AIDS RESEARCH AND HUMAN RETROVIRUSES
Volume 17, Number 7, 2001, pp. 649–655
Mary Ann Liebert, Inc.
Sequence Note
Isolation and Characterization of a Full-Length Molecular
DNA Clone of Ghanaian HIV Type 1 Intersubtype A/G
Recombinant CRF02_AG, Which Is Replication 
Competent in a Restricted Host Range
SHIGERU KUSAGAWA,1 YUTAKA TAKEBE,1 RONGGE YANG,1 KAZUSHI MOTOMURA,1
WILLIAM AMPOFO,2 JAMES BRANDFUL,2 YOSHIO KOYANAGI,3 NAOKI YAMAMOTO,4
TETSUTARO SATA,5 KOICHI ISHIKAWA,1,2 YOSHIYUKI NAGAI,1 and MASASHI TATSUMI6
ABSTRACT
We have isolated a replication-competent, full-length molecular clone of HIV-1 CRF02_AG, designated
p97GH-AG1, by reconstituting two separately amplified genomic regions of an HIV-1 provirus of a 1997
Ghanaian isolate. The phylogenetic and recombination breakpoint analyses revealed that 97GH-AG1 had an
A/G recombinant structure similar to that of prototype Nigerian isolate IbNG. The 17-nucleotide insertion
downstream of the primer-binding site appeared to be a common sequence signature specific to most
CRF02_AG strains, including 97GH-AG1. 97GH-AG1 showed an R5 phenotype and exerted productive in-
fection in both HOS and NP2 cell infectivity assays, whereas it failed to show a detectable level of progeny
production in peripheral blood mononuclear cells (PBMCs). The data may suggest the presence of unknown
determinant(s) that dictate efficient replication in PBMCs, but that are not required for replication in im-
mortalized cell lines.
GLOBALLY CIRCULATING HIV-1 STRAINS are classified into among injecting drug users in Kaliningrad in Russia, andthree groups, designated M, N, and O, which are defined CRF04_cpx from Cyprus and Greece.1
as distinct clusters on phylogenetic trees. Group M comprises Our understanding of the pathogenesis and the molecular bi-
the great majority of HIV-1 isolates and is further divided into ology of HIV-1 has been mainly based on the analysis of a few
at least nine nonrecombinant subtypes, designated A to D, F to strains of subtype B, a subtype that is not often found in the
H, and J and K.1 Analyses of subgenomic and full-length major epicenter of the HIV epidemic, including Africa and
HIV-1 sequences identified some numbers of intersubtype re- south and Southeast Asia. Accordingly, the molecular reagents
combinants that clustered with different subtypes in different for nonsubtype B viruses are limited. In particular, replication-
parts of their genome. Some recombinants showed a widespread competent HIV-1 molecular clones are critically needed for the
geographic dissemination, referred to as circulating recom- studies requiring functional gene products with the defined and
binant forms (CRFs).2 Four CRFs, CRF01 through CRF04, uniform genetic and immunological properties of respective
are currently recognized: CRF01_AE from Southeast Asia, subtypes, or CRFs. Only seven replication-competent nonsub-
CRF02_AG from Africa, CRF03_AB found in the epidemic type B molecular clones are so far available, including one sub-
1AIDS Research Center, National Institute of Infectious Diseases, Tokyo 162-8640, Japan.
2Noguchi Memorial Institute for Medical Research, University of Ghana, Legon, Ghana.
3Department of Virology, Tohoku University Graduate School of Medicine, Sendai 980-8575, Japan.
4Department of Microbiology, Tokyo Medical and Dental University, Tokyo, 113-8519 Japan.
5Department of Pathology, National Institute of Infectious Diseases, Tokyo 162-8640, Japan.
6Department of Veterinary Science, National Institute of Infectious Diseases, Tokyo 162-8640, Japan.
649
Downloaded by University of Ghana,Legon from www.liebertpub.com at 02/25/19. For personal use only. 
650 KUSAGAWA ET AL.
type C (pIndieCl3), four subtype D (NDK,4 Z2Z6, ELI,5 and were infected with a serially diluted virus stock of NJ97-42,
94UG114.1), one African strain of CRF01_AE (90CF402.16), overlaid with medium containing 0.7% agarose, and cultured
and MAL (HIV-1 A/D/K/? recombinant).5 The availability of for 3 days. After staining with 5-bromo-4-chloro-3-indolyl-b-
replication-competent molecular clones would facilitate the D-galactoside, viruses were recovered from plaques and prop-
studies particularly aimed at determining the biological conse- agated in HeLa 4.5 cells, which express both CXCR4 and CCR5
quence of HIV-1 genetic diversity and its impact on cellular with CD4, to avoid the possible complication of recombination
and humoral immune responses. Here we describe the first full- events with the HIV-1 long terminal repeat (LTR) sequence in
length molecular DNA clone of HIV-1 intersubtype A/G re- MAGIC5A cells.
combinant (CRF02_AG) from Ghana and discuss on its struc- High molecular weight DNAs were extracted from HeLa 4.5
tural and virological properties. cells infected with plaque-purified NJ97-42 and were used as
An HIV-1 strain (NJ97-42) was isolated in 1997 from a templates for polymerase chain reaction (PCR) amplification of
symptomatic HIV-seropositive 60-year-old consenting Ghana- HIV-1 proviral sequences by the Expand Long Template PCR
ian woman (NJ97-42) by cocultivation of the peripheral blood system (Boehringer Mannheim, Indianapolis, IN). The replica-
mononuclear cells (PBMCs) with phytohemagglutinin (PHA)- tion-competent provirus clones were reconstituted from two
stimulated donor PBMCs. She was a sexually transmitted dis- separately amplified genomic regions3,7 (Fig. 1). Briefly, the
ease clinic patient seropositive for Treponema pallidum anti- 658-bp fragment spanning the viral LTR, and the untranslated
gen. At the time of blood sampling, her CD41 cell count was leader sequence preceding the gag gene, was amplified by us-
440 cells/ml and her CD41:CD81 cell ratio was 0.85. The ing the primer pair of HIV-LTR1(1)/EcoRI (59-CGGA-
HIV-1 strain, NJ97-42, was originally classified as HIV-1 sub- ATTCT1GGATGGGCTAATTTACTCCAA 22-39, sense; the
type A by phylogenetic tree analysis based on the env (C2/V3) EcoRI site is underlined. The positions of the nucleotides in
sequence in a previous study (data not shown). The virus was HIV relative to HXB2CG, which were determined by the HXB2
plaque purified in the MAGIC5A indicator cell line, a deriva- Numbering Engine available at http://hiv-web.lanl.gov/NUM-
tive of HeLa-CD4-LTR-b-Gal (MAGI), which expressed high HXB2/HXB2.Nuc.html, are hereinafter shown as superscripts
level of CD4 and CCR5 as well as CXCR4.3 MAGIC5A cells in the first and last nucleotides of the corresponding HIV-1 se-
FIG. 1. The scheme of construction and structure of the full-length HIV-1 CRF02_AG molecular clone, p97GH-AG1. The po-
sitions of PCR primers that were used to reconstitute the full-length clone are shown at the top. Details of the construction are
described in text.
Downloaded by University of Ghana,Legon from www.liebertpub.com at 02/25/19. For personal use only. 
FIG. 2. Structural profiles of 97GH-AG1. (A) Phylogenetic tree based on full-length nucleotide sequence. Full-length nucleotide
sequence of 97GH-AG1 was aligned with those of the newly proposed HIV-1 group M reference strains (http://hiv-
web.lanl.gov/ALIGN_CURRENT/subtype_alignments.html) in the Los Alamos HIV sequence database. Sites where there was a
gap in any of the sequences were excluded. The tree was generated by the neighbor-joining method based on the Kimura two-
parameter distance matrix, using PHYLIP. SIVCPZGAB was used as outgroup. Subtype or CRF clades are indicated outside the
tree. The bootstrap values are shown at corresponding nodes. (B) Bootstrap plots depicting the relationship to the indicated ref-
erence strain of respective subtype. Since the bootstrap values against subtype B, D, E, and G references were negligibly low,
only plots for subtypes A, C, G, H, and J are shown. Trees were constructed from the multiple genome alignment, and the per-
centage of bootstrap replicates (y axis) that support the clustering of 97GH-AG1 with the reference strains was plotted for a win-
dow of 500 bp moving in increments of 100 bp along the alignment. Regions of subtype A or G origin are identified by high
bootstrap values (.90%). Points of cross-over of the two curves indicate recombination breakpoints. (C) Bootscan plot of 97GH-
AG1 with the prototype CRF02_AG strain IbNG, in comparison with the subtype C and B reference strains. (D) The deduced
recombinant structure of p97GH-AG1. The regions in white could not be assigned to any known subtype.
651
Downloaded by University of Ghana,Legon from www.liebertpub.com at 02/25/19. For personal use only. 
652 KUSAGAWA ET AL.
quence in respective primers) and HIV-LTR 660(–) (59- the GFP-positive cultures. One replication-competent full-
C660TTCTAGAACCCTGTTCGGGCGCC ACTGCT631-39, an- length molecular DNA clone, designated p97GH-AG1 (Fig. 1),
tisense; KasI/NarI site is underlined). For the amplification of was identified among 10 candidate plasmids.
the approximately 9.1-kb 39 HIV segment containing most of The size of the full-length HIV-1 genome in p97GH-AG1
the HIV genome, a primer set of HIV PBS 615(1) (59-A615 was 9748 bp (since 29 bp of the 39-terminal part in the 39 LTR
GTCTAGAAAATCTCTAGCAGT GGCGCCCGAACAG649- sequence was missing because of the 39 LTR primer that we
39, sense; KasI/NarI site is underlined) and HIV U5 9690(–) used, the total length of this clone after reverse transcription
(59-AGACGCGGCCGCG9690GTCTGAGGGATCTCTA GT- should be 9777 bp), with intact open reading frames for all nine
TACCAGAGT9663-39, antisense; NotI site is underlined) was HIV-1 genes, including gag, pol, env, vif, vpr, tat, rev, vpu, and
used. The fragment containing the 59 LTR that was cloned into nef. p97GH-AG1 had two NF-kB sites, three SP-1 sites, a nor-
the pBRSK9 vector (Fig. 1), a derivative of pBR322, contain- mal TATA box (TATAAA), and a typical 3-nucleotide bulge
ing the multiple cloning site derived from pBluescript-SK(–) (UCU) in the TAR stem region (data not shown). Neighbor-
(Stratagene, La Jolla, CA), was subsequently cleaved with joining analysis based on full-length HIV-1 sequences revealed
KasI/NarI in the primer-binding site and by NotI in the that p97GH-AG1 is clustered with the reference strains for HIV-
polylinker to allow the insertion of the 9.1-kb PCR products 1 intersubtype A/G recombinants (CRF02_AG), including
cleaved with the same restriction enzymes. The full-length IbNG8 and DJ263 and DJ2642 (Fig. 2A). The bootstrap and di-
HIV-1 DNA sequence was determined on both strands, using versity plot analyses showed that p97GH-AG1 shared an al-
the fluorescent dye terminator method in an Applied BioSys- most identical structural profile with IbNG8,9 (Fig. 2B–D).
tems model 373A DNA sequencer (Applied Biosystems, Fos- The alignment of the nucleotide sequences near the LTR and
ter City, CA). The resultant plasmid was found to contain a the gag leader regions, in comparison with that of HIV-1 sub-
small deletion immediately upstream of the primer-binding site type B strain HXB2, revealed that 97GH-AG1 had a 17-nu-
and to have weak replication capability in the indicator cells. cleotide insertion similar to that of two CRF02_AG reference
To repair this defect, a DNA segment containing the 59 half strains, including IbNG and DJ263 (DJ264 has one extra nu-
of the HIV genome, encompassing from the 59 LTR to the cleotide) (Fig. 3A). The other form of HIV-1 intersubtype A/G
NcoI site in the vpr gene, was amplified with the primer pair recombinants (92NG003 and 92NG083), as well as CRF01_AE,
HIV-LTR1(1)/BamHI (59-CGGGATCCT1GGATGGGCTAA- subtype G, and some of subtype A strains (92UG03 and
TTTACTCCAA22-3 , sense; BamHI site is underlined) and HIV SE8131), have 24-nucleotide insertions10,119 (Fig. 3A). The 17-
Vpr 5678(–) (59-A5678TGGAGCCATGGTCTAGGAAAGT- nucleotide insertion has not been detected so far in any other
GTCTG5651-39, antisense; NcoI site is underlined) and was HIV-1 subtypes, CRF clades, or other forms of recombinants
cloned by the TA cloning method into the XcmI site in pCR- that contained subtype A segments (Fig. 3A), and thereby ap-
XL-TOPO (InVitrogen, San Diego, CA). The insert containing peared to be specific to most of the CRF02_AG strains, in-
the 59 half of the HIV-1 genome was cleaved with ApaI and cluding 97GH-AG1. As shown in Fig. 3A, the 24-nucleotide
NcoI and then cloned into the ApaI–NcoI sites in vector DNA. insertion10 is generated by a duplication of the 39 part of the
The infectivity of HIV-1 DNA clones was tested with PBS stem–loop structure, which is composed of duplication
HeLa4.5-nEGFP, a highly sensitive indicator cell line that ex- units i and ii.11 These two duplication units, with an interven-
presses a high level of CD4 and both major HIV-1 coreceptors, ing AT-rich 5-nucleotide stretch,11 were composed of three
CCR5 and CXCR4, and carries the HIV-1 LTR-driven en- purine-rich segments of 6, 7, and 6 bp (Fig. 3A). The 24-bp in-
hanced green fluorescent protein (EGFP) gene with nuclear lo- sertion comprises units of 7, 6, 5, and 6 nucleotides (Fig. 3A).
calizing signal (nEGFP). HeLa4.5-nEGFP cells were trans- In contrast, the 17-nucleotide insertions uniquely found in most
fected with each candidate DNA clone by the method using of the CRF02_AG strains are apparently generated by the dele-
FuGENE 6 (Boehringer Mannheim). The replication-competent tion of a 7-nucleotide segment of duplication i, and thereby
clones were identified by the following three criteria: (1) de- were composed of two 6-bp units with an intervening 5-bp AT-
tection of fluorescence in the nuclei of transfected HeLa4.5- rich sequence (Fig. 3A).
nEGFP cells, assuring the intactness of tat gene function and It is noted that the insertion of 9 amino acids was observed
that of its cis-acting TAR sequence in the candidate clone; (2) in the proximal part of the amino-terminus coding region of the
formation of syncytia, reflecting the functional intactness of env nef gene12 in p97GH-AG1. This insertion appears to be unique
gene and the related genetic elements required for env gene ex- in this clone, since it is not found in any other CRF02_AG so
pression (tat and rev and their cis-acting elements) to trigger far reported in the database (Fig. 3B). However, it is uncertain
membrane fusion; and (3) production of progeny virion, which whether this has any consequences for the viological properties
is assessed by reverse transcriptase assay of the supernatants of of the virus.
FIG. 3. Sequence features unique to 97GH-AG1. (A) Alignment of nucleotide sequence near the primer-binding sites (PBS).
Locations of the PBS, PBS insertion,10,11 and U5–PBS hairpin structure15 with the positions of nucleotides numbered relative to
HXB2CG (determined by HXB@ numbering engine, available at http://hiv-web.lanl.gov/NUM-HXB2/HXB2.Nuc.html), are
shown at the top. The shaded areas indicate the locations of duplicative sequences. Duplications i and ii11 are composed of units
of duplicative sequences 6, 7, and 6 bp long, with an intervening 5-bp AT-rich stretch. The 17-bp insertions unique to most of
CRF02_AG, including 97GH-AG1, consisting of two 6-bp units with a 5-bp intervening sequence, are shown at the bottom. (B)
Alignment of deduced amino acid sequences of the amino-terminus regions of Nef proteins. Dots indicate identity with the HXB2
sequence, shown at the top; dashes indicate a gap in the alignment.
Downloaded by University of Ghana,Legon from www.liebertpub.com at 02/25/19. For personal use only. 
MOLECULAR CLONE OF GHANAIAN CRF02_AG 653
Downloaded by University of Ghana,Legon from www.liebertpub.com at 02/25/19. For personal use only. 
654 KUSAGAWA ET AL.
The NP2-CD413 and HOS-CD4 cell14-based infectivity as- p97GH-AG1 exerted productive infection in NP2-CD4-CCR5
says indicated that 97GH-AG1 used CCR5, but not CXCR4, as cells, but not in NP2-CD4-CXCR4 cells (Fig. 4B). Essentially
a primary coreceptor (Fig. 4). 97GH-AG1 showed syncytium similar results were obtained in the HOS cell-based infectivity
formation in NP2-CD4 cells expressing CCR5 (NP2-CD4- assay (data not shown). However, p97GH-AG1 did not show
CCR5 cells), but not in those expressing CXCR4 (NP2-CD4- any detectable level of progeny production in phytohemagglu-
CXCR4 cells) (Fig. 4A). The virion-associated reverse tran- tinin (PHA)-stimulated PBMCs even after CD81 T lympho-
scriptase assay of culture supernatants demonstrated that cytes were depleted (data not shown). It is known that pro-
FIG. 4. Virological properties of HIV-1 CRF02_AG molecular clone p97GH-AG1. (A) Syncytium formation in NP2-CD4 in-
dicator cell lines. Left: NP2-CD4-CXCR4 cells. Right: NP2-CD4-CCR5 cells. Syncytium formation was monitored by Giemsa
staining 3, 5, and 7 day postinfection. (B) Coreceptor usage of p97GH-AG1 in NP2-CD4 cell infectivity assay. The virion-as-
sociated RT activities in culture supernatants collected 3, 5, and 7 days after infection with respective strains are shown as a his-
togram. Each plot was an average of triplicated assays.
Downloaded by University of Ghana,Legon from www.liebertpub.com at 02/25/19. For personal use only. 
MOLECULAR CLONE OF GHANAIAN CRF02_AG 655
longed activation with interleukin 2 (IL-2) in addition to PHA REFERENCES
is required for the induction of sufficient surface CCR5 ex-
pression in PBMC cultures. Indeed, the previously isolated 1. Robertson DL, Anderson JP, Bradac JA, et al.: HIV-1 nomencla-
ture proposal [letter]. Science 2000;288:55–56.
HIV-1 subtype C infectious molecular clone, pIndieC1, which
2. Carr JK, Salminen MO, Albert J, et al.: Full genome sequences of
uses CCR5 as a coreceptor,3 was not able to replicate in the human immunodeficiency virus type 1 subtypes G and A/G inter-
standard PBMC cultures stimulated only with PHA, while it subtype recombinants. Virology 1998;247:22–31.
could replicate in PBMCs stimulated with both PHA and IL-2 3. Mochizuki N, Otsuka N, Matsuo K, et al.: An infectious DNA clone
prior to the infection. Even under the same experimental con- of HIV type 1 subtype C. AIDS Res Hum Retroviruses 1999;15:
ditions in which pIndieCl resulted in productive infection, 1321–1324.
p97GH-AG1 was not able to show any detectable progeny pro- 4. Spire B, Sire J, Zachar V, et al.: Nucleotide sequence of HIV1-
duction in PBMCs. NDK: A highly cytopathic strain of the human immunodeficiency
There are several possible explanations for the replication virus. Gene 1989;81:275–284.
competency of p97GH-AG1 in the restricted host range. The 5. Alizon M, Wain-Hobson S, Montagnier L, and Sonigo P: Genetic
variability of the AIDS virus: Nucleotide sequence analysis of two
indicator cell lines that were used for screening the infec-
isolates from African patients. Cell 1986;46:63–74.
tious molecular clones in the present study overexpressed 6. Gao F, Robertson DL, Morrison SG, et al.: The heterosexual hu-
CD4 and the coreceptors, and thereby under these extreme man immunodeficiency virus type 1 epidemic in Thailand is caused
conditions it is possible to select HIV-1 DNA clones that are by an intersubtype (A/E) recombinant of African origin. J Virol
dependent on high levels of CCR5 and/or CD4 to propagate 1996;70:7013–7029.
efficiently in target cells. p97GH-AG1 might require higher 7. Dittmar MT, Simmons G, Donaldson Y, et al.: Biological charac-
CCR5 and CD4 expression levels for efficient propagation terization of human immunodeficiency virus type 1 clones derived
in PBMCs. Alternatively, p97GH-AG1 may represent a vi- from different organs of an AIDS patient by long-range PCR. J Vi-
ral species that can replicate slowly in certain cell popula- rol 1997;71:5140–5147.
tions in vivo. This phenomenon may also suggest the pres- 8. Howard TM and Rasheed S: Genomic structure and nucleotide se-
quence analysis of a new HIV type 1 subtype A strain from Nige-
ence of unknown determinant(s) that are required for
ria. AIDS Res Hum Retroviruses 1996;12:1413–1425.
efficient propagation in PBMCs but not for replication in im- 9. Carr JK, Laukkanen T, Salminen MO, et al.: Characterization of
mortalized cell lines. Further analyses are currently in subtype A HIV-1 from Africa by full genome sequencing. AIDS
progress to understand the mechanism underlying the differ- 1999;13:1819–1826.
ence in permissiveness of 97GH-AG1 propagation in differ- 10. Chang SY, Apichartpiyakul C, Kuiken CL, Essex M, and Lee TH:
ent target cells. Sequence features downstream of the primer-binding site of HIV
In conclusion, our screening system, which facilitates the type 1 subtype E shared by subtype G and a subset of subtype A.
identification of replication-competent HIV-1 clones, enabled AIDS Res Hum Retroviruses 1999;15:1703–1706.
us to isolate several infectious molecular clones of nonsubtype 11. De Baar MP, De Ronde A, Berkhout B, et al.: Subtype-specific se-
B and CRF clades, including subtype C,3 CRF02_AG (in the quence variation of the HIV type 1 long terminal repeat and primer-
16,17 binding site. AIDS Res Hum Retroviruses 2000;16:499–504.present study), and CRF01_AE recombinants. Replication-
12. Shugars DC, Smith MS, Glueck DH, et al.: Analysis of human im-
competent HIV-1 molecular clones of nonsubtype B/CRF munodeficiency virus type 1 nef gene sequences present in vivo. J
clades would facilitate the investigation of differences in viro- Virol 1993;67:4639–4650.
logical and immunological properties (if any), and the devel- 13. Soda Y, Shimizu N, Jinno A, et al.: Establishment of a new sys-
opment of clade-specific molecular and immunological tem for determination of coreceptor usages of HIV based on the
reagents. human glioma NP-2 cell line. Biochem Biophys Res Commun
1999;258:313–321.
14. Deng H, Liu R, Ellmeier W, et al.: Identification of a major co-re-
ACKNOWLEDGMENTS ceptor for primary isolates of HIV-1. Nature 1996;381:661–666.
15. Beerens N, Klaver B, and Berkhout B: A structured RNA motif is in-
We thank Hiroo Hoshino for NP2 human glioma-CCR trans- volved in correct placement of the tRNA(3)(Lys) primer onto the hu-
fected cell lines. The HOS-CCR transfected cell lines were ob- man immunodeficiency virus genome. J Virol 2000;74:2227–2238.
tained from Nathaniel Landau through the AIDS Research and 16. Sato H, Tomita Y, Ebisawa K, et al.: Augmentation of HIV-1 mul-
Reference Reagent Program (Division of AIDS, NIAID, NIH). tiple-drug resistance by insertion of a foreign 11-amino-acid frag-
ment into the reverse transcriptase. J Virol 2001; in press.
We thank Feng Gao for valuable advice. This study was sup-
17. Kusagawa S, Sato H, Tomita Y, et al.: Isolation and characteriza-
ported by grants from the Ministry of Health and Welfare, the tion of replication-competent molecular DNA clones of HIV-1 in-
Organization for Pharmaceutical Safety and Research, and the tersubtype AE recombinants (CRF01–AE): Use of improved plaque
Human Science Foundation. S.K. and R.Y. are the recipients isolation and screening system. In preparation.
of research resident fellowships from the Japanese Foundation
for AIDS Prevention. Address reprint requests to:
Yutaka Takebe and Masashi Tatsumi
SEQUENCE DATA National Institute of Infectious Diseases
1-23-1 Toyama, Shinjuku-ku
The full-length sequences of HIV-1 97GH-AG1 were sub- Tokyo 162-8640, Japan
mitted to GenBank and are available under accession number
AB049811. E-mail: takebe@nih.go.jp and tatsu@nih.go.jp
Downloaded by University of Ghana,Legon from www.liebertpub.com at 02/25/19. For personal use only. 
This article has been cited by:
1. Robert J Scarborough, Michel V Lévesque, Etienne Boudrias-Dalle, Ian C Chute, Sylvanne M Daniels,
Rodney J Ouellette, Jean-Pierre Perreault, Anne Gatignol. 2014. A Conserved Target Site in HIV-1 Gag
RNA is Accessible to Inhibition by Both an HDV Ribozyme and a Short Hairpin RNA. Molecular Therapy
- Nucleic Acids 3, e178. [Crossref]
2. Maurice L.J. Moncany, Karine Dalet, Pascal R.R. Courtois. 2006. Identification of conserved lentiviral
sequences as landmarks of genomic flexibility. Comptes Rendus Biologies 329:10, 751-764. [Crossref]
3. Christine M. Rousseau, Brian A. Birditt, Angela R. McKay, Julia N. Stoddard, Tsan Chun Lee, Sherry
McLaughlin, Sarah W. Moore, Nice Shindo, Gerald H. Learn, Bette T. Korber, Christian Brander, Philip
J.R. Goulder, Photini Kiepiela, Bruce D. Walker, James I. Mullins. 2006. Large-scale amplification, cloning
and sequencing of near full-length HIV-1 subtype C genomes. Journal of Virological Methods 136:1-2,
118-125. [Crossref]
4. Denis M. Tebit, Léopold Zekeng, Lazare Kaptué, Hans-Georg Kräusslich, Ottmar Herchenröder. 2003.
Construction and characterisation of a full-length infectious molecular clone from a fast replicating, X4-
tropic HIV-1 CRF02.AG primary isolate. Virology 313:2, 645-652. [Crossref]
5. Lucía Pérez-Alvarez, Elena Delgado, María Luisa Villahermosa, María Teresa Cuevas, Valentina García,
Elena Vázquez de Parga, Michael M. Thomson, Arturo Prieto, Laureano Cuevas, Leandro Medrano, José
A. Taboada, Rafael Nájera. 2002. Biological characteristics of newly described HIV-1 BG recombinants in
Spanish individuals. AIDS 16:4, 669-672. [Crossref]
6. Shigeru Kusagawa, Hironori Sato, Yasuhiro Tomita, Masashi Tatsumi, Kayoko Kato, Kazushi Motomura,
Rongge Yang, Yutaka Takebe. 2002. Short Communication: Isolation and Characterization of Replication-
Competent Molecular DNA Clones of HIV Type 1 CRF01_AE with Different Coreceptor Usages. AIDS
Research and Human Retroviruses 18:2, 115-122. [Abstract] [PDF] [PDF Plus]
7. Mikako Takahoko, Minoru Tobiume, Koichi Ishikawa, William Ampofo, Naoki Yamamoto, Michiyuki
Matsuda, Masashi Tatsumi. 2001. Infectious DNA Clone of HIV Type 1 A/G Recombinant (CRF02_AG)
Replicable in Peripheral Blood Mononuclear Cells. AIDS Research and Human Retroviruses 17:11,
1083-1087. [Abstract] [PDF] [PDF Plus]
Downloaded by University of Ghana,Legon from www.liebertpub.com at 02/25/19. For personal use only.