DEPARTMENT OF MEDICAL MICROBIOLOGY
COLLEGE OF HEALTH SCIENCES
UNIVERSITY OF GHANA
CARRIAGE OF MULTI-DRUG RESISTANT ENTEROBACTERALES AND
ACINETOBACTER BAUMANNII AMONG HOSPITALISED PAEDIATRIC PATIENTS
AT THE CHILD HEALTH DEPARTMENT, KORLE-BU TEACHING HOSPITAL
BY
HUKPORTI NELSON
(10803876)
THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN
PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE AWARD OF
MASTER OF PHILOSOPHY DEGREE IN MEDICAL MICROBIOLOGY
AUGUST, 2022
University of Ghana http://ugspace.ug.edu.gh
i
DECLARATION
I, Nelson Hukporti, declare that this thesis is the result of my research conducted in the
Department of Medical Microbiology, College of Health Sciences, Korle-Bu, under the
supervision of Prof. Japheth A. Opintan and Dr Appiah-Korang Labi, both of the University of
Ghana's Department of Medical Microbiology. All sources used in this paper have been
properly credited.
Sign: Date: 24/08/2022
Name: Nelson Hukporti
Student ID: 10803876
Sign: Date:
Supervisor: Prof. Japheth A. Opintan
Sign Date:
Co-Supervisor: Dr Appiah-Korang Labi
University of Ghana http://ugspace.ug.edu.gh
ii
DEDICATION
First and foremost, to God Almighty, the Giver life, for His never-ending love.
Secondly, to my lovely wife, Mrs Bernice Etornam Hukporti, and my adorable sons, Devine
Klenam Hukporti and Joel Elikem Hukporti-Nelson.
Finally, I would want to thank my parents, Mr Augustine Hukporti and Rose Kekrebesi, as
well as all of my siblings, friends, and the many others who helped me in various ways
throughout my studies.
University of Ghana http://ugspace.ug.edu.gh
iii
ACKNOWLEDGEMENTS
Prof. Japheth A. Opintan and Dr Appiah-Korang Labi, Senior Lecturers of the Department of
Medical Microbiology, College of Health Sciences, University of Ghana (UG), have been
extremely helpful throughout this work. Thank you for your guidance and feedback. I would
also like to thank Madam Mary-Magdalene Osei, Mr Fleischer Kotey, and Mr Awiagah Kwame
Sherrif, all of the Department of Medical Microbiology, for their contributions in many diverse
ways.
Prof. Eric Sampane (Head, Department of Medical Microbiology), Mrs Evelyn Dzomeku and
Mrs Emelia Nettey deserve special mention for their support in many ways.
In addition, special thanks to Dr Beverly Egyir, Madam Felicia Amoa Owusu, and all the Staff
of the Bacteriology Department of the Nugochi Memorial Institute for Medical Research
(NMIMR) for their immense support.
Finally, I would like to express my gratitude to my family for their support in many diverse
ways.
University of Ghana http://ugspace.ug.edu.gh
iv
ABSTRACT
BACKGROUND: Infection and carriage of multidrug resistant (MDR) Enterobacterales and
Acinetobacter baumannii are increasing globally and complicate the management of infections in
children. Outbreaks of infections due to these MDR pathogens, particularly carbapenem-resistant
Enterobacterales (CRE) and A. baumannii in hospitals are widespread and are a growing problem.
Carriage of MDR pathogens is a precursor for invasive infections which are associated with high
morbidity and mortality. This study determined the prevalence and epidemiology of MDR
pathogens, with a focus on carbapenem-resistant Enterobacterales and A. baumannii among
paediatric inpatients of the Korle-Bu Teaching Hospital.
AIM: This study aimed at identifying the risk factors for carriage of carbapenem-resistant
Enterobacterales and A. baumannii, and the molecular genotypes of carbapenemase-producing
isolates, among paediatric inpatients at the Korle-Bu Teaching Hospital.
METHOD: A cross-sectional study was conducted over 8 months period, from March to October
2021 at the Child Health Department, Korle-Bu Teaching Hospital. A systematic sampling method
was used to recruit the participants. Relevant clinical data was extracted from participants’ medical
records per a structured data collection instrument. Rectal swabs were collected from participants
and inoculated onto MacConkey agar and incubated at 35-37°C for 18-24hrs. Different colonial
morphotypes were identified by standard bacteriological techniques and confirmed with MALDI-
TOF spectometry. Antimicrobial susceptibility testing was performed on all isolates. Carbapenem
resistant isolates were screened for carbapenemase production using modified Hodge test.
Multiplex polymerase chain reaction (PCR) and gel imaging techniques were used to evaluate the
presence, and to characterise carbapenemase genes present. Frequency tables were used to
University of Ghana http://ugspace.ug.edu.gh
v
summarize the prevalence and distribution of MDR organisms. Associations between risk factors
and carriage of carbapenem resistant organisms were analysed using multinomial logistic
regression.
RESULTS: A total of 344 bacteria isolates; 331 Enterobacterales and 13 A. baumannii were
isolated from rectal swabs of 299 paediatric inpatients ≤ 13years. The most common isolates were
E. coli (60.5%, n = 208), K. pneumoniae (29.9%, n = 103) and A. baumannii (3.8%, n = 13).
Prevalence of MDR among the isolated organisms were 75.6% (n = 260); E. coli (74.0%, n = 154),
K. pneumoniae (76.7%, n = 79), and A. baumannii (100%, n = 13). Carriage of ESBL producing
Enterobacterales was 72.6% (n = 217); with E. coli (46.8%, n = 140) and K. pneumoniae (25.1%,
n = 75) being the most predominant ESBL phenotypes. Faecal carriage of carbapenem resistant
bacteria was 23.1% (n = 69). E. coli (11%, n = 33), K. pneumoniae (7.4%, n = 22), A. baumannii
(3.3%, n = 10) were the most common carbapenem resistant isolates. 52.2% (n = 36) of these
carbapenem resistant isolates expressed phenotypic carbapenemase activity by the modified
Hodge test (MHT). Thirty two (46.4%) were found to harbour at least one carbapenemase gene;
blaOxa-48 (20.3%, n = 14), blaVIM (15.9%, n = 11), blaNDM (4.4%, n = 3), and blaIMP (5.8%, n = 4).
Five (15.6%) harboured 2 carbapenemase genes, but none harboured 3 or more genes. Prior
exposure to carbapenems and fluoroquinolones increased the odds of carriage of carbapenem-
resistant Enterobacterales and A. baumannii by approximately two folds.
CONCLUSION: This study reports high faecal carriage of MDR bacteria among paediatric
inpatients of the Korle-Bu Teaching Hospital. This includes carbapenem-resistant
Enterobacterales and A. baumannii with blaOxa-48 and blaVIM carbapenemase genes being the
commonest. Prior antibiotic exposure to carbapenems and fluoroquinolones within the past year
were significant risk factors for carriage of carbapenem-resistant isolates.
University of Ghana http://ugspace.ug.edu.gh
vi
TABLE OF CONTENTS
DECLARATION............................................................................................................................ i
DEDICATION............................................................................................................................... ii
ACKNOWLEDGEMENTS ........................................................................................................ iii
ABSTRACT .................................................................................................................................. iv
TABLE OF CONTENTS ............................................................................................................ vi
LIST OF TABLES ......................................................................................................................... xi
LIST OF FIGURES .................................................................................................................... xii
LIST OF ABBREVIATIONS ................................................................................................... xiii
CHAPTER ONE ........................................................................................................................... 1
INTRODUCTION......................................................................................................................... 1
1.1 Background .......................................................................................................................... 1
1.2 Problem Statement .............................................................................................................. 3
1.3 Justification .......................................................................................................................... 4
1.4 Aim of the Study .................................................................................................................. 5
1.5 Specific Objectives............................................................................................................... 5
CHAPTER TWO .......................................................................................................................... 6
LITERATURE REVIEW ............................................................................................................ 6
2.1 Multi-drug Resistance in Enterobacterales and Acinetobacter baumannii .................... 6
2.2 Infections caused by Enterobacterales and Acinetobacter baumannii ......................... 10
University of Ghana http://ugspace.ug.edu.gh
vii
2.3 Common Antimicrobials against MDR Enterobacterales and A. baumannii ............. 11
2.4 Carbapenem Structure and Mode of Activity ................................................................ 12
2.5 Carbapenem Resistant Enterobacterales (CRE) and A. baumannii............................. 12
2.6 Mechanisms of Carbapenem Resistance ......................................................................... 13
2.6.1 AmpC β-lactamases .................................................................................................... 15
2.6.2 Extended-spectrum β-lactamases (ESBL) ................................................................ 15
2.6.3 Carbapenemases ......................................................................................................... 16
2.7 Epidemiology of MDR Enterobacterales and Acinetobacter baumannii in Children . 18
2.8 Risk Factors for Carriage of Carbapenem-resistant Isolates in Children ................... 20
2.9 Laboratory Detection of MDR Enterobacterales and A. baumannii ............................ 20
2.9.1 Antimicrobial Susceptibility Testing and Diagnosis of Carbapenem-Resistant
Isolates from Rectal Swabs ................................................................................................. 20
2.9.2 Phenotypic Detection of Carbapenemase-producing Enterobacterales and A.
baumannii ............................................................................................................................. 21
2.9.3 Molecular Testing for Carbapenem Resistant Enterobacterales and A. baumannii
............................................................................................................................................... 22
CHAPTER THREE .................................................................................................................... 23
METHODS AND MATERIAL ................................................................................................. 23
3.1 Study Design ...................................................................................................................... 23
3.2 Study Site ........................................................................................................................... 23
University of Ghana http://ugspace.ug.edu.gh
viii
3.2.1 Inclusion criteria ......................................................................................................... 23
3.2.2 Exclusion criteria ........................................................................................................ 23
3.3 Determination of sample size ........................................................................................... 24
3.4 Stool Sample Collection, Transport, and Storage. ......................................................... 24
3.5 Isolation and Identification of Bacterial Isolates ............................................................ 25
3.6 Antimicrobial susceptibility testing ................................................................................. 25
3.7 Phenotypic test for carbapenemase activity.................................................................... 26
3.8 DNA Extraction and Analysis of Carbapenemase Genes .............................................. 27
3.8.1 Molecular characterisation of carbapenemase-producing genes ........................... 28
3.9 Data Analysis ..................................................................................................................... 31
3.10.1 Ethical approval ........................................................................................................... 31
CHAPTER FOUR ....................................................................................................................... 32
RESULTS .................................................................................................................................... 32
4.1 Demographic and Clinical Characteristics of the Study Participants ......................... 32
4.2 Distribution of Bacterial Isolates in Rectal Swabs of Study Participants .................... 34
4.3 Antimicrobial Resistance Patterns among the Isolates .................................................. 34
4.4 Carriage of carbapenem-resistant Enterobacterales, A. baumannii, and Distribution of
Carbapenemase Genes ............................................................................................................ 36
4.5 Risk factors for Carriage of Carbapenem-resistant Enterobacterales and A. baumannii
among the Study Participants ................................................................................................ 37
University of Ghana http://ugspace.ug.edu.gh
ix
CHAPTER FIVE ........................................................................................................................ 39
DISCUSSION .............................................................................................................................. 39
5.1 Prevalence and Distribution of MDR Enterobacterales and A. baumannii among
hospitalized paediatric patients ............................................................................................. 39
5.2 Carriage and Distribution of Carbapenem-Resistant Enterobacterales and A.
baumannii among Paediatric Inpatients ............................................................................... 40
5.3 Phenotypic and Molecular Characterization of Carbapenemase-producing Genes .. 41
5.4 Risk Factors for Carriage of Carbapenem-resistant Enterobacterales and A.
baumannii ................................................................................................................................. 42
CHAPTER SIX ........................................................................................................................... 44
CONCLUSION, LIMITATATION AND RECOMMENDATIONS ..................................... 44
6.1 Conclusion .......................................................................................................................... 44
6.2 Limitations ......................................................................................................................... 44
6.3 Recommendations ............................................................................................................. 44
REFERENCES ............................................................................................................................ 46
APPENDIX I ............................................................................................................................... 58
CONSENT FORM .................................................................................................................. 58
APPENDIX II .............................................................................................................................. 61
RESEAECH QUESTIONNAIRE .......................................................................................... 61
APPENDIX III ............................................................................................................................ 63
University of Ghana http://ugspace.ug.edu.gh
x
LABORATORY PROTOCOLS ............................................................................................ 63
APPENDIX IV ............................................................................................................................ 66
PROTOCOL FOR DNA EXTRACTION ............................................................................. 66
APPENDIX V .............................................................................................................................. 67
PCR MASTER MIX PREPARATION ................................................................................. 67
APPENDIX VI ............................................................................................................................ 69
GELS AND OTHER IMAGES .............................................................................................. 69
APPENDIX VII ........................................................................................................................... 76
ETHICAL CLEARANCE ...................................................................................................... 76
University of Ghana http://ugspace.ug.edu.gh
xi
LIST OF TABLES
Table 1: Primer sequences and amplicon sizes for carbapenemase genes……………………….28
Table 2: Clinical characteristics of the study participants………………………………………...33
Table 3: Distribution of Bacteria Isolates………………………………………………………..34
Table 4: Resistance of bacterial isolates to the tested antimicrobials, as well as their MDR and
ESBL proportions…………………………………………………………………………………….35
Table 5: Distribution of carbapenemase genes among carbapenem resistant isolates
…………………………………………………………………………………….………………………...37
Table 6: Risk factors for carriage of carbapenem resistant Enterobacterales and A. baumannii
……………………………………………………………………………………………………………….38
Table 7: Proportion of ingredients for the preparation of Master mix…………………...……...66
Table 8: Thermomocycling conditions for detection of carbapenemase genes (35cycles…………....67
University of Ghana http://ugspace.ug.edu.gh
xii
LIST OF FIGURES
Figure 1 A picture showing positive and negative Modified Hodge Test results
………………………………………………….………………………………………….……..27
Figure 2 Agarose gel electrophoresis image for amplification product of carbapenemase genes
using multiplex PCR…………………………………………………….………..........................30
Figure 3 image of gel electrophoresis……………………………………………………...…………...68
Figure 4 image of gel electrophoresis……………………………………………………...…………...69
Figure 5 image of gel electrophoresis……………………………………………………...…………...70
Figure 6 image of gel electrophoresis………………………………………………………...………...71
Figure 7 image of gel electrophoresis………………………………………………………...………...72
Figure 8 A picture of the researcher working on the bench…………………………………….…….73
Figure 10: A picture of the Becton Dickinson Phoenix SpecTM Nephelometer used, showing
inoculum turbidity of 0.5 McFarland……………………………………………………………...……..73
Figure 10 A picture of the researcher working on the bench………………………………….……...74
Figure 11 Letter of approval for Ethical clearance ……………………………………………………………………....75
University of Ghana http://ugspace.ug.edu.gh
xiii
LIST OF ABBREVIATIONS
AMR Antimicrobial Resistance
AST Antimicrobial Susceptibility Test
ATCC American type culture collection
β Beta
CDC Center for Disease Control
CFPD Cefpodoxime
CFPM Cefipime
CFTX Cefotaxime
CFXT Cefoxitin
CHPS Community-Based Health Planning and Services
CIP Ciprofloxacin
CKD Chronic kidney disease
CLSI Clinical and Laboratory Standard Guidelines
COT Co-trimoxazole
CPE Carbapenemase-producing Enterobacterales
CRE Carbapenem-resistant Enterobacterales
DNA Deoxynucleic acid
DNase Deoxyribonuclease
ESBL Extended-spectrum-β-lactamase
GEN Gentamicin
HAI Health associated infection
ICU Intensive care unit
University of Ghana http://ugspace.ug.edu.gh
xiv
IMP Imipenemase Metallo-β-lactamase
IV Intravenous
KBTH Korel-Bu Teaching Hospital
KPC Klebsiella pneumoniae carbapenemase
MEM Meropenem
MDR Multidrug resistance
MHA Muller Hinton agar
MHT Modified Hodge Test
n Number
NDM New Delhi Metallo-β-lactamase
NHSN National Healthcare Safety Network
NICU Neonatal Intensive Care Unit
NMIMR Noguchi Memorial Institute for Medical Research
PICU Paediatric Intensive Care Unit
OXA-48 Oxacillinase-48
SMART Study for Monitoring Antimicrobial Resistance Trends
SPSS Statistical package for the social sciences
RS Rectal swab
µm/µl micrometer/microliter
UG University of Ghana
VIM Verona Integron Metallo-β-lactamase
WHO World Health Organisation
University of Ghana http://ugspace.ug.edu.gh
1
CHAPTER ONE
INTRODUCTION
1.1 Background
Antimicrobial resistance (AMR) is a serious public health threat, affecting global health (WHO,
2017). The emergence of multidrug resistant (MDR) Enterobacterales and Acinetobacter
baumannii as causes of both nosocomial and community-acquired infections is a major concern
globally (Howard et al., 2012). Diseases caused by these bacteria are difficult to treat, particularly
in low income countries, and are linked with high morbidity and mortality rates, as well as
prolonged duration of hospitalisation (Agyepong et al., 2018; Labi et al., 2020).
MDR infections kill an estimated 700,000 people worldwide each year, with available data
predicting the number could climb to 10 million by 2050 if efforts to combat resistance and
development of new antibiotics are not made (O'Neill, 2014). According to the 2017 World Bank
assessment, AMR could cost low-income countries over 5% of their GDP and impoverish up to
28 million people by 2050 (O'Neill, 2014).
Antimicrobial resistance to broad-spectrum antibiotics, such as the extended-spectrum
cephalosporins, is a major challenge among Enterobacterales and A. baumannii (Labi et al., 2020;
Olu-Taiwo et al., 2020). Carbapenems have predominantly been the antibiotic class of choice for
treating these infections (Chiotos et al., 2017; Codjoe et al., 2017). However, the advent of novel
β-lactamases with the ability to directly hydrolyse carbapenems and render it ineffective, has led
to an increased prevalence of carbapenem-resistant Enterobacterales (CRE) and A. baumannii.
This has become problematic because of the significant mortality rates associated with MDR
University of Ghana http://ugspace.ug.edu.gh
2
infections and the propensity for global spread of these resistant genes via mobile genetic elements
(Nordmann et al., 2013; Tzouvelekis et al., 2014; Tischendorf et al., 2016).
According to data from China's nationwide antimicrobial resistance surveillance, K. pneumoniae
resistance to imipenem and meropenem grew to 25% and 26.3% in 2018, respectively, from 3.0%
and 2.9 % in 2005. The rate of CRE infections has surged significantly throughout Europe.
Carbapenem-resistant K. pneumoniae (CR-KPN) has increased to 60% in Greece and 40% in Italy
(Wang, 2020). Although CRE transmission is associated with healthcare settings, the risk of spread
into the general population is growing steadily. Coupled with this, are the limited therapeutic
choices available to treat people, particularly children infected with these pathogens, making CRE
a major global epidemiologic concern (Gupta et al., 2011; Nordmann et al., 2013). The World
Health Organization has since 2017 categorized these pathogens as among the most serious
organisms on the global priority list of pathogens (WHO, 2017).
In Africa, the epidemiology of carbapenemases is relatively unknown. New Delhi Metallo-B-
lactamases (NDM) has been identified as the most common carbapenemase gene in Morocco,
Kenya, and South Africa (Brink et al., 2012; Nordmann et al., 2013). In 2012, South Africa became
the first African country to report a Klebsiella pneumoniae carbapenemases (KPC) positive
organism (Brink et al., 2012).
Despite the increasing carriage of MDR Enterobacterales and A. baumannii reports in Africa, their
epidemiology remains largely unknown (Chiotos et al., 2017). In Kenya for example, paediatric
carriage of MDR Enterobacterales in stool has been shown to almost triple, from 21% on
admission; to 57% on discharge for patients who spent 2 or more days on admission (Kagia et al.,
2019).
University of Ghana http://ugspace.ug.edu.gh
3
Unfortunately, no vaccines are available to prevent infections caused by these MDR pathogens.
As a result, it is important everything is done to ensure common infections like urinary tract
infections do not become life-threatening due to a lack of adequate treatment.
1.2 Problem Statement
There are increasing reports of MDR infections among paediatric inpatients in Ghana, particularly
carbapenem-resistant Enterobacterales and A. baumannii infections. These are mostly associated
with life-threatening nosocomial infections. (Opintan et al., 2015; Codjoe et al., 2017; Agyepong
et al., 2018).
In Ghana, carriage of MDR Enterobacterales and 3rd generation cephalosporin-resistant organisms
are as high as 49.6% and 46.1% respectively in neonates (Labi et al., 2020). Pathogen carriage is
a precursor for acquiring invasive diseases with a high likelihood of poor disease outcomes (Tsai
et al., 2014; Doare et al., 2015; Labi et al., 2020). Paediatric patients are confronted with very
limited antibiotic alternatives and as a result, are the worst affected group. Paediatric mortality
rates due to carbapenem resistant Enterobacterales and A. baumannii are as high as 40–65%
(Nordmann et al., 2011; Codjoe et al., 2017; Chiotos et al., 2017).
In addition to the high disease burden, the advent of novel β-lactamases with an increased rate of
pathogen transmission, has contributed to the rapid global spread of MDR organisms and has
increased the possibility of community transmission. Carbapenem resistant isolates are resistant to
almost all available antibiotics (Doare et al., 2015; Chiotos et al., 2017).
Despite increasing reports of infections caused by MDR Enterobacterales and A. baumannii in
Ghanaian hospitals, surveillance studies to provide credible data to guide antibiotic stewardship
strategies are lacking (Opintan et al., 2016; Labi et al., 2020). In particular, the dynamics of spread
University of Ghana http://ugspace.ug.edu.gh
4
of these MDR pathogens in Ghanaian paediatric referral centres are barely described. Meanwhile,
these are the institutions already battling with an increasing number of high-risk patients and
growing numbers of antibiotic-resistant pathogens (Agyepong et al., 2018; Labi et al., 2020).
Therefore, establishing the carriage and extent of resistance determinants are required to close the
knowledge gap and provide a framework for empiric therapy and antibiotic stewardship strategies
(Codjoe et al., 2016; Opintan et al., 2015).
1.3 Justification
Despite the high clinical significance of MDR, particularly carbapenem-resistant Enterobacterales
and A. baumannii and the public health threat they pose, very few studies have been conducted on
these infections in Ghana, especially among paediatric inpatients. There is, therefore, an urgent
need to investigate the carriage and molecular characteristics of these MDR pathogens in children
and to identify potentially modifiable risk factors for pathogen carriage (Codjoe et al., 2016; Labi
et al., 2020).
As the prevalence of MDR, particularly carbapenem resistance among Enterobacterales and A.
baumannii increase, the risk for carriage among paediatric inpatients is expected to increase as
well. Such an increase may result in the spread of resistance genes, including carbapenemases. A
better understanding of the risk factors for CRE carriage, the dynamics of spread, as well as the
molecular characteristics of the carbapenemase-producing genes present, among hospitalized
paediatric patients will be useful for the management and prevention of CRE infections in Ghana
(Nordmann et al., 2013; Codjoe et al., 2016; Chiotos et al., 2017; Labi et al., 2020).
There is, therefore, an urgent need to investigate the carriage and molecular characteristics of these
MDR pathogens in children and to identify risk factors for pathogen carriage. Data generated from
this study will be extremely useful in improving paediatric management of MDR infections as well
University of Ghana http://ugspace.ug.edu.gh
5
as improve infection prevention and control strategies in Ghana (Labi et al., 2020; Codjoe et al.,
2016) and will provide evidence to shape policy on the allocation of scarce medical resources for
antibiotic stewardship programmes.
1.4 Aim of the Study
To determine the carriage rates of MDR Enterobacterales and A. baumannii and associated risk
factors, as well as the molecular characteristics of carbapenemase-producing genes present among
paediatric inpatients at the Korle-Bu Teaching Hospital.
1.5 Specific Objectives
i. To determine the prevalence of MDR Enterobacterales and A. baumannii among hospitalized
paediatric patients.
ii. To determine the proportion of MDR Enterobacterales and A. baumannii among hospitalized
paediatric patients that are carbapenem-resistant, and to characterize the carbapenemase-
producing genes present.
iii. To describe the risk factors for carriage of carbapenem-resistant Enterobacterales and A.
baumannii.
University of Ghana http://ugspace.ug.edu.gh
6
CHAPTER TWO
LITERATURE REVIEW
2.1 Multi-drug Resistance in Enterobacterales and Acinetobacter baumannii
MDR among Enterobacterales and A. baumannii has reached alarming rates. The fight to curb
resistance among these groups of pathogens has assumed global importance and has taken centre
stage in many clinical settings. With its "Bad Bugs No Drugs" campaign and the acronym
"ESKAPE" pathogens, the Infectious Diseases Society of America, for example, has offered
significant insight into this problem and the need for novel therapies (Logan, 2012; WHO 2017)
The World Health Organization (WHO) has since identified AMR among Enterobacterales and A.
baumannii as an important barrier to public health, reaching new lows in many countries,
particularly in Sub-Saharan due to existing resource constraints, resulting in poor disease
outcomes, especially among vulnerable paediatric patients (WHO 2017; Adesanya et al., 2020;
Labi et al., 2020). Broad-spectrum antimicrobial resistance remains a predominant feature within
these pathogens among paediatric inpatients in low-resource countries, despite intense efforts to
control their development and spread (Gupta et al., 2011; Eibach et al., 2016).
Carriage rates of MDR Enterobacterales and A. baumannii are increasing worldwide, posing a
particular threat to children. Outbreaks of these MDR infections, especially carbapenem-resistant
Enterobacterales and A. baumannii are common and are becoming a greater burden, particularly
among paediatric inpatients at referral centres where these life-threatening infections are
commonly preceded by pathogen carriage (Adesanya et al., 2020). However, the dynamics of
spread in sub-Saharan Africa is not well described and data on the prevalence, acquisition, carriage
and spread of these MDR isolates among paediatric inpatients in Ghanaian referral centres, in
University of Ghana http://ugspace.ug.edu.gh
7
particular, are limited, and risk factors for transmission are not well defined (Codjoe, 2016; Kagia
et al., 2019; Labi et al., 2020).
Carbapenems have been the antimicrobial class of the first choice for treating life-threatening
infections because carbapenem resistance has been uncommon until recently. The emergence of
novel B-lactamases with the natural ability to directly break down carbapenems has contributed to
a surge in the number of carbapenem-resistant isolates (Gupta et al., 2011). Given how frequently
these carbapenem-resistant pathogens cause infections, in addition to the unacceptably high
mortality rates, and the ease of widespread transmission of mobile genetic resistant elements, AMR
among these pathogens has become a serious global health problem (Gupta et al., 2011;
Tzouvelekis et al., 2014; Tischendorf et al., 2016).
Carriage of MDR pathogens among hospitalized children increases the probability of acquiring
life-threatening infections, with increased mortality and morbidity rates in this vulnerable patient
demographic, and the resultant increase in transmission of these pathogens from carriers and or
colonized patients to others and may remain in the environment because of unsatisfactory infection
prevention and control practices (Karikari, 2017; Moshiri et al., 2018). Although pathogen
dissemination within the health care setting is the most important risk factor for carriage, the
troubling emergence of community acquisition, probably due to contaminated public water, adds
to the speed of transmission (Nordmann et al., 2013; Chiotos et al., 2017). It is, therefore, of
paramount importance to employ specific and heightened infection control precautions and barrier
nursing strategies for high-risk patients, to prevent contaminating the hospital environment and to
help limit transmission to vulnerable patients (Ghaith et al., 2019; Labi et al., 2020).
University of Ghana http://ugspace.ug.edu.gh
8
A 2017 National Healthcare Safety Network (NHSN) data in the United States of America (USA)
revealed 13% of E. coli and Klebsiella, as well as 74 % of A. baumannii in intensive-care units.
Other studies reported an increase in the proportion of nosocomial infections caused by
carbapenem-resistant Enterobacterales growing from 1.2% in 2001 to 4.2% in 2011, with
Klebsiella spp. accounting for the largest rise (10%). Globally, meropenem non-susceptibility is
found in 4% of K. pneumoniae and 1% of E. coli strains in children, while in Asia, K. pneumoniae
resistance to cephalosporins and ampicillin among paediatric inpatients is 84% and 94% (Chea et
al., 2015; De Oliveira et al., 2019; Yam et al., 2019). MDR Enterobacterales caused 18.6% of all
invasive neonatal infections in Taiwan's neonatal intensive care unit (NICU), and drug resistance
was more common in neonates who had previously received broad-spectrum antibiotic treatment
(Tsai et al., 2014).
China's nationwide surveillance on AMR showed K. pneumoniae resistance to imipenem and
meropenem stood at 3% and 2.9% respectively in 2005 but rose dramatically to 25% and 26.3%
respectively in 2018. Similarly, the number of K. pneumoniae resistant to carbapenems has surged
to 60% in Greece and 40% in Italy, whereas in the Republic of Korea, 69% of all bloodstream
infections are caused by carbapenemase-producing Enterobacterales, with KPC and NDM being
the most predominant carbapenemase genes isolated (Park et al., 2019; Wang, 2020). Of the
mechanisms of resistance among these pathogens, carbapenemase expression was the commonest
mechanism, and the rapid global spread of carbapenem resistance is attributable to the
dissemination of carbapenemase-producing strains (Eichenberger et al., 2019; Wang, 2020).
In Africa, K. pneumoniae resistance to cephalosporins and ampicillin among pediatric inpatients
reached 50% and 100%, respectively, and multidrug resistance among hospitalized paediatric
inpatients, involving commonly used antibiotics; ampicillin, chloramphenicol, and cotrimoxazole
University of Ghana http://ugspace.ug.edu.gh
9
stood at 75% as opposed to 30% in Asia (Le Doare et al., 2015; De Oliveira et al., 2019). Rectal
Carriage of MDR Enterobacterales and A. baumannii stood at 0% on admission in a Tunisian
Intensive Care Unit (ICU) but rose sharply to 45.16% on discharge and a 24% prevalence of
carbapenem-resistant Enterobacterales was recorded in an Egyptian PICU. Similarly, faecal
carriage of MDR Enterobacterales was 21% on admission but rose to 57% on discharge among
paediatric inpatients who spent at least 48hours on admission. The most common resistant
determinants isolated were the NDM and the OXA-48 carbapenemase genes (Ghaith et al., 2019;
Kagia et al., 2019).
In Ghana, prevalence of MDR Enterobacterales and Acinetobacter spp. infections in a major
referral hospital were found to be as high as 89.5% and 62.1% respectively, and 59.8% of the
Acinetobacter spp. isolates were carbapenem-resistant, whereas 8.1% harboured the NDM gene
(Agyepong et al., 2018; Olu-Taiwo et al., 2020). Other studies in a NICU revealed a neonatal
carriage rate of MDR Enterobacterales and organisms resistant to 3rd generation cephalosporin as
high as 49.6% and 46.1% respectively. As much 75.6% and 15.6% of Klebsiella spp. respectively
expressed phenotypic Extended-spectrum-β-lactamase (ESBL) and carbapenemase activity, and
Codjoe et al. (2016) revealed a 2.9% prevalence of the carbapenemase genes; NDM, Verona
Integron-encoded Metallo-β-lactamase (VIM) and Oxacillinase-48 (OXA-48) in Ghana (Codjoe,
2016; Labi et al., 2020). Despite these alarming rates, data on AMR on paediatric referral centres
is sparse, and AMR surveillance is nonexistent, not much is known about the mode of the spread
of the carbapenem resistance among these MDR pathogens in paediatric inpatients (Opintan et al.,
2015; Codjoe, 2016; Codjoe et al., 2017; Codjoe et al., 2019; Labi et al., 2020). These
characteristics are poorly described for paediatric referral centres in Ghana, which are institutions
University of Ghana http://ugspace.ug.edu.gh
10
dealing with vulnerable patients and a surging number of MDR organisms, suggesting not much
has been or is being done to contain them (Donkor et al., 2013; Ampaire et al., 2015).
Added to conferring resistance to almost all B-lactams, carbapenemase-producing organisms are
linked to many other non-B-lactam resistance determinants, resulting in multidrug and pan drug-
resistant strains (Nordmann et al., 2012). The rising number of carbapenemase producers with
reduced sensitivity to colistin and tigecycline; the two drugs with doubtful efficacies in previous
types of CRE infections have now become first-line treatments, further restricts the already limited
treatment options, giving credence to the fact that we are fast approaching, if not already at an
impasse, and that totally new drugs are required urgently (Tzouvelekis et al., 2014).
2.2 Infections caused by Enterobacterales and Acinetobacter baumannii
Enterobacterales are common colonizers of the gastrointestinal tract (GIT) of humans and are
implicated in many diseases, with very alarming mortality and morbidity burdens. Similarly, the
emergence A. baumannii has been linked with several hospital-acquired infections of clinical
importance in the elderly, children, and the immunocompromised (Olu-Taiwo et al., 2020).
Infections acquired from these clinically relevant pathogens are increasingly becoming
widespread, especially among children, and are mostly non-susceptible to several pharmacological
agents, and are becoming progressively resistant to practically all existing antimicrobials, leading
to poorer disease outcomes, protracted periods of hospital stay, and higher treatment costs, and
may include urinary and respiratory tract infections, GIT, and skin infections, as well as
septicaemia, and many other life-threatening infections (Ruppé et al., 2015; Codjoe, 2016; Eibach
et al., 2016).
University of Ghana http://ugspace.ug.edu.gh
11
2.3 Common Antimicrobials against MDR Enterobacterales and A. baumannii
In the last few years, research into developing many new and modified drugs that are effective
against drug-resistant Enterobacterales and A. baumannii has been launched, however, in most
cases, no new antimicrobial class can be expected any time soon (Codjoe, 2016; Agyepong et al.,
2019).
Since the 1990s most low-cost broad-spectrum and first-line antibiotics have been employed as
successful treatment agents for treating various kinds of infections. Some of these agents include
ampicillin, trimethoprim-sulfamethoxazole, gentamicin, tetracycline, fluoroquinolones, and
several cephalosporins. However, the widespread resistance of disease-causing bacteria to these
drugs have necessitated the reliance on carbapenems to treat patients with these MDR pathogens.
As a result, carbapenems have been such an essential antibiotic class for the effective management
of MDR infections, for which reason it has been justifiably referred to as “the antibiotic of last
resort” for treating life-threatening multidrug resistant infections (Eliakim-Raz et al., 2015; Doi,
2019).
However, the increasing prevalence of carbapenemase-producing organisms, which are novel B-
lactamases with the inherent ability to directly breakdown carbapenems, has resulted in the rise in
bacteria strains resistant to almost all available treatment alternatives, brings the clinical efficacy
of carbapenems, under immense threat, and is becoming a major setback to global public health,
posing a complex clinical challenge when treating serious illnesses, particularly in children
because of the already limited antibiotic options available for them (Aysegul et al., 2014; Ghaith
et al., 2019).
Although phase III clinical trials on tigecycline in children between 8-11years suffering from life-
threatening bacterial infection have yet to be completed, recent pharmacokinetic studies within
University of Ghana http://ugspace.ug.edu.gh
12
this paediatric age group suggest administering a dose at 12 hourly interval, could give satisfying
results (Chiotos et al., 2017). Several other innovative drugs, such as derivatives of polymyxin, β-
lactamase inhibitors developed together with non-β-lactams, newer aminoglycosides are in the
early phases of development (Chiotos et al., 2017).
2.4 Carbapenem Structure and Mode of Activity
Carbapenems are broad-spectrum antibiotics that inhibit metallo-ß-lactamases (MBL) and
extended-spectrum ß-lactamases (ESBL), both of which are produced by gram-negative bacteria,
and belong to the ß-lactam group of antibiotics, which are similar in structure to penicillins. The
name "carbapenem" describes inherent differences between penicillin and cephalosporins; "carba-
" denotes the substitution of an atom of carbon for sulfur at position one, and "-penem" denotes
the existence of a double bond between the second and third positions (Jeon et al., 2015; Codjoe
et al., 2019).
Carbapenems have been until recently, highly effective in treating infections from both Gram-
positive and Gram-negative bacteria isolates, in addition to anaerobes, and act by invading the
bacteria cell wall and adhering to penicillin-binding proteins (PBPs) within the organism, to cause
the lyse of the bacteria cell, and thereby, effectively killing the bacteria (Xu et al., 2014)
2.5 Carbapenem Resistant Enterobacterales (CRE) and A. baumannii
CRE and carbapenem-resistant A. baumannii are phenotypically non-susceptible to at least one of
the carbapenem antibiotics (meropenem, ertapenem, doripenem, or imipenem), and are implicated
in various life-threatening nosocomial infections (Chiotos et al., 2017; CDC, 2019). This arises
from one of two methods: enzymatic or non-enzymatic mechanisms. Enzymatic hydrolysis involve
carbapenemases; enzymes that break down the β-lactam ring of the carbapenem antibiotic. The
University of Ghana http://ugspace.ug.edu.gh
13
latter involves the synthesis of ESBLs and/or AmpC cephalosporinases, as well as decreased
membrane permeability. The synthesis of carbapenemase enzymes is the commonest mechanism
of resistance among MDR isolates and have been the key to the rapid global transmission of
carbapenem resistance, due to easily transferrable mobile genetic determinants, such as plasmids
and transposons that encode these carbapenemase genes (Chiotos et al., 2017; Wang, 2020).
Except for the detection of OXA-48 in Tunisia, Egypt and Morocco and NDM and KPC in Kenya
and South Africa, the epidemiology of carbapenemase producing isolates in Africa is relatively
unknown. In Ghana, just like in most other African countries, there is very little data on the
epidemiology of carbapenemase producers; data on risk factors for pathogen carriage, dynamics
of spread, treatments and disease outcomes, particularly in children is grossly limited. Meanwhile,
carbapenem resistance among Enterobacterales as well as A. baumannii in this high risk group
continue to surge, and a lack of clinical trials, assessing the possibility of new agents in the younger
population worsen the already limited therapeutic choices (Kieffer et al., 2016; Chiotos et al.,
2017).
2.6 Mechanisms of Carbapenem Resistance
Resistance to carbapenems among Enterobacterales and A. baumannii is facilitated by 2 main
mechanisms; non-enzymatic and/or enzymatic processes (antibiotic molecule breakdown).
Because of their outer membrane structure, these pathogens are frequently more resistant to
antimicrobials as opposed to Gram-positive bacteria. This confers protection to the organisms’
internal membrane or the peptidoglycan from dyes, drugs, detergents as well as lysozyme and
penicillin leading to MDR isolates (Xu et al., 2014; Codjoe, 2016).
University of Ghana http://ugspace.ug.edu.gh
14
Non-enzymatic mechanisms employ the use of efflux pumps as well as down regulation of outer
membrane porins, largely from broad-spectrum antibiotic exposure. Many of these resistant
mechanisms are intrinsic to the organism and can be expressed either intrinsically (chromosomal
genes) or acquired. Organisms, including commensals and pathogens, with intrinsic resistance, are
innately resistant to particular kinds of antimicrobial agents, complicating the selection of
appropriate treatment regimens, and thereby, increasing the likelihood for acquired resistance to
develop. By the selective modification of their porin channels, Enterobacterales, for example, can
selectively restrict the uptake of β-lactam antibiotics, thereby reducing the effectiveness of the
antibacterial agent. (Forsberg et al., 2012; Moshiri et al., 2018).
By contrast, acquired resistance involves organisms that have established numerous mechanisms
of resistance, such as inactivation of enzymes, mutation of target-sites, and the activation efflux
pump. Inactivating enzymes have prevailed since the clinical use of β-lactam antimicrobials; from
penicillinases, cephalosporinases, ESBLs, and quite recently, the advent of metallo-β-lactamases
as well as carbapenemases. Over time, these hydrolyzing enzymes have expanded their spectrum
of activities. The MBLs have had a significant impact on the clinical utility of carbapenems and
have the potential to render useless, the therapeutic use of these important medications (Castañeda-
García et al., 2013).
Horizontal transfer of mobile genetic elements harbouring resistance genes generally are made up
of plasmids. Because these plasmids typically carry numerous B-lactamase, one plasmid conjugate
may be enough in spreading resistance determinants to many antibiotic classes. There are three (3)
major classes of β-lactamases namely AmpC, ESBL, and carbapenemase-producing organisms
(Mariappan et al., 2017; Labaste et al., 2019).
University of Ghana http://ugspace.ug.edu.gh
15
2.6.1 AmpC β-lactamases
Several clinically important Enterobacterales have chromosomally encoded AmpC β-lactamases
that easily hydrolyses broad-spectrum cephalosporins as well as penicillins and can also weakly
breakdown carbapenems, acting similar to carbapenemase producers, especially when down-
regulated porins are present. Antibiotic exposure can stimulate the expression of normally
suppressed chromosomal AmpC enzymes, resulting in their continued expression (Malande et al.,
2016; Moshiri et al., 2018). Many AmpC enzymes are found on mobile genetic materials and have
been detected in most Enterobacterales. The spread of AmpC β-lactamases leads to poorer
treatment outcomes because plasmid-mediated AmpC enzymes in Enterobacterales are not
easily detected by phenotypic techniques. Mutations in the AmpC attenuator and promoter regions
are mostly responsible for acquiring plasmid-mediated AmpC genes and their subsequent
overexpression in bacterial isolates (Frye, 2013; Xu, 2014; Malande et al., 2016).
2.6.2 Extended-spectrum β-lactamases (ESBL)
ESBL confers resistance to β-lactams such as aztreonam, and most cephalosporins and are most
prevalent on plasmids of Klebsiella spp. and E. coli with the most prevalent ESBL genes being
Temoneira-1(TEM-1) and sulfhydryl variable-1 (SHV-1) β-lactamases (Gupta et al., 2011;
Tzouvelekis et al., 2014). ESBL strains whose porins have been altered or whose expression has
been regulated such as in Klebsiella spp., Enterobacter spp., and E. coli, among other genera, are
unlikely to spread extensively but may thrive locally within hospitals. Ertapenem is the most
affected among the various carbapenem antibiotics; although bacteria pathogens may still be
susceptible to other carbapenem types, lower ertapenem susceptibility is mostly linked to the
presence of AmpC/ESBL and the precise modifications in bacteria porins (Bedenić et al., 2014;
Codjoe et al., 2017).
University of Ghana http://ugspace.ug.edu.gh
16
2.6.3 Carbapenemases
Carbapenemases are β-lactamase enzymes that hydrolyse various types of antibiotics, including
penicillins, cephalosporins, and carbapenems, giving rise to resistance to multiple β-lactams as
well as other non-β-lactam resistant organisms. Carbapenemases are predominantly responsible
for the development of multidrug and pan drug-resistant isolates, and the global spread of bacteria
isolates nearly resistant to all known antibiotics (Nordmann et al., 2012).
Carbapenemases are mostly plasmid-mediated and can spread rapidly among bacterial isolates in
a variety of ways. This has become a great public health concern globally, even more so among
paediatric patient populations in low resource countries because of how frequently they cause
infections, the high mortality and morbidity burdens, as well as the global spread of resistant
determinants via mobile genetic materials (Nordmann et al., 2013; Bedenić et al., 2014;
Tzouvelekis et al., 2014; Tischendorf et al., 2016).
For epidemiological purposes, it is important to distinguish carbapenemase isolates from isolates
that are resistant to carbapenems as a result of other resistant mechanisms because although both
types of resistant isolates require contact precautions, organisms harbouring carbapenemase genes
may require more rigorous infection control methods, such as focused active surveillance (Ghaith
et al., 2019). The NDM, KPC, IMP, VIM, and OXA-48 are the most widely distributed
carbapenemase genes of clinical importance and have been categorized into 3 ambler classes; A,
B, and D carbapenemases (Nordmann et al., 2012; Kieffer et al., 2016).
2.6.3.1 K. pneumoniae Carbapenemase (KPC)
The KPC is plasmid-encoded, and was first discovered in North America in K. pneumoniae but is
now widespread in E. coli, Enterobacter cloacae, and S. marcescens. A wide variety of antibiotics
University of Ghana http://ugspace.ug.edu.gh
17
including aztreonam, extended-spectrum cephalosporins, and carbapenems are all hydrolysed by
KPC carbapenemase genes (Kieffer et al., 2016).
2.6.3.2 Imipenemase Metallo-β-lactamase (IMP)
A. baumannii and P. aeruginosa were the first bacteria to be found with the IMP gene. It was
eventually discovered in Enterobacterales transferable plasmids. All β-lactams and carbapenems
can be hydrolysed by IMP (Kieffer et al., 2016).
2.6.3.3 Verona Integron-encoded Metallo- β-lactamase (VIM)
The VIM gene was first discovered in P. aeruginosa, but it was later found in plasmids from
Klebsiella spp. and E. coli. It has a similar mode of action to the KPC (Kieffer et al., 2016).
2.6.3.4 New Delhi Metallo-β-lactamase (NDM)
A newly discovered carbapenemase gene was discovered on the chromosomes of A. baumannii
but later discovered on plasmids of Enterobacterales. It works in the same way as the IMP and the
VIM metallo-β-lactamases (Kieffer et al., 2016).
2.6.3.5 Oxacillinase Type Carbapenemases (OXA-)
OXA enzymes come in a variety of forms but do not include extended-spectrum cephalosporins
and Aztreonam. Despite the discovery of OXA-48 in Enterobacterales, principally in K.
pneumoniae and E. coli, OXA-type β-lactamases are found widely in Acinetobacter species
(Kieffer et al., 2016).
2.6.3.6 Molecular/Ambler classification of carbapenemase enzymes
The Ambler class A carbapenemases include chromosomal and plasmid-encoded carbapenemases,
with K. pneumoniae carbapenemases being the most frequent. The KPC gene, blaKPC, is linked
University of Ghana http://ugspace.ug.edu.gh
18
predominantly with clonal expansion and the epidemiologic success of the global spread of the
KPC carbapenemase genotypes. More than 80% of carbapenem resistance in the USA is
attributable to activities of KPC, and is also responsible for the rising prevalence of MDR globally
(Chiotos et al., 2017).
The VIM, IMP variants are among ambler class B carbapenemases and although have been
detected globally, have been largely associated with multidrug infections within the Mediterranean
sub-region as well as Asia. The NDM, another ambler class B variant, is prevalent in the Indian
sub-region and is responsible for more than half of the CRE isolates in the region. The NDM, just
like the other carbapenemases have recently been detected in many parts of Europe, Africa, Asia
as well as the United States, usually in people who travelled to CRE prevalent areas (Chiotos et
al., 2017).
The OXA-48 carbapenemases belong to the Ambler class D carbapenemases, which are
oxacillinases. The most common carbapenemases found in Acinetobacter species are Class D
carbapenemases although they are increasingly being found among Enterobacterales. Geographic
disparities for the different carbapenemase genes are expected to fade away as global travel and
medical tourism remain on the rise (Chiotos et al., 2017).
2.7 Epidemiology of MDR Enterobacterales and Acinetobacter baumannii in Children
Quite possibly, the limited nature of MDR epidemiological studies in children, notably in the
areas of CRE carriage and infections, may be responsible for the continuous global increase of
CREs. From 2007 to 2011, 14% of neonatal invasive infections in a NICU in Kolkata, India, were
caused by NDM-1 type Enterobacterales (Johnson et al., 2017). The SMART (Study of Monitoring
Antimicrobial Resistance Trend) surveillance program gathered reports between 2002 and 2010,
University of Ghana http://ugspace.ug.edu.gh
19
on paediatric patients with CRE infections in five countries; India, Israel, Spain, the United States,
and Greece. India had the most prevalence with 39%, followed by Israel with 29%, Spain with
19%, the United States with 11%, and Greece with 3% (Johnson et al., 2017). Enterobacter spp.,
K. pneumoniae, and E. coli were the commonest isolates detected. NDM, KPC, and VIM were the
commonest isolated phenotypes; over 50% of the organisms were from NICUs or PICUs. All NDM
isolates came from the Indian sub-region, all KPC from the USA and Israel, and all VIM genotypes
from within Europe (Johnson et al., 2017).
Nosocomial outbreaks of Carbapenem-resistant Enterobacterales (CRE) have also been recorded
in paediatric health care centres in many parts of the world, notably in a California NICU, a
Spanish PICU, and a Nepalese NICU. All these outbreaks were linked to carbapenemases; IMP,
VIM, and NDM-1 whereas between 2003 and 2015, records from England’s Public Health unit on
confirmed laboratory isolates of carbapenemase-producing Enterobacterales in the UK indicated
an unprecedented spike of carbapenemase genes (Hsu et al., 2014; Chiotos et al., 2017). Carriage
of carbapenem resistance among K. pneumoniae and E. coli accounted for 32% of all Carbapenem-
resistant bacteria. With multiple reported outbreaks of carbapenemase-producing Enterobacterales
and A. baumannii among paediatric populations in India, and many other parts of the world,
children appear to be a particularly vulnerable group, who are the worst affected group in terms of
mortality and morbidity burden (Chiotos et al., 2017).
In Ghana and many other resource-limited countries, the mechanism of transmission is poorly
defined. There exist only scanty data on the prevalence, acquisition, and carriage of these MDR
pathogens among Ghanaian paediatric inpatients, and risk factors for transmission are not well
established (Codjoe, 2016; Codjoe et al., 2017; Kagia et al., 2019; Labi et al., 2020).
University of Ghana http://ugspace.ug.edu.gh
20
2.8 Risk Factors for Carriage of Carbapenem-resistant Isolates in Children
Carriage of these MDR pathogens is a precursor for serious systemic infections, high mortality
and morbidity rates, as well as increasing hospital costs and protracted hospital stay. Several risk
factors predispose children to the carriage of these pathogens including immunosuppression,
prematurity, admission to the ICU, previous exposure to antibiotics, stem-cell transplant,
chemotherapy, invasive medical devices, indwelling catheters, protracted hospital stay, and
impaired GIT function such as necrotizing enterocolitis or Hirschprung's or surgery (Chiotos et
al., 2017; Codjoe et al., 2017; Moshiri et al., 2018; Labi et al., 2020).
2.9 Laboratory Detection of MDR Enterobacterales and A. baumannii
Accurate detection and characterization of pathogens are crucial to aid prompt and efficient
diagnoses as well as the selection of the right antimicrobials against the isolated pathogen. This is
fundamental in every clinical setting the pivot of any efficient epidemiological surveillance
strategies (Fournier et al., 2014; Boswihi et al., 2018). The CDC recommends various strategies
for isolating and identifying MDR bacteria from rectal or perianal swabs in the clinical laboratory
including the use of automation, disc diffusion, agar-based methods, modified Hodge test,
molecular techniques and many others (Boswihi et al., 2018).
2.9.1 Antimicrobial Susceptibility Testing and Diagnosis of Carbapenem-Resistant Isolates
from Rectal Swabs
The Centre for Disease Control (CDC) recommends a variety of tests for in-vitro pathogen
detection, including the inoculation of fresh stool specimens from rectal or perianal swabs onto
MacConkey agar and the subsequent use of antibiotic discs on Mueller-Hinton agar as well as
commercially available chromogenic media for the diagnoses of CRE, as well as other MDR
University of Ghana http://ugspace.ug.edu.gh
21
Enterobacterales and A. baumannii. They have a reasonable detection sensitivity, are reasonably
affordable, and are simple to interpret (Chiotos et al., 2017).
Disk diffusion is one of the most common baseline tests for pathogen detection. Impregnated discs
with a standard amount of the antimicrobial agent are positioned on Mueller-Hinton agar (MHA),
seeded with a 0.5McFarland Standard turbidity of the test bacteria and incubated overnight. The
antimicrobial agent diffuses into the medium as the bacterium grows during incubation. The
inhibition zone created by the antibiotic used is proportional to the susceptibility of the organism
of interest (Chiotos et al., 2017). The double-disc synergy testing is another technique for the
detection of MDR organisms, particularly CRE. Automated systems are also currently
commercially available to assess antibiotic susceptibility (Chiotos et al., 2017).
2.9.2 Phenotypic Detection of Carbapenemase-producing Enterobacterales and A.
baumannii
The most common phenotypic detection of carbapenemase activity is by the modified Hodge test
(MHT), also called the "cloverleaf" test. It involves streaking a suspected carbapenemase-
producing bacterium over MHA. The expression of carbapenemase activity is confirmed when a
test isolate produces a carbapenemase enzyme that breaks down the carbapenem, permitting a
carbapenem-susceptible strain to grow down the inoculum streak toward the carbapenem disc
positioned at the centre of the MHA. The MHT has very high sensitivity, is affordable, as well as
simple to use. It is recommended by the CLSI and the CDC for the phenotypic detection of
carbapenemase producing isolates (Chiotos et al., 2017).
The recently designed Carba NP test, which stands for “Carbapenemase Nordmann-Poirel”, is
another very efficient technique for the detection of carbapenemase. The method is simple,
University of Ghana http://ugspace.ug.edu.gh
22
requires little expertise, can be reproduced and is highly economical (Nordmann et al., 2011;
Nordmann et al., 2012).
2.9.3 Molecular Testing for Carbapenem Resistant Enterobacterales and A. baumannii
To detect and characterize common carbapenemase genes (KPC, VIM, IMP, NDM, and OXA-48),
single and multiplex PCR techniques are highly effective and has sensitivities and specificities
approaching 100%. The ability to detect specific carbapenemase genotypes, greater sensitivity and
specificity, as well as quick turnaround time, are clear advantages of these molecular-based
techniques. The downsides include the relatively high cost of various procedures, as well as the
necessity for specialized skills and equipment (Chiotos et al., 2017).
University of Ghana http://ugspace.ug.edu.gh
23
CHAPTER THREE
METHODS AND MATERIAL
3.1 Study Design
A cross-sectional study was carried out over an 8 months, from March to October 2021. A
systematic sampling method was used to recruit a total of 299 participants. An interval of one
month was allowed between the collection of each batch of samples to prevent duplicity of
samples. The number of participants recruited per unit were proportional to the total bed capacity
of the unit.
3.2 Study Site
The study was undertaken at the Department of Child Health, Korle-Bu Teaching Hospital, Accra,
Ghana. The Korle-Bu Teaching Hospital is a tertiary referral hospital located in Accra, Ghana’s
capital city. The hospital has a Child Health Department serving children under 13years with
Medical and Surgical conditions. The department has an emergency unit, a surgical unit, a ‘babies’
unit (for neonates), a Paediatric Intensive Care Unit (PICU), an oncology unit as well as an Out-
Patient Department. The Child Health Department has an estimated daily general outpatient
attendance of 120.
3.2.1 Inclusion criteria
i. Paediatric inpatients ≤ 13years for whom consent had been granted
3.2.2 Exclusion criteria
i. Paediatric inpatients with missing folders/ incomplete hospital records
ii. Paediatric inpatients ≤ 13years for whom consent had been declined
University of Ghana http://ugspace.ug.edu.gh
24
3.3 Determination of sample size
The minimum sample size was determined using an MDR carriage rate of 24% from a similar
study (Ghaith et al., 2019), and a 95% confidence interval with an error margin of 5%. The
minimum sample size for the study was calculated using the formula;
N ═
𝑍2×𝑃(1−𝑃)
𝑚2
Where;
N= minimum sample size
Z = 1.96, the standard score for the confidence interval at 95%.
m = margin of error at 5% (standard value of 0.05)
P = 0.24, thus, the prevalence rate (24%) of Carbapenem-resistant Enterobacterales infection in
hospitalized children from a similar study (Ghaith et al., 2019).
Therefore, our minimum sample size, N =
1.962×0.24(1−0.24)
0.052
= 280.28
The minimum sample size = 280.
However, a sample size of 299 was used.
Participants’ information were extracted from their clinical records per a structured questionnaire
alongside the rectal swab. The number of participants from each unit/ward was proportional to
the patient/bed capacity of the unit.
3.4 Stool Sample Collection, Transport, and Storage.
Using strict aseptic techniques, rectal swabs (RS) from each study participant were collected.
Participants were hospitalized paediatric children 13 years and below. A total of 299 non-duplicate
University of Ghana http://ugspace.ug.edu.gh
25
RS were collected and transported in a cool box to the Department of Medical Microbiology of
the University of Ghana Medical School and processed within 2hrs.
3.5 Isolation and Identification of Bacterial Isolates
Each rectal swab was directly inoculated onto MacConkey (Oxoid, Ltd Basingstoke, UK) agar and
incubated at 35±2°C for 18-24hrs. This was followed by purity plating until pure bacterial isolates
were obtained. Pure, non-duplicate bacteria isolates were identified presumptively using standard
biochemical methods (indole test, citrate, oxidase urea, motility, Triple sugar iron (TSI) tests).
Confirmation was done using MALDI spectrometry (Bruker Daltonics, Bremen, Germany).
3.6 Antimicrobial susceptibility testing
Antibiotic susceptibility test (AST) was carried out by the Kirby Bauer’s disc diffusion method,
per the Clinical and Laboratory Standards Institute (CLSI) guidelines (2020). For each pure non-
duplicate bacteria isolate, a 0.5 McFarland standard equivalent suspension of organisms was
prepared and inoculated on Muller-Hinton agar (Oxoid, Hampshire, England) to obtain a confluent
growth. Within 15 minutes of bacteria application, various antimicrobial discs were positioned on
the lawn of bacterial isolates using sterile forceps and incubated aerobically within 15 minutes of
antimicrobial disc application, for 16-18hrs at 37°C. Figure 2 below is a picture of
Becton Dickinson Phoenix SpecTM Nephelometer, showing inoculum turbidity of 0.5 McFarland.
Antimicrobial discs used for the AST were Cotrimoxazole (1.25/23.75μg), Ciprofloxacin (5μg),
meropenem (10μg), gentamicin (10μg), cefepime (30μg), cefotaxime (30μg), cefpodoxime (10μg),
cefpodoxime/clavulanic acid (10μg/1μg). All antimicrobials used were from BD BBLTM Sensi-
Disc Antimicrobial Susceptibility Test Discs. The plates were incubated at 37˚C for 16-18 hours
and the diameters of the zones of complete inhibition were measured to the nearest millimetre and
compared with the CLSI guidelines to determine resistance and sensitivity states. Zone sizes within
University of Ghana http://ugspace.ug.edu.gh
26
the intermediate resistance and absolute resistant range were classified as resistant. MDR was
defined as in-vitro resistance of a test organism to three or more different classes of antimicrobials
(Magiorakos et al., 2012). Escherichia coli ATCC25922 and Klebsiella pneumoniae ATCC13883
were used as quality control strains for susceptibility testing.
The combined disc tests (CDT) were used for phenotypic screening and confirmation of extended-
spectrum B-lactamases (ESBLs) expression according to CLSI (2020) recommendations. ESBL
was determined by comparing the inhibition zone diameters (ZD) around cefpodoxime/clavulanic
acid (10μg/1μg) disc to that of cefpodoxime (10μg) (without clavulanic acid). The test is positive
if the inhibition ZD around the disc with the clavulanic acid is ≥ 5mm larger than the disc without
it.
3.7 Phenotypic test for carbapenemase activity
The modified Hodge test (MHT) was used to test for phenotypic expression of carbapenemase
activity, and multiplex PCR was employed to confirm the presence of specific carbapenemase-
producing genes. All isolates resistant to meropenem; zone diameters (ZD) ≤ 23mm for
Enterobacterales and ZD ≤ 14mm for A. baumannii (CLSI, 2020; Olu-Taiwo et al., 2020) were
phenotypically tested for carbapenemase activity by the MHT as recommended by CLSI 2020.
Briefly, the indicator organism, E. coli ATCC 25922 was obtained by preparing an overnight broth
culture, adjusted to 0.5 McFarland turbidity standard followed by a 10-fold dilution in saline. The
broth was seeded onto the MHA plate (Biotec Ltd, UK) and meropenem (10μg) positioned at the
centre. 3-5 colonies of the test isolate were then inoculated onto the plate in a line straight from
the edge of the disc to the end of the plate and incubated overnight at 35-37ºC for 16-24 hours.
The isolate is positive when a clover-leaf-like indentation of the E. coli ATCC 25922 grew along
University of Ghana http://ugspace.ug.edu.gh
27
the test organism's growth streak, within the disc diffusion zone. Figure 1 below shows positive
and negative Modified Hodge Test results.
Figure 1: Isolates A and C were Modified Hodge Test Negative, while isolates B and D were
Modified Hodge Test Positive, showing clover-leaf indentation at the point of intersection between
E. coli ATCC 25922 and test organism.
Image Source: self
3.8 DNA Extraction and Analysis of Carbapenemase Genes
Extraction of DNA was done by the boiling lysis method as described by Ribeiro et al. (2016). All
69 carbapenem-resistant isolates were cultured overnight onto nutrient agar at 35-37ºC for 16-24
hours. Using sterile techniques, 3 colonies of the bacterial isolate was inoculated in 200μl of double
distilled water and heated at 98ºC for 10 minutes, refrigerated for 10minutes at -20ºC, then
centrifuged at 1,350rpm for 5minutes. 150μl of the supernatant (DNA template) was pipetted into
2ml Eppendorf tubes and stored at -20ºC until further molecular analysis.
Isolates
A and C
E. coli ATCC
25922
Meropenem
disc
Isolates
B and D
University of Ghana http://ugspace.ug.edu.gh
28
3.8.1 Molecular characterisation of carbapenemase-producing genes
All 69 carbapenem-resistant isolates were investigated for the presence of the five most prevalent
carbapenemase genes; NDM, KPC, VIM, OXA-48, and IMP by multiplex PCR as described by
Obeng-Nkrumah et al., (2019) and Poirel et al (2011). Table 1 below shows a list of primer
sequences and amplicon sizes used for the detection of carbapenemase genes.
Table 1. Table 1: Primer sequences and amplicon sizes for carbapenemase genes
Gene Primer sequence (5’→3’) Amplicon
size (bp)
Reference
IMP FP: GGAATAGAGTGGCTTAAYTCTC
RP: CCAAACYACTASGTTACT
188 (Obeng-Nkrumah et al.,
2019)
VIM FP: GATGGTGTTTGGTCGCATA
RP: CGAATGCGCAGCACCAG
390 (Poirel et al., 2011)
OXA- 48 FP: GCGTGGTTAAGGATGAACAC
RP: CATCAAGTTCAACCCAACCG
438 (Poirel et al., 2011)
NDM FP: GAAGCTGAGCACCGCATTAG
RP: TGCGGGCCGTATGAGTGATT
760 (Obeng-Nkrumah et al.,
2019)
KPC FP: GTATCGCCGTCTAGTTCTGC
RP: GGTCGTGTTTCCCTTTAGCC
683 (Obeng-Nkrumah et al.,
2019)
University of Ghana http://ugspace.ug.edu.gh
29
Using primers in Table 1, the PCR was run in two separate primer sets; primer sets 1 and 2. The
first primer set included OXA-48 and KPC, whereas primer set 2 was made up of NDM, VIM and
IMP. Each PCR reaction had 12.5µl of One Taq Quick-Load 2× Master Mix with Standard Buffer,
3.5µl of nuclease-free water, 7µl of primer, and 2µl of DNA template, to give a final PCR reaction
volume of 25µl.
The applicable Biosystems Thermal cycler was used for amplification (Thermo Fisher Scientific,
USA). For the first set of primers, the following cycling conditions were used; initial denaturation
at 95ºC for 5 minutes, then 35 cycles of denaturation at 95ºC for 30 seconds, annealing at 60ºC for
30 seconds, and elongation at 72ºC for 1 minute, followed by a final elongation step at 72ºC for 3.
The cycling conditions for the second primer set is summarised below;
Initial denaturation at 94ºC for 3 minutes, followed by 35 cycles of denaturation at 94ºC for 30
seconds, annealing at 61.6ºC for 30 seconds, and elongation at 72ºC for 1 minute, followed by a
final elongation step at 72ºC for 7 minutes.
Following this, 5µl of each PCR reaction mixture was loaded onto a 2.0% agarose gel, containing
SYBR red and electrophoresed for 45 minutes. The gel was visualized under UV illumination in a
gel doc. The amplicon sizes were compared to a 100bp DNA ladder. Figure 2 below shows
carbapenemase genes determined by multiplex PCR.
University of Ghana http://ugspace.ug.edu.gh
30
Figure 2: Agarose gel electrophoresis image for amplification product of carbapenemase genes
using multiplex PCR.
Lane 1: well 1= 100bp Ladder, well 2 = KPC Positive control, well 3: Negative control, wells 4
to 12: carbapenem-resistant isolates. Wells 6, 8 and 10, showing OXA-48 positive isolates (438bp)
Lane 2: well 1= 100bp ladder, well 2= OXA-48 Positive control, well 3= negative control, wells
4 to 11= carbapenem resistant isolates. No Carbapenemase gene detected.
1 2 3 4 5 6 7 8 9 1 0 11 12
Lane 1
Lane 2
University of Ghana http://ugspace.ug.edu.gh
31
3.9 Data Analysis
All data were entered into a Microsoft Access database, then exported and analysed using SPSS
software version 25. Descriptive statistics (means, frequencies, percentages, and standard
deviations) were used to summarize data on the participants’ demographic and clinical
characteristics, as well as the distribution of carbapenem-resistant Enterobacterales and A.
baumannii, carbapenemase genes present, and antimicrobial resistance patterns. Also, at an alpha
level of 0.05, a combination of bivariate associations and logistic regression analyses were
conducted to determine risk factors for carriage with CRE among the study participants.
3.10.1 Ethical approval
The Ethical and Protocol Review Committee of the University of Ghana's College of Health
Sciences granted the study ethical approval. CHS-Et/M.5- 5.10/2020-2021 is the protocol
identification number. Before analysis, all data were anonymised and treated with strict
confidentiality.
University of Ghana http://ugspace.ug.edu.gh
32
CHAPTER FOUR
RESULTS
4.1 Demographic and Clinical Characteristics of the Study Participants
In total, 299 paediatric inpatients aged 13 years and below (mean age = 47.8 ± 47.1 months) were
recruited, with 61.9% (n = 155) being males, and 38.1% (n = 114) females. Most of the participants
were referred from district healthcare facilities (42.1%, n = 126), and the majority of participants
(24.1%, n = 72) recruited were from the Babies’ Unit. Majority of the participants (56.5%, n = 169)
had had a previous hospital admission within the past year (the mean previous and current hospital
admission durations were 13.4 and 14.3 days, respectively), whereas (14%, n = 42) of the participants
had previous ICU admissions, and (14%, n = 42) had a history of intra-nasal oxygen therapy with
oxygen delivery devices in KBTH. With regards to history of invasive procedures in the past year,
(91.3%, n = 273) had a history of intravenous device insertion over the past year, whereas (46.2%, n =
138) had past surgeries. 18.7% (n = 56) had a history of urethral catheterization, (5.4%, n = 16) had
history of endotracheal intubation, (2%, n = 6) had a history of wound drain insertion, and (47.4%, n
= 22) had had no such history. Furthermore, (7.4%, n = 22) and (6.4%, n = 19) of participants had
previous exposure to chemotherapy and steroids respectively, in the past year. The clinical
characteristics of the study participants are summarized in Table 2.
University of Ghana http://ugspace.ug.edu.gh
33
Table 2: Clinical characteristics of the 299 study participants
Characteristic Number Percentage (%)
Type of referral facility
CHPS Compound 4 1.3
Polyclinic 74 24.7
District 126 42.1
Regional 57 19.1
Tertiary 38 12.7
Ward
Paediatric Intensive Care Unit 20 6.7
Babies’ Unit 72 24.1
Paediatric Surgical 58 19.4
Paediatric Medical 68 22.7
Oncology 33 11.0
Emergency Room
48 16.1
Previous admission within the past year
Yes 169 56.5
No
130 43.5
Exposure to carbapenems within the past year
Yes 37 12.4
No
262 87.6
ICU admission within the past year
Yes 42 14
No
257 86
Comorbidities
Malnutrition 2 0.7
Prematurity 9 3
Congenital heart disease 4 1.3
Hydrocephalus 2 0.7
CKD 6 2
Hypertension
20 6.7
History of intra-nasal oxygen use in the past year
Yes 42 14.0
No
257 86.0
History of invasive procedure in the past year
Nil 22 7.4
IV access 273 91.3
Surgery 138 46.2
Catheter 56 18.7
Tube 16 5.4
Wound drain 6 2.0
Exposure to immunosuppressants in the past year
Chemotherapy 22 7.4
Steroids 19 6.4
Current admission duration = 14.3 ± 16.5 days; Previous admission duration = 13.4 ± 27.0 days
University of Ghana http://ugspace.ug.edu.gh
34
4.2 Distribution of Bacterial Isolates in Rectal Swabs of Study Participants
E. coli (60.5%, n = 208) was the most predominant bacteria isolated, followed by Klebsiella
pneumoniae (29.9%, n = 103), then Acinetobacter baumannii (3.8%, n = 13). The distribution of the
various bacteria isolates is summarized in table 3 below.
Table 3: Distribution of Bacteria Isolates
Organism Number of Isolates Percentage (%)
E. coli 208 60.5
Klebsiella pneumoniae 103 29.9
Acinetobacter baumannii 13 3.8
Enterobacter cloacae 8 2.3
Morganella morganii 5 1.5
Proteus mirabilis 4 1.2
Citrobacter braakii 2 0.6
Serratia marcescens 1 0.3
Total 344 100
4.3 Antimicrobial Resistance Patterns among the Isolates
The pooled rate of antimicrobial resistance for all bacteria decreased from (81.1%) cefotaxime,
(77.6%) cotrimoxazole, (75%) cefpodoxime, (73.3%) cefipime, (51.7%) ciprofloxacin, (41.3%)
gentamicin, and (20.1%) meropenem. The respective lowest and highest rates of antimicrobial
resistance recorded for the three most predominant bacteria isolates (meropenem excluded) were as
follows: E. coli (cefotaxime = 79.3%), Klebsiella pneumoniae (cefotaxime = 83.5%), and
University of Ghana http://ugspace.ug.edu.gh
35
Acinetobacter baumannii (ciprofloxacin = 90%; cefipime, cotrimoxazole, cefotaxime, gentamicin, and
cefpodoxime = 100% each).
In addition, the overall prevalence of bacteria isolates that were multidrug-resistant was 75.6%, and
was distributed among the most predominant bacteria isolates as; E. coli (74.0%), Klebsiella
pneumoniae (76.7%), Acinetobacter baumannii (100%).
With regards to ESBL expression, 65.4% of Enterobacterales were ESBL producing and was
distributed predominantly among E. coli (67.3%), and Klebsiella pneumoniae (72.8%). However,
overall carriage of ESBL producing Enterobacterales was 72.6% (n = 217); with E. coli (46.8%, n =
140) and K. pneumoniae (25.1%, n = 75) being the most predominant ESBL phenotypes. The
antimicrobial resistance rates and ESBL status of bacteria isolates are presented in Table 4.
Table 4: Resistance of bacterial isolates to the tested antimicrobials, as well as their MDR and
ESBL proportions.
Organisms/Antimicrobials MEM CFPM COT CIP CFTX GEN CFPD MDR ESBL
Escherichia coli 14.4% 74.5% 77.4% 49/5% 79.3% 34.1% 72.1% 74% 67.3%
Klebsiella pneumoniae 21.4% 73.8% 78.6% 56.3% 83.5% 49.5% 76..7% 76.7% 72.8%
Acinetobacter baumannii 76.9% 100% 100% 90% 100% 100% 100% 100% NA
Morganella morganii 50% 50% 100% 25% 75% 25% 50% 75% 50%
Citrobacter braakii 0% 0% 100% 0% 0% 100% 100% 100% 0%
Proteus mirabilis 0% 0% 0% 0% 0% 50% 0% 0% 0%
Serratia marcescens 0% 100% 100% 100% 100% 100% 100% 100% 100%
Enterobacter cloacae 0% 25% 25% 25% 75% 25% 100% 50% 50%
All bacteria 20.1% 73.3% 77.6% 51.7% 81.1% 41.3% 75% 75.6% 65.4%
MEM = Meropenem; CFPM = Cefipime; COT = Co-trimoxazole; CIP = Ciprofloxacin; CFTX = Cefotaxime; GEN =
Gentamicin; CFPD = Cefpodoxime, NA= Not applicable
University of Ghana http://ugspace.ug.edu.gh
36
4.4 Carriage of carbapenem-resistant Enterobacterales, A. baumannii, and Distribution of
Carbapenemase Genes
Overall carriage of carbapenem resistant Enterobacterales and A. baumannii was (23.1%, n = 69), and
was distributed among the bacteria isolates as follows: E. coli (11.0%, n = 33), Klebsiella pneumoniae
(7.4%, n = 22), Acinetobacter baumannii (3.3%, n = 10) and Morganella morganii (1%, n = 3).
With regards to phenotypic carbapenemase activity, 52.2% (n = 36) of the carbapenem resistant
isolates were MHT positive. Multiplex PCR results showed 46.4% (n = 32) of carbapenem resistant
isolates harboured at least one carbapenemase gene. BlaOxa-48 (20.3%, n = 14) was the most widely
distributed carbapenemase gene, followed by blaVIM (15.9%, n = 11), then blaIMP (5.8%, n = 4), and
the blaNDM (4.3%, n = 3). No carbapenem resistant isolate harboured a blaKPC gene.
E. coli and K. pneumoniae harboured the majority of the carbapenemase genes and was distributed as
follows: blaOxa-48 (E. coli = 71.4%, n = 10; K. pneumoniae = 21.4%, n = 3; and M. morgannii = 7.1%,
n = 1); blaVIM (E. coli = 54.6%, n = 6; K. pneumoniae = 36.4%, n = 4; and M. morgannii = 9.1%, n =
1); blaNDM (E. coli = 66.7%, n = 2; K. pneumoniae = 33.3%, n = 1); and blaIMP (E. coli = 50%, n = 2;
K. pneumoniae = 50%, n = 2). No A. baumannii isolate harboured any carbapenemase gene.
Overall, 15.6% (n = 5) of bacteria isolates harboured 2 carbapenemase genes. 1 K. pneumoniae and 1
E.coli harboured both a blaOxa-48 and blaIMP; 1 E. coli isolate harboured both blaOxa-48 and blaVIM; 1 E.
coli had a blaVIM and blaNDM carbapenemase genes, and 1 K. pneumoniae isolate harboured both blaNDM
and blaIMP carbapenemase gene. No isolate harboured 3 or more carbapenemase genes. Table 5 below
shows the distribution of the carbapenemase genes detected.
University of Ghana http://ugspace.ug.edu.gh
37
Table 5: Distribution of Carbapenemase Genes among Carbapenem Resistant Isolates
4.5 Risk factors for Carriage of Carbapenem-resistant Enterobacterales and A. baumannii
among the Study Participants
Of the variables investigated as potential risk factors for carriage of carbapenem-resistant
Enterobacterales and A. baumannii, exposure to carbapenems and fluoroquinolones in the past year
were associated with carriage of carbapenem-resistant Enterobacterales and A. baumannii. Both
variables increased the odds of carriage of carbapenem-resistant isolates by approximately two folds.
The results of the risk factor analysis are summarized in Table 6 below.
CARBAPENEMASE GENES
ISOLATE OXA-48 VIM NDM IMP KPC
E. Coli 10 (71.4%) 6 (54.6%) 2 (66.7%) 2 (50%) Nil
K. pneumoniae 3 (21.4%) 4 (36.4%) 1 (33.3%) 2 (50%) Nil
M. morganii 1 (7.1%) 1 (9.1%) Nil (0%) Nil (0%) Nil
Total genes (20.3%, n = 14) (15.9%, n = 11) (4.3%, n = 3) (5.8%, n = 4) Nil
University of Ghana http://ugspace.ug.edu.gh
38
Table 6: Risk factors for carriage of carbapenem resistant Enterobacterales and A. baumannii
Risk factor OR (95% CI) p value
Exposure to carbapenems in the past year 2.178 (1.022–4.39) 0.044
Exposure to fluoroquinolones in the past year 2.420 (1.063–5.511) 0.035
University of Ghana http://ugspace.ug.edu.gh
39
CHAPTER FIVE
DISCUSSION
5.1 Prevalence and Distribution of MDR Enterobacterales and A. baumannii among hospitalized
paediatric patients
This study investigated the risk factors for carriage of MDR pathogens, particularly carbapenem-
resistant Enterobacterales and A. baumannii, and examined the molecular characteristics of the
carbapenemase-producing genes present, among hospitalized paediatric patients in Ghana. This fills
an important knowledge gap, particularly in Ghanaian paediatric referral centres where such data are
grossly limited (Agyepong et al., 2018; Labi et al., 2020; Olu-Taiwo et al., 2020).
The present study identified a high carriage of MDR Enterobacterales and A. baumannii, distributed
among E. coli, K. pneumoniae, and A. baumannii as the three most predominant MDR organisms. The
observed carriage is consistent with previous reports in Ghana by Agyepong et al. (2018) and Labi et
al. (2020) but is significantly higher than what was reported in Tunisia (Hammami et al., 2017).
Antibiotic use is a significant risk factor for the development of AMR, and is known to vary between
geographical locations (Chiotos et al., 2017). This may be responsible for the difference in the observed
prevalence.
Resistance to frequently used antibiotics in hospitalized children was high, decreasing across
cefotaxime, cotrimoxazole, cefpodoxime, cefipime, ciprofloxacin, gentamicin, and meropenem. These
findings are consistent with previous reports by Agyepong et al. (2020) in Ghana, where pathogen
resistance to commonly used antibiotics was observed to be highest to most used antimicrobials, as
opposed to less frequently used ones, decreasing across cotrimoxazole, cefotaxime, cefpodoxime,
gentamicin, ciprofloxacin, cefipime, and meropenem. By contrast, the level of resistance observed in
the present study to cefpodoxime, cefipime and meropenem were remarkably higher compared to
University of Ghana http://ugspace.ug.edu.gh
40
reports for cefpodoxime (44.4%), cefipime (8.5%), and meropenem (2.5%) from previous studies
(Codjoe et al., 2017; Agyepong et al., 2018; Labi et al., 2020). This may reflect increasing AMR
among Enterobacterales and A baumannii, and in particular, increasing resistance of these top-priority
pathogens to carbapenems in Ghana. Another reason for the disparity observed may stem from the fact
that, whereas the previous studies focused on an array of clinical specimens from the general patient
population, except for Labi et al. who focused on neonates, the present study focused exclusively on
faecal carriage of these pathogens among paediatric inpatients.
5.2 Carriage and Distribution of Carbapenem-Resistant Enterobacterales and A. baumannii
among Paediatric Inpatients
Similar to previous reports in Egypt (24%), India (39%), Israel (29%), and 19% carriage of
carbapenem-resistant Enterobacterales and A. baumannii reported in Spain (Johnson et al., 2017;
Ghaith et al., 2019), a high carriage (23.1%) of carbapenem-resistant Enterobacterales and A.
baumannii was observed in the present study. However, this observation is largely at variance with the
relatively lower rates (2.9%, 7.2% and 10%) previously recorded in Ghana by Codjoe et al. (2019),
Hackman, et al. (2017) and Oduro (2016) respectively. The high rate observed in the current study
may be suggestive of increased transmission of carbapenem-resistant isolates, particularly among
paediatric inpatients at the Child Health Department, Korle-Bu Teaching Hospital. This result may
also be due to the fact that this study focused exclusively on paediatric inpatients who may be at an
increased risk for pathogen carriage, as opposed to the previous studies, which focussed on the general
patient population.
However, carbapenem resistance was highest among Acinetobacter baumannii, followed by K.
pneumoniae, and least among E. coli, similar to observations made in Egypt, Ghana, Tunisia, and
China (Codjoe et al., 2016; Hammami et al., 2017; Agyepong et al., 2018; Park et al., 2019; Olu-
Taiwo et al., 2020). These carbapenem-resistant isolates were less susceptible to other commonly used
University of Ghana http://ugspace.ug.edu.gh
41
antibiotics such as cephalosporins, sulphonamides, and commonly used aminoglycosides, just as was
reported by Agyepong et al., (2018) and Eichenberger et al. (2019).
5.3 Phenotypic and Molecular Characterization of Carbapenemase-producing Genes
A little over 52% of the carbapenem-resistant isolates in the present study exhibited phenotypic
expression of carbapenemase activity by the MHT. However, Multiplex PCR revealed that 46.4% of
carbapenem-resistant isolates harboured at least one carbapenemase gene, and less than 16% of these
isolates harboured 2 carbapenemase-producing genes. None harboured 3 or more genes. This
observation, although at variance with previous reports from Ghana (Codjoe et al., 2016), agrees with
findings in Egypt (Ghaith et al., 2019), Tanzania (Mushi et al., 2014) and China (Han et al., 2020)
where 45.3%, 35% and 49% of carbapenem resistant isolates harboured at least one carbapenemase
gene respectively. This study also observed a high prevalence (15.6%) of multiple carbapenemase
genes among carbapenemase producing isolates, an observation that is in variance with 7.2%
prevalence observed in earlier studies in Ghana (Codjoe et al., 2016). This disparity may stem from
the fact that the present study focused on paediatric inpatients, whereas previous studies focused on
general patient populations. The increased carriage of carbapenem-resistant Enterobacterales and A.
baumannii observed in the present study may have contributed to increased dissemination of
carbapenemase genes. The present study also demonstrated that the MHT is a sensitive indicator for
the detection of carbapenemase production as reported by Hara et al. (2013) and Nordmann et al.
(2013).
Similar to previous reports in Ghana (Codjoe et al., 2016; Codjoe et al., 2019; Quansah et al., 2019),
the current study observed dominance of blaOxa-48 among the carbapenemase genes detected, occurring
at a proportion of 20.3%, whereas the blaIMP and blaNDM genes occurred at relatively lower frequencies
of 5.8% and 4.3%, respectively. Interestingly, this study detected a relatively higher proportion of
blaVIM (15.9%) genes compared to 7.2% reported by Codjoe et al., (2016). This sharp contrast might
University of Ghana http://ugspace.ug.edu.gh
42
be indicative of increasing transmission of carbapenemases among isolates as indicated by Quansah et
al. (2019), Labi et al. (2020) and El Kholy et al. (2020). However, no blaKPC was detected in this study,
which is consistent with finding in Ghana by Codjoe et al. (2016).
Furthermore, E. coli and K. pneumoniae were the most common carriers of carbapenemase genes. This
observation is consistent with previous studies in Ghana (Codjoe et al., 2019; Quansah et al., 2019),
Tunisia (Hammami et al., 2017) and Egypt (Ghaith et al., 2019). However, the carbapenemase gene
distribution per species is relatively higher in the present study than previous studies in Ghana (Codjoe
et al., 2016; Labi et al. 2020), which might be giving credence to reports of increasing carbapenem-
resistant determinants in the country. In particular, the increased report of OXA-48 and VIM
carbapenemase genes is a major cause of concern and a call for heightened surveillance of MDR
pathogens, particularly surveillance of carbapenem-resistant Enterobacterales and A. baumannii in
paediatric referral centres in Ghana, and the implementation of strict infection control measures, as
well as comprehensive antimicrobial stewardship strategies.
In terms of ESBL carriage and distribution, the overall carriage of Enterobacterales that expressed
phenotypic ESBL activity was almost 73%, with the most common ESBL producing pathogens being
E. coli and Klebsiella pneumoniae. These observations are consistent with findings from previous
studies in Ghana, Pakistan, and Egypt (Ghaith et al., 2019; Labi et al., 2020; Qureshi et al., 2021).
5.4 Risk Factors for Carriage of Carbapenem-resistant Enterobacterales and A. baumannii
The findings from this study are consistent with previous studies in Ghana, China and other parts of the
world, where risk factors for pathogen carriage were predominantly exposure to antibiotics, particularly
carbapenems and fluoroquinolones (Chiotos et al., 2017; Codjoe et al., 2017; Moshiri et al., 2018; Kim
et al., 2020; Labi et al., 2020). Similarly, the current study identified previous exposure to carbapenems
and fluoroquinolones in the past year as the main risk factors for carriage of carbapenem-resistant
Enterobacterales and A. baumannii, increasing the odds of carriage of carbapenem-resistant isolates by
University of Ghana http://ugspace.ug.edu.gh
43
approximately two folds. This may be suggestive of increased use of broad-spectrum antibiotics,
particularly fluoroquinolones and carbapenems in the treatment of infections. This reinforces the need
for comprehensive antimicrobial stewardship strategies, especially the use of fluoroquinolones and
carbapenems, to aid in the prevention and control of MDR.
University of Ghana http://ugspace.ug.edu.gh
44
CHAPTER SIX
CONCLUSION, LIMITATATION AND RECOMMENDATIONS
6.1 Conclusion
This study reports high faecal carriage of MDR Enterobacterales and A. baumannii, including
carbapenem resistant phenotypes, with high levels of resistance to commonly used antibiotics, among
paediatric inpatients at the Department of Child Health, Korle-Bu Teaching Hospital. Majority of the
carbapenemase producing organisms carried blaOxa-48 and blaVIM. Finally, the study identified previous
antibiotic exposure; particularly exposure to carbapenems, and fluoroquinolones within the past year
as significant risk factors for carriage of carbapenem-resistant isolates, increasing the odds of pathogen
carriage by approximately two folds.
6.2 Limitations
Only a limited repertoire of carbapenemase genes were screened for, and several others may have been
missed. Furthermore, the study did not determine whether or not the carbapenem resistant isolates were
carried persistently.
6.3 Recommendations
Based on the findings of this study, I recommend that;
i. This study is extended to other vulnerable groups, and also continuous surveillance of MDR
pathogens is enhanced, particularly among carbapenem-resistant Enterobacterales and A.
baumannii, since this is imperative to monitor these resistance determinants.
ii. Sequencing of the carbapenemase producing isolates is carried out to help improve
understanding of the molecular bases of their resistance, as well as the genetic relatedness of
these genes with those identified in other geographical locations.
University of Ghana http://ugspace.ug.edu.gh
45
iii. Comprehensive antibiotic stewardship strategies are instituted to limit the clinical effects of
carbapenem-resistant isolates.
iv. Additionally, the capacity and infrastructure for the detection of carbapenemase expression in
clinical laboratories is be improved for the purposes of patient management and surveillance.
University of Ghana http://ugspace.ug.edu.gh
46
REFERENCES
1. Abbott, I., Cerqueira, G. M., Bhuiyan, S., & Peleg, A. Y. (2013). Carbapenem resistance in
Acinetobacter baumannii: Laboratory challenges, mechanistic insights and therapeutic strategies.
Expert Review of Anti-Infective Therapy, 11(4), 395–409. https://doi.org/10.1586/eri.13.21
2. Abuosi, A. A., Akoriyea, S. K., Ntow-Kummi, G., Akanuwe, J., Abor, P. A., Daniels, A. A., &
Alhassan, R. K. (2020). Hand hygiene compliance among healthcare workers in Ghana’s health
care institutions: An observational study. Journal of Patient Safety and Risk Management, 25(5),
177–186. https://doi.org/10.1177/2516043520958579
3. Adesanya, O. A., & Igwe, H. A. (2020). Carbapenem-resistant Enterobacteriaceae (CRE) and
gram-negative bacterial infections in Nigeria: A retrospective epidemiological surveillance study.
7(4), 804–815. https://doi.org/10.3934/publichealth.2020062
4. Agyepong, N., Govinden, U., Owusu-Ofori, A., Amoako, D. G., Allam, M., Janice, J., Pedersen,
T., Sundsfjord, A., & Essack, S. (2019). Genomic characterization of multidrug-resistant ESBL-
producing Klebsiella pneumoniae isolated from a Ghanaian teaching hospital. International Journal
of Infectious Diseases, 85, 117–123. https://doi.org/10.1016/j.ijid.2019.05.025
5. Agyepong, N., Govinden, U., Owusu-Ofori, A., & Essack, S. Y. (2018). Multidrug-resistant gram-
negative bacterial infections in a teaching hospital in Ghana. Antimicrobial Resistance & Infection
Control, 7(1), 37. https://doi.org/10.1186/s13756-018-0324-2
6. Alqahtani, J. M. (2017). Emergence of Stenotrophomonas maltophilia nosocomial isolates in a
Saudi children’s hospital. Saudi Medical Journal, 38(5), 521 LP – 527.
https://doi.org/10.15537/smj.2017.5.16375
7. Ampaire, L. M., Katawera, V., Nyehangane, D., Boum, Y., & Mbarara, E. (2015). Epidemiology
of Carbapenem Resistance among Multi-drug Resistant Enterobacteriaceae in Uganda. 8(2), 418–
423. https://doi.org/10.9734/BMRJ/2015/17055.Epidemiology
University of Ghana http://ugspace.ug.edu.gh
https://doi.org/10.1586/eri.13.21
https://doi.org/10.1177/2516043520958579
47
8. Aysegul, Alp, E., Percin, D., Cevahir, F., Kürkçü, C. A.-, & Ozturk, A. (2014). Letter to the Editor
Risk factors for carbapenem-resistant Klebsiella pneumoniae rectal colonization in pediatric units.
0, 4–7. https://doi.org/10.3855/jidc.4593
9. Bedenić, B., Plečko, V., Sardelić, S., Uzunović, S., & Godič Torkar, K. (2014). Carbapenemases
in Gram-Negative Bacteria: Laboratory Detection and Clinical Significance. BioMed Research
International, 2014, 841951. https://doi.org/10.1155/20