i 
 

 

 

COLLEGE OF HEALTH SCIENCES 

DEPARTMENT OF MEDICAL MICROBIOLOGY 

 

CHARACTERIZATION OF UROPATHOGENIC ESCHERICHIA COLI (UPEC) 

IN HIV SEROPOSITIVE WOMEN WITH ASYMPTOMATIC BACTERIURIA 

BY: 

HAROLD KWADZO AMEGBLETOR 

(10804654) 

 

 

 THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON  

IN PARTIAL FULFILMENT OF THE REQUIREMENT FOR THE AWARD OF 

MPHIL IN MEDICAL MICROBIOLOGY DEGREE 

AUGUST, 2022

University of Ghana http://ugspace.ug.edu.gh 



ii 
 

DECLARATION 

I declare that this thesis is the product of research conducted by Harold Kwadzo 

Amegbletor at the Medical Microbiology Department of the University of Ghana Medical 

School under the supervision of Professor Japheth A. Opintan and Dr. Appiah-Korang 

Labi and to the best of my knowledge, has not been conducted nor presented for any 

other degree nor processional qualification at this or any other institution except as 

referenced. 

 

 

Sign:        Date:         

Name: Harold Kwadzo Amegbletor 

Student ID: 10804654 

 

 

 

Sign:       Date:       

Academic Supervisor: Prof. Japheth A. Opintan 

 

 

 

 

 

Sign                                                                                   Date:   

 

Co-Supervisor: Dr Appiah-Korang Labi 

 

 

 

 

 

 

University of Ghana http://ugspace.ug.edu.gh 



iii 
 

DEDICATION 

I dedicate this work to my father, Rowland Kwaku Amegbletor; my mother, Regina 

Boateng, and to all loved ones   

University of Ghana http://ugspace.ug.edu.gh 



iv 
 

ACKNOWLEDGEMENT 

I am forever grateful to the almighty God for His traveling mercies throughout the study 

period. I am deeply grateful to Professor Japheth A. Opintan and Dr. Appiah-Korang 

Labi for their constructive criticism, patience, guidance, support, provision of resources, 

and their assistance in editing the scripts. A big thank you to Dr. Beverly Egyir and 

Madam Felicia Owusu (Department of Bacteriology, Noguchi Memorial Institute of 

Medical Research) for their assistance at the molecular phase of this work.  

To the Head and all the lecturers of Medical Microbiology Department, University of 

Ghana Medical School, a big thank you for the knowledge imparted during the 

coursework. My gratitude is incomplete without acknowledging Miss Mary-Magdalene 

Osei, Department of Medical Microbiology, (UGMS) for her technical support. 

My profound gratitude to the Head and staff of the Primary Health Care (PHC) unit 

(particularly Mr. Isaac Nana Beyin) and the entire laboratory staff of the St. Martin de 

Porres Hospital, Eikwe. I am forever grateful to the Ghana National Petroleum Company 

(GNPC) foundation for its financial support throughout the study period. A big thank you 

to Mr. Nelson Hukporti for his moral support and partnership throughout the molecular 

work at Noguchi. 

Finally, I would want to appreciate the emotional, financial and prayerful support I got 

from my family and friends. May God reward you.  

University of Ghana http://ugspace.ug.edu.gh 



v 
 

ABSTRACT 

BACKGROUND: Asymptomatic bacteriuria (ASB), a precursor for Urinary tract 

infection (UTI), is high among People living with HIV (PLHIV). E. coli is the most 

implicated organism. An understanding of the risk factors for ASB, virulence genes and 

resistance profile of uropathogens among this population is important to the management 

and control. 

AIM: To characterize uropathogenic E. coli (UPEC) in HIV seropositive women with 

asymptomatic bacteriuria 

METHODOLOGY: This cross-sectional study was carried out at St. Martin de Pores 

Hospital, Eikwe in the Western Region of Ghana. A structured questionnaire was used to 

extract clinical information from the folders of 400 HIV seropositive women. The 

information included patient demographics, history of hospitalization, HAART treatment 

initiation date and WHO disease stage. Urine samples were obtained, cultured and 

identified with MALDI TOF biotyper. Antibiotic resistance pattern was determined, and 

genes coding for virulence and integrons were screened for using Multiplex PCR and gel 

imaging techniques.  

RESULTS: From the 400 samples cultured, 21.15% (85/400) were positive. The most 

prevalent organisms were; Escherichia coli 69.4% (59/85), Enterococcus faecalis 8.2% 

(7/85), Klebsiella pneumoniae 7.0% (6/85)), Proteus mirabilis 7.0% (6/85), 

Staphylococcus hemolyticus 3.5% (3/85). All uropathogenic E. coli isolates were resistant 

to ampicillin and 98.3% (58/59), resistant to trimethoprim sulfamethoxazole, followed by 

tetracycline 94.9% (56/59), cefuroxime 74.6% (45/59), amoxiclav 49.2% (30/59) and 

ciprofloxacin 32.2% (19/59). The lowest resistance was recorded to meropenem and 

University of Ghana http://ugspace.ug.edu.gh 



vi 
 

fosfomycin at 1.7% and nitrofurantoin 6.8% (4/59). The commonest virulence genes 

observed were ChuA 66.1% (n=39/59), PapC 57.6% (n=34/59), cnf1 50.8% (n=30/59), 

kpsMTII 45.8% (n=27/59), iuAt 35.6% (n=21/59) and usp gene 8.5% (n=5/59). Two 

isolates (3.4%) harbored all 5 genes (iuAt, cnf1, papC, chuA, kpsMTII). Five isolates 

haboured iuAt, cnf1, papC and chuA (8.5%, n=5/59). Three genes (iuAt, cnf1, papC) were 

all observed in 6 isolates (10.2%, n=6/59) whilst 7 isolates (12%, n=7/59) were found to 

harbor genes iuAt and cnf1. The commonest integron was intI 42% (n=25/59) followed 

by intII 20% (n=12/59). Viral load [(OR=1.000, 95% CI, 1.000-1.000) (p = 0.295)], 

HAART duration [(OR=1.036, 95% CI, 0.287-1.042) (p=0.287)], age [(OR=1.020, 95% 

CI, 0.999-1.042) (p = 0.06)] and WHO disease stage [(OR=1.286, 95% CI, 0.535-1.6) (p 

= 0.885)] showed no significant association with the occurrence of asymptomatic 

bacteriuria (p≥0.05). HAART duration was observed to be a predictor of resistance to 

amoxiclav [(OR=1.329, 95% CI, 1.113-1.588) (p= 0.002)]. 

CONCLUSION: 

This study showed that asymptomatic bacteriuria is common among women living with 

HIV (WLHIV) visiting Eikwe district hospital, with no association with age, viral load, 

WHO disease stage and HAART duration. High prevalence of multidrug resistant UPEC 

coupled with the high carriage of virulence genes indicates that WLHIV are at a high risk 

of developing urinary tract infections with the potential for complications. There is a need 

for regular monitoring of bacteriuria and antibiotic susceptibility testing among this 

population.  

 

University of Ghana http://ugspace.ug.edu.gh 



vii 
 

TABLE OF CONTENTS 

DECLARATION ................................................................................................................ ii 

DEDICATION ................................................................................................................... iii 

ACKNOWLEDGEMENT ................................................................................................. iv 

ABSTRACT ........................................................................................................................ v 

LIST OF TABLES ............................................................................................................ xii 

LIST OF FIGURES ......................................................................................................... xiii 

LIST OF ABBREVIATIONS .......................................................................................... xiv 

CHAPTER ONE ................................................................................................................. 1 

INTRODUCTION .............................................................................................................. 1 

1.1 Background ............................................................................................................... 1 

1.2 Problem Statement ............................................................................................... 3 

1.4 AIM ...................................................................................................................... 5 

1.5 Specific Objectives ............................................................................................... 5 

CHAPTER 2 ....................................................................................................................... 6 

LITERATURE REVIEW ................................................................................................ 6 

2.1 Urinary Tract Infection......................................................................................... 6 

2.1.1 Asymptomatic bacteriuria ............................................................................. 7 

2.1.1.1 Diagnosis of Asymptomatic Bacteriuria ....................................................... 9 

2.1.1.2 Guideline for the treatment of Asymptomatic bacteriuria .......................... 10 

University of Ghana http://ugspace.ug.edu.gh 



viii 
 

2.1.2 Acute uncomplicated urinary tract infections ............................................. 12 

2.1.3 Complicated urinary tract infections ........................................................... 13 

2.1.4 Recurrent urinary tract infections ............................................................... 13 

2.1.5 Routes of infection ...................................................................................... 14 

2.1.6 Microbial Spectrum of Urinary Tract Infections ........................................ 15 

2.1.7 Pre disposing factors to Bacteriuria in females........................................... 16 

2.1.9 Epidemiology of Extra Intestinal-Pathogenic E. coli (ExPEC) .................. 24 

2.1.10 Identification of Uro-pathogenic E. coli (UPEC) ....................................... 26 

2.1.11 Virulence factors for Uro-Pathogenic E. coli (UPEC)................................ 26 

2.1.11.1 Adhesins .............................................................................................. 28 

2.1.11.2 Distribution and role of Toxin in renal pathology .......................... 30 

2.1.11.3 Capsular polysaccharide ................................................................... 32 

2.1.11.4 Siderophores....................................................................................... 33 

2.2 Human Immunodeficiency Virus / AIDS........................................................... 33 

2.2.1 Pathophysiology of HIV/AIDS ........................................................................ 33 

2.2.2 Opportunistic Infections ................................................................................... 34 

2.2.3 WHO clinical stages of HIV/AIDS for Adults ................................................. 34 

2.3 Mechanism of action and Antibiotic resistance ................................................. 36 

2.3.1 Epidemiology of Antibiotic resistance in UPEC ............................................ 36 

2.3.2 Association between Antibiotic resistance and Virulent factors in UPEC. .... 38 

University of Ghana http://ugspace.ug.edu.gh 



ix 
 

2.3.3 Role of Integrons in Antimicrobial resistance ............................................ 39 

CHAPTER THREE .......................................................................................................... 41 

METHODOLOGY ........................................................................................................... 41 

3.0 Study site and design ............................................................................................. 41 

3.1 Study Participants ............................................................................................... 41 

3.2 Inclusion and Exclusion criteria ......................................................................... 42 

3.3 Sample Size (n) Determination .......................................................................... 42 

3.4 Participant Information ...................................................................................... 42 

3.5 Specimen Collection and Processing ................................................................. 43 

3.6 Laboratory Investigation .................................................................................... 43 

3.6.1 Phase I ......................................................................................................... 43 

3.6.1.1 Identification of organisms ................................................................... 44 

3.6.1.2 Antimicrobial susceptibility test (AST) ............................................... 44 

3.6.1.3 Stocking of Isolates ................................................................................ 45 

3.6.2 Phase II........................................................................................................ 45 

3.6.2.1 Extraction of DNA for Virulent Factor Genes and Integrons in 

UPEC 45 

3.6.2.2 Molecular screening of Virulence and Integron genes using Multiplex 

PCR 46 

3.7 Ethical considerations ........................................................................................ 47 

University of Ghana http://ugspace.ug.edu.gh 



x 
 

3.8 Data analysis ...................................................................................................... 48 

CHAPTER FOUR ............................................................................................................. 49 

RESULTS...................................................................................................................... 49 

4.1 DEMOGRAPHIC CHARACTERISTICS OF STUDY PARTICIPANTS ............ 49 

4.1.1 Distribution of uropathogens by viral load ................................................. 49 

4.1.2 Distribution of uropathogens by duration of HAART therapy ................... 49 

4.2 Distribution of uropathogens .......................................................................... 52 

4.3 Antibiotic Susceptibility Profile of UPEC...................................................... 52 

4.4 Virulence gene distribution among UPEC isolates ........................................ 54 

4.5 . Distribution of Integrase genes in UPEC isolates ........................................ 55 

4.6 HAART duration as a predictor of Antibiotic resistance ............................... 60 

CHAPTER 5 ..................................................................................................................... 61 

CHAPTER 6 ..................................................................................................................... 68 

CONCLUSION AND RECOMMENDATION ............................................................ 68 

APPENDICES .................................................................................................................. 91 

Appendix 1 .................................................................................................................... 91 

Informed Consent Form............................................................................................. 91 

Appendix II ................................................................................................................... 95 

Questionnaires ........................................................................................................... 95 

Appendix III .................................................................................................................. 97 

University of Ghana http://ugspace.ug.edu.gh 



xi 
 

Laboratory Protocols ................................................................................................. 97 

Appendix IV ................................................................................................................ 100 

DNA extraction protocol ......................................................................................... 100 

Appendix V ..................................................................................................................... 101 

Pre, During and Post PCR Activities .......................................................................... 101 

Appendix VI ................................................................................................................ 103 

Gel images ............................................................................................................... 103 

Appendix VII............................................................................................................... 105 

ADDITIONAL RESULTS ...................................................................................... 105 

Risk factors as predictors of growth ........................................................................ 109 

Appendix VIII ............................................................................................................. 112 

Ethical Clearance ..................................................................................................... 112 

 

 

 

 

 

 

University of Ghana http://ugspace.ug.edu.gh 



xii 
 

LIST OF TABLES 

Table 2.1 WHO disease stage classification………………………………..……. … 39 

Table 3.0 Primer sequences and Amplicon sizes for Virulent and Integron 

genes………………………………………………………………………………….52 

Table 4.1 Distribution of risk factor among study participants ………………….…. 49 

Table 4.2: Risk factor association to bacteriuria ………………………………….... 50 

Table 4.3 Resistance profile and distribution of integrase and virulence genes in UPEC 

isolates ……………………………………………………………………………..   55 

Table 4.4 Binary logistic regression analysis of HAART duration as a predictor of 

resistance  …………………………………………………………………………… 59 

Table A1: Proportions of ingredients for the preparation of Master……………………..99 

Table A2: Thermocycling conditions for the Virulence genes (30cycles)……….............99 

 

Table A3: Thermocycling conditions for integrase genes (30cycles) …………...……...100 

Table A4: Distribution of virulence genes in antibiotic resistant and susceptible isolates 

………………………………………………………………………………………103 

Table A5: Distribution of integrase genes in antibiotic resistant and susceptible isolates 

……………………………………………………………………………………….105 

Table A6: Binary logistic regression analysis of risk factors as predictors of growth 

……………………………………………………………………………………… 107 

Table A7: Binary logistic regression analysis of virulence genes as predictors of  

resistance ……………………………………………………………………………108 

 

University of Ghana http://ugspace.ug.edu.gh 



xiii 
 

LIST OF FIGURES 

Figure 1. Diagram of UPEC virulence factors…………………………….............. 31    

Figure 2. Percentage resistance of UPEC isolates to antibiotics…………............... 52 

Figure 3. Distribution of virulence and integrase genes ………………………….. 53 

Figure 4 Distribution of integrase genes in UPEC isolates ……………………….. 54 

Figure 5. Gel image of chuA and Papc …………….……………………………... 101 

Figure 6. Gel image of iuAt, usp and chuA bands ……………...…………………. 101 

Figure 7. Gel image of papC, kpmsTTI and cnf1 bands ….………………………. 102 

Figure 8. Gel image of Integrons ……………..……………………………………..102 

 

 

 

 

 

 

 

 

 

University of Ghana http://ugspace.ug.edu.gh 



xiv 
 

LIST OF ABBREVIATIONS 

HIV   Human Immunodeficiency Virus 

AIDS   Acquired Immune Deficiency Syndrome 

PLHIV  People Living with HIV 

WLHIV           Women Living with HIV 

ASB                Asymptomatic Bacteriuria 

UTI                 Urinary Tract Infection 

UPEC              Uropathogenic Escherichia coli 

ExPEC             Extra Intestinal Pathogenic Escherichia coli 

UNAIDS         United Nations  

CD4                 Cluster of Differentiation 4 

ART                 Anti-Retroviral Therapy 

HAART           Highly Active Anti-Retroviral Therapy 

UGMS             University of Ghana Medical School 

UG                   University of Ghana 

CFU                 Colony Forming Unit 

IDSA                Infectious Disease Society of America 

PFGE               Pulse Field Gel Electrophoresis 

CNF                 Cytotoxic Necrotizing Factor 

CAUTI            Catheter Associated Urinary Tract Infection 

TRAF              Tumor Necrosis Factor 

TRL                 Toll-like Receptor 

NMEC             Neonatal Meningitis Escherichia Coli 

ST                    Sequence Types 

PCR                 Polymerase Chain Reaction 

PAI                  Pathogenicity Island 

MSHA             Mannose Sensitive Hemagglutinin 

University of Ghana http://ugspace.ug.edu.gh 



xv 
 

MRHA            Mannose Resistant Hemagglutinin 

WHO              World Health Organization 

SXT                Trimethoprim Sulfamethoxazole 

TET                Tetracycline 

CRX                Cefuroxime 

CAZ                Ceftazidime 

CTX                Cefotaxime 

CRO                Ceftriaxone 

AMP                Ampicillin 

PEN                 Penicillin  

MEM               Meropenem 

CIP                  Ciprofloxacin 

AMC               Amoxiclav 

FOS                 Fosfomycin 

Nal                  Nalidixic Acid 

NIT                 Nitrofurantoin 

AMK              Amikacin 

GEN               Gentamicin 

FEP                 Cefepime 

SMDPH          St. Martin De Porres Hospital 

CLED             Cysteine Lactose Electrolyte Deficient  

EMB               Eosin Methylene Blue Agar 

AST                Antibiotic Susceptibility Testing 

ATCC            American Type Culture Collection 

University of Ghana http://ugspace.ug.edu.gh 



1 
 

   CHAPTER ONE 

     INTRODUCTION 

1.1 Background 

Urinary tract infection (UTI) is an infection of the upper and lower urinary tract 

(Vasudevan, 2014), and is one of the most frequent bacterial infections that constitutes a 

considerable economic burden to society  (Grabe et al., 2015).  Approximately 150 to 

250 million cases of UTIs are reported globally each year (Tabasi et al., 2015). In the 

United States, UTI accounts for 7 million and 1  million office and emergency 

department visits respectively leading to 100,000 admissions (Foxman, 2010).  

 

A wide range of pathogens are implicated in UTIs, namely; Klebsiella pneumoniae, 

Enterococcus faecalis, Staphylococcus saprophyticus (Mandracchia et al., 2015) with 

uro-pathogenic Escherichia coli (UPEC) accounting for over 80% of the infections 

(Dielubanza & Schaeffer, 2011). E. coli is normal flora in the intestinal tract of warm 

blooded mammals (Shah et al., 2019) but may be pathogenic through the employment of 

virulence factors which enables an ascending colonization of the urinary tract (Foxman, 

2010).  

 

The risk of acquiring UTI is high  among females and specific patient groups such as  

sickle cell disease patients (Bebe et al., 2020; Donkor et al., 2017), diabetic patients 

(Mandracchia et al., 2015), pregnant women, the elderly, catheterized patients, 

individuals with urological malformations and people living with Human 

University of Ghana http://ugspace.ug.edu.gh 



2 
 

Immunodeficiency Virus (PLHIV)  (Iweriebor, 2012). Asymptomatic bacteriuria (ASB) 

is defined as the presence of an established quantitative count of bacteria in a well 

collected urine specimen from a person with no signs and symptoms ascribable to UTI 

(Rubin et al., 1992). ASB among HIV positive patients was reported at 18% in South 

Africa (Laker et al; 2004), 36.7% in India (Yadhav & Samreen, 2017), 12.3% in 

Tanzania (Ngowi et al., 2021), 7.0 % in Ethiopia (Fenta et al., 2016)  and 31.3% amongst 

HIV pregnant women in Nigeria (Akadri and Odelola, 2020). 

 

In Ghana, there are about 210,000 women aged 15 years and over, living with HIV as of 

2019 (UNAIDS, 2019). While there have been studies in Ghana on opportunistic 

infections in PLHIV (Adjei et al., 2018; Lartey et al., 2015; Opintan et al., 2017), the 

prevalence of ASB and the burden of UTI in WLHIV have not been investigated. The 

burden of UTI is compounded in Women living with HIV (WLHIV) (Chaula et al., 2017)  

due to their anatomical predisposition to UTI (Barber et al., 2013; Dielubanza & 

Schaeffer, 2011; Foxman et al., 2002) coupled with the distinctive pathogenesis of HIV 

which causes a decline in the CD4 T cells and makes the body unable to fight foreign 

invaders such as UPEC. The high prevalence of renal dysfunction among HIV people in 

Ghana, particularly those on Antiretroviral (ART) drugs (Chadwick et al., 2015; Obiri-

Yeboah et al., 2018)  puts WLHIV at risk, since expression of  virulence genes can 

potentiate renal pathology and aid in hematogenous dissemination (Gilks et al., 1990; 

SHRUTHI et al., 2012; Taramasso et al., 2016).  

 

University of Ghana http://ugspace.ug.edu.gh 



3 
 

Uropathogenic (UPEC) E.coli is reportedly the predominant uro-pathogen in Ghana 

among PLHIV (Boaitey et al., 2012) and pregnant women  which makes it a pathogen of 

interest to be investigated among this at risk population.   

This study determined the prevalence of asymptomatic bacteriuria and its associated risk 

factors. We determined the antimicrobial susceptibility of UPEC, the distribution of 

virulence genes and integrons among UPEC. 

 

1.2 Problem Statement  

UTI accounts for about 60% of non-AIDS defining illness (Hidron et al., 2010), posing 

clinical burden among PLHIV. Asymptomatic bacteriuria is an important precursor of 

UTI among PLHIV (Murugesh et al; 2014). About 30% of people with asymptomatic 

bacteriuria develop UTI if not treated (Smaill, 2007).    

Treatment of UTI in PLHIV with antimicrobial agents is necessary to minimize the risk 

of renal problems such as HIV associated nephropathy, pyelonephritis, acute and chronic 

kidney disease ( Iweriebor, 2012). High level of opportunistic infections among PLHIV 

necessitates the intake of antibiotics leading to an increase surge in antibiotic resistant 

bacteria among this population (Samje et al., 2020). Incidence of multidrug-resistant 

(MDR) bacteria is of public health concern and has made management of UTI very 

challenging especially in the developing world (Vila & Pal, 2010). High resistance to 

cotrimoxazole a prophylactic agent, against opportunistic infections in the study 

population, has been reported in several populations including PLHIV (Adeyemi et al., 

University of Ghana http://ugspace.ug.edu.gh 



4 
 

2010; Donkor et al., 2019; Evans et al., 1995; Newman et al., 2011; Opintan et al., 

2015). Drug resistant urinary pathogens leave clinicians with very little treatment options.  

 

1.3 Justification 

Among PLHIV, antibiotic resistance is a major concern due to their susceptibility to 

infections and their tendency to become reservoirs to MDR pathogens from frequent 

hospital visits and admissions (Olaru et al., 2021). This theory was confirmed in Nigeria 

as it was observed that multidrug resistant pathogens were prevalent in PLHIV which 

made them a source of  MDR pathogens  (Kemajou & Ajugwo, 2016).  

Ability of an organism to establish UTI depends on the presence of virulence genes 

(Oelschlaeger et al., 2002) and the type of virulence genes present determines the 

severity of disease. The simultaneous expression of virulence and resistance genes among 

this population could be very devastating due to the possibility of treatment failure 

leading to persistence of infection and the possible development of renal complication. 

This raises concerns as IDSA recommends against screening of ASB (Nicolle et al., 

2019) despite the high UTI cases and renal problems reported among this population 

(Chadwick et al., 2015; Obiri-Yeboah et al., 2018). Furthermore, data on the carriage of 

virulence genes in MDR uropathogens among this population is scanty in Ghana and the 

world at large. It is therefore important to identify the virulence gene pool present in 

resistant isolates to help appreciate the pathogenic potential of these uropathogens so 

recommendations can be made for screening of bacteriuria among this population.  

University of Ghana http://ugspace.ug.edu.gh 



5 
 

Also, there is paucity of data on the prevalence of asymptomatic bacteriuria at the study 

site and its associated risk factors such as viral load, age, WHO disease stage among 

PLHIV.  

This work will fill the knowledge gap on the prevalence of ASB among WLHIV in 

Ghana. Data is also needed to help clinicians determine if WLHIV having high viral load 

are potential asymptomatic carriers of bacteriuria so they can treat in time to avoid 

progression to symptomatic UTI. Antibiotic resistance profiles generated will be useful in 

the selection of appropriate antibiotics for the treatment of UTIs especially in settings 

without access to diagnostic microbiology services. 

 

1.4 AIM 

To determine the prevalence of asymptomatic bacteriuria and associated virulence factors 

in Uropathogenic E. coli at the St. Martin de Porres Hospital, Eikwe. 

 

1.5 Specific Objectives 

The specific objectives are to: 

i. determine the prevalence of ASB and its associated risk factors among HIV 

seropositive women with asymptomatic bacteriuria 

ii. determine resistance profile of UPEC and to screen for integrons in UPEC among 

HIV seropositive women with asymptomatic bacteriuria 

iii.  screen for genes encoding adhesins, toxins, siderophores and capsule  

 

University of Ghana http://ugspace.ug.edu.gh 



6 
 

CHAPTER 2 

 

LITERATURE REVIEW 

 

2.1 Urinary Tract Infection 

 

Urinary tract infections may be defined as the presence of significant microbial growth 

characterized by more than 105 colony forming unit (cfu) of the same organism per 

milliliter of urine with or without the presence of symptoms (Ragnarsdóttir & Svanborg, 

2017). Bacteria, fungi and protozoans are possible etiological agents implicated in UTI 

but bacteria are the most predominant with UPEC being the leading cause of UTI (Flores-

mireles et al., 2015). Urinary tract infection may affect any part of the urinary tract 

system; the bladder, kidney, prostate, ureter and the urethra. Due to effective innate 

immune response and the mechanical action of urine, not all bacterial invasions of the 

urinary tract usually led to infections. Most UTIs are caused by a single microorganism 

(monomicrobial) but individuals with structural abnormalities and indwelling catheters 

may have multiple organisms involved. UTI is more prevalent in young sexually active 

women and is estimated that 1 in 3 women will develop UTI before reaching 24years 

(Foxman, 2002). 

 

 The possibility of having UTI after sexual intercourse is higher in women due to 

colonization of the periurethral area and the subsequent movement into the urethra. 

Infection gradually starts from the lower urinary tract which comprises the urethra and 

the bladder causing urethritis and cystitis respectively. Its progression to the upper 

urinary tract can cause infections such as pyelonephritis and may disseminate 

University of Ghana http://ugspace.ug.edu.gh 



7 
 

hematogenously causing septicemia (Chakupurakal et al., 2015). Urinary tract infections 

have been classified into four main groups; asymptomatic, acute uncomplicated, 

complicated and recurrent UTIs (Smelov et al., 2016). 

 

2.1.1 Asymptomatic bacteriuria  

 

Asymptomatic bacteriuria (ASB) is  a very common condition and influenced by 

variables such as age, sex, sexual activity, pregnancy and genitourinary abnormalities 

(Colgan et al., 2006; Nicolle, 1997; Nicolle, 2003; Zhanel et al., 1990). It has been 

evidenced that, ASB in healthy women increases with age, from 1% in females between 

five (5) to fourteen (14) years and more than 20% in females above 80 years (Nicolle, 

2003). Infecting organisms are diverse and include Enterococcus species, Pseudomonas 

auroginosa, Group B Streptococcus with UPEC being the most common organism (Mims 

et al., 1990; Warren et al., 1982). UPEC may be carried by patients for years and will not 

induce an immune response. An earlier study postulated that these organisms may not be 

carrying virulence genes. However, advance molecular epidemiology has explained that 

these genes are present but has rather failed to express the phenotypes (Plos et al., 1990).  

 

In some organisms such as E. coli 83972, they have lost the ability to express functional 

P and type 1 fimbriae rendering it unable to induce an immune response hence has 

evolved as a commensal in the urinary tract leading to asymptomatic bacteriuria (Klemm 

et al., 2006).  

 

 

University of Ghana http://ugspace.ug.edu.gh 



8 
 

Asymptomatic bacteriuria is usually not considered an infection and not clinically 

relevant, but for some group of people,  it is considered a risk factor for developing 

symptomatic UTI (Smelov et al., 2016). Asymptomatic bacteriuria accounts for 70% of 

symptomatic UTI cases in unscreened pregnant women (Sibiani, 2010).   

 

The prevalence of ASB among PLHIV has been reportedly high ranging from 4% to 

25.3% (Skrzat-Klapaczyńska et al., 2018). ASB among HIV positive patients was 

reported at 18% in South Africa (Laker et al; 2004), 36.7% in India (Yadhav & Samreen, 

2017), 12.3% in Tanzania (Ngowi et al., 2021), 7.0 % in Ethiopia (Fenta et al., 2016)  

and 31.3% amongst HIV pregnant women in Olabisi Onabanjo University Teaching 

Hospital, Sagamu, Nigeria (Akadri and Odelola, 2020). 

 

 In Ghana, ASB was reported at 56.1%, 33.3%, 5.5%, and 9.5% among pregnant HIV 

negative women (Afoakwa et al., 2018; Boye et al., 2012; Labi et al., 2015; Obirikorang 

et al., 2012) and 7.7%  among non-pregnant HIV negative women (Boye et al., 2012). 

Another study conducted in Ghana by Lutterodt et al., (2014), also reported a bacteriuric 

rate of 31.6% among out and inpatients visiting a hospital on account of UTI. 

 

It has been proposed that spontaneous asymptomatic bacteriuria may offer some form of 

protection against symptomatic infections caused by other  pathogenic organisms and this 

might be due to competition for space and nutrients  (Cai et al., 2012). 

 

 

University of Ghana http://ugspace.ug.edu.gh 



9 
 

2.1.1.1 Diagnosis of Asymptomatic Bacteriuria 

 

Asymptomatic bacteriuria is characterized by the presence of one or more species of 

viable bacteria growing in a properly collected urine specimen from a person with no sign  

or symptom ascribable to UTI regardless of the presence or absence of pyuria (Nicolle et 

al., 2019).  According to the Infectious Disease Society of America (IDSA), the 

quantitative criteria for defining a significant bacteriuria are; 105  CFU/ml in two 

consecutive samples in women, a single sample in men without symptoms and 

102CFU/ml may be considered significant in catheterized patients  (Nicolle et al., 2019). 

Studies have indicated that a single voided urine specimen has an 80% specificity for 

diagnosing ASB in women whereas two consecutive specimens have 95% specificity 

(Kunin et al., 1964; Solomkin et al., 1992).  

 

According to Deziel et al., (2000), the reason for the collection of second urine specimen 

is to differentiate between true bacteriuria and contamination. They therefore raised 

questions as to whether it is important to culture second urine specimen and if yes, what 

time interval is most appropriate.  IDSA recommends a minimum of 24hrs time interval 

but silent on the maximum time interval between the consecutive cultures. Kass, (1952) 

in his study found a very high reproducibility of significant bacteriuria (66 out 67 

women) of the same species from a second urine specimen after 1 to 2 months interval. 

Similarly, Deziel et al., (2000), recorded a high reproducibility of ASB after 2 to 4 

months interval of a second specimen collection. Diezel and his colleagues used Pulse 

Field Gel Electrophoresis (PGFE) technique to differentiate women with reinfection from 

those with the same strains of organisms that were isolated four months prior. Deziel et 

University of Ghana http://ugspace.ug.edu.gh 



10 
 

al., (2000) suggested that the quantitative criteria of 105 cfu/ml should be the 

discriminatory factor between true bacteriuria and contamination not consecutive cultures 

as recommended by IDSA. Smaill, (2007) reemphasized that a quantitative value of >105 

cfu/ml in a single mid-stream clean catch specimen is adequate and generally accepted as 

practical alternative for the diagnosis of ASB. 

 

2.1.1.2 Guideline for the treatment of Asymptomatic bacteriuria 

 

According to the Ghana standard treatment guideline of 2017, oral and IV ciprofloxacin 

are the first line drugs for the treatment of uncomplicated and complicated UTIs 

respectively. For asymptomatic people, whether to treat or not to treat bacteriuria is a 

frequent dilemma in clinical medicine (Colgan et al., 2006). Historically, ASB was 

treated in all population (Dahiya et al., 2018). However, evidence suggests that screening 

of asymptomatic people for bacteriuria should be done only when factors for poor 

prognosis are present and antimicrobial therapy can prevent poor outcomes (US 

Preventive Services Task force, 1996). According to Infectious Disease Society of 

America (IDSA), treatment of ASB may accelerate antimicrobial resistance and pose 

needless economic burden on patients. Nonetheless, in some subjects, treatment of 

asymptomatic bacteriuria can prevent symptomatic urinary tract infection, chronic kidney 

disease, urinary tract cancer and possibly death ( Nicolle et al., 2005).  

 

IDSA recommends against the treatment of asymptomatic bacteriuria in premenopausal 

non pregnant young women for reasons being that, ASB among this population has not 

University of Ghana http://ugspace.ug.edu.gh 



11 
 

been linked to any disease with a detrimental outcome such as hypertension, renal failure, 

or urinary tract cancer. Moreover, study conducted where some asymptomatic women 

with bacteriuria were given nitrofurantoin and others given placebo revealed that, 

although women with ASB are more likely to develop symptomatic UTI, treatment of 

asymptomatic bacteriuria did not decrease the frequency of symptomatic UTI nor prevent 

bacteriuria within a year after treatment compared to the placebo group (Hooton et al., 

2000).  

 

Pregnant women with asymptomatic bacteriuria are at a higher risk of delivering low 

birth weight and premature infants and stand a higher risk of developing pyelonephritis 

(Hooton et al., 2000). A Cochrane systematic review revealed that treatment of ASB in 

pregnant women decreases the risk of developing pyelonephritis by 75% (Smaill & 

Vazquez, 2019). Treatment of pregnant women with ASB throughout the course of the 

pregnancy yields similar benefits as treating them for 14 days with nitrofurantoin and 

trimethoprim sulfamethoxazole (SXT) (Whalley and Cunningham, 1997). IDSA 

recommends a 3 to 7 days antimicrobial therapy for pregnant women with asymptomatic 

bacteriuria and further recommends that these women be screened periodically for the 

duration of their pregnancy (Nicolle et al., 2005). 

 

Among older people, IDSA does not recommend the screening and treatment of 

asymptomatic bacteriuria (Nicolle et al., 2005). Studies conducted revealed that the 

incidence of asymptomatic bacteriuria among pre and post-menopausal women was 

independent of age (Evans et al., 1900; Bengtsson et al., 1998).  

University of Ghana http://ugspace.ug.edu.gh 



12 
 

In PLHIV, there is no recommendation for the screening and treatment of asymptomatic 

people with bacteriuria. A study in Kenya reported asymptomatic bacteriuria among 

female prostitutes at 23%. From the study, no difference was found between proportions 

of  bacteriuria among HIV positive and HIV negative participants and the presence of 

bacteriuria had no correlation with CD4+ count (Ojoo et al., 1996).  

De Pinto et al found that ASB in HIV men correlates with CD4+ count but no negative 

clinical outcome has been linked to ASB in this population.  

 

2.1.2 Acute uncomplicated urinary tract infections 

 

Acute uncomplicated urinary tract infection is an infection of the bladder characterized 

by polyuria, urgency and painful urination in a woman with no abnormality in the 

genitourinary tract, (Hooton & Stamm, 1997). In the outpatient department, acute 

uncomplicated urinary tract infection is one of the frequently reported infections and the 

second most common reason for antibiotic prescription (Wagenlehner et al., 2011). This 

group includes sporadic or recurrent lower (cystitis) or upper (pyelonephritis) UTI in 

healthy people, especially non-pregnant, premenopausal women with no known 

comorbidities or abnormalities within their urinary tract (Co-chair et al., 2018). In 

diagnosing uncomplicated cystitis and acute pyelonephritis, urine cultures should yield a 

bacterial growth of 103 CFU/ml and 104 CFU/ml of urine respectively.  

 

 

 

University of Ghana http://ugspace.ug.edu.gh 



13 
 

2.1.3 Complicated urinary tract infections 

 

In complicated urinary tract infections, bacterial counts of 105 CFU/ml and 104 CFU/ml 

for women and men respectively, is considered significant. It is more associated with 

people with a structural or functional impairment of the genitourinary tract or people with 

underlying conditions that increases the risk of a failing therapy (Co-chair et al., 2018). 

There is a greater diversity of uro-pathogens involved in complicated urinary tract 

infections and the commonly isolated organism include; E. coli, Pseudomonas 

aeruginosa, Klebsiella species, Enterococcus species among others. The tendency of 

treatment failure is very high due to the underlying abnormality and the broader range of 

antimicrobial resistance displayed by the organisms involved (Annual epidemiological 

report, 2014). 

 

2.1.4 Recurrent urinary tract infections 

 

This type of UTI is more common in healthy young women with functional and normal 

urinary tracts. Recurrent UTIs are confirmed with at least three interludes of 

uncomplicated infections with a colony count of 103CFU/ml over a period of 12 months 

(Hooton, 2001). Uro-pathogenic coliforms have the ability to attach to uro-epithelial cells 

and can therefore easily colonize the vagina of women with recurrent UTI. Antibiotic 

treatment of recurrent UTIs is dependent on knowledge about the risk factors because 

treatment is not needed in women in which no risk factor has been identified (Co-chair et 

al., 2018). 

 

University of Ghana http://ugspace.ug.edu.gh 



14 
 

2.1.5 Routes of infection  

 

There are three routes by which bacteria can gain access into the human body and 

colonize the urinary tract; the ascending, hematogenous and lymphatic routes. 

Hematogenous route is less common in healthy individuals and is associated with blood 

borne pathogens. In bacteremia and endocarditis, the kidney is the major place of 

inflammation caused by gram positive organisms such as Staphylococcus aureus. 

 

In PLHIV, the cytopathic effect of the virus on renal parenchymal cells leads to 

disruption of the normal cell activity (Alfano et al., 2019) which can potentially cause a 

breach in the renal parenchyma and enable organisms to gain access to the kidneys in 

patients with candidemia or staphylococcal bacteremia. Gram negative bacteria are rarely 

involved in infection of the kidney through hematogenous routes. In retroperitoneal 

abscesses and severe bowel infections, UTI may result through the lymphatic routes 

(Davis & Flood, 2011).  

 

In healthy patients, the main route of urinary tract infection is by ascending and this is 

caused by bacteria from the fecal flora colonizing the vaginal introitus and displacing the 

normal vaginal flora (Chen et al., 2013). After spreading to the perineum and periurethral 

area, they ascend against mechanical action of the urine in the urethra, by employing 

various virulence factors such as adhesion, flagella-mediated motility and other 

mechanisms that defeat the natural antibacterial defense mechanisms against UTI to 

cause cystitis (Handley et al., 2002; Ragnarsdóttir & Svanborg, 2017).  

 

University of Ghana http://ugspace.ug.edu.gh 



15 
 

2.1.6 Microbial Spectrum of Urinary Tract Infections 

 

Most UTIs are considered monomicrobial. No much difference has been reported for the 

microbial spectrum of both uncomplicated upper and lower community acquired UTI.   

E. coli and Staphylococcus saprophyticus accounts for about 70 to 95% and 10 to 15% of 

uncomplicated UTI respectively (Czaja et al., 2007; Echols et al., 1993). However, 

complicated UTIs have a wider spectrum with organisms such as Pseudomonas, 

Enterococcus, Staphylococcus, Serratia, Providencia and fungi involved (Nicolle et al., 

2005).  

In Ghana, a wide range of uropathogens have been reported but E. coli constitutes a 

significant proportion. Varying proportions of E. coli dominated bacteriuria cases 

ranging from 36.0% to 62.5% were reported among different populations 

(Acheampong et al., 2018; Adjei & Opoku, 2004; Afoakwa et al., 2018; Afriyie et al., 

2018; Gambrah et al., 2021; Lutterodt et al., 2014; Obirikorang et al., 2012; Turpin 

et al., 2007; Yenli et al., 2019). Also, other studies have reported Pseudomonas, 

Klebsiella, Enterococcus and Staphylococcus species as predominant uropathogens 

among different populations (Ambrose et al., 2009; Donkor et al., 2017; Donkor et 

al., 2019; Dzifa et al., 2021; Karikari et al., 2020; Labi et al., 2015; Omoregie & 

Eghafona, 2016; Samje et al., 2020). 

 

In children, E. coli constitutes about 80% to 90% of the community-acquired acute upper 

urinary tract infections (pyelonephritis) (Oelschlaeger et al., 2002). They possess 

chromosomal virulence genes forming the “pathogenicity island” which are expressed to 

enhance the survival and establishment of the bacteria in the urethra (Oelschlaeger et al., 

University of Ghana http://ugspace.ug.edu.gh 



16 
 

2002). Patient’s age has an influence  on the type of infective agent as Staphylococcus 

saprophyticus is reported to account for 10% of UTIs in young females compared to less 

than 1% in elderly females (Davis & Flood, 2011). 

 

2.1.7 Pre disposing factors to Bacteriuria in females 

 

Many factors can account for the high prevalence of bacteriuria in females including 

sexual activity, menopause, genital prolapse, immunosuppression and antimicrobial use 

Sexually active women, especially those that have coitus three (3) or more times a week 

have a 2.6-fold increased risk of UTI compared to their counterparts who do not engage 

in sexual activities (Hooton et al., 1996). There is a likelihood that uro-pathogens will be 

mechanically introduced into the bladder during coitus and this coupled with injury to the 

vaginal introitus during sexual intercourse, most likely puts sexually active women at an 

increased risk of developing UTI (Foxman et al., 1997; Hooton, Hillier, et al., 1991). 

Additionally, behavioral factors such as vaginal douching, use of hot tubs, tightening 

underwear,  personal hygiene, change of sexual partner within a year, and circumcision 

status of male partners have been suggested to increase females susceptibility to UTI 

(Hooton et al., 1996; Scholes et al., 2000). This is evidenced in a study conducted in  

Eastern Ethiopia, where 61.4% of married and sexually active HIV positive participants 

were reported to have bacteriuria (Marami et al., 2019). Also unprotected sexual activity 

in marriage is almost inevitable because of cultural beliefs and this might account for the 

high level of ASB, 83.5%,  reported from a study conducted amongst married and 

cohabitating women in Ghana (Afoakwa et al., 2018). Similarly, another study revealed 

that the prevalence of UTI among young college women was about 48% few days after 

University of Ghana http://ugspace.ug.edu.gh 



17 
 

sexual intercourse, 25% within 2 weeks and this decreasing trend was observed with 

increasing days of abstinence (Vincent et al., 2013).  

 

Frequent use of spermicides among sexually active women has also been linked to UTI. 

The active ingredient used in spermicidal compounds in the united states is Nonoxynol-9, 

a nonionic surfactant which has been in use for several decades for family planning 

(Schreiber et al., 2006). An intact vaginal flora ecosystem is of a high importance in the 

prevention of urogenital infections and some researchers have tried to investigate the 

impact of nonoxymol-9 on vaginal ecosystem (Schreiber et al., 2006). Some in-vitro 

studies have suggested that the use of nonoxynol-9 containing  spermicides decreases 

Lactobacillus colonization in the vagina (Mcgroarty et al., 1992) especially the hydrogen 

peroxide producing ones (Hooton, et al., 1991).  

 

Whiles studies have demonstrated the role of hydrogen peroxide producing Lactobacillus 

in preventing bacterial vaginosis and candidiasis (Hawes et al., 1996; Hillier et al., 1992), 

a case control study has also established an increase in vaginal E. coli colonization in 

females without the hydrogen peroxide producing Lactobacillus strains (Gupta et al., 

1998) which predisposes them to urinary tract infections. The findings of Gupta and his 

colleagues have been highlighted in a study by Rosenstein and his colleagues when they 

found out that introduction of nonoxymol-9 into the vagina in the absence of sexual 

intercourse caused a decrease in hydrogen peroxide producing lactobacillus and an 

increase E. coli colonization (Rosenstein et al., 1998).  

University of Ghana http://ugspace.ug.edu.gh 



18 
 

Even though some studies have suggested otherwise, (Moncla & Hillier, 2005; Schreiber 

et al., 2006), the above discussions indicate that the antimicrobial potential of nonoxynol 

-9 can cause changes in the normal vaginal flora lead to the proliferation of UPEC.  

 

Vulvovaginal atrophy is a common condition characterized by vaginal dryness, irritation, 

postcoital bleeding and soreness with a reported prevalence rate of 47% among post-

menopausal women (Bride et al., 2010). It is the result of hypoestrogenism and has been 

reported together with reduced glycogen production and depletion of Lactobacilli in the 

vagina as risk factors for UTI among post-menopausal women. In Pre-menopausal 

women, the vagina Lactobacilli utilizes lactose and produces lactic acid which decreases 

the vaginal pH, preventing colonization by uro-pathogens (Raz, 2001). However, this 

mechanism is reduced or absent in post-menopausal women making them prone to UTI. 

A study by Raz and Stamm has re-emphasized the role of hypoestrogenism in UTI as 

they have proven that topical application of estrogen cream in post-menopausal women 

exponentially restored Lactobacilli which translated into reduced vaginal colonization of 

E. coli by half  as a result of reduced vaginal pH caused by the production of lactic acid 

(Raz & Stamm, 1993). 

Pelvic organ prolapse is the fall of the uterus and the vaginal walls through the vaginal 

canal (Aytan et al., 2014). It is a pelvic floor dysfunction in which pelvic organs descend 

due to anatomical or functional abnormalities of the tissues that give the pelvic organs 

support  (Aytan et al., 2014). This is reportedly prevalent in elderly women  (Storme et 

al., 2019). Emptying the bladder is a natural mechanical defense against UTI. However,  

this is compromised in patients with genital prolapse as voiding dysfunction has been 

University of Ghana http://ugspace.ug.edu.gh 



19 
 

reported as a very common condition among these patients, prompting an increased risk 

of UTI (Aytan et al., 2014). Voiding dysfunction has also been reported among 

PLWHIV, making pathogen clearance from the urinary tract inefficient and promoting 

the development of UTI (Lebovitch & Mydlo, 2008). Hamid and Losco have proposed 

that residual urine volume as low as 30mls can increase the risk of UTI. 

 

Amongst the types of prolapse, anterior prolapse or cystocele (the drop of the bladder 

into the vagina), is most significantly associated with UTI (Aytan et al., 2014). 

Nonetheless, posterior prolapse or rectocele can also exert pressure on the urethra causing 

voiding dysfunction which accelerates the development of UTI. Despite the high 

occurrence of voiding dysfunction in women with genital prolapse, the occurrence of 

prolapse does not automatically translate to presence of voiding dysfunction hence it is 

needless to treat patients with asymptomatic bacteriuria with good voiding (Hamid & 

Losco, 2014) except for pregnant women and patients going for urinary tract surgery 

(Aytan et al., 2014). 

Genetical predisposition to UTI has been proposed by some researchers, as they observed 

that having a mother or a sister with a history of UTI is another risk factor for developing 

UTI. Recurrent UTI has been shown to be four times higher in women who are non-

secretors of the ABO antigen, chiefly because UPEC has a better adherence to uro-

epithelial cells in these women thereby compounding the risk of UTI in this population 

(Stapleton et al., 1992). ABO blood group antigens are primarily found on red blood cells 

but some levels of these antigens are secreted into body fluids such as saliva, sweat, tears, 

semen and the plasma. Whiles some are able to secrete the ABO antigens in their body 

University of Ghana http://ugspace.ug.edu.gh 



20 
 

fluids, others are not able and they are called the non-secretors. These non-secretors have 

inherited the recessive form of the gene, se se, making them unable to secrete these 

proteins into the body fluid  (Adamo & Kelly, 2014; Metgud et al., 2016). These genes 

can be inherited from parents and this forms the basis for genetic susceptibility. 

 

Neutrophils play key role in phagocytosis by moving across urothelial cells in response to 

interlukin-8, an inflammatory cytokine (Godaly et al., 1998; Godaly et al., 1997). 

Absence of the receptor for this cytokine, CXCR1, will inhibit the migration of 

neutrophils across urothelial cells to perform phagocytic functions. This has been 

proposed to be the cause of recurrent pyelonephritis in  pediatric patients who 

demonstrated a defect in the CXCR1 receptor (Frendéus et al., 2000). 

 

Catheter associated urinary tract infection (CAUTI) is the major cause of UTI in 

hospitalized patients and accounts for a significant number of hospital acquired 

infections (Asafo-Adjei et al., 2018; Nandini & Madhusudan, 2016; Ray et al., 2015). 

CAUTI is the result of non-adherence to infection prevention  and control protocols, poor 

aseptic techniques and poor catheter insertions (Storme et al., 2019). A survey in 66 

hospitals in Europe and 183 hospitals in USA revealed that 17.5% (Nandini & 

Madhusudan, 2016) and 23.6% (Nandini & Madhusudan, 2016; Ray et al., 2015) 

respectively, of patients on admission are catheterized.  

 

The most important determinant of bacteriuria in catheterized patients is the length of 

catheterization (Hooton et al., 2010) as CAUTI develops in 100% of patients that have 

been catheterized for more 30 days and present with clinical signs such as hematuria 

University of Ghana http://ugspace.ug.edu.gh 



21 
 

fever and loin pain (Parida & Mishra, 2013). Bacterial colonization within the lumen of 

the human catheter occurs within 48hrs whiles the colonization of the external wall of the 

catheter occurs within 72 to 168hrs (Olmsted et al., 2013) with a  daily risk  of 

acquisition of bacteriuria reported at 3-7% (Hooton et al., 2010). Prolonged 

catheterization can compromise the natural defense of the host and create a niche for 

bacteria through biofilm formation (Storme et al., 2019). Long term catheterization 

coupled with other host factors such as local trauma, anatomical or functional deformities 

of the urinary tract, immunosuppression and diabetes mellitus increases the risk of 

catheter associated UTI  (Storme et al., 2019). 

 

Within 24hrs of the birth of a female child, the vagina is colonized by certain 

microorganisms and this creates an ecosystem that provide several health benefits to the 

female throughout their life time. Studies, both in human and animals, have shown that 

antimicrobial agents alter this ecosystem, predisposing females to UTIs (Hertbelius-

elman et al., 1992; Winberg et al., 1993). Increased level of amoxicillin administration in 

apes have been observed to cause a high colonization of the vagina  with E. coli 

(Hertbelius-elman et al., 1992). This study was replicated with nitrofurantoin and 

trimethoprim in monkeys but no significant increment was found in the vaginal 

colonization of E. coli and this suggest that beta lactam antibiotics may be more 

associated with vaginal dysbiosis in females. Cotrimoxazole and fluoroquinolones have 

also been associated with vaginal colonization of uro-pathogens thereby increasing the 

risk for UTI. Even though this is to a lesser extent, it calls for concern as cotrimoxazole is 

a prophylactic drug commonly used in WLHIV and prolonged usage may predispose 

them to vaginal dysbiosis and subsequently lead to UTI. 

University of Ghana http://ugspace.ug.edu.gh 



22 
 

 

Antecedent antimicrobial use has been found to increase the risk of cystitis among 

women as a prospective study demonstrated that females using antimicrobial agents 15 to 

28 days prior, have an increased risk of developing uncomplicated cystitis (Smith et al., 

1997) 

The risk of acquiring UTI is increased in  specific groups of people including sickle cell 

disease patients (Bebe et al., 2020; Donkor et al., 2017), diabetic patients (Mandracchia 

et al., 2015), pregnant women, the elderly, catheterized patients, people diagnosed with 

urological malformations and PLHIV  (Iweriebor, 2012a) . The incidence rate of UTI in 

HIV/AIDS patients has been reported at 7 to 50% (Maria et al., 1994; Obulesu et al., 

2017) and this is the result of increased likelihood of opportunistic infections in PLHIV 

(Kuipers & Zamparutti, 2014). Opportunistic infections account for 90% of HIV-related 

morbidity and mortality whereas opportunistic cancers and other causes account for 7% 

and 3% respectively (Staine, 2008). Higher prevalence of asymptomatic bacteriuria 

(ASB) has also been reported among women living with HIV compared to non-HIV 

pregnant women (Chaula et al., 2017) putting them at a higher risks of developing UTI.  

 

2.1.8 Molecular Pathogenesis of UTI 

Colonization of the bladder by UPEC is contingent on its ability to overcome the body’s 

formidable  natural  defense to infection, the mucosal barrier (Hannan et al., 2013). 

UPEC usually migrate from the gastrointestinal tract into the periurethral space, up the 

urethra and into the bladder (Hooton, 2001). When UPEC reaches the bladder, it attaches 

to the umbrella or facet cells using adhesin FimH on the tip of the type 1 pilli (Hannan et 

University of Ghana http://ugspace.ug.edu.gh 



23 
 

al., 2013). Umbrella cells are mono layer of a highly differentiated and polarized cells 

that have clear apical and basolateral membrane regions defined by tight junctions 

(Varley et al., 2007). This colonization event activates inflammatory response in the 

bladder epithelium. Bladder cells recognize UPEC Lipopolysaccharide (LPS) through its 

toll-like receptor 4 (TLR-4)-CD14 pathway which results in the generation of IL8, a 

strong chemoattractant for neutrophils. A cycling of the apical membrane of the facet 

cells is a normal process (Bishop et al., 2007) which allows for internalization of the 

attached UPEC  (Martinez et al., 2000; Schwartz et al., 2011). To mitigate this 

pathogenic activity, the bladder cell undertakes active expulsion of the endocytosed 

UPEC. UPEC has the ability to neutralize lysosomes and this neutralization process is 

detected by lysosomal membrane protein which in turn activate pathways that direct the 

exocytosis of the UPEC-containing lysosomes (Miao et al., 2016).  This is further 

enhanced by the activation of Toll-like receptor 4 (TLR4) by the UPEC leading to 

ubiquitylation of Tumor Necrosis Factor 3 (TRAF3) which facilitates communication 

with a guanine-nucleotide exchange factor that directs assembly of exocyst complex, 

thereby accomplishing expulsion of intracellular bacteria (Miao et al., 2017).  

 

Despite these innate mechanisms available for the expulsion of UPEC from the cells,    

UPEC is able to employ a by-pass mechanism to gain access into the cytoplasm of 

bladder cells and develop clonal biofilm-like masses called intracellular bacterial 

communities (IBCs) (Anderson et al., 2014; Schwartz et al., 2011). The host responds to 

this by exfoliating the infected facet cells (Roth et al., 1998) and discharging the IBCs 

into the urine. Molecular mechanisms transduce signals that lead to differentiation and 

University of Ghana http://ugspace.ug.edu.gh 



24 
 

proliferation of the underlying transitional cells to restore the shed superficial cells. 

Albeit the robust inflammatory response and exfoliation of infected cells, UPEC is able to 

maintain high titers in the bladder for several days.  

 

 

2.1.9 Epidemiology of Extra Intestinal-Pathogenic E. coli (ExPEC) 

 

Escherichia coli is a genetically diverse facultative gram-negative bacillus, comprising 

nonpathogenic strains naturally found in the fecal flora of warm-blooded animals and 

other strains responsible for intestinal and extra intestinal diseases (Dale & Woodford, 

2015). ExPEC can molecularly be defined as E. coli isolates with at least two of the 

following virulent factor genes within their genome; papA and/or papC, sfa/foc, 

afa/draBC, kpsM II and iutA (Peirano et al., 2013). In the past, ExPEC isolates were 

grouped based on the disease they are associated with namely; Uropathogenic E. coli 

(UPEC), neonatal meningitis-associated E. coli (NMEC), and sepsis-causing E. coli 

(SEPEC). However, it was later observed that these organisms can cause disease at 

multiple anatomical sites (Dale & Woodford, 2015).  

 

Based on genetic, clinical considerations and significance to humans, E. coli was later 

classified into three groups namely; commensal strains, intestinal strains and 

extraintestinal pathogenic strains (ExPEC) where ExPEC comprises all non-commensals 

capable of causing disease at sites other than the intestine (Russo & Johnson, 2000). 

Extra intestinal infections can occur in all age groups and at any anatomical site (Russo & 

Johnson, 2000). However, majority of ExPEC are uro pathogenic (UPEC) and constitutes 

about 90% of community and hospital acquired urinary tract infections (Talan et al., 

University of Ghana http://ugspace.ug.edu.gh 



25 
 

2015). Comparably, the genomes of UPEC are larger than those of commensal E. coli 

strain because of their continuous acquisition and occasional loss of genetic materials 

(Ahmed et al., 2008; Hacker et al., 1997; Touchon et al., 2009). This difference in 

genome size is observed in three typical UPEC strains; CFT073, 536 and UTI89 when 

compared to the genome of a commensal reference strain MG1655 (Brzuszkiewicz et al., 

2006; Chen et al., 2006; Welch et al., 2002).  

 

Clemont and his colleagues have grouped E. coli phylogenetically into 4 groups; A, B1, 

B2, and D using a triplex polymerase chain reaction method (Bonacorsi et al., 2000). The 

virulent ExPEC belongs mainly to the group B2 and marginally group D whereas 

majority of the intestinal commensals belong to group A (Bonacorsi et al., 2000).  With 

advancement in molecular epidemiology, Multilocus Sequence Typing (MLST) has 

enabled an in depth analysis of the ExPEC where isolates were grouped into distinct 

sequence types (STs) which are based on identical allelic profiles (Maiden et al., 1998; 

Wirth et al., 2006; Yun et al., 2014). These STs include ST131, ST73, ST95, ST127 to 

which all B2 belong and ST69 to which group D belongs (Banerjee et al., 2013; Siu et 

al., 2008). They are further put into broader clonal complexes which are described as a 

group of at least three STs each, which differ from each other by not more than 1 of 7 

alleles (Salvador et al., 2012). Some of these clones are able to escape antimicrobial 

effects by displaying resistance to certain classes of antibiotics. For instance, ST131-

O25b clone has been associated with high resistance to fluoroquinolones and 

cephalosporins whiles ST69 shows high level of resistance to trimethoprim-

sulfamethoxazole (Johnson et al., 2011; Nicolas-Chanoine et al., 2008). 

University of Ghana http://ugspace.ug.edu.gh 



26 
 

 

2.1.10 Identification of Uro-pathogenic E. coli (UPEC) 

 

Identification is the use of established criteria to differentiate, isolate and identify 

organisms that cause disease. Identification is done routinely by morphological and 

biochemical characteristics and less frequently, by serological tests. Advancement of 

molecular works, has paved way for identification of an organism to the genomic level, 

making it easier and faster (Barron, 1996). 

According to Johnson and Stell, (2000), UPEC can be identified by the presence of two 

or more virulent factor genes. However, this hypothesis suffers some drawbacks because 

these genes are not UPEC-specific. Also, the PCR methods and approaches available for 

the identification of UPECs as proposed by some studies have limitations. In that, the 

genes identified are not specific to UPEC but are also harbored by commensal E. coli. 

For instance, fimH as recommended by Johnson and Stell, (2000), rfaH by Van Der Zee 

et al., (2016), and ecp, fyuA, sfa/ focDE by Blackburn et al., (2009) and López-banda et 

al., (2014) are not exclusively found in UPEC but also in commensal strains. Brons et al., 

(2020) developed a PCR assay to molecularly determine UPEC using three selected 

UPEC-specific genes involved in virulence as targets. These include c3509, c3686 (yrbH) 

and chuA. A combination of these genes can be used in the detection of UPEC. 

2.1.11 Virulence factors for Uro-Pathogenic E. coli (UPEC) 

 

It has been reported that not all E. coli found in the fecal flora can cause a urinary tract 

infection and the ability of an organism to establish UTI depends on the presence of 

virulence genes (Oelschlaeger et al., 2002). The type of virulence genes present 

University of Ghana http://ugspace.ug.edu.gh 



27 
 

determines the type and severity of the disease and these genes can be transferred 

horizontally between bacterial populations because of their location on mobile genetic 

elements such as pathogenicity island (PAI).  

 

Virulence factors are encoded by specific genes and the expression of those genes 

enables pathogenic organisms to establish an infection (Pitout, 2012). Establishment of 

an infection depends on the expression of more than one gene as a single factor rarely 

causes infection and the level of expression is also of importance because higher levels 

increase the chances of infection (Dobrindt, 2005) This has been demonstrated in several 

studies where it was observed that more virulent factors are needed to invade 

immunocompetent people than the immunosuppressed (Maslow et al., 1993; Otto et al., 

2001; Rijavec et al., 2008). Expression of genes can be regulated or influenced by 

environmental factors such as temperature, nutrient and iron deprivation (Nagy & Kere, 

2003). For example, siderophores are expressed when there is iron deprivation whereas 

Type 1, P and S fimbriae are expressed at the normal body temperature (Collinson et al., 

1992). 

University of Ghana http://ugspace.ug.edu.gh 



28 
 

 

         (Terlizzi et al., 2017) 

Figure 1.  Diagram of UPEC virulent factors   

 

 

2.1.11.1 Adhesins 

  

The first step to colonization is adhesion. This is mediated by bacterial surface fimbriae 

and other structures such as Dr adhesins which recognize host cell surface receptors on 

other uroepithelial cells. Fimbriae are crowned with different adhesins which referees 

tropism in the upper or lower urinary tract by discerning receptors on the bladder or the 

kidney epithelium (Wright & Hultgren, 2006). Initially, fimbriae were thought to 

University of Ghana http://ugspace.ug.edu.gh 



29 
 

augment bacterial virulence by simply attaching bacteria to the cells (Lelffler & 

Svanborg-edrnn, 1980). However, a study has shown that fimbriated bacteria activate 

specific transmembrane signaling pathway in the uroepithelial cells (Hedlund et al., 

1996). These cytokines recruit inflammatory cells such as neutrophils from the blood 

stream, across epithelial barrier in the lumen. Both P and type 1 fimbriae have been 

shown to  stimulate cytokine production in epithelial cells (Godaly et al., 1998).  

 

Type 1 fimbriae Mannose sensitive Hemagglutinin (MSHA) is crowned with FimH 

adhesins (Hannan et al., 2013) which attaches to mannose rich epitopes located in the 

Tamm-Horsfall glycoprotein, secretory IgA or bladder cell uroplakin (Eto et al., 2007). 

Type 1 fimbriae do not only aid in attachment, it also plays a role in invasion. It uses 

uroplakin Ia and Ib receptors for internalization (Martinez et al., 2000). S fimbriae binds 

to sialic acid epitopes present in sialylated glycoproteins and glycolipids. P fimbriae 

Mannose Resistant Hemagglutinin (MRHA) is tipped with PapG adhesin which 

recognize Galα1-4Galβ- epitopes in the globoseries-containing glycolipids (Wright & 

Hultgren, 2006).    

 

P fimbriae has a higher virulence and is being expressed in about 80% of bacterial strains 

that causes uncomplicated acute pyelonephritis and less than 20% of strains causing 

asymptomatic UTI (Leffler & Svanborg-edrnn, 1981; Marklund et al., 1995). PapG 

adhesins compromises immunoglobulin A transport into the urinary space and this 

enables UPEC to evade an important protective mechanism permitting it to initiate an 

ascending infection (Rice et al., 2005; Ashkar et al., 2008). It has been hypothesized that 

University of Ghana http://ugspace.ug.edu.gh 



30 
 

after invasion into the bladder, FimH adhesins are expressed which promotes attachment 

to the bladder epithelium. Howbeit, when the bacteria ascend the renal parenchyma, 

phase variation occurs which suppresses the FimH adhesins and expresses the PapG 

adhesins enabling attachment to renal parenchymal cells. 

 

2.1.11.2 Distribution and role of Toxin in renal pathology 

 

UPEC has several genes that encode toxins that cause pathology in patients (cnf1, hlyA, 

set, astA, vat, usp, and cva/cvi) (Abe et al., 2008; Chiou et al., 2010). The cytotoxic 

necrotizing factor type 1 (cnf1) has been shown to induce apoptosis in bladder cells lines 

of human in vitro (Mills et al., 2000) and has also been shown to increase F-actin, 

superoxidase generation and also decrease the phagocytic function of polymorphonuclear 

neutrophils (Hofman et al., 2000). About 31% to 44% and 36% to 48% of UPEC isolates 

are associated with cystitis and pyelonephritis respectively (Andreu et al., 1997; 

Mitsumori et al., 1999; Yamamoto et al., 1995). A study by Horcajada et al., (2005)  

revealed that cnf1 is a good promoter of  bacteremia emanating from urinary tract 

infections.  (Rijavec et al., 2008) reported that 10% and 24% of UPEC isolated from 

immunosuppressed and immunocompetent patients respectively, had cnf1 gene. 

Similarly, a study conducted by Rezatofighi et al., (2021) where the distribution of 

virulent factor genes was investigated revealed that 12.3% of UPEC isolated from 

patients with urinary tract infection had cnf1 gene whiles commensal E. coli had 3.3%. 

Additionally, an earlier work performed by Tarchouna et al., (2013) on 96 UPEC strains 

revealed that 3% of the isolates associated with cystitis were carrying cnf1 gene but none 

was detected among isolates associated with pyelonephritis. Opposed to the findings of  

University of Ghana http://ugspace.ug.edu.gh 



31 
 

Tarchouna and his colleagues, 63.6% of UPEC from patients with pyelonephritis were 

found to be carrying the cnf1 gene whereas 34% and 25.8% carriage, was recorded in 

patients with cystitis and ASB respectively (Tabasi et al., 2016).  

 

Uropathogenic specific protein (USP) gene encodes a 346 amino acid protein known as 

the uropathogenic specific protein. Reportedly, this gene is more associated with UPEC 

than fecal E. coli isolates. It was first discovered in the UPEC strain Z42 isolated from a 

patient with prostatitis. Yamamoto and his colleagues found usp gene in about 93.4% and 

88% of UPEC isolated from patients with pyelonephritis and prostatitis respectively 

(Yamamoto et al., 2001). Also, 30% and 59% of this gene was found in UPEC isolates 

respectively, from immunosuppressed and immunocompetent patients (Rijavec et al., 

2008). In South Korea, Yun et al., (2014) isolated UPEC from children with ASB and 

symptomatic UTI had 10% and 4% carriage of usp gene respectively. 

A genotypic examination of the relationship between virulent factors and different 

clinical symptoms revealed that 52.4%, 72.7% and 22.6% of UPEC from patients with 

cystitis, pyelonephritis and ASB respectively, carried the usp gene (Tabasi et al., 2016). 

Based on sequence homology analysis, the possibility of usp being a bacteriocin was 

proposed. A bacteriocin is a peptidic toxin or an antibiotic produced by some strains of 

bacteria to inhibit the growth of closely related strains (Leroy & De Vuyst, 2010). 

Bacteria that produce bacteriocin co-synthesizes immunity proteins that protects it from 

the harmful effect of its own toxin. Detailed analysis has shown that close to half of the 

nucleotide sequence of the usp C-terminal shares the same identity with the E. coli 

bacteriocin colicin E7 which has a nuclease activity whiles the N-terminal shares some 

University of Ghana http://ugspace.ug.edu.gh 



32 
 

similarity with the type VI protein secretion system component (Nakano et al., 2001; 

Papadakos et al., 2012). Most bacteriocins with nuclease activity have three functional 

domains that are responsible for recognition of specific receptor protein on cell 

membrane of the target organism, translocation of protein into the target cell and the 

eventual destruction of genetic material of target cell (Cascales et al., 2007).  

 

2.1.11.3 Capsular polysaccharide 

 

These are products of oligosaccharide polymers with unique antigenic epitopes. They 

serve as a shield surrounding the bacteria and offers resistance to phagocytosis, which 

makes the bacteria able to survive in tissues and circulation (Horwitz & Silvertein., 

1980). Capsule also confers serum resistance by offering protection against complement 

mediated killing (Rasko et al., 2013). Examples of capsule antigens include kpsMT I  

kpsMT II,  kpsMT III   K1 and K5 (Pitout, 2012). In  a research conducted by Yun et al., 

(2014),   

40% and 14% of UPEC isolates from children in South Korea with ASB and UTI 

respectively, carried kpsMTII. Also, Rezatofighi et al., (2021) reported that kpsMTII 

carriage among UPEC and commensal E. coli strains were 32.6% and 30% respectively. 

Additionally, Taylor et al., (2015) revealed that 20% of UPEC isolates from patients with 

UTI were found to be carrying the kpsMTII gene and 64% mortality rate was recorded 

among these patients.  Johnson & Stell, (2000) rather recorded a higher prevalence (63%)  

of  kpsMTII gene among UPEC isolates. 

 

University of Ghana http://ugspace.ug.edu.gh 



33 
 

2.1.11.4 Siderophores 

 

These are specialized structures used by bacteria to compete with host for nutrients such 

as iron. All uropathogen bacteria express some form of iron intake system. Enterobactin 

is expressed by all E. coli strains but most strains correlated with acute pyelonephritis 

produces high affinity iron binding protein called aerobactin (iutA), yersinibactin (fyuA) 

and ChuA (Garcia et al., 2011). These virulent genes are usually expressed in response to 

iron deprivation (Yun et al., 2014). Varying prevalence (80%, 19%,) of iutA has been 

recorded among UPEC isolates by different researchers (Johnson & Stell, 2000; Taylor et 

al., 2015).  

 

2.2 Human Immunodeficiency Virus / AIDS 

Human Immunodeficiency virus (HIV) belongs to the lentivirus group within the family 

of retroviridae. It has been classified into two, HIV-1 and HIV-2, based on the genetic 

characteristics and some differences in the viral antigens. The core of the virus comprises 

two identical single-stranded RNA molecules which are converted by reverse 

transcription, into DNA (C. Lee et al., 2000).  HIV-1 has been proven to have evolved 

from central African Chimpanzees whereas HIV 2 to have evolved from sooty Monga 

beys (Sharp, 2014) with HIV 1 being highly pathogenic compared to HIV 2 (Advisory et 

al., 2016).  

 

2.2.1 Pathophysiology of HIV/AIDS 

Infection is preceded by attachment of the virus to the host cells through a series of 

interactions between viral structural proteins and the host cell receptors. The virus has a 

University of Ghana http://ugspace.ug.edu.gh 



34 
 

surface glycoprotein called gp120 with which it attaches to the CD4 receptor on the host 

cells such as CD4 T lymphocytes, macrophages and dendritic cells (Feng et al., 2012). 

Immunosuppression, which is a major feature of HIV infection, results from lysis of the 

infected CD4 cells and the inhibition of the production of CD4 T lymphocytes which 

leads to a steady reduction in T helper cells (Sharp, 2014; Zhang et al., 1997). 

 

2.2.2 Opportunistic Infections 

The advancement of immunosuppression leads to a depletion of the CD4 cell to a level 

where immune response is impaired such that opportunistic infections and neoplasm 

begin to develop (Medina-ramı et al., 2017). Opportunistic infections are defined as 

infections caused by non-pathogenic organisms which become pathogenic when the 

immune system is compromised (Faria et al., 2015). Common opportunistic pathogens 

usually associated with immunosuppression includes Toxoplasma gondii, 

Cryptosporidium parvum, Pneumocystis jirovecii, Mycobacterium tuberculosis amongst 

others (Advisory et al., 2016).   

 

2.2.3 WHO clinical stages of HIV/AIDS for Adults 

The WHO clinical stages for HIV/AIDS classification employs the use of clinical 

parameters to guide clinicians in making decisions, especially those in resource limited 

countries where access to laboratory services is not readily accessible (WHO, 2006). This 

system groups patients into four hierarchical clinical stages from asymptomatic patients 

(stage 1) to patients with AIDS (stage4). Assignment of patients to the groups depends on 

the presentation of one or more symptoms from that group. This system has been shown 

University of Ghana http://ugspace.ug.edu.gh 



35 
 

to be an adequate and a practical way of managing HIV seropositive people because of 

the positive correlation between the clinical signs listed and the CD4+ cell count (Hunter 

& Cyr, 2006; Kassa et al., 1999; Lynen et al., 2006; Malamba et al., 1999).  

Very few works have looked into the association between ASB and WHO clinical stages. 

In Nairobi, a study reported a bacteriuric rate of 23% among asymptomatic HIV 

seropositive commercial sex workers assigned to WHO clinical stage 1 (Ojoo et al., 

1996).  

Table 2.1 WHO disease stage classification 

Clinical Stage Description 

1 Asymptomatic  

Persistent generalized lymphadenopathy 

 

2 Unexplained moderate weight loss  (<10% of presumed or measured body 

weight), Recurrent respiratory tract infections (sinusitis, tonsillitis, otitis 

media and pharyngitis), Herpes zoster, Angular cheilitis, Recurrent oral 

ulceration, Papular pruritic eruptions, Seborrhoeic dermatitis, Fungal nail 

infections 

 

3  

Weight loss of greater than 10 percent of total body weight, prolonged 

(more than 1 month) unexplained diarrhea, pulmonary tuberculosis, and 

severe systemic bacterial infections including pneumonia, pyelonephritis, 

empyema, pyomyositis, meningitis, bone and joint infections, and 

bacteremia. Mucocutaneous conditions, including recurrent oral candidiasis, 

oral hairy leukoplakia, and acute necrotizing ulcerative stomatitis, 

gingivitis, or periodontitis 

 

4  

HIV wasting syndrome, Pneumocystis pneumonia (PCP), recurrent severe 

or radiological bacterial pneumonia, extrapulmonary tuberculosis, HIV 

encephalopathy, CNS toxoplasmosis, chronic (more than 1 month) or 

orolabial herpes simplex infection, esophageal candidiasis, and Kaposi’s 

sarcoma 

 

University of Ghana http://ugspace.ug.edu.gh 



36 
 

2.3 Mechanism of action and Antibiotic resistance 

Antimicrobial agents have been grouped based on their mechanism or site of action. 

They’ve been grouped into cell wall synthesis inhibitors (β lactams, cephalosporins) 

nucleic acid synthesis inhibitors (fluroquinolones  and others), inhibition of ribosome 

function (aminoglycosides, macrolides among others),  inhibitors of cell membrane 

function (polymyxins among others) and inhibitors of folate metabolism (Dowling et al., 

2017). Several mechanisms have been employed by bacteria to directly inactivate 

antimicrobial molecules, modification of target sites or reduction of antibiotic uptake. 

Resistance can be intrinsic, acquired or adaptive (Munita et al., 2016). Acquired 

resistance can occur through horizontal transfer of resistant genes usually by mobile 

genetic elements and by mutation (Breidenstein et al., 2011).  

 

2.3.1 Epidemiology of Antibiotic resistance in UPEC  

The Ghana Standard Treatment guideline, (2017) recommends the use of ciprofloxacin, 

cefuroxime, Amoxiclav, Ceftriaxone and Gentamicin for the management of UTI. 

However, uropathogens especially UPEC, are increasingly developing resistance to these 

commonly prescribed antibiotics and this is worryingly limiting the treatment options 

available for UTI (Al Sweih et al., 2005). In Nigeria, these multidrug resistant pathogens 

are constantly multiplying especially in PLHIV making them a source of  MDR 

pathogens  (Kemajou & Ajugwo, 2016).  In Tanzania, 75% of uropathogens isolated from 

PLHIV were resistant to Trimethoprim Sulfamethoxazole (SXT) (Marwa et al., 2015). A 

similar study in Tanzania reported that 90%, 16.7%, 10% and 13.3% of UPEC isolated 

from PLHIV were resistant to SXT, nitrofurantoin, gentamicin and ceftriaxone, 

University of Ghana http://ugspace.ug.edu.gh 



37 
 

respectively (Chaula et al., 2017). A study conducted on ASB among women of 

reproductive age in Ghana by Afoakwa et al., (2018) revealed that 98.25%, 96.49%, 

94.73%, 5.26%, 8.77% and 17. 54% of UPEC were resistant to Ampicillin, SXT, 

Tetracycline, Cefotaxime, Ciprofloxacin and Cefuroxime respectively. The study 

however reported very low resistance (5.6%) to Gentamicin and no resistance to 

Amikacin.  

 

In a study conducted among PLHIV by Kemajou & Ajugwo, (2016) in Nigeria, it was 

observed that 88.0%, 16.7%, 42.9%, 69.0% and 7.1% of UPEC were resistant to 

Ampicillin, Ciprofloxacin, trimethoprim-sulfamethoxazole, Ceftriaxone and Gentamicin 

respectively. In Ethiopia,  Fenta et al., (2016) also found UPEC isolates among patients 

on HAART to be resistant to Ampicillin, Amoxiclav, trimethoprim-sulfamethoxazole, 

gentamicin, ciprofloxacin, cefotaxime and amikacin in the proportions of 86.4%, 59.1%, 

72.7%, 0%, 22.7%, 18.2% and 0% respectively. This high sensitivity of UPEC to 

aminoglycosides is consistent with the findings of other researchers in Ghana who 

worked on non-HIV participants (O. Adjei & Opoku, 2004; Afoakwa et al., 2018; 

Asafo-Adjei et al., 2018; Dzifa et al., 2021; Lutterodt et al., 2014a)  

 

Contrary to the findings of Kemajou & Ajugwo, (2016) and  Fenta et al., (2016), 60% 

resistance to Gentamicin was recorded by Zakka et al., (2018) for UPEC isolated from 

PLHIV in Jos Metropolis, Nigeria. The challenge of administering aminoglycosides is 

that it has nephrotoxicity potentials and should be used only when all treatment options 

are exhausted (Martínez-Salgado et al., 2007).  

University of Ghana http://ugspace.ug.edu.gh 



38 
 

 

2.3.2 Association between Antibiotic resistance and Virulent factors in UPEC. 

Mobile genetic elements such as plasmids, transposons and integrons carry and facilitate 

the spread of antibiotic resistant and virulent factor genes which provide survival 

advantage to the microorganisms (Silva & Mendonça, 2012).  

 

The susceptibility pattern of E. coli has changed since the introduction of third generation 

cephalosporins and subsequent development of extended spectrum beta lactamases 

(ESBL) (Silva & Mendonça, 2012). Lee et al., (2010), in their investigation of nine 

virulent factors have found out that aerobactin receptor (iuAt) was significantly common 

in ESBL producing E. coli carrying the bla 
CTX-M-1 whereas serum resistance associated 

outer membrane protein (traT) was more common in isolates with bla 
CTX-M-9. Another 

study has indicated that CTX-M producing ESBL E. coli, though with a comparably 

lower prevalence of iuAt and traT, carried more virulent factors than CTX-M producers 

(Pitout et al., 2005).  

 

A study conducted in Iran revealed a significant association between antibiotic resistance 

and virulent factors in UPEC, particularly among biofilm formers (Shah et al., 2019). 

Similarly, Tabasi et al., (2015) reported a strong correlation among UPEC biofilm 

formers and resistance to ampicillin, norfloxacin and trimethoprim-sulfamethoxazole. 

However, hemolysin (hlyA) producing isolates showed a significantly lesser resistance to 

tetracycline, nalidixic acid and trimethoprim-sulfamethoxazole compared to non-

hemolysin producing isolates.  

University of Ghana http://ugspace.ug.edu.gh 



39 
 

 

In Ghana, Forson et al., (2019), reported on UPEC associated ASB in pregnant women 

and found a significant association between antibiotic resistant isolates and virulence. 

They also observed that ampicillin resistant UPEC isolates harboring the BlaTEM gene 

had a higher number of virulent factors compared to isolates resistant to tetracycline or 

gentamicin.  

An understanding on the interplay between virulent factors and antibiotic resistance is 

very crucial in era where available treatment options are failing and world is speedily 

transitioning into the post antibiotic era.  

 

2.3.3 Role of Integrons in Antimicrobial resistance 

Resistance genes are usually carried on integrons, bacteriophages and mobile genetic 

elements such as transposons and plasmids and transferred horizontally (Xu et al., 2011). 

Integrons are site-specific recombination systems that arrest mobile gene cassettes 

encoding antibiotic resistance and has the potential of expressing these gene cassettes 

(Butzin et al., 2009).  

A functional integron is characterized by the presence of an integrase gene (intI), a 

recombination or attachment site (attI) for insertion of DNA sequences and a promoter 

gene (Pc) (Butzin et al., 2009). Integrons are generally classified into 4 (intI1, int12 intI3 

and intI4) based on the differences in the amino acid sequences of the intI integrases 

(Deng et al., 2015). Amongst the classes of integrons associated with antibiotic 

resistance, intI is the most prevalent  and most clinically relevant because of their wide 

distribution in 22-59% of gram negative bacteria (Butzin et al., 2009). Their immobility 

University of Ghana http://ugspace.ug.edu.gh 



40 
 

makes them closely associated with mobile elements such as transposons and conjugative 

plasmids and this is what accounts for their wide distribution (Butzin et al., 2009).  

A study conducted in Ghana on non-HIV pregnant women revealed that 12.2%  and 2.4% 

of UPEC isolates were carrying intI and intII genes respectively (Forson et al., 2019). In 

Syria, a rather high prevalence (54.66%) of class I integrons was found in Trimethoprim 

resistant UPEC with a significant association with multidrug resistance and ESBL 

production (Al-assil et al., 2013). In Pakistan, Khan et al., (2018) reported ESBL 

producing UPEC as an emerging health issue as they found class 1 integrons in about 

79% MDR UPEC isolates carrying CTX-M1, TEM and SHV genes.   

 

A comprehensive study conducted in European countries and Korea revealed a slightly 

higher prevalence of  class 1 integrons in 57.6% and 69% of trimethoprim resistant 

UPEC isolates respectively (Pondé, 2013; Yu et al., 2004).  Solberg et al., (2006) 

highlighted the role of integrons in antibiotic resistance as they reported that about 71.6% 

of trimethoprim-sulfamethoxazole resistant UPEC isolates carried the class 1 integron 

whereas 28.4% of the trimethoprim-sulfamethoxazole resistant isolates carried class 2 

integrons. This finding reenforces our knowledge on the role of integrons, especially intI, 

in antibiotic resist 

 

 

 

 

University of Ghana http://ugspace.ug.edu.gh 



41 
 

CHAPTER THREE 

METHODOLOGY 

3.0 Study site and design 

Women living with HIV (WLHIV) and attending the Antiretroviral treatment (ART) 

clinic at the St. Martin de Porres Hospital (SMDPH), Eikwe in the Western Region of 

Ghana, were sampled.  St. Martin de Porres Hospital is a faith-based institution managed 

by the Catholic Diocese of Sekondi-Takoradi and a member of the Christian Health 

Association, Ghana (CHAG). It is a rural facility and a district hospital within Ellembelle 

which serves as a major referral center for the people of Nzema and neighboring towns in 

Ivory Coast. SMDPH has about 200 bed capacity, annual OPD attendance of over 80, 

000 patients and over 14,000 admissions. The facility is well known for its maternal and 

child health services and has an annual maternal delivery of about 2,800. It has an 

emergency ward, infectious disease unit, pediatric ward, neonatal intensive care unit 

(NICU), general adult ward and a high dependency unit with an outpatient department 

(OPD).  Its ART Clinic serves about 1900 active clients with an average monthly 

attendance of about 150 clients. 

 

3.1 Study Participants 

HIV sero-positive women (15 years and above) with no complaints suggestive of UTI, 

reporting to the ART Clinic between March and June 2021 were enrolled. Blood and 

urine samples, and clinical information were taken from consenting participants.  

University of Ghana http://ugspace.ug.edu.gh 



42 
 

 

3.2 Inclusion and Exclusion criteria 

 

The inclusion criteria for this study were females above 15years on Antiretroviral 

therapy, taking cotrimoxazole prophylaxis.  

The exclusion criteria comprise treatment naïve females and females taking antibiotics 

other than cotrimoxazole were excluded from the study. 

3.3 Sample Size (n) Determination 

The minimum sample size for this study was determined with the Yamane (1967:886) 

formula, 𝑛 =
𝑁

1+𝑁(𝑒2) 
   , using a 95% confidence interval, 0.5 standard deviation and a 

±5% precision. Where n = sample size, N = Population and e = allowable error.  

N = 210,000 (Women above 15yrs living with HIV in Ghana (UNAIDS, 2019) 

e = 5% (0.05) 

𝑛 =
210000

1+210000(0.052) 
   = 399  

The minimum sample size (n) for this study was 399. However, 400 HIV seropositive 

women were enrolled.   

 

3.4 Participant Information 

 

A structured questionnaire was used to extract clinical information from the patient and 

the patient folders. These included patient demographics, history of hospitalization within 

the past three months, HAART treatment initiation date and WHO disease stage. 

 

University of Ghana http://ugspace.ug.edu.gh 



43 
 

3.5 Specimen Collection and Processing 

 

Participants were directed on proper specimen collection procedures and were given 

50mls properly labelled sterile urine containers to collect 20mls of mid-stream urine. 5ml 

of venous blood was collected from the antecubital fossa of each patient into 

ethylenediaminetetraacetic acid (EDTA) vacutainer using precision needles.  

 

3.6 Laboratory Investigation 

 

Laboratory investigation occurred in two (2) phases at three different laboratories 

PHASE 1 –Culturing of urine samples, bacteria identification, antibiotic susceptibility 

test and stocking of uro-pathogens (UPEC) at the Bacteriology Department of St. Martin 

de Porres Hospital 

PHASE II – Molecular characterization of UPEC (Screening for integrons and virulent 

factor genes) at the Bacteriology Department, Noguchi Memorial Institute of Medical 

Research. 

 

3.6.1 Phase I 

 

Urine samples were aseptically streaked on Cysteine Lactose Electrolyte Deficient 

(CLED) agar using a 10µl loop and incubated at 370C. Plates were inspected after 18 

to 24 hours and significance was given to plates yielding bacterial count of 1 x 105 

CFU/ml (Chesbrough, 1999). 

 

University of Ghana http://ugspace.ug.edu.gh 



44 
 

3.6.1.1 Identification of organisms 

 

Standard microbiological procedures were followed. Lactose fermenting (yellow)  

discrete colonies were sub-cultured onto Eosin Methylene Blue (EMB) agar (Techno 

PharmaChem, India) and incubated aerobically for 10hrs (Leininger et al., 2001). UPEC 

was differentiated from other lactose fermenters of the Enterobacterales order by the 

production of greenish metallic sheen on EMB agar (Leininger et al., 2001). Identity of 

the isolates were confirmed using Maldi-Biotyper version, 4.1.100.(PYTH) 1742019-06-

158_01-16-09. 

3.6.1.2 Antimicrobial susceptibility test (AST) 

 

AST was performed according to Clinical and Laboratory Standards Institute (CLSI) 

guidelines 2020 with the following antibiotics; trimethoprim-sulfamethoxazole 

(Cotrimoxazole) (25µg), nitrofurantoin (300µg), Nalidixic acid (30µg), Cefuroxime 

(30µg), ampicillin (10µg), Fosfomycin (200µg), Tetracycline (30µg), Ciprofloxacin 

(5µg), Gentamicin (10µg), Cefepime (30µg) and Amikacin (30µg), Meropenem (30µg), 

Ceftriaxone (30µg), Amoxiclav (30µg) (Oxoid ltd Basingstoke, UK). This was done 

using Kirby Bauer’s disc diffusion method on Muller-Hinton agar (Oxoid Ltd) as 

follows; 

 Three to five well isolated colonies of the same morphology were picked with a 

sterile loop and transferred into 4 to 5 ml of sterile broth medium. 

 This was emulsified and incubated at 35 ± 2o C until a 0.5 McFarland standard is 

achieved. 

 Within 15 minutes of attaining the 0.5 McFarland standard, a loopful of the 

University of Ghana http://ugspace.ug.edu.gh 



45 
 

organism was transferred on to Mueller-Hinton agar plate and a sterile cotton 

swab was used to streak the entire surface of the agar.  

 Within 15 minutes of streaking, sterile forceps was used to pick antibiotic discs 

unto the agar plate and incubated at 37oC for 18 to 24hrs.  

Zones of inhibition were measured using transparent ruler and interpreted 

according to CLSI break point systems. 

The efficacy of the antibiotic discs and growth promotion potential of the media were 

ascertained using American Type Culture Collection (ATCC) control strains (E. coli 

ATCC 25922) and the results were interpreted using CLSI 2020 guideline. 

3.6.1.3 Stocking of Isolates 

 

Sterile plastic loops were used to transfer pure colonies into Skim milk, Tryptone, 

Glucose and Glycerol (STGG) stocking media and stored under -200C until further 

processing.  

3.6.2   Phase II 

 

3.6.2.1 Extraction of DNA for Virulent Factor Genes and Integrons in UPEC 

 

DNA was extracted from 59 UPEC isolates using fresh overnight cultures plated on 

nutrient agar. This was done according to the boiling lysis method described by Ribeiro 

et al, (2016) using 200µl of double distilled water against 3 well isolated colonies, heated 

at 98oC for 10minutes, refrigerated for 10minutes in -20oC and centrifuged at 1,350rpm 

for 5minutes. 150µl of the supernatant (DNA template) was pipetted into 2ml Eppendorf 

tubes and stored in -20oC until further works.  

University of Ghana http://ugspace.ug.edu.gh 



46 
 

 

3.6.2.2 Screening for Virulence and Integron genes using Multiplex PCR 

 

Multiplex PCR was performed to determine the following genes; iron capture systems 

(iutA, chuA), adhesin (PapC), capsule (kpsMTII), toxin (cnf1, usp) and integrons (intI and 

intII) using primers in Table 3.1. The PCR was run in two primer sets: Set 1; (iutA, 

kpsMTII, USP, cnf1) Set 2; (PapC, intI, intII, chuA). Each PCR reaction had 1µl of 25 

Pmol primer, 6.25µl of One taq Quick-Load 2× Master Mix with Standard Buffer, 3.25µl 

of nuclease free water and 1.5µl of DNA template giving a final reaction volume of 15µl.                            

Amplification was performed using applied Biosystems Thermal cycler (Thermo Fisher 

Scientific, USA). Cycling conditions were as follows; initial denaturation at 95oC for 5 

min for 30cycles, followed by a final denaturation (94oC, 30 s), annealing (63oC, 30 s), 

extension (72oC, 5 min) and final extension (72oC, 4 min). The amplicons were loaded 

onto a 2% agarose gel containing sybr red and electrophoresed for one hour. The gel was 

observed under in a gel doc under UV light. The band sizes were compared to a 100 bp  

DNA ladder. 

 

 

 

 

 

 

University of Ghana http://ugspace.ug.edu.gh 



47 
 

Table 3.0 Primer sequences and Amplicon sizes for Virulent and Integron genes 

 

 

3.7 Ethical considerations 

 

This study was given ethical approval (CHS-Et/m.4.5.8/2020-21) by the Ethical and 

Protocol Review Committee of the College of Health Sciences, University of Ghana and 

the Management of St. Martin de Porres Hospital, Eikwe. Written Informed consents 

were sought from participants seeking care at the ART clinic of St. Martin de Porres, 

Eikwe. 

Gene Primer Sequences (5’ – 3’)  Amplicon 

length (bp) 

Reference 

 

Virulent Genes 

kpsMT II F: GCGCATTTGCTGATACTGTTG 272 (Johnson & 

Stell, 2000) R:  CATCCAGACGATAAGCATGAGCA 

 

cnf1 

F: AAG ATG GAG TTT CCT ATG CAG GAG  

498 

 

(López-banda et 

al., 2014) 
R: CAT TCA GAG TCC TGC CCT CAT TAT T 

 

PapC 

F: GTGGCAGTATGAGTAATGACCGTTA   

200 

 

(López-banda et 

al., 2014) 
R: ATATCCTTTCTGAGGGATGCAATA 

 

USP 

F: ACATTCACGGCAAGCCTCAG  

        440 

(Bauer et al., 

2002; Kurazono 

et al., 2000) R: AGCGAGTTCCTGGTGAAAGC 

iutA F: GGCTGGACATCATGGGAACTGG  

300 

(Johnson & 

Stell, 2000) R: CGTCGGGAACGGGTAGAATCG 

chuA F: GACGAACCAACGGTCAGGAT  

279 

(Johnson & 

Stell, 2000) R: TGCCGCCAGTACCAAAGACA 

 

Integron Genes 

Int I F:  GGGTCAAGGATCTGGATTTCG 483 (Lucey et al., 

2000) R:  ACATGGGTGTAAATCATCGTC 

 

IntII 

F:  CACGGATATGCGACAAAAAGGT  

788 

 

(Lucey et al., 

2000) 
R: GTAGCAAACGAGTGACGAAATG 

University of Ghana http://ugspace.ug.edu.gh 



48 
 

3.8 Data analysis 

 

Primary data extracted using questionnaires were keyed into Microsoft Excel for 

preliminary analysis. The data from excel spreadsheet was transferred to Statistical 

Package for Social Sciences (SPSS) (Version 20) for further analysis. Descriptive 

statistics was used to determine percentages and mean. The chi square test and Logistic 

regression analysis was used to investigate association between dependent and 

independent variables. And a p value<0.05 was considered significant.