOO4 DPEB 0.000078 nd nd 1.00E-05 nd 
2213 DPEB 0.000027 nd nd 1.00E-05 nd 
AS008 DPEB 0.000018 nd nd 0.000011 nd 
ASOO9 DPEB 0.000023 nd nd 0.000015 nd 
EMS30-02 DPEB 0.000016 nd nd 0.000012 nd 
WACCI-TONI DPEB 0.000023 nd nd 1.00E-05 nd 
ASOO3 DPEB nd nd nd 9.50E-06 nd 
COLMUT10-01 DPEB 0.000042 nd nd 0.000018 nd 
EMS10-01 DPEB 0.000016 nd nd 6.50E-06 nd 
442 DPEB 5.80E-08 nd nd nd nd 
6824 DPEB 4.40E-06 nd nd nd nd 
F2RG004 DPEB 1.00E-05 nd nd 0.000013 nd 
G5 DPEB 0.000069 nd nd 9.00E-06 nd 
       
 
 
 
 
 
 
 
 
 
181 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5. cont’d. 
Acc Source dlalphaalanine glutamine llysine laspartic bthreonine 
F2RG011 DPEB 0.000083 nd nd 0.000017 nd 
RC-03 DPEB 0.000013 nd nd 0.000015 nd 
F2RG007 DPEB 0.000017 nd nd 7.50E-06 nd 
BOTN006 DPEB 0.00004 nd nd 0.000013 nd 
F2RG012 DPEB 0.000012 nd nd 9.00E-06 nd 
F2RG010 DPEB 0.00002 nd nd 7.00E-06 nd 
F2RG009 DPEB 0.000028 nd nd 9.10E-06 nd 
G41 DPEB 0.000024 nd nd 6.70E-06 nd 
G35 DPEB 0.000037 nd nd 7.10E-06 nd 
422 DPEB 0.000034 nd nd 1.00E-05 nd 
G24 DPEB 0.000037 nd nd 8.90E-06 nd 
G80 DPEB 0.000088 nd nd 0.000016 nd 
G22 DPEB 0.000027 nd nd 7.40E-06 nd 
G7 DPEB 0.000046 nd nd 0.000015 nd 
G50 DPEB 0.00004 nd nd 7.00E-06 nd 
GOLINGA DPEB nd nd nd nd nd 
SONGOTRA SARI 0.000035 nd nd 2.50E-06 nd 
BAWUTA SARI 1.30E-06 nd nd 4.50E-07 nd 
ZAAYURA SARI 7.00E-06 nd nd nd nd 
PADI-TUYA SARI 0.000039 nd nd 1.90E-06 nd 
APAGBAALA SARI nd nd nd 9.30E-08 nd 
ASONTEM SARI 2.10E-06 nd nd nd nd 
ITO7K-299-6 SARI nd nd nd nd nd 
SARVX-09-002 SARI nd nd nd nd nd 
IT98K-628 SARI 0.000027 nd nd 1.30E-06 nd 
SARI-6-2-6 SARI nd nd nd 2.50E-06 nd 
SARVX-09-004 SARI 2.30E-06 nd nd nd nd 
       
 
 
 
 
 
 
182 
 
University of Ghana http://ugspace.ug.edu.gh
 
Appendix 5. cont’d. 
Acc Source dlalphaalanine glutamine llysine laspartic bthreonine 
SARVX-07-001 SARI 4.30E-06 nd nd 1.30E-07 nd 
SARI-5-5-5 SARI 1.10E-06 nd nd nd nd 
ITO7K-298-45 SARI 0.000039 nd nd 3.50E-07 nd 
IT10K-817-3 SARI 0.000015 nd nd nd nd 
IT86D-610 SARI nd nd nd nd nd 
IT08K- SARI 0.000026 nd nd 0.000015 nd 
SARI-2-50-80 SARI 0.000016 nd nd 6.00E-06 nd 
SARI-3-11-88 SARI nd nd nd 3.30E-06 nd 
SARI-1-50-81 SARI 0.000027 nd nd 9.40E-06 nd 
IT08K-137-1 SARI nd nd nd 4.70E-06 nd 
SARI-3-11-100 SARI nd nd nd 7.70E-06 nd 
IT07K-299-69 SARI 0.000018 nd nd 0.000017 nd 
SARI-6-299 SARI nd nd nd nd nd 
SARI-13-17-12 SARI 0.000011 nd nd 4.70E-06 nd 
IT08K-150-241 SARI 0.000026 nd nd 7.40E-06 nd 
       
 
 
 
 
 
 
 
 
 
 
 
 
 
183 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5. cont’d. 
   Acc Source lthreonine lvaline dproline lmethionine 
RC-01 DPEB nd 6.90E-06 nd 2.40E-06 
AS007 DPEB nd 3.20E-06 2.40E-06 1.90E-06 
312 DPEB nd 6.90E-06 2.00E-06 2.20E-06 
RC-04 DPEB nd 5.90E-06 4.90E-06 2.00E-06 
AGRAC-216 DPEB nd 0.000021 6.80E-07 2.00E-06 
BELEDI B DPEB nd 0.000011 nd 3.70E-06 
LADUNI 1B DPEB nd 0.000011 nd 1.80E-06 
111 DPEB nd 3.00E-06 3.90E-06 2.10E-06 
4223 DPEB nd 1.90E-06 nd 1.80E-06 
212 DPEB nd nd 8.50E-06 3.30E-06 
BOTN002 DPEB nd 1.50E-06 5.60E-06 3.40E-06 
ASOO4 DPEB nd 0.000011 0.000017 5.50E-06 
2213 DPEB nd 4.10E-06 3.20E-06 4.10E-06 
AS008 DPEB nd 6.10E-06 6.30E-06 2.40E-06 
ASOO9 DPEB nd 5.30E-06 6.20E-06 1.80E-06 
EMS30-02 DPEB nd 9.80E-06 0.000015 1.90E-06 
WACCI-
TONI DPEB nd 4.00E-06 7.60E-06 3.50E-06 
ASOO3 DPEB nd 0.000015 4.50E-06 4.60E-06 
COLMUT10-
01 DPEB nd 6.10E-06 0.000021 6.00E-06 
EMS10-01 DPEB nd 2.80E-06 2.80E-06 1.80E-06 
442 DPEB nd 6.00E-06 7.80E-06 1.80E-06 
6824 DPEB nd 0.000012 3.40E-06 1.90E-06 
F2RG004 DPEB nd  4.40E-06 2.80E-06 
G5 DPEB nd 0.000015 1.00E-05 5.30E-06 
      
 
 
 
 
 
 
 
 
184 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5. cont’d. 
   Acc Source lthreonine lvaline dproline lmethionine 
F2RG011 DPEB nd 0.000023 0.000014 7.80E-06 
RC-03 DPEB nd 1.10E-06 6.90E-06 3.50E-06 
F2RG007 DPEB nd 1.00E-05 9.60E-06 3.30E-06 
BOTN006 DPEB nd nd 0.000011 4.50E-06 
F2RG012 DPEB nd 0.000029 nd 1.80E-06 
F2RG010 DPEB nd 0.000012 9.10E-06 2.60E-06 
F2RG009 DPEB nd nd 1.00E-05 3.30E-06 
G41 DPEB nd nd 1.00E-05 1.90E-06 
G35 DPEB nd 1.40E-06 0.000014 4.00E-06 
422 DPEB nd 6.50E-07 0.000011 2.50E-06 
G24 DPEB nd 3.00E-06 4.70E-06 3.70E-06 
G80 DPEB nd 8.50E-07 0.000028 6.10E-06 
G22 DPEB nd 1.30E-06 0.00002 5.30E-06 
G7 DPEB nd 0.000016 2.70E-06 4.40E-06 
G50 DPEB nd 0.000015 4.50E-06 6.50E-06 
GOLINGA DPEB nd 5.50E-06 2.60E-06 1.90E-06 
SONGOTRA SARI nd 4.40E-06 nd 2.30E-06 
BAWUTA SARI nd 1.70E-06 nd 2.00E-06 
ZAAYURA SARI nd 3.60E-06 2.00E-06 2.10E-06 
PADI-TUYA SARI nd 5.80E-06 2.20E-06 2.00E-06 
APAGBAALA SARI nd 4.50E-06 3.60E-06 1.90E-06 
ASONTEM SARI nd 2.30E-06 nd 2.10E-06 
ITO7K-299-6 SARI nd 3.00E-06 3.40E-06 1.90E-06 
SARVX-09-002 SARI nd 3.40E-06 7.50E-06 2.00E-06 
IT98K-628 SARI nd 7.00E-06 3.10E-07 2.00E-06 
SARI-6-2-6 SARI nd 9.30E-06 0.000011 2.00E-06 
SARVX-09-004 SARI nd 0.000016 0.000048 2.60E-06 
      
 
 
 
 
 
 
 
185 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5. cont’d. 
    Acc Source lthreonine lvaline dproline lmethionine 
SARVX-07-001 SARI nd 5.30E-06 0.000014 2.20E-06 
SARI-5-5-5 SARI nd 8.40E-06 0.000012 2.60E-06 
ITO7K-298-45 SARI nd 0.000014 0.000047 3.20E-06 
IT10K-817-3 SARI nd 9.20E-06 0.000023 2.30E-06 
IT86D-610 SARI nd 2.10E-06 3.40E-06 1.90E-06 
IT08K- SARI nd 0.000029 0.00002 2.80E-06 
SARI-2-50-80 SARI nd 3.00E-06 3.10E-06 3.90E-06 
SARI-3-11-88 SARI nd 4.30E-06 nd 1.90E-06 
SARI-1-50-81 SARI nd 6.20E-06 2.30E-06 1.80E-06 
IT08K-137-1 SARI nd 0.000011 nd 2.10E-06 
SARI-3-11-100 SARI nd 6.90E-06 4.60E-07 1.90E-06 
IT07K-299-69 SARI nd 0.000015 4.00E-06 1.90E-06 
SARI-6-299 SARI nd 8.20E-06 nd 2.20E-06 
SARI-13-17-12 SARI nd 0.000023 0.000014 4.40E-06 
IT08K-150-241 SARI nd 0.000012 9.80E-06 2.00E-06 
      
 
 
 
 
 
 
 
 
 
 
 
 
 
 
186 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5. cont’d. 
     Acc Source isoleucine trans4hydroxylproline ltyrosine dlbetaphenylalanin ltryptophan 
RC-01 DPEB 8.80E-06 8.30E-06 nd 0.000106 0.00056 
AS007 DPEB 8.90E-06 9.10E-06 nd 0.000035 0.000275 
312 DPEB 1.00E-05 1.00E-05 4.10E-06 0.000064 0.000172 
RC-04 DPEB 9.70E-06 9.80E-06 2.00E-06 0.000016 0.000169 
AGRAC-216 DPEB 7.60E-06 7.90E-06 0.000099 0.001522 0.0004 
BELEDI B DPEB 7.60E-06 7.80E-06 0.000021 0.000377 0.0005 
LADUNI 1B DPEB 7.80E-06 8.00E-06 2.70E-06 0.000236 0.000192 
111 DPEB 7.80E-06 8.00E-06 nd 0.000616 0.000362 
4223 DPEB 7.70E-06 7.90E-06 nd 0.000076 0.000303 
212 DPEB 8.00E-06 8.20E-06 0.000102 nd nd 
BOTN002 DPEB 7.70E-06 7.90E-06 0.000033 0.000065 0.00079 
ASOO4 DPEB 7.90E-06 8.10E-06 0.000071 0.000368 0.000439 
2213 DPEB 7.80E-06 8.10E-06 0.000049 nd 0.000998 
AS008 DPEB 7.80E-06 8.00E-06 8.50E-06 0.000212 0.0004 
ASOO9 DPEB 7.80E-06 8.00E-06 0.000016 nd 0.000382 
EMS30-02 DPEB 7.90E-06 8.10E-06 0.000018 0.000052 0.000354 
WACCI-
TONI DPEB 7.90E-06 8.10E-06 0.000043 nd 0.000352 
ASOO3 DPEB 8.00E-06 8.20E-06 0.00006 0.000306 0.001227 
COLMUT10-
01 DPEB 8.00E-06 8.20E-06 0.000213 nd 0.000607 
EMS10-01 DPEB 7.80E-06 8.00E-06 0.000041 0.000102 0.000155 
442 DPEB 8.40E-06 8.60E-06 5.50E-06 0.000151 0.000083 
6824 DPEB 8.30E-06 8.50E-06 3.40E-06 0.0001 0.0006 
F2RG004 DPEB 7.90E-06 8.10E-06 0.00002 nd nd 
G5 DPEB 7.70E-06 7.90E-06 0.000155 nd nd 
       
 
 
 
 
 
 
 
 
187 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5. cont’d. 
     Acc Source isoleucine trans4hydroxylproline ltyrosine dlbetaphenylalanin ltryptophan 
F2RG011 DPEB 7.90E-06 8.00E-06 0.000158 nd nd 
RC-03 DPEB 7.90E-06 8.10E-06 0.000105 nd nd 
F2RG007 DPEB 7.70E-06 7.90E-06 0.000094 0.000035 0.000596 
BOTN006 DPEB 7.90E-06 8.10E-06 0.000033 nd nd 
F2RG012 DPEB 7.70E-06 7.90E-06 0.000025 0.000499 0.003769 
F2RG010 DPEB 7.80E-06 8.00E-06 0.000021 nd nd 
F2RG009 DPEB 7.90E-06 8.10E-06 0.000051 nd nd 
G41 DPEB 8.00E-06 8.20E-06 0.000028 nd nd 
G35 DPEB 7.90E-06 8.10E-06 0.000021 nd nd 
422 DPEB 8.00E-06 8.20E-06 0.000078 nd nd 
G24 DPEB 8.00E-06 8.20E-06 0.000025 nd nd 
G80 DPEB 8.00E-06 8.20E-06 0.000287 nd nd 
G22 DPEB 8.20E-06 8.40E-06 0.00017 nd nd 
G7 DPEB 8.10E-06 8.30E-06 0.000106 nd nd 
G50 DPEB 7.70E-06 7.90E-06 0.00016 0.000018 nd 
GOLINGA DPEB 8.70E-06 8.90E-06 0.000013 0.000058 0.00038 
SONGOTRA SARI 8.80E-06 9.00E-06 nd 0.000165 0.000698 
BAWUTA SARI 8.60E-06 8.80E-06 nd 0.000096 0.000619 
ZAAYURA SARI 9.00E-06 9.20E-06 nd 0.000029 0.00012 
PADI-TUYA SARI 9.40E-06 9.50E-06 nd 0.000097 0.000421 
APAGBAALA SARI 8.00E-06 8.20E-06 8.60E-06 0.000286 0.001874 
ASONTEM SARI 8.30E-06 8.50E-06 1.20E-06 0.000046 0.000227 
       
 
 
 
 
 
 
 
 
 
 
188 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 5. cont’d. 
Acc Source isoleucine trans4hydroxylproline ltyrosine dlbetaphenylalanin ltryptophan 
ITO7K-
299-6 SARI 8.30E-06 8.50E-06 nd 0.000081 0.000368 
SARVX-
09-002 SARI 8.10E-06 8.30E-06 0.00005 0.00018 0.001157 
IT98K-
628 SARI 9.80E-06 9.90E-06 0.000021 0.000075 0.000647 
SARI-6-
2-6 SARI 9.40E-06 9.60E-06 2.10E-07 0.000099 0.000224 
SARVX-
09-004 SARI 0.000013 0.000013 0.000145 0.000309 0.000669 
SARVX-
07-001 SARI 9.20E-06 9.30E-06 0.000026 0.000215 0.00071 
SARI-5-
5-5 SARI 0.000011 0.000011 0.000099 0.000176 0.000695 
ITO7K-
298-45 SARI 0.000014 0.000014 0.000135 0.000301 0.000484 
IT10K-
817-3 SARI 0.000012 0.000011 0.000082 0.000338 0.000629 
IT86D-
610 SARI 8.20E-06 8.40E-06 nd 0.000121 0.000159 
IT08K- SARI 7.70E-06 8.00E-06 nd 0.000974 0.001015 
SARI-2-
50-80 SARI 7.70E-06 7.80E-06 nd 0.00006 0.000732 
SARI-3-
11-88 SARI 7.60E-06 7.80E-06 nd 0.00002 0.000254 
SARI-1-
50-81 SARI 7.80E-06 8.00E-06 nd 0.000074 0.000388 
IT08K-
137-1 SARI 7.60E-06 7.80E-06 nd 0.00014 0.00118 
SARI-3-
11-100 SARI 7.70E-06 7.90E-06 nd 0.000093 0.000923 
IT07K-
299-69 SARI 7.80E-06 8.00E-06 nd 0.000099 0.000672 
SARI-6-
299 SARI 7.70E-06 7.80E-06 nd 0.004566 0.002271 
SARI-
13-17-
12 SARI 8.60E-06 8.70E-06 0.000072 0.000258 0.000387 
IT08K-
150-
241 SARI 7.70E-06 7.90E-06 nd 0.000112 0.000696 
       
 
189 
 
University of Ghana http://ugspace.ug.edu.gh
Appendix 6. Highest mean amino acids concentrations in some cowpea accessions. 
Accession Amino acid Concentration (ppm) 
Songotra L-Histidine 0.000172 
F2RG011 Glycine 6.00 x 10-6 
G80 L-Asparagine 0.000122 
G80 DL-Alpha-Alanine 0.000088 
COLMUT10-01 L-Asapartic 0.000018 
IT08K L-Valine 0.000029 
SARVX-09-004 L-Proline 0.000048 
F2RG011 L-Methionine 7.80 x 10-6 
IT07K-298-45 Iso-Leucine 0.000014 
IT07K-298-45 Trans-4-Hydroxy-Proline 0.000014 
G80 L-Tyrosine 0.000287 
SARI-6-299 DL-Beta-phenyl-Alanine 0.004566 
F2RG012 L-Tryptophan 0.003769 
 
 
 
 
 
 
190