University of Ghana http://ugspace.ug.edu.gh INTESTINAL CARRIAGE OF EXTENDED-SPECTRUM BETA- LACTAMASES PRODUCING ENTEROBACTERIA IN IMMUNOCOMPETENT PATIENTS TAWIAH GLORIA DELLA (10551508) THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE AWARD OF MSC MEDICAL LAB. SCIENCE DEGREE JULY, 2017 University of Ghana http://ugspace.ug.edu.gh DECLARATION I hereby declare that this is the product of my own research undertaken under the supervision and has neither been presented in whole nor in part for another degree elsewhere. I am solely responsible for any residual flaws in the work. Tawiah Gloria Della (10551508) (Student) Signature……………………….. Date……/……/…………. Dr Noah Obeng-Nkrumah Principal Supervisor Signature…………………… Date……/……/……………… Dr Enid Owusu (Co-supervisor) Signature…………………… Date……/……/……………… i University of Ghana http://ugspace.ug.edu.gh ABSTRACT Background: The intestinal tract serves as a reservoir for ESBL–producing Enterobacteriaceae and colonized patients act as a source of dissemination and infections. What is not clear in literature is whether the immune status of patients influences ESBL intestinal colonization patterns. Available studies on ESBL faecal colonization have not clearly distinguished between immunocompetent and suppressed patients. Aim: The aim of the study was to examine immunocompetent patients for faecal carriage with extended-spectrum beta-lactamase-producing enterobacteria at a district care hospital setting in Ghana. Method: Between March and May 2017, a cross-sectional sampling was performed to enrol patients and conduct questionnaire-structured interviews for factors that predispose patients to ESBL faecal carriage. Faecal samples from study patients were quantified to determine the predominant ESBL-producing enterobacteria. PCR and sequencing were used to characterize ESBL genes. Results: The overall faecal carriage prevalence of ESBL was 35.5% (n = 38/107). The blaCTX-M- gene, mostly CTX-M-15, was detected in 79% (n = 30/38) of the ESBL-producing isolates. Other ESBL types detected include blaSHV(n=3) and blaOXA(n=1). The CTX-M-15-positive isolates, when present in a faecal sample, constituted the predominant faecal enterobacteria-with significantly higher colony counts than all other enterobacteria in a faecal sample. In multivariate regression, the following were identified as independent risk factors for faecal carriage with ESBL-producing enterobacteria: hospitalization in the past 1 year, infections since admission, use of antibiotics in past 6 weeks, and admission from another hospital. ii University of Ghana http://ugspace.ug.edu.gh Conclusion: Nearly one in every 3 patients included in the study was colonized by ESBL- producing enterobacteria. The high colonization level is worrying, therefore prudent antimicrobial use should be adopted in the hospital. iii University of Ghana http://ugspace.ug.edu.gh DEDICATION This work is dedicated to Almighty God, my parents DSP/Mr. Christopher Tawiah and Mrs Jemima Tawiah, my mentor, Dr Noah Obeng Nkrumah Your inspirations have been most helpful and dearly appreciated. To God be the glory, great things He has done iv University of Ghana http://ugspace.ug.edu.gh ACKNOWLEDGEMENTS My sincere gratitude goes to the Almighty God for giving me the grace and strength to go through this programme successfully. I am also grateful to my family especially to my Parents, Mr and Mrs Tawiah for the support and encouragement they gave me during the period of study. The financial, emotional, psychological and moral support from my parents, sisters and brother cannot be overlooked. May the good Lord richly bless you. I also thank the Department of Medical Laboratory Science, School of Allied Health Sciences, University of Ghana, for the training, exposure and experience they offered me during my postgraduate studies. I am exceptionally grateful to my supervisor, Dr. Noah Obeng- Nkrumah and my Co-supervisor, Dr. Enid Owusu for their excellent supervision, patience and dedication towards my training in scientific research. To Loretta Antwi of Public Health Reference Laboratory, Mr Michael Olu Taiwu of School of Allied Health Science Microbiology Laboratory, I say a very big thank you for guiding me through the culturing and identification aspects of my laboratory work. I also want to thank all the teaching and non-teaching staff at the Department of Medical Laboratory Science and other departments. Finally, I appreciate the assistance of both Madam Ruth and Mr Asamoah of Achimota Government Hospital-Achimota, for their great help during my sample collection and being there whenever I needed them. Thank you all very much. May the good Lord continue to bless you. v University of Ghana http://ugspace.ug.edu.gh TABLE OF CONTENTS DECLARATION ............................................................................................................................. i ABSTRACT .................................................................................................................................... ii DEDICATION ............................................................................................................................... iv ACKNOWLEDGEMENTS ............................................................................................................ v TABLE OF CONTENTS ............................................................................................................... vi LIST OF FIGURE.......................................................................................................................... ix LIST OF TABLE ............................................................................................................................ x LIST OF ABBREVIATIONS ........................................................................................................ xi CHAPTER ONE ............................................................................................................................. 1 INTRODUCTION ....................................................................................................................... 1 1.1 Background ........................................................................................................................... 1 1.2The ESBL problem................................................................................................................. 2 1.4 Problem statement ................................................................................................................. 4 1.5 Justification ........................................................................................................................... 6 1.6Aim ......................................................................................................................................... 7 1.5 Specific Objectives ................................................................................................................ 7 CHAPTER TWO ............................................................................................................................ 8 LITERATURE REVIEW ............................................................................................................ 8 2.1 EXTENDED SPECTRUM β-LACTAMASES (ESBLS) ..................................................... 8 2.1.1 Background ..................................................................................................................... 8 2.1.2 Characterization of extended spectrum β-lactamases (ESBLs) ...................................... 9 2.2 GROWING CHALLENGE OF CTX-M TYPE ESBL ....................................................... 14 2.3PREVALENCE AND RISK FACTORS FOR CARRIAGE OF ESBL- PRODUCING ENTEROBACTERICEAE. ......................................................................................................... 15 2.4 DETECTION OF ESBL CARRIAGE ................................................................................ 18 2.4.1 Disk diffusion methods- ............................................................................................... 18 vi University of Ghana http://ugspace.ug.edu.gh 2.4.2 Broth –dilution method ................................................................................................. 19 2.4.3 Confirmatory tests for ESBL-producing Enterobacteriaceae ....................................... 19 2.4.4 Other detection methods ............................................................................................... 20 2.4.5 ESBL commercial detection methods .......................................................................... 22 2.4.6 Molecular techniques for ESBL detection .................................................................... 23 CHAPTER THREE ...................................................................................................................... 25 3.1 Study Area ........................................................................................................................... 25 3.2 Study Design ....................................................................................................................... 25 3.3 Participants .......................................................................................................................... 25 Exclusion criteria ...................................................................................................................... 25 Study isolates ............................................................................................................................. 26 3.4 Minimum sample size ........................................................................................................ 26 3.5 Procedure for data collection............................................................................................... 26 3.5.1 Phase-1- Collection, questionnaire interviews and faecal cultures . ............................ 27 3.5.2 Phase-2- Phenotypic determination of ESBLs ............................................................. 28 3.5.3 Phase 3- Molecular characterization ............................................................................. 30 CHAPTER FOUR ......................................................................................................................... 36 4.0 RESULT .............................................................................................................................. 36 4.2Enterobacteriaceae isolates cultured from fecal samples. ................................................... 39 4.3 Specific type of ESBL gene sequences in E. coli and K. pnuemoniae ............................... 41 4.4 Faecal concentration of ESBL-producing E. coli and K. pnuemoniaeamong the study patients. ..................................................................................................................................... 43 4.5Univariate comparison of risk factors exposition in the study population with and without ESBL-positive faecal carriage. .................................................................................................. 45 4.6 Independent risk factors of ESBL positive faecal carriage identified using multivariate logistic regression analysis. ....................................................................................................... 48 CHAPTER 5 ................................................................................................................................. 50 5.0 DISCUSSION ..................................................................................................................... 50 5.1 Occurence of ESBL faecal carriagein ummonocompetent patients .................................... 50 5.2 Characterization of the ESBL gene sequences .................................................................... 52 5.3 Feacal concentration of ESBL-producing E .coli /K.pneunoniae. ...................................... 53 5.4 Risk factors of ESBL-faecal carriage .................................................................................. 53 vii University of Ghana http://ugspace.ug.edu.gh 5.4 Limitations of the study....................................................................................................... 54 CHAPTER 6 ................................................................................................................................. 55 6.0 CONCLUSION AND RECOMMENDATION .................................................................. 55 6.1 CONCLUSION ................................................................................................................... 55 REFERENCES ............................................................................................................................. 58 APPENDIX ................................................................................................................................... 76 viii University of Ghana http://ugspace.ug.edu.gh LIST OF FIGURE Figure 4.1: Flow chart summary of results ................................................................................... 36 ix University of Ghana http://ugspace.ug.edu.gh LIST OF TABLE Table 3.1 ESBL PCR Primers ....................................................................................................... 32 Table 4.1 Patients Demographics ................................................................................................. 38 Table 4.2Enterobacteriaceae isolates cultured from fecal samples ............................................. 40 Table 4.3Specific type of ESBL gene sequences in E. coli and K. pnuemoniae .......................... 42 Table 4.5 Comparism of the feacal concentration (CFU/g) of ESBL-positive E . coli /K. pneunoniae and all ESBL negative entrobacteria in feacal amples of 38 ESBL faecal carriers............................................................................................................................................44 Table 4.6 Univariate comparison of the risk factors exposition in the study population with and without ESBL-positive faecal carriage ......................................................................................... 46 Table 4.7 Independent risk factors of ESBL positive faecal carriage using multivariate logistic regression analysis. ....................................................................................................................... 49 x University of Ghana http://ugspace.ug.edu.gh LIST OF ABBREVIATIONS ADH Achimota District Hospital AMpC Ampicillin hydrolyzing Cephalosporinase BES Brazillian extended -spectrum Beta-lactamases CAZ Ceftazidime CFU Colony forming units CLSI Clinical and Laboratory Standards Institute CTX Cefotaxime CTX-M Cefotaximase CV Clavulanic acid ESBLs Extended spectrum Beta-lactamase OXA Oxacillinase PCR Polymerase Chain reaction PER Pseudomonas Extended Resistance SHV Sulfhydryl variable active sites SSI Staten serum Institut TEM Temoniera ul Micro litre VEB veitnamese extended-spectrum Beta-lactamase GES Guiana Extended-Spectrum ug Microgram g Gram MIC microgram AOR Adjusted Odd Ratio xi University of Ghana http://ugspace.ug.edu.gh CHAPTER ONE INTRODUCTION 1.1 Background The most preferred antibiotic in the treatment of infectious diseases globally is the Beta-lactam antibiotics. Although, there are several resistance mechanisms against Beta-lactam antibiotics, Beta-lactamases. are the most common (Lakshmi et al., 2014; Nigam, Gupta & Sharma, 2014). Generally, three broad groups of Beta-lactamases are differentiated: class C cephalosporinases (AmpC), extended-spectrum beta-lactamases (ESBLs) and Beta-lactamases with carbapenemase activity (Ghafourian et al., 2015). Among these enzymes, the ESBLs are the most prominent Beta-lactamase resistant mechanism against Beta-lactam antibiotics. ESBLs enzymes are equipped for hydrolyzing an extensive variety of Beta-lactams, including the most newly developed cephalosporins, yet are not mediated against cephamycins and carbapenems (Dhillon & Clark, 2012). Though, ESBLs are characterized as Beta-lactamases that present resistance to the penicillins, cephalosporins, and monobactams by hydrolysis, however, are sensitive to inhibitors such as clavulanic acid, sulbactam and tazobactam (Brolund, 2014). ESBLs are encoded by point mutations in genes such as TEM, SHV and CTX. A newly-emerging Beta- lactamase group CTX-M ESBLs, are gradually becoming popular around the world (Cantón, González-Alba & Galán, 2012). The Enterobacteriaceae frequently referred to as enterobacteria, are the most prominent Gram- negative bacteria found to be associated with ESBLs (Östholm, 2014). Enterobacteriaceae are represented by over 40 genera with 110 recognized species. Of these, Escherichia coli and 1 University of Ghana http://ugspace.ug.edu.gh Klebseilla pneumoniae are the widely spread ESBL-producing isolates (Östholm, 2014). Intestinal carriage with ESBL-producing isolates poses serious threats to infection control and prevention ( Ebrahimi et al., 2016 ; Titelman et al., 2014). This is because ESBL-producing isolates in carriers is a threat to other individuals (non-carriers) via human to human transmission or through the environment. This reportedly leads to increase in the resistance pool and also aid in the acquisition of resistance mechanisms by susceptible bacteria (Kumar & Babu, 2012). ESBL-producing Enterobacteriaceae intestinal carriage is widespread especially in Europe and America (Östholm, 2014), ESBL-producing Escherichia coli and Klebseilla pneumoniae investigations have been done across hospitalized patients and healthy community persons (Brolund, 2014). In contrast, little research has been conducted in Africa including sub-Saharan countries, where there appears to be the significant spread of infections and colonization with ESBL-producing isolates (Tansarli et al., 2014). In Ghana, there is a limited report. The first published data of ESBL was an acknowledgement of high levels in one of the largest referral hospitals (Obeng-Nkrumah, 2013). There is the need to conduct more epidemiological surveillance studies for local data to aid in the implementation of infection control and prevention measures which is crucial for monitoring resistance pattern at the local level to help clinical administration (Andriatahina et al., 2010). The present study focuses on the faecal colonization with ESBL-producing E. coli and K. pneumoniae among patients in a hospital care setting. 1.2 The ESBL problem ESBLs in Enterobacteriaceae renders Beta-lactam antibiotics ineffective. This compels the use of non-Beta-lactam antimicrobials such as ciprofloxacin and amikacin (Andriatahina et al., 2010) in the treatment of infections due to these pathogens. Nonetheless, there is increasing evidence 2 University of Ghana http://ugspace.ug.edu.gh that the occurrence of ESBL is associated with the antimicrobial co-resistance to both Beta- lactam and non-Beta-lactam antibiotics, considerably reducing treatment options available for these pathogens (Ebrahimi et al., 2016; Titelman et al. 2014). Consequently, the duration of hospital stays, charges and mortality rates are also increased. Plasmids remain the significant wellspring of ESBL transmission adding to the selection of antimicrobial co-resistance among Escherichia coli and Klebsiella pneumoniae (Baudry et al., 2009). ESBL-producing enterobacteria are increasingly becoming associated with transferable genetic elements, including integrons and transposons, which travel alongside the ESBL-containing plasmids. In Escherichia coli and Klebsiella pneumoniae, the genes encoding ESBLs are sometimes carried by transposons borne on transmissible plasmids, which facilitate the rapid transfer of genetic material between unrelated Enterobacteriaceae strains (Baudry et al., 2009). The ESBL genes could likewise be discovered incorporated inside integrons as a feature of multi-drug resistance cassettes that present mechanisms for resistance to extended-spectrum cephalosporins as well as to other antibiotic classes such as aminoglycosides, macrolides, sulphonamides and chloramphenicol (Pfeifer, Cullik & Witte, 2010). In addition, the integrons live on conjugative plasmids and are consequently effortlessly transmitted from one strain to the other (Wang et al., 2015). Extended Spectrum Beta-Lactamase producing organisms have been accounted for as a worldwide rising public health issue. ESBL infections are mostly associated with seriously ill patients who have had a prior hospitalization or prolonged stays in health care facilities, especially intensive care units (Esteve-Palau et al., 2015). Likewise, the presence of indwelling medical devices such as catheters, invasive tubes or arterial lines increases the risk of ESBL infections (Garland, 2014; Chen et al., 2013). Other documented risks, many of which are 3 University of Ghana http://ugspace.ug.edu.gh related, include increased severity of illness, a severe underlying disease like malignancy and heart failure, administration of total parenteral nutrition, poor nutritional status, mechanical ventilatory assistance, hemodialysis and recent surgery (Quan et al., 2017; Nakai et al., 2016). The consequences have been several treatment failures and outbreaks of multidrug resistance which required expensive control efforts. Recent works have additionally highlighted faecal carriage as a noteworthy pool of ESBL-positive bacteria in the hospital (Davido et al., 2017; Stedt et al., 2015). Colonization of the intestinal tract with ESBL-positive isolates leads to infection. Therefore, a faecal carriage with ESBL-positive enterobacteria is of clinical importance (Davido et al., 2017; Stedt et al., 2015). 1.4 Problem statement Beta-lactams (e.g., cefotaxime) remains the most broadly utilized antibiotics in sub-Saharan Africa including Ghana. However, resistance to Beta-lactam antibiotics is progressively turning into a worldwide problem in the management of infections caused by members of the family Enterobacteriaceae particularly E. coli and K. pnuemoniae. The presence of ESBLs in E. coli and K. pneumoniae remain the chief resistance mechanism against the Beta-lactam antibiotics. ESBL-producing organisms may be endemic in Ghana. Indeed, it is the experience in Ghana that about 40% of the infecting E.coli and K. pneumoniae isolates in Korle-Bu Teaching Hospital (the nation’s largest tertiary care facility) are ESBL-producing (Obeng-Nkrumah et al., 2013). Similar prevalence rates have been reported elsewhere in Ghana. Infections with ESBL- producing Enterobacteriaceae increases the risk of antibiotic treatment failure, morbidity and mortality, length of hospital stay, and cost of hospitalization (Quan et al., 2017; Nakai et al., 2016). 4 University of Ghana http://ugspace.ug.edu.gh Prior intestinal colonization with ESBL-producing isolates has been identified as significant risk factor for ESBL infections (Davido et al., 2017; Stedt et al., 2015). Intestinal colonization with ESBL—producing Enterobacteriaceae are reportedly a frequent occurrence among patients admitted in the hospitals. Such colonized patients remain reservoirs ̶ serving as conduits for the dissemination ESBL-producing Enterobacteriaceae among patients and the hospital environments ̶ and as revolving doors for the spread of resistant pathogens between the community and hospital (Davido et al., 2017; Stedt et al., 2015). This phenomenon increases the hospital potential as a repository of multidrug resistant pathogens, with a consequential increase in hospital acquired infections and its associated economic burden to the patient, hospital and country (Quan et al., 2017; Nakai et al., 2016). Despite these menace, limited studies have reported on the intestinal carriage of ESBLs in Africa. In Ghana, there are no published article on infections and intestinal colonization with ESBL-producing isolates. Many efforts for reducing the ESBL menace are proposed in literature. One of such approaches involves reducing the effect of patient characteristics that may predispose them to intestinal colonization with ESBLs (Bar-Yoseph et al., 2016; Rieg et al., 2015; Kumar et al., 2014). An important factor that predisposes patients to ESBL intestinal colonization is the misuse and abuse of antibiotics. This is more pronounced in immunosuppressed patients where antibiotics are systematically used as prophylaxis to prevent infections. There is, however, a paucity of data to infer correlations between immunosuppression, immunocompetence, and ESBL intestinal colonization. The present study is part of a larger explorative study on immunocompetence and ESBL intestinal colonization. The larger project is a comparative study to examine ESBL intestinal colonization in immunosuppressed and immunocompetent patients in age and time matched patient cohorts. This present study was designed to report the occurrence of intestinal 5 University of Ghana http://ugspace.ug.edu.gh colonization with ESBL-producing Enterobacteriaceae among immunocompetent patients — with a particular focus on quantification of ESBL-producing isolates and on genotypes of ESBLs. Furthermore, risk factors for intestinal colonization with these resistant bacteria were analyzed. 1.5 Justification The primary objective of this study is to examine the occurrence of intestinal colonization with ESBL-producing enterobacteria in immunocompetent patients in a hospital setting and determine factors predictive of this phenomenon. This is important in understanding the possible mechanisms for dissemination of ESBL resistance and risk factors for colonization (Nakai et al., 2016; Reuland et al., 2016). Foremost such awareness can lead to successful infection control and proper patient management efforts which is especially crucial in the settings of developing countries where there is limited financial tolerance for longer hospital stays due to persistent illness (Bar-Yoseph et al., 2016; Kumar et al., 2014). Also, the study will add up to knowledge on the poorly defined diversity of ESBL genes in enterobacteria from Africa. In hospital care settings, ESBL faecal carriage status is also essential for instituting interventions and provision of guidance for research. In addition, such information provides baseline data to help in the implementation of active surveillance for multidrug-resistant bacteria. 6 University of Ghana http://ugspace.ug.edu.gh 1.6 Aim To determine the faecal carriage of extended-spectrum beta-lactamase producing enterobacteria in immunocompetent inpatients at a district care hospital setting in Ghana. 1.5 Specific Objectives The specific objectives of the study were: a) to determine the occurrence of ESBL-producing enterobacteria among study patients. b) to determine the specific type of ESBL gene sequences in enterobacteria from (a) above. c) to examine the faecal concentration of ESBL-producing enterobacteria among the study patients. d) to determine risk factors that predispose study patients to the faecal carriage with ESBL- producing enterobacteria. 7 University of Ghana http://ugspace.ug.edu.gh CHAPTER TWO LITERATURE REVIEW 2.1 EXTENDED SPECTRUM β-LACTAMASES (ESBLS) 2.1.1 Background The introduction of the first Beta-lactam antibiotic, Penicillin, helped greatly incurring infections caused by bacterial species. Prolong use of this antibiotic led to the production of a resistance mechanism, Penicillinase (Beta-lactamase) that hydrolyzed the beta-lactam antibiotic. The resistance mechanism was later found to spread to same or other bacterial species. through a mobile genetic material called Plasmid. The first plasmid-mediated Beta-lactamase (inhibited by clavulanic acid) was described and named TEM-1 in the early 1960s from a Greek patient named Temoniera within an Escherichia coli that showed resistance mainly to amino penicillin (Datta & Kontomichalou, 1965). Other types of plasmids encoded Beta-lactamases such as SHV-1 was found in Klebseilla pneumonia and later in other Enterobacteriaceae (Chaves et al., 2001). TEM-1 Beta-lactamase also spread to Klebsiella pneumonia and other Gram-negative bacterial (Kiratisin, Apisarnthanarak, Laesripa & Saifon, 2008). The rapid spread of TEM-1 and SHV-1 was as a result of their carriage in conjugative transposons and plasmids. TEM-1 producing K. pneumonia has progressively become endemic in many hospitals (Khosravi, Hoveizavi & Mehdinejad, 2013; Chang, Siu, Fung, Huang & Ho, 2001 ). Over the past years, overcoming the menace of beta-lactamases has led to the development of many new generations of Beta-lactam antibiotics with increased spectrum and more resistance to Beta-lactamases enzymes. Nevertheless, new mutants of Beta-lactamase emerge from a narrow spectrum to an extended-spectrum, hydrolyzing many types of Beta-lactam antibiotics including the third generation cephalosporins used to treat patients (Newire, Ahmed, House, Valiente & 8 University of Ghana http://ugspace.ug.edu.gh Pimentel, 2013). These enzymes spectrums of activity against the oxyimino-cephalosporins (extended-spectrum cephalosporins) termed Extended Spectrum Beta-lactamases (ESBLs). Since then, the prevalence of ESBL-producers has gradually increased in acute care hospitals (Bradford, 2001). ESBL, therefore, mediate resistance to extended-spectrum cephalosporins with an oxyimino side chain: cefotaxime, ceftriaxone, and ceftazidime and oxyimino-monobactam aztreonam. The rates of hydrolysis of these Beta-lactam antibiotics are greater than ten percent , evidently more than that of benzylpenicillin, Beta-lactam inhibitors including the clavulanic acid, tazobactam or sulbactam which essentially mediate activity against these enzymes but not cephamycin and carbapenems (Bush, 2013). 2.1.2 Characterization of Extended-Spectrum β-Lactamases (ESBLs) The Bush, Jacoby and Medeiros classification of 1995 which correlates molecular structures of Beta-lactamases based on nucleotides and amino acid sequences to their phenotypic functioning now remains the most up-to-date classification scheme for Beta-lactamases (Bush & Jacoby, 2010; Bush, Jacoby & Medeiros, 1995). There are four main groups (1-4) and multiple subgroups in this system. For the most part, Beta-lactamases of a specific group correlate with a particular molecular class in the Ambler’s classification system. Technically, ESBLs are Bush- Jacoby-Medeiros group 2be and 2d enzymes belonging to Ambler’s class A or class D Beta- lactamases with a serine active site which can hydrolyze oxyimino-Beta-lactam compounds at a rate that is equivalent to or higher than 10% that of benzylpenicillin yet are restrained by active site beta-lactamase inhibitors, for example, clavulanate, sulbactam and tazobactam (Bush, Jacoby & Medeiros, 1995). ESBLs have been grouped into major evolutionary families in view of judgments of their deduced amino acid sequences (Bush & Jacoby, 2010; Bush, Jacoby & Medeiros, 1995). 9 University of Ghana http://ugspace.ug.edu.gh Most ESBLs are derivatives of TEM and SHV Beta-lactamase families (Ghafourian et al., 2015). There are over 80 TEM ESBLs and are found mostly in Escherichia coli and Klebsiella pneumoniae (Brolund & Sandegren, 2016; Storberg, 2014). ESBL-producers were mostly nosocomial isolates of klebsiella, and sometimes Escherichia coli, which almost entirely harboured TEM or SHV ESBLs (Thenmozhi et al., 2014). But CTX-M enzymes are replacing TEM and SHV ESBLs as the transcendent ESBLs over Europe (D’Andrea et al., 2013). The CTX-M ESBLs have additionally turned into the most common type of ESBLs described amid the previous 5 years from Canada and South American nations (Brolund & Sandegren, 2016; Storberg, 2014; D’Andrea et al., 2013; Livermore et al., 2007) . Among the CTX-M ESBLs, 11.7% were from South Africa and this denoted the primary report of CTX-M enzymes in the country (Govinden et al., 2006). In another study from Tanzania by Blomberg and others (Tansarli et al., 2014), CTX-M ESBLs were the most predominant ESBL type in Escherichia coli strains. Elsewhere in Southwest Nigeria, ESBLs were categorized from 30 selected multidrug-resistant Klebsiella pneumonia strains isolated from patients. All the isolates produced at least one type of ESBL, with 57% producing CTX-M enzymes (Storberg, 2014; Tansarli et al., 2014). 2.1.2.1 Functional and molecular grouping Characterization of the ESBLs will require the need for a short review of Beta-lactamase classification. The classification of Beta-lactamase was based on their hydrolytic spectrum, susceptibility to inhibitors, and whether they were encoded for by the chromosome or plasmids. This first scheme classification was informed by irregularities established during the subsequent fifteen (15) year period from which evolved two distinct approaches were evolved. This included the Ambler molecular classification scheme and the Bush-Jacoby-Medeiros functional 10 University of Ghana http://ugspace.ug.edu.gh classification system. A major restructuring as recommended by Bush in 1989 with more updates in 1995. has been the basis for Ambler’s scheme ,this scheme, however, lacks differentiation between ESBLs and their progenitors, including details in enzymatic activities (Bush, Jacoby & Medeiros, 1995). This classification system corresponds to the Ambler scheme which was the first classification system used. Ambler and colleagues in 1991 identified four molecular classes A to D beta-lactamases according to amino acid sequences. Class A, C, D are serine Beta- lactamases revealed to have structural similarity whereas Class B are all metalloenzymes with zinc active sites (Bush & Jacoby, 2010). The Bush, Jacoby and Medeiros classification of 1995 which associates molecular structures of Beta-lactamases based on nucleotides and amino acid sequences to their phenotypic functioning now remains the most contemporary classification scheme for Beta-lactamases. There are four main groups (1-4) and multiple subgroups in this scheme. Essentially, Beta-lactamases of a specific group correlate with a particular molecular class in the Ambler’s classification system. Technically, ESBLs are Bush-Jacoby-Medeiros group 2be and 2d enzymes belonging to Ambler’s class A or class D Beta-lactamases with a serine active site which is able to hydrolyze oxyimino-Beta-lactam compounds at a frequency explicitly equivalent to or greater than 10% that of benzylpenicillin but remain inhibited via active site Beta-lactamase inhibitors such as clavulanate, sulbactam and tazobactam (Pitout & Laupland, 2008; Bush et al., 1995). 2.1.2.2 Diversity of ESBLs types The pace of growth of ESBL from parent Beta-lactamases in addition to pre-existing ESBL presently known are more than 200 natural ESBL variants. Generally, they are put together into major and minor ESBL types. Major ESBLs exist frequently and are expressed and detected in many clinical isolates in any parts of the world while the minor types are sometimes challenged 11 University of Ghana http://ugspace.ug.edu.gh (Naas, Poirel & Nordmann, 2008). Diversity results after alteration of their narrow spectrum complement. Many of these novel ESBLs which remain typically plasmid-encoded rise naturally from occurring enzymes that are intrinsically broad spectrum (Poole, 2004). The major types which are the typical ESBLs developed from class A TEM (TEM-1or TEM-2) and SHV (SHV- 1) enzymes, together with class D ESBLs (OXA family) which have been acknowledged severally. Yet, other non-TEM, non-SHV ,non-OXA ESBLs such as BES, GES, PER, TLA, VEB and CTX-M have been reported worldwide with the most prevalent being CTX-M-type ESBLs (Stürenburg & Mack, 2003; Rupp & Fey, 2003). 2.1.2.2.1 TEM –type ESBLS (Class A) TEM-type products of ESBL were first reported in 1965 from Athens, Greece of a plasmid- encoded Beta-lactamase in Gram-negative bacilli (Datta & Kontomichalou, 1965). TEM-1 was a non-ESBL resistance to Penicillin and first-generation cephalosporin but not oxyimino- cephalosporin or monobactams (Stürenburg & Mack, 2003). Single amino acid substitution at position 39 of TEM-1 led to the development of TEM-2. TEM-2 hydrolytic properties remained related to that of the TEM-1 enzyme (Barthélémy, Peduzzi & Labia, 1985). TEM -3 was discovered in a strain of K. pneumoniae with transferable resistance to higher cephalosporin. Its hydrolytic activity was against cefotaxime and hence the first TEM-type beta-lactamase that showed ESBL phenotypic characteristics. It had the ability to hydrolyze extended-spectrum cephalosporin due to two amino acid substitutions: Lys104Glu and Ser238Gly differing from an amino acid sequence of TEM-2 (Paterson & Bonomo, 2005). Generally, the blaTEM gene is a 286 amino acid peptide of 23 principal amino acid after the signal sequence on the N-terminal cleaved to form the complete enzyme. Amino acid substitution positions 104 (glutamate to lysine), 238 (glycerin to serine) or 240: (glutamate to lysine) are the 12 University of Ghana http://ugspace.ug.edu.gh results of ESBL phenotype among TEM enzymes (figure 2.1.2.2.1). TEM types of ESBL are most often found in Escherichia coli and Klebsiella pneumonia but are also described in other Gram-negative bacteria. TEM-1 are reportedly the most prevalence in this group (Perez, Endimiani, Hujer & Bonomo, 2007; Stapleton, Shannon & French, 1999). 2.1.2.2.2 SHV Type ESBL SHV Beta-lactamases are a plasmid-mediated group that were known to comprise at least twenty-three variants besides SHV-1. Most SHV retains extended-spectrum activity against the newer broad-spectrum cephalosporins (Tzouvelekis & Bonomo, 1999). The most prominent description of plasmid-mediated Beta-lactamases in Klebsiella species recounted was named SHV-1 (sulfhydryl variable). The comprehensive sequence of SHV-1 amino acid has been discovered to have 68% amino acid homology with TEM-1enzyme (Bois, Marriott & Amyes, 1995). It is reported that SHV type Beta-lactamase has their likely antecedent in chromosomal penicillinase in K. pneumonia (Tzouvelekis & Bonomo, 1999). The SHV-2 enzyme was found to vary from SHV-1 by substitution of glycine with serine at position 238. This is as a consequence in development of affinity of SHV-1 Beta-lactamase to oxyimino-cephalosporin (Barthélémy, Péduzzi, Ben Yaghlane & Labia, 1988). At position 234, Serine residue is efficiently hydrolyzed by ceftazidime and lysine residue at position 240 by cefotaxime (Bonnet, 2004). Currently, SHV- type of more than 40 has been described where charges in amino acid sequence confer the ability to hydrolyze new cephalosporin. Globally SVH-2, SHV-2a SHV-5 SHV-12 are the common SHV type ESBLs (Liakopoulos, Mevius & Ceccarelli, 2016). 2.1.2.2.3 Others Over the years, the upsurge of non-TEM and non-SHV descent has developed in ESBLs (Paterson & Bonomo, 2005). Noticeable among these are the CTX-M (cefotaximase), OXA 13 University of Ghana http://ugspace.ug.edu.gh (oxacillinases), PER (pseudomonas extended resistance), VEB (Vietnamese extended Beta- lactamases) and BES (Brazilian extended Beta-lactamases). Researchers have identified 7 types of PER ESBL with the first reported in 1991 from a patient in turkey. It was shown to be resistant to ceftazidime and aztreonam but susceptible to carbapenems (Vahaboglu et al., 2001; Danel, Hall, Gur, Akalin & Livermore, 1995) and associated with infections caused by Salmonella species, Acinetobacter species and Proteus vulgaris transmissible in a large plasmid (154 kb in size) or in chromosome depending on the different bacterial strains. VEB-1 first originated in E. coli isolate from Vietnam (Poirel et al., 1999) while GES from K. pneumoniae isolates obtained in France in 1998 (Poirel et al., 2000). GES has in a way been detected in other enterobacteria such as Pseudomonas aeruginosa (Poirel et al., 2000). 2.2 GROWING CHALLENGE OF CTX-M TYPE ESBL In Germany, the first CTX-M was observed within an E. coli clinical isolate (Bauernfeind, Schweighart & Grimm, 1990). Subsequently in 2000, dramatic changes arose in the prevalence and types of ESBLs worldwide. CTX-M enzymes have been known to encode genes that often harbor insertion sequence ISEcpI which enable them to easily transfer and move to other genetic locations. It is also transmissible by conjugation with high transfer frequencies of 107 to 102 per donor cell (D’Andrea et al., 2013). These properties make CTX-M not only limited to nosocomial infections but also have the potential to spread beyond the hospital environment heightening public health concerns. Previously, ESBL -producers were ordinarily nosocomial isolates of Klebseillae, and occasionally E. coli, which nearly completely sheltered TEM and SHV ESBLs (Pitout & Laupland, 2008). Nonetheless, CTX-M enzymes are substituting TEM and SHV ESBLs as the 14 University of Ghana http://ugspace.ug.edu.gh major ESBLs across Europe (Blanco et al., 2009; Livermore et al., 2007; Hernandez et al., 2005). CTX-M ESBLs had been the most prevalent type of ESBLs described from Canada and South American countries (Livermore et al., 2007; Cantón & Coque, 2006) . However, presently, CTX-M enzymes are recognized to be the predominant ESBL worldwide and also including Africa.Over 150 more CTX-M genes have been identified (www.lahey.org/studies), and classified into five families according to amino acid sequence: CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9, and CTX-M-25; recently two groups:CTX-M-74 and CTX-M-75 have been added (Bonnet et al., 2003; Karim, Poirel, Nagarajan & Nordmann, 2001). In addition, Escherichia coli have promptly joined Klebseillae as major hosts for CTX-M and this development is worrying. Research by Pagani et al., (2003) indicated that diverse types of CTX-M enzymes could be found in a single hospital. The impact of CTX-M producing enterobacteria causing infections is indicated through colonization of gastrointestinal tract (Ben- Ami et al., 2006). Patients colonized (carriers) become the route of CTX-M producers in health- care settings besides other merit vehicles aimed at dissemination to the community (Cantón & Coque, 2006) and worldwide dissemination through international travellers (Lübbert et al., 2015). 2.3 PREVALENCE AND RISK FACTORS FOR CARRIAGE OF ESBL- PRODUCING ENTEROBACTERIACEAE. ESBL over the past years has increased rapidly with Enterobacteriaceae due to the fact that their ESBL genes are carried on plasmids enabling dissemination across species barriers (Ozgumus, Tosun, Aydin & Kilic, 2008). Faecal carriage of ESBL-producing Enterobacteriaceae amongst asymptomatic individuals is increasing in the hospital as well as in outside the hospital (Ben-Ami et al., 2006). The gastrointestinal tract is the primary ecological niche for Enterobacteriaceae. 15 University of Ghana http://ugspace.ug.edu.gh Herein, inter-and intra-species exchange of resistance can happen and upon suitable selective pressure, resistant species can emerge and dominate (Carlet, 2012). Although faecal carriage of antibiotic-resistant bacteria is not an instantaneous menace to the immunocompetent individual, it poses two threats: treatment becomes considerably difficult to treat when auto-infection of a sterile body site occurs and resistant organism may be transmitted to other individuals (Donskey, 2004). Colonization with ESBL producing isolates remains a possible origin of cross-transmission and privilege for infection. Thus colonizing bacteria may serve as a source for later infection, and consequently will affect the choices of empirical antimicrobial treatment. This was clear in a research conducted by Ben-Ami et al., (2016) which proved that 4 of the patients with ESBL- producing Enterobacteriaceae colonization (15.4%) developed subsequent ESBL infection. Another study reported, 35 (8.5%) of the patients colonized developed ESBL infection (Reddy et al., 2007). Friedmann et al., (2009) had reported the frequency of 8% faecal carriage of ESBL- producing Enterobacteriaceae at admission. Notable studies have been documented on the increase in intestinal rates with ESBL-producing E. coli and K. pnemoniae in various countries (Girlich, Bouihat, Poirel, Benouda & Nordmann, 2014; Schaumburg et al., 2013). A fecal carriage surveillance studies in Europe indicated that the rate of inpatients colonized by ESBL producers has been addressed by few national studies, yet the few including a Spanish analysis demonstrated that frequency of fecal carriers had increased from 1% to 12% among hospitalized patients between 1991 and 2003 with continuous increase since 2000 in invasive E coli and K. pneumoniae isolates resistance to cephalosporins (Coque, Baquero & Canton, 2008). In Korea, the prevalence was 12% in E. coli and 20% to 30% for K. pneumonia (Ko et al., 2008) and 45% faecal carriage in hospitalized high-risk patients (Ko, Moon, Hur & Cho, 2012). In the 16 University of Ghana http://ugspace.ug.edu.gh time period between 2011 to 2013, a study conducted showed hospitalized patients faecal carriage with E. coli and K. pneumoniae rate was 62.7% (Babu et al., 2016). Certain parts of the world are classified as high-risk areas, and travel to these areas becomes one major risk factor for acquisition of asymptomatic faecal carriage of ESBL-producing Enterobacteriaceae. These areas include Indian subcontinent, Middle East, Asia and North Africa (Östholm-Balkhed et al., 2013; Tärnberg et al., 2011; Peirano & Pitout, 2010; Tängdén, Cars, Melhus & Löwdin, 2010 ). High acquisition with travellers is largely linked to the international spread of E. coli clone ST131, a carriage which mostly occurs through ingesting of contaminated food and water (Peirano and Pitout, 2010). Östholm-Balkhedet al., (2013) confirmed one common risk factor for acquisition of ESBL among faecal flora was travel to an international country. The geographical area visited had the greatest impact although there were other factors that significantly affect the risk of ESBL-producing Enterobacteriaceae colonization. Healthcare contact and antimicrobial exposure including the cephalosporins and fluoroquinolones have the identification of risk factors for endemic regions for asymptomatic carriage (Wener et al., 2010). Within hospitals, the spread has been facilitated by carriers with diarrhea, gastroenteritis, urinary catheter and other type of catheters (Spadafino, Cohen, Liu & Larson, 2014; Tängdén et al., 2010). ESBL–producing Enterobacteriaceae frequency of nosocomial acquisition is increased with extended duration of hospitalization, doubling to 17% by day 4 or 5 after admission, gradually increasing up to 33 after 10 day or more days of hospitalization (Friedmann et al., 2009). New patients admission to a gastric unit risked factors determined for ESBL- Enterobacteriaceae colonization were multiple contacts with hospital within the previous year, chronic catheter use, and high-level dependency. Risk factors such as recent antibiotic treatment, 17 University of Ghana http://ugspace.ug.edu.gh multiple hospitalization, old age, crowding of hospital patients in the hospital and broad- spectrum antibiotic were mentioned by other studies for fecal carriage (Isendahl et al., 2012; Friedmann et al., 2009 ). Additionally, the use of vancomycin and piperacillin-tazobactam has been described as being related to ESBL colonization, by the initial decolonization of the normal flora and subsequent colonization with ESBL strains (Rieg et al., 2015). 2.4 DETECTION OF ESBL CARRIAGE The emergence of ESBLs has enabled the development of numerous detection strategies found all over the world. The detection of ESBLs could be a major challenge for microbiologists owing to the upsurge of phenotypic differences among strains. Clinical laboratory standard Institute (CLSI) has accordingly, developed screening methods for ESBL-producers including disk diffusion and dilution antimicrobial susceptibility tests (Wayne & Pa, 2007). Comparable results with reported sensitivities of over 94% and specificities over 98% are produced by both methods. Other methods, some of which are commercially available methods of ESBL detection include Vitek ESBL test, E tests, Minimum Inhibitory Concentration (MIC), genetic methods, and Isoelectric focusing (Pitout et al., 1998). 2.4.1 Disk diffusion methods The CLSI guidelines published in January 2010 (M100-S20) by The Clinical and Laboratory Standards Institute, (2016) involve semi-confluent to confluent growth of Enterobacteria isolates on Mueller-Hinton agar. It mentions a primary screening of Escherichia coli, Klebseilla species and Proteus species for ESBL production with zone inhibition diameters of < 22 mm for ceftazidime (30 µg), < 27 mm for cefotaxime (30µg). CLSI also created allowance for use of 10µg cefpodoxime disk in ESBL screening using zone diameters of ≤ 22 mm for Proteus 18 University of Ghana http://ugspace.ug.edu.gh mirabilis and ≤ 17 mm for Escherichia coli, Klebsiella oxytoca and Proteus mirabilis. Concurrent use of all reagents increases the chances of ESBL detection. 2.4.2 Broth –dilution method The CLSI procedures (M100-S20, 2016) include dilution methods for screening of ESBL- production in Klebsiella, Escherichia coli and Proteus species. A ceftazidime, aztreonam, cefotaxime, or ceftriaxone minimum inhibitory concentration (MIC) of ≥ 2 ug/ml is indicative of ESBL expression. Cefpodoxime MIC remains at ≥ 8ug/ml. Standardization have also been made for Proteus mirabilis, which is selected for confirmation at MIC of ≥ 2 ug/ml. 2.4.3 Confirmatory tests for ESBL-producing Enterobacteriaceae Clinical Laboratory Standard Institute (2016) recommend a combined disk method and an MIC method for ESBL confirmation. This confirmatory test now rest on demonstrating synergy between cefotaxime, ceftazidime or cefpodoxime with or without clavulanic acid. 2.4.3.1 Combined Disk synergy test Clinical Laboratory Standard Institute protocols employ susceptibility to cefotaxime (30 µg) and cefotaxime (30 µg)/clavulanic acid (10 µg), ceftazidime (30 µg) and ceftazidime (30 µg)/clavulanic acid (10 µg). A zone increase of 5mm or more, in the presence of clavulanic acid for any antibiotic disks indicates ESBL production 2.4.3.2 Broth dilution test Extended Spectrum Beta-Lactamase confirmation is equally applicable on standard broth dilution methods. ESBL production outcomes are an equal or greater than threefold serial dilution decrease in MICs in the presence of clavulanic acid. This standardization is maintained by use of ceftazidime (0.25 to 128 µg/ml), ceftazidime plus clavulanic acid (0.25/4 to 128/4 19 University of Ghana http://ugspace.ug.edu.gh µg/ml), cefotaxime (0.25 to 64 µg/ml), and cefotaxime plus clavulanic acid (0.25/4 to 64/4µg/ml). This method, conversely, is arduous particularly for routine examinations. 2.4.4 Other detection methods Moreover, other detections methods are broadly categorized into two groups: phenotypic methods and genotypic methods have been considered and recommended by several workers aside CLSI. The phenotypic methods detect the expression of ESBL enzymes in vitro, and the genotypic methods use molecular techniques to detect the presence of ESBL genes. 2.4.4.1 Phenotypic methods Fundamentally the Kirby-Bauer disk diffusion test methodology has been the backbone behind the phenotypic methods of which the principle is employ that ESBLs hydrolyze third-generation cephalosporins, but are inhibited by Beta-lactamase inhibitors mainly clavulanic acid. 2.4.4.2 Double disk approximation test First routine ESBL detection method was described in 1987 by Brun-Buisson and colleague. Synergy between 30 µg antibiotic disks of ceftazidime, ceftriaxone, cefotaxime and cefpodoxime placed 30 mm (center to center) from an amoxicillin/clavulanic acid (20 µg/10 µg) was suggestion of ESBL production by this method. For the reason that this method is affected by low ESBL activities which widen inhibition zones, some studies have altered the standard approximation distance to 35 mm for optimum results (Ho, Tsang, Que, Ho & Yuen, 2000; Thomson & Sanders, 1992 ). In addition, heavy inocula also incline to mask the ESBL synergy. The interpretation of the test hence has been reasonably subjective. Yet, numerous workers have examined this procedure and indicate that, sensitivities and specificities may range from 79 % to 97 % and 94% to 100 % respectively (Mackenzie, Miller & Gould, 2002; Cormican, Marshall & Jones, 1996). A most important advantage of this test is in the fact that the procedure is 20 University of Ghana http://ugspace.ug.edu.gh technically simple and remains a convenient method for screening of ESBLs in the laboratory (Ho et al., 2000) 2.4.4.3 Disk replacement method In 1998, Schooneveldt and colleagues described a modified disk replacement technique for detecting ESBL-producing isolates. The method includes the replacement of three 6mm sterile paper disks inoculated with 20 µl of clavulanic acid (200 µg/ml) at the same spots, after an hour, with ceftazidime, cefotaxime and aztreonam disks on media inoculated with a test organism. Control disks of the antibiotics are instantaneously placed at least 30 mm from these locations. Definition of a positive testis by a zone increase of over 5 mm for the replacement disks compared to the controls. It has been determined that while the sensitivity of this test is similar to that of the double-disk approximation method, the need for a second step render it unfitting for routine laboratory work (Schooneveldt, Nimmo & Giffard, 1998). 2.4.4.4 Three –dimensional method This method describes that a fully susceptible strain, such as Escherichia coli ATCC 25922 is inoculated onto a Mueller-Hinton agar plate, after which a slit is cut into the media and filled with a heavy inoculum (10^9cfu/mi)of the test organism. Extended-spectrum cephalosporin disks are consequently placed on the surface of the plate 3mm from the slit. A discontinuity in the circular inhibition zone or the production of discrete colonies in the vicinity of the inoculated slit is considered positive. Although this test is not specific for ESBLs, it is more sensitive in detecting ESBLs than the double-disk diffusion test (Thomson and Sanders, 1992). This method is however, technically challenging and labor intensive (Vercauteren, Descheemaeker, Ieven, Sanders & Goossens, 1997). 21 University of Ghana http://ugspace.ug.edu.gh 2.4.5 ESBL commercial detection methods Besides the above-mentioned tests some formulations available for ESBL, AmpC and carbapenemase detection have been developed and advertised by commercial institutions. Widely held between the commercially available detection methods are the E-test methods, and other automated detection methods. 2.4.5.1 E-test method The E-test disk, produced by AB Biodisk in Sweden, is a two-sided plastic strip in which a fixed concentration of clavulanic acid (4 ug/ml) is added to one side of an oxyimino-Beta-lactam MIC gradient. Therefore, ESBL, Amp C and carbapenemase production are indicated by a greater than 8 fold reduction in the MIC of the cephalosporin with clavulanic acid (Cormican et al., 1996). Some workers analyzed this method and have made several important observations (Cormican et al., 1996). They noted that the E-test remains the easiest method for ESBL detection and suitable for routine laboratory work. The reported sensitivities and specificities range from 87 % to 100 % and 95 % to 100 % respectively. A few limitations, nevertheless, were also observed: results are indefinite for weak enzymes, subtle zone deformations are difficult to identify and interpret-test strips are also expensive for routine laboratory detection of ESBL, AmpC and carbapenemase (Perez et al., 2007). 2.4.5.2 Automated ESBL detection method These are antimicrobial susceptibility test systems automated to perform analyses and interpretations for ESBL phenotypes. They include the Vitek test, produced by Bio Merieux Vitek, (Missouri, United States) which utilizes cephalosporins and cephalosporin-inhibitor combinations in wells on a card to detect ESBLs within 4 to 15 hours (Livermore et al., 2002). MicroScan panels from Dade Behring MicroScan (Sacramento, California, USA) which uses 22 University of Ghana http://ugspace.ug.edu.gh dehydrates serial dilutions of cephalosporins and clavulanate combinations in panels and BD Automated Microbiology System from Becton Dickinson Biosciences (Sparks, MO-Maryland, USA) which uses a short incubation system of 6hours to measure growth responses to cephalosporins, with or without clavulanate (Stürenburg, Lang, Horstkotte, Laufs & Mack, 2004). In 2007, Weigand and others matched performance levels of the automated systems and reported that the system with the highest sensitivity was Phoenix (99 %), and then Vitek2 (86 %) and MicroScan (84 %). Specificities were much lower ranging from 52 % (Phoenix) to 78 % (Vitek 2) (Wiegand, Geiss, Mack, Stürenburg & Seifert, 2007). In an earlier study, Sturenburg et al., 2004 compared the abilities of Vitek 2 system and the Phoenix system to correctly detect ESBLs. Whereas the Phoenix system showed 100% detection rate, the Vitek system misidentified 5% of the ESBL producing isolates due to low susceptibilities to either cefotaxime or ceftazidime but not both. These results are comparable to conclusions made by Leverstein-van Hall et al., (2002). World Health Organization compared the various automated ESBL tests and documented that the automated systems are capable of detecting the ESBL production with almost the same efficiency as the conventional techniques. The automated systems, however, can be complex and misleading given the underlying software algorithms (Wiegand et al., 2007). They also are expensive for routine laboratory work. 2.4.6 Molecular techniques for ESBL detection Gradually, molecular methods for ESBL detection are gaining recognition. The most common genotypic method has been the Polymerase Chain Reaction (PCR) amplification with oligonucleotides primers to determine genes of specific Beta-lactamases and derivatives of TEM, SHV, OXA and other ESBLs. Thus PCR and subsequent sequencing have become the widely accepted method of choice (Fluit, Visser & Schmitz, 2001; Bradford, 1999). 23 University of Ghana http://ugspace.ug.edu.gh The advantage of sequencing is to distinguish between the non-ESBL parent enzymes and different variants of ESBLs. Despite the variable results obtained due to difficulties in reading some sequencing autoradiographs, leading to the introduction of errors in establishing true differences amongst many sequences especially SHV genes, nucleotide sequencing remains the gold standard for the detection of specific ESBL genes present in a strain (Bradford, 1999). For this reason, research and reference laboratories have employed molecular techniques to detect the presence of ESBL genes and their specific subtypes in bacteria isolates. 24 University of Ghana http://ugspace.ug.edu.gh CHAPTER THREE METHODS 3.1 Study Area This study was conducted among patients recruited from the Achimota District Hospital (ADH) in the Greater-Accra region of Ghana. Achimota is an urban community with a pediatric and adult population of over 200,000 in the Accra Metropolitan Area (Asante et al., 2015). The ADH is approximately a 100-bed capacity primary care government hospital with no intensive care units (Esena & Addo, 2014). The hospital caters for medical and trauma emergencies. There are 7 wards including maternity (15 beds), pre- and post-natal (14 beds), geriatric female (14 beds), children ward (20 beds), male ward (15 beds), and the gastrointestinal ward (15 beds). The hospital has a central laboratory that provides some microbiological services but does not perform procedures in bacteriology. 3.2 Study Design The study was a cross-sectional survey to document the occurrence of intestinal carriage with ESBL-producing enterobacteria. Questionnaire-based interviews were also conducted at the time of sampling to document factors that may predispose patients to intestinal colonization with ESBL-producing study isolates. 3.3 Participants The study population comprised immunocompetent in-patients on admission at the ADH. Criteria for immunocompetence was as defined by (Salisbury & Ramsay, 2013) (Appendix 1). Exclusion criteria. Hospitalized patients living with human immunodeficiency virus (HIV) but immunocompetent were excluded from the study. The HIV patients constitute the study subjects 25 University of Ghana http://ugspace.ug.edu.gh in a related ongoing study. Also excluded from the study were patients who provided consent but were unavailable to fill questionnaires or provide stool specimens for laboratory work. Study isolates. The identification of faecal enterobacteria isolates positive for ESBLs constitutes the primary study outcome. 3.4 Minimum sample size The sample size was determined using the statistical formula as defined by (Charan & Biswas, 2013); N=Z2 (P) (1-P) (ERROR) 2 Where Z, 1.96 is the standard score for the confidence interval of 95%; P, is the sample proportion prevalence of faecal carriage with ESBL-producing isolates. Given that there is no published data on the estimate of P in the Ghanaian population, a value of 50% (0.5) will be used. Using a 9% allowable ERROR, Our minimum sample size, N=1.972 (0.5) (1-0.5) (10/100)2 = 98 patients Granting critical factors of time and funding, 107 immunocompetent patients were recruited and examined for intestinal carriage of ESBL-producing E. coli and K. pneumoniae. 3.5 Procedure for data collection Data collection were conducted in 3 phases: a) Phase 1-collection, questionnaire interviews and faecal cultures 26 University of Ghana http://ugspace.ug.edu.gh b) Phase 2-phenotypic determination of ESBLs c) Phase 3-molecular characterizations 3.5.1 Phase-1- Collection, questionnaire interviews and faecal cultures This phase included patient selection, questionnaire-administered interviews, as well as a collection of faecal samples for laboratory investigations. Selection of patients: Prior to commencement of the study, appropriate permissions were sought from the hospital authorities. On the day 1 of the survey, all patients hospitalized for ≥ 2 days at the ADH were considered potential study participants. Randomly, the hospitalized patients were introduced to the study. They were provided with copies of the study information. On day 2, the patients previously contacted were requested to join the study. Those who obliged to participate were asked to provide an informed consent (Appendix 2). Their folders were examined with the help of an attending physician to identify those who were immunocompetent (based on the definitions by (Salisbury & Ramsay, 2013) and were without HIV. Only patients who satisfied these criteria were enrolled in the study. Questionnaire-administered interviews: For all patients entered into the study, data of relevant importance were registered into a standardized questionnaire (Appendix 3). The questionnaire was designed based on ESBL faecal carriage risk factors reported in the literature. These included patients demographic information (age, gender, employment status, educational level), duration of hospital stay until survey day, the source of current hospitalization (home or hospital), and a number of patients in the ward. Some patient lifestyle characteristics were also recorded: use of hand sanitizer at least once in the past 3 months, travel outside Ghana in past 1 year, travel outside a home in past 1 year, pipe water in the household, toilet facility in the household, and animal contact in past three months. Data on patient hospitalization history were 27 University of Ghana http://ugspace.ug.edu.gh also collected. These included hospitalization in past 1 year, use of medication that affects intestinal flora, use of antibiotics in past 6 months and bacterial infection since admission. Where necessary, attending physicians were consulted to help clarify patient’s hospitalization history. Faecal culture: Hundred and seven (n = 107) study participants submitted faecal specimens for laboratory investigations. The samples were transported on the ice at 0 oC to the microbiology laboratory of the Department of Medical Laboratory Sciences, University of Ghana. At the laboratory, 1 g of each faecal specimen was vortexed in 10 ml of 0.9 % sterile saline. Ten-fold serial dilutions of each suspension were prepared at 10-1 to 10-4. The serial dilutions were cultured onto Statens Serum Institut (SSI) enteric media (SSI Diagnostica, Denmark) by mixing 1ml of each dilution with 24 ml of molten SSI agar (at 52 oC) and incubating aerobically at 35-37 oC for 18-24 hours. The SSI enteric medium combines selective properties with growth differentiation for direct isolation and rapid diagnosis of members of the family Enterobacteriaceae. The faecal concentration of enterobacteria isolates: Quantification was performed by counting growing colonies per enterobacteria morphotype and estimating the number of colony forming units per gram of faecal sample (CFU/g). Estimation of the number of enterobacteria harboured by each faecal specimen (CFU/g) number of colonies per morphotype x 101 (for first faecal dilution) x 10 (dilution factor). Each enterobacteria morphotype was sub cultured onto SSI agar for purity. 3.5.2 Phase-2- Phenotypic determination of ESBLs Each pure culture of an enterobacteria morphotype was subjected to phenotypic ESBL screening and confirmation detection test. 28 University of Ghana http://ugspace.ug.edu.gh Screening test for ESBLs: Each enterobacteria morphotype was examined for the presumptive presence of ESBLs using resistance to 3rd generation cephalosporins. The ESBL screening was performed by the agar disc diffusion method of sensitivity testing using cefpodoxime (10ug), cefotaxime (30 ug) and ceftazidime (30 ug) antibiotic discs (RoscoDiagnostica, Tastrup, Denmark). Susceptibility testing was performed according to the Clinical and Laboratory Standard Institute guidelines. Briefly, two to five colonies of each morphotype were vortexed in about 3ml of 0.9% sterile saline. The test inoculum was incubated at room temperature for 15 minutes and the density compared to 0.5 McFarland standard [107-8Colony forming units (CFU/ml)]. Where necessary, the density of the incubated inoculum was adjusted with sterile 0.9% saline until it equalled that of 0.5 McFarland standard. About 5 µm (loopful) of the inoculum was dispensed to 25 mL of cation balanced Mueller-Hinton agar Mueller Hinton agar (bioMerieux, France) in 90 mm circular plate. The inoculum on the agar was then swabbed in three directions with a cotton-tipped applicator (Oxoid, United Kingdom) to obtain a semi- confluent to confluent growth on the entire agar surface. The moisture was allowed to be absorbed for 15 minutes. Antibiotic disks were then applied firmly to the surface of the agar plate and incubated at 35-37 oC for 18 to 24 hours aerobically. After incubation, inhibition zone diameters of the various antibiotics were measured and interpreted by CLSI 2016 guidelines. Enterobacteria with zone inhibition diameters of ≤ 24 mm for cefpodoxime, ≤ 27 mm for ceftazidime and ≤ 29 mm for cefotaxime were reported as cephalosporin resistant and positive for ESBL screening. Confirmation of ESBL production: All cephalosporin enterobacteria were confirmed for the presence of ESBLs using the Kirby-Bauer’s method of sensitivity testing according to protocols by the Clinical and Laboratory Standards Institute (CLSI, 2016). ESBL confirmation was done 29 University of Ghana http://ugspace.ug.edu.gh by the combined disk synergy assay. This test was performed using ceftazidime antibiotic discs (30 µg) and cefotaxime antibiotic disks (30 µg) with and without clavulanate (10 µg) on cation balanced Mueller-Hinton Agar. The CLSI (2016) interpretative guideline was used to confirm isolates as ESBL-producers. According to the CLSI (2016) reference, the study isolates that demonstrated clavulanic acid effect defined by an increase in zone diameter greater than 5mm for at least one test antibiotic were considered ESBL-producers. Klebsiella. pneumoniae ATCC 700603 was used as positive control for ESBL production. Escherichia coli ATCC 25922 was used as a negative control. Identification of bacteria isolates: Enterobacteria isolates determined to ESBL-producing were identified to the species level. Those found to be non-ESBL-producing were identified to the genus level. Representative colonies of each isolate were inoculated into the following biochemical media: peptone broths (Sigma, UK), citrate slants (Sigma, UK), urea agar slants (Sigma, UK), Triple–Sugar-Iron agar slants (Sigma, UK) and motility test semi-solid agar. The inoculated media were incubated aerobically for 18 to 24 hours at 35-37. Following, the media were observed for reactions evident of members of the family Enterobacteriaceae. Two to 3 drops of Kovac’s reagent (Oxoid, UK) were added to peptone broth cultures to ascertain indole reaction. The biochemical reactions were compared to that of reference strains for presumptive genus identification. Definitive identifications of isolates to the species level were confirmed with the MINIBACT-E ® (SSI Diagnostica, Denmark) according to manufacturer’s guidelines, and results read after 5 hours. Only enterobacteria isolates that were ESBL-producing were included in subsequent work. 3.5.3 Phase 3- Molecular characterization This section involved characterizing cephalosporin resistant E. coli and K. pneumonia (with 30 University of Ghana http://ugspace.ug.edu.gh either ESBL-positive or negative phenotype) by PCR to confirm the presence of gene families encoding these ESBLs. The isolates were subjected to whole DNA extraction. Bacterial DNA template for PCR assays was obtained by the boiling suspension method. This involved suspending two to three colonies of each test isolate in 1 mL for an overnight culture and heating at 90 oC for 10 minutes using a water bath incubator. The Samples were spun at 12000 rpm for 10 minutes and the resulting supernatant extracted for PCR. Gene amplification: For detection of ESBL genes, SHV, TEM, OXA-2, OXA-10, and the CTX- M group 1, 2, and 9 primers were used (See table 3.1 for primer sequences). The PCR mix for ESBLs included 2 µL of template DNA, 12.5 µL of 2x Multiplex Mastermix (Inqaba, South Africa), 2.5 µL of 10x reverse and forward primer, and 7.5 µL of DNAse/RNase free water (Inqaba, South Africa, South Africa). Previously characterized strains positive for the specific ESBL genes were used as positive controls. Escherichia coli ATCC 25922 was used as negative control. All PCR protocols included an initial denaturation of 94 °C for 15 minutes and a final extension at 72 °C for 10 minutes. The TEM PCR was performed at 94 oC for 15 minutes, 94 oC for 30 seconds for 30 cycles, 63 oC for 90 seconds, 72 oC for 60 seconds, and a final extension at 72 oC for 10 minutes, with a final hold at 6 oC. Multiplex PCR assay was performed for CTX-M- 1 and CTX-M-2 genes at 94 oC for 15 minutes and then for 27 cycles of 94 oC for 30 seconds, 50 oC for 90 seconds, 72 oC for 60 seconds, and a final extension at 72 oC for 10 minutes, with a final hold at 6 oC in a thermal cycler. Isolates negative for CTX-M-1 and -2 genes examined for CTX-M-9 genes. For CTX-M-9, PCR was conducted at 94 oC for 15 minutes and then for 27 cycles of 94 oC for 30 seconds, 50 oC for 90 seconds, 72 oC for 60 seconds, and a final extension at 72 oC for 10 minutes, with a final hold at 6 oC. Another multiplex PCR assay was also performed for SHV, OXA 2 and OXA 10 genes at 94 oC for 15 minutes and then for 30 cycles of 31 University of Ghana http://ugspace.ug.edu.gh 94 oC for 30 seconds, 63 oC for 90 seconds, 72 oC for 60 seconds, and a final extension at 72 oC for 10 minutes, with a final hold at 6 oC. Table 3.1 ESBL PCR Primers PCR Primer (target) Primer sequences (5’-3’) T oC a cycles ESBLs TEM (918bp) FP: GTATCCGCTCATGAGACAATAACCCTG 63oC at 90 seconds 30 RP: CCAATGCTTAATCAGTGAGGCACC Internal FP CCGGAGCTGAATGAAGCCAT Internal RPCGTTGTTGCCATTGCTGCAG SHV (842bp) FP: CGC CTG TGT ATT ATC TCC CTG 63oC at 90 seconds 30 TTAGCC RP: TTG CCA GTG CTC GAT CAG CG Internal FP : ACCATGAGCGATAACAGCGC Internal RP: AAGCGCCTCATTCAGTTCCG OXA-2 (330bp) FP: GTTAACAGGGGCTTTGCAGG 63oC at 90 seconds 30 RP: TGCACGCAGTATCCAGTTGC OXA-10 (655bp) FP: ATGAAAACATTTGCCGCATATGTA 63oC at 90 seconds 30 RP: ACACCAGGATTTGACTCAGTTCC CTX-M-1(940 bp) FP: 50 oC at 90 seconds 30 GACAGACTATTCATGTTGTTGTTAWTTCG RP: CCGTTTCCSCTATTACAAA Internal FP: GGACGATGTCACTGGCTGAG Internal RP: TTTCGTCTCCCAGCTGTCGGG CTX-M-2 (253 bp) FP: ACAGTTGGTGACGTGGCTTAAGG 50 oC for 90 30 RP: TCAGAAACCGTGGGTTACGA seconds CTX-M-8/25/26 FP1: ACATCGCGTTAAGCGGAT 50 oC for 90 30 (690/346bp) FP2: GCACGATGACATTCGGG seconds RP: AACCCACGATGTGGGTAGC CTX-M-9 (860bp) FP: ATGGTGACAAAGAGAGTGCAACG 50 oC for 90 30 RP: ATGATTCTCGCCGCTGAAGC seconds Internal FP: CAAATTGATTGCCCAGCTCG Internal RP: AAACGTCTCATCGCCGATCG * T oC, activation temperature; PCR, polymerase chain reaction Gel Electrophoresis. All PCR products were analyzed by horizontal gel-electrophoresis in a 2% (weight/volume) self-made agarose gel (SeaKem®GTG®Agarose, Lonza). Gene Ruler 100bp DNA Ladder Plus (Fermentas, Germany) were diluted 1:10 with Mili-Q® water as a size marker. 32 University of Ghana http://ugspace.ug.edu.gh Amplification products (5 µl) were diluted 1:4 with water and 0.2 % loading dye. Gels were run at 50 volts for 1 hour plus 15 minutes and stained with Gel Red (Bio-Rad) for 30 minutes. The gels were photographed by use of Ultraviolet trans-illuminator and digital capture system. Nucleotide sequencing: The PCR products were sent to Macrogen (Seoul, Korea) for nucleotide sequencing. Additional internal primers (Appendix 3) were used for sequencing: CTX-M-1, CTX-M-9, SHV and TEM genes. The DNA sequences from Macrogen were analyzed using the Codon Code analyzer®. Nucleotide- and deduced protein sequences were compared with sequences in the NCBI database (http://www.ncbi.nlm.nih.gov/BLAST). TEM and SHV beta- lactamase sequences were compared to wild-type E. coli TEM-1 and SHV-1 sequences (Gen Bank accession no. AF427133.1 and AF148850 respectively) by using the database at http://www.lahey.org/studies. 3.6 Maintenance of working isolates. Isolates to be stocked were purified onto 5 % Sheep blood agar and inoculated onto Brain Heart Infusion agar in 1.5 ml cryovial tubes (Sigma, United Kingdom). Inoculated tubes were incubated at 35-37 oC for 18-24 hours and stored at 5 oC until further workup. 3.7 Quality control To establish the quality of media and the potency of antibiotics purchased for this work, quality control assessments were conducted for each batch of study reagents. The Kirby-Bauer method of sensitivity testing was performed with the control strains Klebsiella pneumoniae ATCC 700603 and Escherichia coli ATCC 25922 for every batch of new antibiotics and media and the results interpreted according to performance standards of CLSI guidelines. Students t-test was used to analyze significant differences in inhibition zone sizes of the control strains. Briefly, no 33 University of Ghana http://ugspace.ug.edu.gh inhibition zone size of the control strain measured on a representative sample of media or antibiotic should be more than 4 standard deviations away from the midpoints between referenced stated limits of CLSI (2016). Also, not more than 1 in 20 results was outside the stated accuracy limits by CLSI 2016 guidelines. Otherwise, the media or antibiotic is rejected 3.8 Data analysis Study data was entered into a Microsoft Excel sheet for editing. The results were analyzed using Statistical Package for Social Sciences (SPSS) V16. The study isolates including ESBL- producing isolates were described using relative numbers, proportions or percentages. Similarly, PCR results were discussed using descriptive analysis with proportions and percentages. Overall, point estimates of statistical significance were determined at 2 tailed P-values < 0.05. Categorical data was compared across study parameters using χ2 or Fisher's exact tests where appropriate. The student’s t-test was used to compare continuous data. In this study, faecal colony counts of ESBL-producing E. coli and K. pneumoniae were compared to that of total non-ESBL-producing enterobacteria. The box and whisker displays were used to illustrate the lower, upper, interquartile range, median and mean faecal colony counts of ESBL-producing E. coli and K. pneumonia and other ESBL-negative faecal enterobacteria. The odds ratio (OR) was used to quantify the association between independent predictor variables and patients with and without ESBL faecal carriage. From univariate analyses, predictor variables with P-value < 0.05 was examined in multivariate logistic regression models to determine independent risk factors. Predictive accuracy of the models was evaluated by Hosmer and Leme which show goodness-of- fit test with P-value > 0.05 suggesting that the model predicts accurately on average. The area under the ROC (Receiver Operating Characteristic) Curve > 0.7 was used to analyze the discriminatory capability of ESBL faecal carriage versus their respective controls. 34 University of Ghana http://ugspace.ug.edu.gh 3.9 Ethical consideration Ethical approval was obtained from the Ethics and Protocol Review Committee of the School of Biomedical and Allied Health Sciences before the study was carried out (Approval number: SBAHS-MD./10551508/AA/5A/2016-2017). Written informed consent was obtained before study patients were enrolled. All study details were explained to participants before requesting for their consent and subsequent enrollment into the study. Information provided to participants included the risk, benefits and the right to refuse participation or withdraw participation from the study at any time. Study participants were assured that enrollment into the study is entirely voluntary and that their clinical care and management would not be jeopardized by refusing to participate in the study. Participants were informed that there will be no financial incentives for participating in this study. 3.10 Financial acknowledgement This work was supported by the parent project (Intestinal colonization with ESBL in different patient cohorts) led by Dr Noah Obeng-Nkrumah (Department of Medical Laboratory Sciences, University of Ghana) with funds from the Puerperal Infection Work package of the Hospital Acquired Infections (HAI-Ghana) Project (www.haighana.com). The HAI-Ghana project is funded by the Danish International Development Agency financed the whole project. 35 University of Ghana http://ugspace.ug.edu.gh CHAPTER FOUR 4.0 RESULT - - - - - - - - Figure4 1:Flowchart summary of results 36 University of Ghana http://ugspace.ug.edu.gh 4.1 Demographics of immunocompetent patients enrolled in the study. Between February and May 2017, 520 in-patients were encountered at the hospital. Of these, only 107 were enrolled in the study (Table 4.1). The excluded patients included those who refused participation and/or were immunosuppressed. Patients who consented participation but were unwilling to be questionnaire-interviewed or unable to provide faecal specimens were dismissed. The 107 study participants were from the pre- and post-natal ward (n = 27, 25.2 %), geriatric ward (n = 26, 24.3 %), male ward (n = 34, 31.8 %), and the gastrointestinal ward (n = 20, 18.7 %). They were (n = 72, 67.3 %) admitted from the home, or from another hospital [n = 35 (32.7 %)]. The mean number of patients in the wards was 8.5±3.0 [95 % confidence interval (CI):9-8] and ranged from 1-14. Forty–two (39.2 %) study patients were males and 65 (60.7 %) were females. The mean age of study patients was 39.4±13.8 [95 % confidence interval (.CI):42- 37] and ranged from 13-83. Overall, 77(72.0 %) of the study patients had employment, 6 (5. 6 %) had no formal education, and 64 (59.8 %) had travelled outside Ghana in past year. Of the 107 patients, 75 (70.1 %) had the previous hospitalization in the past 1 year, 61 (57.0 %) no piped water in their household, and 72 (43.0 %) had no toilet facility in their household. 37 University of Ghana http://ugspace.ug.edu.gh Table 4.1 Patients Demographics Description Number (%) Age (Mean ±SD) 39.4±13.8 Age group <28 days 0(0.0) 28 days- 1yr 0(0.0) >1yr -5yrs 0(0.0) 6yrs-15yrs 2(1.9) 16yrs-65yrs 98(91.6) >65yrs 7(6.5) Gender Male 42 (39.2) Female 65(60.7) Number of persons (mean± SD) 8.5±3.0 Education Primary 40(37) Secondary 37(34) Tertiary 24(22.4) None 6(5.4) Employment Yes 77(71) No 30(28) Travelled out of Ghana Yes 60(59.8) No 43(40.1) Pipe water in household Yes 61(57) No 46(43) Toilet in household Home Yes 35(32) No 72(67.2) Hospitalization in past year Yes 75(70) No 32(30) Admitted from Home 72(66.3) Another hospital 35(32.7) * SD, standard deviation; %, percentage 38 University of Ghana http://ugspace.ug.edu.gh 4.2Enterobacteriaceae isolates cultured from faecal samples. In total, 107 faecal samples (1 per patient) were cultured (Table 4.2). A total of 676 Enterobacteriaceae isolates were recovered. The most frequently isolated Enterobacteriaceae was Escherichia coli (n=161), followed by Klebseilla pneumonia (n=111), Citrobacter species (n=64), Proteus species (n=64), Providentia species (n=42) and Morganella species (n=22) species. Escherichia coli was recovered from all 107 (100%) faecal samples, whiles K. pneumoniae was cultured from 71 (66.3%) of faecal specimens. Overall, 83 (77.5%) of 107 faecal samples harbored cephalosporin resistant isolates including E. coli (n=37), K. pneumoniae (n=12), other Klebsiella species (n=10), Citrobacter species (n=9), Proteus species (n=4), Providentia species (n=4) and Morganella species (n=4). Only E. coli and K. pneumonia were found to be ESBL-producing. Of the 83 cephalosporin resistant isolates, only 38 were ESBL- producing [E. coli (n=31, 44.5%); K. pneumonia (n=7, 8.4%)]. All the ESBL- producing isolates (except 1 E. coli) harboured a corresponding ESBL gene after PCR and sequencing. Overall, the prevalence of intestinal colonization with ESBL-producing E. coli or Klebsiella pneumonia was 35.5%. None of the ESBL-negative enterobacteria harboured an ESBL gene after PCR and sequencing. 39 University of Ghana http://ugspace.ug.edu.gh Table 4.2Enterobacteriaceae isolates cultured from faecal samples Number of faecal samples (n=107) with Number of Faecal enterobacteria confirmed Cephalosporin- ESBL phenotype ESBL gene Isolates resistant isolates positive isolates Escherichia coli (n=161) 107 37 31 30 Klebseilla pneumoniae(n=111) 71 12 7 7 Other Klebsiella species (n=72) 21 10 0 0 Citrobacter species (n=64) 63 9 0 0 Enterobacter species (n=164) 32 4 0 0 Providencia species (n=42) 32 4 0 0 Morganella species (n=22) 11 4 0 0 Serratia species (n=12) 9 4 0 0 Proteus species (n=6) 6 1 0 0 Others (n=22) 8 0 0 0 Total (n=107) 83 (77.5%) 38 (35.5%) 37(34.6%) * ESBL, extended-spectrum beta-lactamases; No. number; %, percentage *Only ESBL-producing isolates were identified to the species level *Other faecal enterobacteria encountered in smaller numbers included Edwardsiella species (n=6), Erwinia species (n=5), Hafnia species (n=4), Shigella species (n=4), Salmonella species (n=3). 40 University of Ghana http://ugspace.ug.edu.gh 4.3 Specific type of ESBL gene sequences in E. coli and K. pnuemoniae Nucleotide sequence analysis of CTX-M, SHV, TEM and OXA genes are shown in (Table 4.3). All the ESBL- producing isolates had at least one corresponding ESBL gene sequence type except 1 E. coli strain (which harboured a blaTEM-13 but no identifiable TEM, CTX-M, SHV or OXA ESBL gene). Overall, 23 (54%) isolates harboured only one ESBL gene, 8 (25%) had 2 ESBL genes, whiles 6 (54%) combined an ESBL plus a broad-spectrum beta-lactamase gene. Eighteen different ESBL gene sequences (12 CTX-M types; 3 SHV types; 2 TEM types; and 1 OXA type) were identified either alone (n=12) or in various combinations (n=6). The most predominant ESBL gene type was blaCTX-M-15(n=11), followed by blaCTX-M-2 (n=5) and blaCTX-M- 14 (n=4). Overall, 34 (91.8%) of the ESBL sequenced genes were blaCTX-M (21.6%) of which were found in various combinations with blaSHV or blaTEM or blaOXA ESBLS. The SHV ESBLs were blaSHV-40, blaSHV-86, and blaSHV-2A; and these were identified among only K. pneumoniae isolates. The TEM ESBLs were blaTEM-3 and blaTEM-15. The only OXA ESBL identified was blaOXA-2 41 University of Ghana http://ugspace.ug.edu.gh Table 4.3 Specific type of ESBL gene sequences in E. coli and K. pnuemoniae Type of Cephalosporin ESBL gene Escherichia coli Klebseilla pneumoniae Total resistance ESBL only SHV-40 0 1 1 SHV-86 0 1 1 TEM-3 1 0 1 CTX-M-2 1 0 1 CTX-M-3 1 - 1 CTX-M-5 1 - 1 CTX-M-14 4 - 4 CTX-M-15 8 - 8 CTX-M-20 1 - 1 CTX-M-27 - 1 1 CTX-M-31 1 1 2 CTX-M-57 1 - 1 CTX-M-1/SHV-40 - 1 1 CTX-M-2/SHV-2A - 1 1 CTX-M-2/TEM-3 1 - 1 CTX-M-3/TEM-15 1 - 1 CTX-M-15/TEM-3 1 - 1 CTX-M-15/TEM-15 1 - 1 CTX-M-27/OXA-2 - 1 1 CTX-M-57 ,TEM-3 1 - 1 ESBL +broad Beta- lactamases CTX-M-2 ,TEM-1 1 1 CTX-M-9 ,TEM-1 2 - 2 CTX-M-12 ,TEM-1 1 - 1 CTX-M-15,TEM-1 2 - 2 Only broad Beta- TEM-13 lactamases 1 - 1 * TEM-1 and TEM-13 are not ESBL gene sequence types 42 University of Ghana http://ugspace.ug.edu.gh 4.4 Faecal concentration of ESBL-producing E. coli and K. pnuemoniae among the study patients. The faecal concentration of ESBL-positive E. coli/K. pneumonia varied considerably by the type of ESBL gene present (Table 4.4). Among patients (n=11) colonized by a CTX-M-15 positive isolate, the predominant faecal enterobacteria were the ESBL-producers [mean ± SD, 190x104 ±27x104 CFU/g; interquartile range (IQR), 175x104 -205x104 CFU/g]. The CTX-M-15 positive E. coli/K. pneumoniae comprised >80.0% of the total enterobacteria counts per faecal samples for all 11 patients. The faecal concentration of all ESBL-negative Enterobacteriaceae for each CTX-M-15 colonized patient was ≤50x104 CFU/kg (For all 11 patients: mean ± SD, 38x104±6x104 CFU/g; IQR, 34x104- 43x104 CFU/g). There were 27 patients with ESBL faecal carriage by a non-CTX-M-15 E. coli/K. pneumoniae. Within this cohort, total ESBL-negative bacteria per faecal sample constituted the predominant faecal isolates (For all 27 patients: mean ± SD, 134x104 CFU/g; IQR, 46x104-200x104 CFU/g). The mean faecal concentration of non-CTX-15 ESBL positive E. coli/K. pneumoniae in faecal samples of all 27 patients was 22x104±21x104CFU/kg with an IQR of 10x104- 24x104 CFU/kg. In these faecal samples, the non-CTX-M-15 E. coli/K. pneumonia averaged about 16.4% of the total faecal enterobacteria. 43 University of Ghana http://ugspace.ug.edu.gh Table 4.4 Comparison of the faecal concentration (CFU/g) of ESBL-positive enterobacteria and all ESBL negative enterobacteria in faecal samples of 38 ESBL faecal carriers. Concentration x104 CFU/g of faecal sample (%)a Type of ESBL faecal carriage No. Patients Isolates with Type Total bIsolates with other ESBL ESBL negative CTX-M-15 ESBL gene but no isolates gene CTX-M-15 1 Patient 2 E.coliCTX-15/TEM-1 183 150 (81.9) - 33 (18.0) 2 Patient 4 E.coliCTX-15 197 162 (82.2) - 35 (17.7) 3 Patient 8 E.coliCTX-15 212 171 (80.6) - 41 (19.3) 4 Patient 12 E.coliCTX-15/TEM-1 222 178 (80.2) - 44 (19.8) 5 Patient 14 E.coliCTX-15 216 181 (83.7) - 35 (16.2) 6 Patient 16 E.coliCTX-15 229 189 (82.5) - 40 (17.4) 7 Patient 19 E.coliCTX-15 224 190 (84.8) - 34 (15.2) 8 Patient 20 E.coliCTX-15 236 191 (80.9) - 45(19.1) 9 Patient 24 E.coliCTX-15 270 220 (81.5) - 50 (18.5) 10 Patient 26 CTX-M15/TEM3 262 230 (87.7) - 32 (12.2) 11 Patient 29 E.coliCTX-M15/TEM15 266 236 (88.7) - 30 (11.3) Mean±SD; IQR 190±27 ; 175-205 38±6 ;34-43 12 Patient 33 E.coliCTX-M14 290 - 12 (4.1) 278 (95.9) 13 Patient 37 K. pneumoniaeSHV86 280 - 10 (3.5) 270 (96.4) 14 Patient 39 E.coliTEM3 159 - 7 (4.4) 152 (95.6) 15 Patient 41 E.coliCTX-M-2 283 - 12 (4.2) 271 (95.7) 16 Patient 42 E.coliCTX-M3 183 - 21 (11.5) 162 (88.5) 17 Patient 43 E.coliCTX-M5 256 - 56 (21.9) 200 (78.1) 18 Patient 47 E.coliCTX-M14 223 - 12 (5.3) 211 (94.6) 19 Patient 50 E.coli CTX-M15/TEM3 181 - 10 (5.5) 171 (94.7) 20 Patient 52 K. pneumoniaeCTX-M27/OXA-2 109 - 9 (8.3) 100 (91.7) 21 Patient 54 E.coli CTX-M15/TEM15 207 - 7 (3.3) 200 (96.6) 22 Patient 58 K. pneumoniae SHV40 88 - 10 (11.3) 78 (88.6) 23 Patient 65 E.coliCTX-M12 ,TEM1 103 - 11 (10.6) 92 (89.3) 24 Patient 73 E.coliCTX-M9 ,TEM1 230 - 21(9.1) 209 (90.8) 25 Patient 77 E.coliCTX-M14 79 - 23 (29.1) 56 (70.8) 26 Patient 81 E.coliCTX-M14 122 - 45 (36.9) 77 (63.1) 27 Patient 85 E.coliCTX-M20 147 - 67 (45.6) 80 (54.4) 28 Patient 91 K. pneumoniae CTX-M27 301 - 100 (33.2) 201 (66.7) 29 Patient 93 K. pneumoniae CTX-M31 294 - 7 (2.3) 287 (97.6) 30 Patient 97 E.coliCTX-M57 170 - 10 (5.8) 160 (94.1) 31 Patient 98 E.coliCTX-M20 145 - 24 (16.5) 121 (83.4) 32 Patient 100 E.coli CTX-M57 ,TEM-3 189 - 33 (17.4) 156 (82.5) 33 Patient 101 K. pneumoniae CTX-M-1/SHV40 123 - 20 (16.3) 103 (83.7) 34 Patient 103 E.coli CTX-M3/TEM15 140 - 34 (24.3) 106 (75.7) 35 Patient 104 E.coliCTX-M9 ,TEM1 297 - 10 (3.4) 287(96.6) 36 Patient 105 E.coli CTX-M2/TEM3 261 - 11 (4.2) 250 (95.7) 37 Patient 106 E.coli CTX-M2 ,TEM-1 86 - 9 (10.5) 77 (89.5) 38 Patient 107 K. pneumoniae CTX-M2/SHV2A 309 - 9 (2.9) 300 (97.1) Mean±SD ; IQR 22±21;10-24 134±89 ; 46-200 * CFU, colony forming units; SD, standard deviation; IQR, interquartile range a %, percent of the total faecal enterobacteria colony counts; b for only E. coli and K. pneumoniae 44 University of Ghana http://ugspace.ug.edu.gh 4.5Univariate comparison of risk factors exposition in the study population with and without ESBL-positive faecal carriage. The results of the univariate analyses on risk factors are presented in Table 4.5. Patients who were admitted from the hospital, compared to home, were significantly more likely to have faecal carriage with ESBL-producing E. coli or Klebsiella pneumoniae [OR, 3.5; 95%CI, 1.5- 8.4; p-value, 0.003]. Patients with a history of hospitalization in the past 1 year were frequently ESBL faecal carriers [OR, 3.6; 95%CI, 1.5-8.6; p-value, 0.003]. Similarly, ESBL faecal carriage was significantly associated with patients who have had infections since admission [OR, 5.2; 95%CI, 2.2-12.3; p-value, <0.001]. Patients’ lifestyle practices significantly associated with ESBL faecal carriage included chronic alcohol use [OR, 12.7; 95%CI, 4.9-32.8; p-value, <0.001], and animal contact in past 1 year [OR, 3.7; 95%CI, 1.5-8.5; p-value, <0.001]. Interestingly, diarrhoea [OR, 0.1; 95%CI, 0.02-0.16; p-value, <0.001] and the use of hand hygiene sanitizer in past 3 months [OR, 0.4; 95%CI, 0.1-2.0; p-value, <0.001]seemed to have a protective effect. 45 University of Ghana http://ugspace.ug.edu.gh Table 4.5Univariate comparison of the risk factors exposition in the study population with and without ESBL-positive faecal carriage Patients with Patients ESBL faecal without ESBL Crude Odds P - Value. Descriptions carriage faecal carriage Ratio (95%CI) (n=38) (n=69) Demography Age (Mean ± SD) 39.6±13.8 39.5±13.8 0.1 Age group Neonates (<28days) 0 0 0 - Infants (28days-5yrs) 0 0 0 - Paediatric (>5yrs-18yrs) 1 1 1.8(0.1-30.2) 1 Adults(>18yrs-65yrs) 36 62 1.9(0.3-10.0) 0.5 Elderly (>65yrs) 1 6 0.3(0.3-2.5) 0.4 Male gender 15 27 1.0(0.4-2.3) 1 No of persons in the ward (Mean ±SD) 8.3±2.8 8.5±2.5 0.7 The total duration of hospital stay (Mean ±SD) 2.9±1.4 3.7±8.6 0.6 Admitted from Hospital 18 14 3.5 (1.5-8.4) 0.003 Home 20 55 Employed 30 47 1.7(0.2-1.4) 0.2 Formal education 36 65 0.4(0.3-0.5) 0.13 Type of formal education Primary 10 30 0.4(0.1-1.1) 0.08 Secondary 14 23 1.2(0.5-2.7) 0.7 Tertiary 12 12 2.1(0.8-5.5) 0.09 Patient’s lifestyle Used hand sanitizer in past 3 months 6 24 0.4(0.1-2.0) 0.04 Frequency of hand sanitizer use per day 1 0 11 - 0.06 2 2 4 1.6(0.2-11.4) 0.5 3 1 5 0.8(0.1-8.1) 1 4 2 3 3.5(0.4-28.1) 0.5 >4 1 1 4.6(0.2-86.6) 0.3 Daily hand-washing in past 1 month 38 43 Frequency of hand washing per day 1 6 13 0.8(0.3-2.3) 0.7 2 9 5 4.0(1.2-13.0) 0.02f 3 8 11 1.4(0.5-4.0) 0.5 4 11 6 0.7(0.3-1.6) 0.4 >4 4 14 0.5(0.1-1.5) 0.2 Chronic smoking 2 4 0.9(0.2-5.2) 1f Chronic alcohol use 29 14 12.7(4.9-32.8) <.0001 Travelled overnight outside home in past 1year 26 43 1.3(0.5-3.0) 0.5 Travelled outside |Ghana in past year 10 12 1.6(0.6-4.4) 0.3 Number of patients in ward (Mean ±SD) 8.3±2.8 8.5±2.5 0.7 Animal contact in past 3 months 20 16 3.7(1.5-8.5) 0.002 Pipe water in household 19 30 1.3(0.5-2.8) 0.5 Toilet in household 30 54 1.0(0.3-2.7) 0.9 Hospitalization history 46 University of Ghana http://ugspace.ug.edu.gh Infection since admission 24 17 5.2(2.2-12.25) <0.0001 Surgery since admission 11 14 1.6(0.6-4.0) 0.3 Functional status: need help of any sort 9 9 2.1(0.7-5.7) 0.2 Co-morbidities Respiratory infections 5 3 3.3(0.7-14.8) 0.1 Diarrhoea 8 56 0.1 (0.02-0.16) <0.001 Diabetes 7 12 1.1 (0.38-3.0 0.88 Hospitalized in past 1 year 28 30 3.6(1.5-8.6) 0.003 Invasive procedure of any type in past 1year 4 3 2.6(0.5-12.2) 0.2f Presence of indwelling catheter 24 26 2.8(1.2-6.5) 0.01 Use of medications that affect intestinal flora 18 22 1.9(0.8-4.3) 0.1 (stomach acids neutralizer, proton pump inhibitor,H2 blockers) Used antibiotic in last 6 month 24 23 3.4(1.5-7.8) 0.002 Used antibiotic without prescription 17 19 2.1(0.9-4.9) 0.07 Current antibiotic use 27 47 1.1 (0.4-2.7) 0.75 Specified antibiotics aminoglycosides 4 10 0.7(0.2-2.4) 0.76 Beta-lactam 14 27 0.9(0.4-2.1) 0.82 Beta-lactam/aminoglycosides 2 4 0.9 (0.2-5.2) 1 Beta-lactam/fluoroquinolones 6 5 2.4 (0.7-8.5) 0.19 Beta-lactam /macrolides 2 2 1.9(0.3-13.8) 0.61 fluoroquinolones 2 8 0.4 (0.08-2.1) 0.32 Lincosamides 3 3 1.8 (0.4-9.6) 0.67 Macrolides 4 4 1.8(0.4-8.0) 0.45 Metronidazole 2 2 1.8(0.3-13.8) 0.61 Phenols 0 1 - - None 1 3 0.6(0.06-5.9) 1 *N, number; CI, confidence interval; ESBL, extended-spectrum beta-lactamases; SD, standard deviation; Risk ratios and Fisher's exact probability tests P-values were calculated for variables with cell counts <5. 47 University of Ghana http://ugspace.ug.edu.gh 4.6 Independent risk factors of ESBL positive faecal carriage identified using multivariate logistic regression analysis. The results of the multivariate analyses are presented in Table 4.5. Patients with faecal carriage by ESBL-producing E. coli or Klebsiella pneumonia had used antibiotics 3.5 times more during the past 6 weeks than patients with a non-ESBL faecal carriage, and this was the strongest predictor for ESBL faecal carriage (AOR, 3.4; 95% CI: 1.5–10.5; p-value =0.0001). Infections since admission was to a lesser degree associated with ESBL faecal carriage (AOR, 3.2; 95% CI: 1.9–7.8; p-value =0.002). Hospitalization in the past 1 year (AOR, 1.6; 95% CI: 1.2–3.6; p-value =0.04) the hospital as source of current admission (AOR, 1.6; 95% CI: 1.1–4.3; p-value =0.003) were also identified as independent risk factors. 48 University of Ghana http://ugspace.ug.edu.gh Table 4.6Independent risk factors of ESBL positive faecal carriage using multivariate logistic regression analysis. Variable Level Adjusted OR 95% CI P-value Admitted from a hospital Yes/No 1.6 1.1-4.3 0.003 Chronic alcohol use Yes/No 2.4 0.9-5.3 0.08 0.7 0.1-2.0 0.07 Used hand sanitizer in past 3 months Yes/No 0.9 0.3-1.6 0.11 Diarrhoea Yes/No Animal contact in past 3 months Yes/No 1.7 0.8-3.5 0.09 Hospitalized in past 1 year Yes/No 1.5 1.2-3.6 0.04 Presence of indwelling catheter Yes/No 1.5 0.7-5.5 0.2 Used antibiotic in last 6 month Yes/No 3.4 1.5-10.5 <0.0001 Infection since admission Yes/No 3.2 1.9-7.8 0.002 * OR, adjusted Odds ratio; CI, confidence interval 49 University of Ghana http://ugspace.ug.edu.gh CHAPTER 5 5.0 DISCUSSION In recent years, faecal carriage with ESBL-producing enterobacteria has been increasingly reported around the world (Karanika et al., 2016). The hospital is widely documented to be a repository of resistant bacteria especially ESBL-producers. This pose a significant health threat to hospitalized patients (Isendahl et al., 2012; Andriatahina et al., 2010 ). In the present study, we examined the occurrence of faecal carriage with ESBL-producing enterobacteria recovered from immunocompetent patients in a district hospital setting in Ghana. In this study, the overall proportion of faecal carriage of ESBL-producing isolates was 35.5%. The CTX-M genes, mostly blaCTX-M-15 were the predominant ESBL genotype. When CTX-M-15- producing isolates occurred in faecal samples, these isolates were the predominant faecal enterobacteria. In this study, independent risk factors for ESBL faecal carriage included previous hospitalization for past 1 year, admission from another hospital, infections since admission and use of antibiotics during the past 6 weeks. 5.1 Occurrence of ESBL faecal carriage immunocompetent patients Studies on ESBL faecal carriage among hospitalized patients is globally prevalent but there is little data on the role of immunity on this subject matter. What is not clear in literature is whether ESBL intestinal colonization patterns differ in patients with varying immune status. Although answers to this conundrum are beyond the purview of this study, the findings of this work may offer some preliminary insights. The proportion of patients with faecal carriage (n=38/107) is significantly lower than the ESBL levels reported for another patient host in Ghana by Obeng- Nkrumah et.al., (n=148/300), Hackman et al., (n=202/400), Feglo et al., (n=77/159) and Sarkodie et al., (n=149/300) (Hackman et al., 2016; Hackman et al., 2014; Obeng-Nkrumah et 50 University of Ghana http://ugspace.ug.edu.gh al., 2013). Although these other studies were conducted among clinical isolates, and without clear distinction between immune-competent or –suppressed patients, perhaps the considerably lower ESBL levels in the present study may point to the protective role of an active immune system. The proportion of ESBL faecal carriage reported in this study is lower than that cited in Cameroon (55.3%), Morroco (42.9%), and Central African Republic (59%) Lonchel et al, 2013;Farra et al., 2016). The ESBL level in this study is, however, higher than that reported in Guinea-Bissau (32.5%), Gabon (33.6%), Tanzania (34.3%), America (2%), South Europe (6%) Japan (6.4%) (Tellevik et al., 2016; Karanika et al., 2016b; Girlich et al., 2014; Schaumburg et al., 2013; Isendahl et al., 2012; Luvsansharav et al., 2011). In all these, the reports were silent on whether the study patients were immune-competent or –suppressed. Indeed, there is limited data on ESBL faecal carriage in immunocompetent patients to compare study findings. In this study, several enterobacteria isolates were resistant to 3rd generation cephalosporins but were ESBL negative. These isolates perhaps harboured other beta-lactamase types, such as the AmpCs, which are able to mediate resistance to cephalosporins. Indeed AmpC-producing enterobacteria that are resistant to beta-lactams antimicrobials, particularly 3rd generation cephalosporins, are widespread in literature (Gonggrijp et al., 2016; Hammerum et al., 2010). The global expansion of other beta-lactamase types including AmpCs is considered as a significant contributor to the emergence of multidrug-resistant enterobacteria and a potential threat to the limited antibiotic options globally. Cephalosporins are possibly the most widely used antibiotics in Ghana for empirical therapy in patients with suspected Gram-negative infections. Resistance to these drugs leaves physicians with very limited empiric options for 51 University of Ghana http://ugspace.ug.edu.gh treating patients. Carbapenems are considered the treatment of choice. Carbapenem therapy is however very expensive and not many patients may be able to afford it. In this study, only TEM, SHV, CTX-M, and OXA ESBL genes were amplified. Other less reported ESBLs such as the blaPER, blaVER and blaBER were not sought for in this study. These ESBL types have been reported few and far between in literature. These minority ESBL types have all been reported in the South Americas and Asia, and the possibility of identifying them in this study was rather slim (Naas, Poirel & Nordmann, 2008). 5.2 Characterization of the ESBL gene sequences. Reports on CTX-M ESBLs, predominantly CTX-M-15, are gradually becoming common worldwide. Literature document CTXMs as the dominant gene in ESBL-producing enterobacteria (Rossolini, Andrea & Mugnaioli, 2008). Cefotaxime plays an important role in the selection for CTX-M ESBLs (Lewis et al., 2007). Overall, CTX-M enzymes represented 91.8% in this study. This situation mirrors the current trend observed across Africa (Storberg, 2014). For its broad-spectrum antibacterial activity, less toxic side effects, and high efficacy, hospitalized patients are most often given cefotaxime leading to extensive and irrational prescription by clinicians. A possible explanation for the dominance of CTX-M genes could be its ability to localize on large plasmids and co-harbor other resistant genes such as blaAmpC, quinolone resistance genes or methylase affecting aminoglycosides (Lahlaoui, Khalifa & Moussa, 2014). The CTX-M-15 borne plasmids, in particular, have been reported to have a high conjugation frequency and are thus more frequently disseminated to other enterobacteria species (Coque et al., 2008). The CTX-M genes are transmissible by conjugation with high transfer frequencies of 10-7 to 10-2 per donor cell. Perhaps the few TEM, SHV and OXA ESBL types 52 University of Ghana http://ugspace.ug.edu.gh identified in this study point to the fact that CTX-M genes are fast replacing other ESBL types (Livermore et al., 2007). 5.3 Faecal concentration of ESBL-producing E. coli /K. pneunoniae. A noteworthy finding in this study was the fact that whenever CTX-M-15 ESBL-positive isolates occurred in a faecal sample, these isolates constituted the predominant faecal bacteria compared to all other enterobacteria. In such instances, the CTX-M-15-producing isolates constituted over 80% of the total faecal enterobacteria. These patients with CTX-M-15 faecal carriage comprise high-density ESBL shedders and may be of public health significance in the dissemination of multidrug-resistant bacteria. The CTX-M-15 genes spread rapidly among bacteria and also are significantly resistance to different classes of of antibiotics. They frequently carry genes that mediate resistance to aminoglycoside, tetracycline, sulfonamide and fluoroquinolones. Thus, CTX-M-15 producers are often multi-drug resistant (Cantón, González-Alba & Galán, 2012). 5.4 Risk factors of the ESBL-faecal carriage. In the absence of identifiable risk factors, ESBL faecal carriers may be undetected at hospital admission, resulting in a steady increase in the number of ESBL-producing isolates brought into the hospitals. In multivariate analysis, this study identified antibiotic use in the past 6 months as the highest predictor of the ESBL faecal carriage. Indeed several other studies have linked prior antibiotic use within the past 4 or 12 months to an increased possibility of faecal ESBL colonization. In fact, some observers have even suggested that the more current the antibiotic use, the greater the risk of faecal carriage with ESBL-positive enterobacteria. This is not surprising given that ESBLs and many other antibiotic-resistant mechanisms evolved as a consequence of misuse and abuse of antibiotics. 53 University of Ghana http://ugspace.ug.edu.gh 5.4 Limitations of the study There are some potential limitations of this study that should be discussed briefly. It should be noted that analysis of specific antibiotic resistance were not a focus of this study. However, Antibiogram of ESBLs versus non-ESBL-producing faecal enterobacteria may perhaps have provided data on the efficacy of some selective antibiotics that could help to maximize clinical outcome of empiric antibiotic therapy. Bacterial clonal relatedness was not investigated in this work. Such investigations would have enabled the study compare various ESBL faecal enterobacteria to determine the extent to which these isolates are being disseminated. Another noteworthy limitation is the rather few study patients. A more large-scale survey is much more likely to be with little bias for high-at-risk ESBL faecal carriers. 54 University of Ghana http://ugspace.ug.edu.gh CHAPTER 6 6.0 CONCLUSION AND RECOMMENDATION 6.1 CONCLUSION The aim of this study was to examine immunocompetent inpatients for faecal carriage with extended-spectrum beta-lactamase producing enterobacteria at a Achimota District Hospital in Ghana. The following are the conclusions based on the study findings and the overall objectives. (1) The faecal carriage prevalence of ESBL in this study was 35.5% and is considered high. (2) The predominant ESBLs were of CTX-M type, mostly CTX-M-15. (3) In all instances where CTX-M-15 positive isolates occurred in faecal specimens, their concentration (CFU/g) significantly exceeded (ratio, 2:1) the counts of total ESBL- negative faecal enterobacteria. (4) Risk factors such as hospitalization in past 1 year, antibiotic use in past 6 months, infections since admission, and admission from another hospital were independently associated with ESBL faecal carriage. 55 University of Ghana http://ugspace.ug.edu.gh 6.2 RECOMMENDATIONS (1) The proportion of patients with ESBL faecal carriage in this study was high (35.5%). However, this is significantly lower than other figures (> 49.0%) reported for ESBL prevalence in clinical isolates across Ghana. Routine laboratory screening for ESBLs may help reduce the menace. (2) The significance of CTX-M-15-producing isolates as predominant faecal enterobacteria in this study is worrying. This has implications for rapid ESBL spread. Further investigations on these isolates to ascertain the reasons behind such dominance is warranted. (3) In order to reduce the spread of ESBLs and avoid compromising patient care, there is the need to perform regular surveillance of ESBL producing bacteria in the hospitals. This information is critical to the appropriate use of antimicrobials for empirical treatment of hospital and community-acquired infections. Additionally, it is important to reinforce strict infection control measures in order to prevent further spread within the hospital and community and from the community into hospital settings. (3) Immediate implementation of antibiotic stewardship and other preventive strategies are necessary to stem the tide of dangerous spread of ESBL-positive enterobacteria in Ghana. (4) Public health efforts on antibiotic resistance should include teaching the population and healthcare personnel on the significance of ESBLs. (6) Hospitalization in past 1 year, antibiotic use in past 6 months, infections since admission, and admission from another hospital were independently associated with ESBL faecal carriage. These risk factors point to the hospital as a major repository of ESBL-producing organisms. There is the need for firm adherence to contact precautions, including simple hand washing, in 56 University of Ghana http://ugspace.ug.edu.gh order to prevent the spread of these organisms. Proper antibiotic stewardship policies may also help control ESBL spread. 57 University of Ghana http://ugspace.ug.edu.gh REFERENCES Andriatahina, T., Randrianirina, F., Hariniana, E. R., Talarmin, A., Raobijaona, H., Buisson, Y. and Richard, V. (2010) ‘High prevalence of faecal carriage of extended-spectrum-beta- lactamase-producing Escherichia coli and Klebsiella pneumoniae in a pediatric unit in Madagascar.’, BMC infectious diseases, 10, p. 204. Asante, L. A., Sasu, A., Ayitey, J. Z. and Boakye-Agyeman, N. A. (2015) ‘The Achimota Transport Terminal in Accra: A Model Urban Regeneration Project in Ghana?’, Journal of Sustainable Development, 8(9), p. 240. Babu, R., Kumar, A., Karim, S., Warrier, S., Nair, S. G., Singh, S. K. and Biswas, R. (2016) ‘Faecal carriage rate of extended-spectrum β-lactamase-producing Enterobacteriaceae in hospitalised patients and healthy asymptomatic individuals coming for health check-up’, Journal of Global Antimicrobial Resistance, 6, pp. 150–153. Bar-Yoseph, H., Hussein, K., Braun, E. and Paul, M. (2016) ‘Natural history and decolonization strategies for ESBL/carbapenem-resistant Enterobacteriaceae carriage: Systematic review and meta-analysis’, Journal of Antimicrobial Chemotherapy, pp. 2729–2739. Barthélémy, M., Peduzzi, J. and Labia, R. (1985) ‘Distinction between the primary structures of TEM-1 and TEM-2 beta-lactamases.’, Annales de l’Institut Pasteur. Microbiologie, 136A(3), pp. 311–21. Barthélémy, M., Péduzzi, J., Ben Yaghlane, H. and Labia, R. (1988) ‘Single amino acid substitution between SHV-1 beta-lactamase and cefotaxime-hydrolyzing SHV-2 enzyme.’, FEBS letters, 231(1), pp. 217–220. 58 University of Ghana http://ugspace.ug.edu.gh Baudry, P., Nichol, K., DeCorby, M., Lagace-Wiens, P., Olivier, E., Boyd, M., Mulvey, R., Hoban, D. and Zhanel, G. (2009) ‘Mechanisms of resistance and mobility among multidrug- resistant CTX-M-producing Escherichia coli from Canadian intensive care units: the 1st report of QepA in North America. ; ’:, Diagn. Microbiol. Infect. Dis., 63, pp. 319–326. Bauernfeind, A., Schweighart, S. and Grimm, H. (1990) ‘A new plasmidic cefotaximase in a clinical isolate of Escherichia coli’, Infection, 18(5), pp. 294–298. Ben-Ami, R., Schwaber, M. J., Navon-Venezia, S., Schwartz, D., Giladi, M., Chmelnitsky, I., Leavitt, A. and Carmeli, Y. (2006) ‘Influx of extended-spectrum-beta-lactamase-producing Enterobacteriaceae into the hospital.’, Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 42(7), pp. 925–34. Blanco, M., Alonso, M. P., Nicolas-Chanoine, M. H., Dahbi, G., Mora, A., Blanco, J. E., López, C., Cortés, P., Llagostera, M., Leflon-Guibout, V., Puentes, B., Mamani, R., Herrera, A., Coira, M. A., García-Garrote, F., Pita, J. M. and Blanco, J. (2009) ‘Molecular epidemiology of Escherichia coli producing extended-spectrum B-lactamases in Lugo (Spain): Dissemination of clone O25b:H4-ST131 producing CTX-M-15’, Journal of Antimicrobial Chemotherapy, 63(6), pp. 1135–1141. Bois, S. K. D., Marriott, M. S. and Amyes, S. G. B. (1995) ‘TEM- and SHV-derived extended- spectrum β-lactamases: Relationship between selection, structure and function’, Journal of Antimicrobial Chemotherapy, pp. 7–22. Bonnet, R., Recule, C., Baraduc, R., Chanal, C., Sirot, D., De Champs, C. and Sirot, J. (2003) ‘Effect of D240G substitution in a novel ESBL CTX-M-27’, Journal of Antimicrobial Chemotherapy, 52, pp. 29–35. 59 University of Ghana http://ugspace.ug.edu.gh Bradford, P. A. (1999) ‘Automated thermal cycling is superior to traditional methods for nucleotide sequencing of bla(SHV) genes’, Antimicrobial Agents and Chemotherapy, 43(12), pp. 2960–2963. Bradford, P. A. (2001) ‘Extended-spectrum beta-lactamases in the 21st century: characterization, epN2emiology, and detection of this important resistance threat’, Clinical Microbiology Reviews, 14(4), p. 933–51. Brolund, A. (2014) ‘Overview of ESBL-producing Enterobacteriaceae from a Nordic perspective.’, Infection Ecology & epidemiology, 4, pp. 1–9. Brolund, A. and Sandegren, L. (2016) ‘Characterization of ESBL disseminating plasmids.’, Infectious diseases (London, England), 48(1), pp. 18–25. Bush, K. (2013) ‘The ABCD’s of ??-lactamase nomenclature’, Journal of Infection and Chemotherapy, pp. 549–559. Bush, K. and Jacoby, G. A. (2010) ‘Updated functional classification of ??-lactamases’, Antimicrobial Agents and Chemotherapy, 54(3), pp. 969–976. Bush, K. and Jacoby, G. A. (2010) ‘Updated functional classification of beta-lactamases.’, Antimicrobial agents and chemotherapy, 54(3), pp. 969–76. Bush, K., Jacoby, G. and Medeiros, A. (1995) ‘A functional classification scheme for β- lactamase and its correlation with molecular structure.’, Antimicrobial Agents Chemotherapy, 39, pp. 1211–1233. Cantón, R. and Coque, T. M. (2006) ‘The CTX-M β-lactamase pandemic’, Current Opinion in Microbiology, pp. 466–475. 60 University of Ghana http://ugspace.ug.edu.gh Cantón, R., González-Alba, J. M. and Galán, J. C. (2012) ‘CTX-M enzymes: Origin and diffusion’, Frontiers in Microbiology. Carlet, J. (2012) ‘The gut is the epicentre of antibiotic resistance’, Antimicrobial Resistance and Infection Control, 1(1), p. 39. Chang, F. Y., Siu, L. K., Fung, C. P., Huang, M. H. and Ho, M. (2001) ‘Diversity of SHV and TEM β-lactamases in Klebsiella pneumoniae: Gene evolution in northern Taiwan and two novel β-lactamases, SHV-25 and SHV-26’, Antimicrobial Agents and Chemotherapy, 45(9), pp. 2407– 2413. Charan, J. and Biswas, T. (2013) ‘How to Calculate Sample Size for Different Study Designs in Medical Research?’, Indian journal of psychological medicine, 35(2), pp. 121–126. Chaves, J., Ladona, M. G., Segura, C., Coira, A., Reig, R. and Ampurdan??s, C. (2001) ‘SHV- 1 ??-lactamase is mainly a chromosomally encoded species-specific enzyme in Klebsiella pneumoniae’, Antimicrobial Agents and Chemotherapy, 45(10), pp. 2856–2861. Chen, Y. Y., Chi, M. M., Chen, Y. C., Chan, Y. J., Chou, S. S. and Wang, F. Der (2013) ‘Using a criteria-based reminder to reduce use of indwelling urinary catheters and decrease urinary tract infections’, American Journal of Critical Care, 22(2), pp. 105–114. Coque, T. M., Baquero, F. and Canton, R. (2008) ‘Increasing prevalence of ESBL-producing Enterobacteriaceae in Europe.’, European Communicable Disease Bulletin, 49(7), pp. 2693- 2700. Coque, T. M., Novais, Â., Carattoli, A., Poirel, L., Pitout, J., Peixe, L., Baquero, F., Cantón, R. and Nordmann, P. (2008) ‘Dissemination of clonally related Escherichia coli strains expressing 61 University of Ghana http://ugspace.ug.edu.gh extended-spectrum β-lactamase CTX-M-15’, Emerging Infectious Diseases, 14(2), pp. 195–200. Cormican, M. G., Marshall, S. A. and Jones, R. N. (1996) ‘Detection of extended-spectrum ??- lactamase (ESBL)-producing strains by the Etest ESBL screen’, Journal of Clinical Microbiology, 34(8), pp. 1880–1884. D’Andrea, M. M., Arena, F., Pallecchi, L. and Rossolini, G. M. (2013) ‘CTX-M-type β- lactamases: A successful story of antibiotic resistance’, International Journal of Medical Microbiology, pp. 305–317. Danel, F., Hall, L. M. C., Gur, D., Akalin, H. E. and Livermore, D. M. (1995) ‘Transferable production of PER-1 ??-lactamase in Pseudomonas aeruginosa’, Journal of Antimicrobial Chemotherapy, 35(2), pp. 281–294. Datta, N. and Kontomichalou, P. (1965) ‘Penicillinase synthesis controlled by infectious R factors in Enterobacteriaceae.’, Nature, 208(5007), pp. 239–241. Davido, B., Batista, R., Michelon, H., Lepainteur, M., Bouchand, F., Lepeule, R., Salomon, J., Vittecoq, D., Duran, C., Escaut, L., Sobhani, I., Paul, M., Lawrence, C., Perronne, C., Chast, F. and Dinh, A. (2017) ‘Is faecal microbiota transplantation an option to eradicate highly drug- resistant enteric bacteria carriage?’, Journal of Hospital Infection, 95(4), pp. 433–437. Dhillon, R. H. P. and Clark, J. (2012) ‘ESBLs: A clear and present danger?’, Critical Care Research and Practice. Ebrahimi, F., Mózes, J., Mészáros, J., Juhász, Á., Majoros, L., Szarka, K. and Kardos, G. (2016) ‘Asymptomatic faecal carriage of ESBL producing Enterobacteriaceae in Hungarian healthy individuals and in long-term care applicants: A shift towards CTX-M producers in the 62 University of Ghana http://ugspace.ug.edu.gh community’, Infectious Diseases, 4235(April), pp. 1–3. Esena, R. K. and Addo, C. O. (2014) ‘Trends in laboratory confirmation of malaria cases in the Achimota Hospital in Accra, Ghana ’, International Journal of Development and Sustainability, 3(4), pp. 679–691. Esteve-Palau, E., Solande, G., Sánchez, F., Sorlí, L., Montero, M., Güerri, R., Villar, J., Grau, S. and Horcajada, J. P. (2015) ‘Clinical and economic impact of urinary tract infections caused by ESBL-producing Escherichia coli requiring hospitalization: A matched cohort study’, Journal of Infection, 71(6), pp. 667–674. Farra, A., Frank, T., Tondeur, L., Bata, P., Gody, J. C., Onambele, M., Rafa??, C., Vray, M. and Breurec, S. (2016) ‘High rate of faecal carriage of extended-spectrum ??-lactamase-producing Enterobacteriaceae in healthy children in Bangui, Central African Republic’, Clinical Microbiology and Infection, 22(10), p. 891. Fluit, A. C., Visser, M. R. and Schmitz, F. J. (2001) ‘Molecular detection of antimicrobial resistance’, Clinical Microbiology Reviews, pp. 836–871. Friedmann, R., Raveh, D., Zartzer, E., Rudensky, B., Broide, E., Attias, D. and Yinnon, A. M. (2009) ‘Prospective evaluation of colonization with extended-spectrum β-lactamase (ESBL)- producing Enterobacteriaceae among patients at hospital admission and of subsequent colonization with ESBL producing Enterobacteriaceae among patients during hospitalization’, Infection Control and Hospital Epidemiology, 30(6), pp. 534–542. Garland, A. (2014) ‘Arterial lines in the ICU: A call for rigorous controlled trials’, Chest, pp. 1155–1158. 63 University of Ghana http://ugspace.ug.edu.gh Ghafourian, S., Sadeghifard, N., Soheili, S. and Sekawi, Z. (2014) ‘Extended-spectrum beta- lactamases: Definition, classification and epidemiology’, Current Issues in Molecular Biology, 17(1), pp. 11–22. Girlich, D., Bouihat, N., Poirel, L., Benouda, A. and Nordmann, P. (2014) ‘High rate of faecal carriage of ESBL and OXA-48 carbapenemase-producing Enterobacteriaceae at a University hospital in Morocco’, Clinical Microbiology and Infection., 20, pp. 350–354. Gonggrijp, M. A., Santman-Berends, I. M. G. A., Heuvelink, A. E., Buter, G. J., van Schaik, G., Hage, J. J. and Lam, T. J. G. M. (2016) ‘Prevalence and risk factors for extended-spectrum β- lactamase- and AmpC-producing Escherichia coli in dairy farms’, Journal of Dairy Science, 99(11), pp. 9001–9013. Govinden, U., Mocktar, C., Moodley, P., Sturm, A. W. and Essack, S. Y. (2006) ‘CTX-M-37 in Salmonella enterica serotype Isangi from Durban, South Africa’, International Journal of Antimicrobial Agents, 28(4), pp. 288–291. Hackman, H. K., Twum-Danso, K., Brown, C. . and Annison, L. (2014) ‘Phenotypic and molecular characterization of extended-spectrum beta-lactamases in klebsiella pneumoniae and Escherichia coli isolates in Accra, Ghana’, American Journal of Tropical Medicine and Hygiene, 91(5), p. 314. Hackman, H. K., Twum-Danso, K., Brown, C. . and Annison, L. (2016) ‘Antimicrobial Resistance Patterns of Extended-Spectrum Β-Lactamase Producing Klebsiellae and E. coli Isolates from a Tertiary Hospital in Ghana’, European Scientific Journal, 1212(3030), pp. 1857– 7881. 64 University of Ghana http://ugspace.ug.edu.gh Hammerum, A. M., Lester, C. H., Jakobsen, L. and Porsbo, L. J. (2010) ‘Faecal carriage of Extended-Spectrum Beta-Lactamase-producing and AmpC Beta-Lactamase-producing bacteria among Danish army recruits’, Clin.Microbiol.Infect., (1469–0691 (Electronic)), pp. 15–17. Hernandez, J. R., Martinez-Martinez, L., Canton, R., Coque, T. M., Pascual, A. and Spanish Group for Nosocomial, I. (2005) ‘Nationwide Study of Escherichia coli and Klebsiella pneumoniae Producing Extended-Spectrum {beta}-Lactamases in Spain’, Antimicrob. Agents Chemother., 49(5), pp. 2122–2125. Ho, P. L., Tsang, D. N. C., Que, T. L., Ho, M. and Yuen, K. Y. (2000) ‘Comparison of screening methods for detection of extended-spectrum β- lactamases and their prevalence among Escherichia coli and Klebsiella species in Hong Kong’, APMIS, 108(3). Isendahl, J., Turlej-Rogacka, A., Manjuba, C., Rodrigues, A., Giske, C. G. and Nauclér, P. (2012) ‘Fecal Carriage of ESBL-Producing E. coli and K. pneumoniae in Children in Guinea- Bissau: A Hospital-Based Cross-Sectional Study’, PLoS ONE, 7(12). Karanika, S., Karantanos, T., Arvanitis, M., Grigoras, C. and Mylonakis, E. (2016) ‘Fecal Colonization with Extended-spectrum Beta-lactamase-Producing Enterobacteriaceae and Risk Factors among Healthy Individuals: A Systematic Review and Meta-analysis’, Clinical Infectious Diseases, 63(3), pp. 310–318. Karim, A., Poirel, L., Nagarajan, S. and Nordmann, P. (2001) ‘Plasmid-mediated extended- spectrum β-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1’, FEMS Microbiology Letters, 201(2), pp. 237–241. Khosravi, A. D., Hoveizavi, H. and Mehdinejad, M. (2013) ‘Prevalence of klebsiella pneumoniae 65 University of Ghana http://ugspace.ug.edu.gh encoding genes for Ctx-M-1, tem-1 and shv-1 extended-spectrum beta-lactamases (ESBL) enzymes in clinical specimens’, Jundishapur Journal of Microbiology, 6(10). Kiratisin, P., Apisarnthanarak, A., Laesripa, C. and Saifon, P. (2008) ‘Molecular characterization and epidemiology of extended-spectrum-beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing healthcare-associated infection in Thailand, where the CTX-M family is endemic.’, Antimicrobial Agents and Chemotherapy, 52(8), pp. 2818–24. Ko, K. S., Lee, M. Y., Song, J. H., Lee, H., Jung, D. S., Jung, S. I., Kim, S. W., Chang, H. H., Yeom, J. S., Kim, Y. S., Ki, H. K., Chung, D. R., Kwon, K. T., Peck, K. R. and Lee, N. Y. (2008) ‘Prevalence and characterization of extended-spectrum β-lactamase-producing Enterobacteriaceae isolated in Korean hospitals’, Diagnostic Microbiology and Infectious Disease, 61(4), pp. 453–459. Ko, Y.-J., Moon, H.-W., Hur, M. and Cho, S. E. (2012) ‘Faecal carriage of extended-spectrum beta-lactamase producing Enterobacteriaceae in Korean community and hospital settings’, Clinical Microbiology and Infection, 18, pp. 807–808. Kumar, D., Singh, A. K., Ali, M. R. and Chander, Y. (2014) ‘Antimicrobial Susceptibility Profile of Extended-Spectrum β-Lactamase (ESBL) Producing Escherichia coli from Various Clinical Samples.’, Infectious diseases, pp. 1–8. Kumar, V. A. and Babu, R. (2012) ‘Medical Microbiology & Diagnosis Fecal Carriage of Extended-Spectrumβ-Lactamase Producing Enterobacteriaceae’, 2(3), pp. 2–3. Lahlaoui, H., Ben Haj Khalifa, A. and Ben Moussa, M. (2014) ‘Epidemiology of Enterobacteriaceae producing CTX-M type extended-spectrum ??-lactamase (ESBL)’, Medecine 66 University of Ghana http://ugspace.ug.edu.gh et Maladies Infectieuses. Elsevier Masson SAS, 44(9), pp. 400–404. Lakshmi, R., Nusrin, K. S., Georgy, S. A. and Sreelakshmi, K. S. (2014) ‘Role of Beta- Lactamases in Antibiotic Resistance: a Review’, International Research Journal of Pharmacy, 5(2), pp. 37–40. Lewis, J. S., Herrera, M., Wickes, B., Patterson, J. E. and Jorgensen, J. H. (2007) ‘First report of the emergence of CTX-M-type extended-spectrum ??-lactamases (ESBLs) as the predominant ESBL isolated in a U.S. health care system’, Antimicrobial Agents and Chemotherapy, 51(11), pp. 4015–4021. Liakopoulos, A., Mevius, D. and Ceccarelli, D. (2016) ‘A review of SHV extended-spectrum ??- lactamases: Neglected yet ubiquitous’, Frontiers in Microbiology. Livermore, D. M., Canton, R., Gniadkowski, M., Nordmann, P., Rossolini, G. M., Arlet, G., Ayala, J., Coque, T. M., Kern-Zdanowicz, I., Luzzaro, F., Poirel, L. and Woodford, N. (2007) ‘CTX-M: Changing the face of ESBLs in Europe’, Journal of Antimicrobial Chemotherapy, pp. 165–174. Livermore, D. M., Struelens, M., Amorim, J., Baquero, F., Bille, J., Canton, R., Henning, S., Gatermann, S., Marchese, a, Mittermayer, H., Nonhoff, C., Oakton, K. J., Praplan, F., Ramos, H., Schito, G. C., Van Eldere, J., Verhaegen, J., Verhoef, J. and Visser, M. R. (2002) ‘Multicentre evaluation of the VITEK 2 Advanced Expert System for interpretive reading of antimicrobial resistance tests.’, The Journal of antimicrobial chemotherapy, 49(2), pp. 289–300. Lonchel, C. M., Melin, P., Gangoué-Piéboji, J., Assoumou, M. C. O., Boreux, R. and De Mol, P. (2013) ‘Extended-spectrum β-lactamase-producing Enterobacteriaceae in Cameroonian 67 University of Ghana http://ugspace.ug.edu.gh hospitals’, European Journal of Clinical Microbiology and Infectious Diseases, 32(1), pp. 79– 87. Lübbert, C., Straube, L., Stein, C., Makarewicz, O., Schubert, S., Mössner, J., Pletz, M. W. and Rodloff, A. C. (2015) ‘Colonization with extended-spectrum beta-lactamase-producing and carbapenemase-producing Enterobacteriaceae in international travellers returning to Germany’, International Journal of Medical Microbiology, 305(1), pp. 148–156. Luvsansharav, U. O., Hirai, I., Niki, M., Nakata, A., Yoshinaga, A., Moriyama, T. and Yamamoto, Y. (2011) ‘Prevalence of faecal carriage of extended-spectrum ß-lactamase- producing Enterobacteriaceae among healthy adult people in Japan’, Journal of Infection and Chemotherapy, 17(5), pp. 722–725. Mackenzie, F. M., Miller, C. A. and Gould, I. M. (2002) ‘Comparison of screening methods for TEM- and SHV-derived extended-spectrum β-lactamase detection’, Clinical Microbiology and Infection, 8(11), pp. 715–724. Naas, T., Poirel, L. and Nordmann, P. (2008) ‘Minor extended-spectrum ??-lactamases’, Clinical Microbiology and Infection, pp. 42–52. Nakai, H., Hagihara, M., Kato, H., Hirai, J., Nishiyama, N., Koizumi, Y., Sakanashi, D., Suematsu, H., Yamagishi, Y. and Mikamo, H. (2016) ‘Prevalence and risk factors of infections caused by extended-spectrum ??-lactamase (ESBL)-producing Enterobacteriaceae’, Journal of Infection and Chemotherapy. Elsevier Taiwan LLC, 22(5), pp. 319–326. Newire, E. A., Ahmed, S. F., House, B., Valiente, E. and Pimentel, G. (2013) ‘Detection of new SHV-12, SHV-5 and SHV-2a variants of extended spectrum Beta-lactamase in Klebsiella 68 University of Ghana http://ugspace.ug.edu.gh pneumoniae in Egypt’, Annals of Clinical Microbiology and Antimicrobials, 12(1), p. 16. Nigam, A., Gupta, D. and Sharma, A. (2014) ‘Treatment of infectious disease: Beyond antibiotics’, Microbiological Research, pp. 643–651. Obeng-Nkrumah, N., Twum-Danso, K., Krogfelt, K. A. and Newman, M. J. (2013) ‘High levels of extended-spectrum beta-lactamases in a major teaching hospital in Ghana: The need for regular monitoring and evaluation of antibiotic resistance’, American Journal of Tropical Medicine and Hygiene, 89(5), pp. 960–964. Östholm-Balkhed, Å., Tärnberg, M., Nilsson, M., Nilsson, L. E., Hanberger, H. and Hällgren, A. (2013) ‘Travel-associated faecal colonization with esbl-producing Enterobacteriaceae: Incidence and risk factors’, Journal of Antimicrobial Chemotherapy, 68(9), pp. 2144–2153. Ozgumus, O. B., Tosun, I., Aydin, F. and Kilic, A. O. (2008) ‘Horizontal dissemination of TEM- and SHV-type beta-lactamase genes-carrying resistance plasmids amongst clinical isolates of Enterobacteriaceae’, Brazilian Journal of Microbiology, 39(4), pp. 636–643. Paterson, D. L. and Bonomo, R. a (2005) ‘Extended-Spectrum β-Lactamases : a Clinical Update’, Clinical microbiology reviews, 18(4), pp. 657–686. Paterson, D. L. and Bonomo, R. A. (2005) ‘Extended-Spectrum beta-Lactamases : a Clinical Update’, Clinical Microbiology Reviews, 18(4), pp. 657–686. Peirano, G. and Pitout, J. D. D. (2010) ‘Molecular epidemiology of Escherichia coli producing CTX-M ??-lactamases: the worldwide emergence of clone ST131 O25:H4’, International Journal of Antimicrobial Agents, pp. 316–321. Perez, F., Endimiani, A., Hujer, K. M. and Bonomo, R. A. (2007) ‘The continuing challenge of 69 University of Ghana http://ugspace.ug.edu.gh ESBLs’. Pfeifer, Y., Cullik, A. and Witte, W. (2010) ‘Resistance to cephalosporins and carbapenems in Gram-negative bacterial pathogens’, International Journal of Medical Microbiology, pp. 371– 379. Pitout, J. D. and Laupland, K. B. (2008) ‘Extended-spectrum ??-lactamase-producing Enterobacteriaceae: an emerging public-health concern’, The Lancet Infectious Diseases, 8(3), pp. 159–166. Pitout, J. D., Thomson, K. S., Hanson, N. D., Ehrhardt, a F., Moland, E. S. and Sanders, C. C. (1998) ‘Beta-Lactamases responsible for resistance to expanded-spectrum cephalosporins in Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis isolates recovered in South Africa.’, Antimicrobial agents and chemotherapy, 42(6), pp. 1350–4. Poole, K. (2004) ‘Resistance to ??-lactam antibiotics’, Cellular and Molecular Life Sciences, 61(17), pp. 2200–2223. Quan, J., Zhao, D., Liu, L., Chen, Y., Zhou, J., Jiang, Y., Du, X., Zhou, Z., Akova, M. and Yu, Y. (2017) ‘High prevalence of ESBL-producing Escherichia coli and Klebsiella pneumoniae in community-onset bloodstream infections in China’, Journal of Antimicrobial Chemotherapy, 72(1), pp. 273–280. Reddy, P., Malczynski, M., Obias, A., Reiner, S., Jin, N., Huang, J., Noskin, G. A. and Zembower, T. (2007) ‘Screening for Extended-Spectrum -Lactamase-Producing Enterobacteriaceae among High-Risk Patients and Rates of Subsequent Bacteremia’, Clinical Infectious Diseases, 45(7), pp. 846–852. 70 University of Ghana http://ugspace.ug.edu.gh Reuland, E. A., Al Naiemi, N., Kaiser, A. M., Heck, M., Kluytmans, J. A. J. W., Savelkoul, P. H. M., Elders, P. J. M. and Vandenbroucke-Grauls, C. M. J. E. (2016) ‘Prevalence and risk factors for carriage of ESBL-producing Enterobacteriaceae in Amsterdam’, Journal of Antimicrobial Chemotherapy, 71(4), pp. 1076–1082. Rieg, S., Küpper, M. F., de With, K., Serr, A., Bohnert, J. A. and Kern, W. V (2015) ‘Intestinal decolonization of Enterobacteriaceae producing extended-spectrum β-lactamases (ESBL): a retrospective observational study in patients at risk for infection and a brief review of the literature.’, BMC infectious diseases, 15, p. 475. Rossolini, G. M., Andrea, M. M. and Mugnaioli, C. (2008) ‘The spread of CTX-M-type extended-spectrum ??-lactamases’, Clinical Microbiology and Infection, pp. 33–41. Rupp, M. E. and Fey, P. D. (2003) ‘Extended-Spectrum Beta-Lactamase (ESBL)-Producing Enterobacteriaceae: Considerations for Diagnosis, Prevention and Drug Treatment.’, Drugs, 63(4), pp. 353–365. Salisbury D, Ramsay M, N. K. (2013) Immunisation against infectious disease: the green book, Public Health England, BMJ (Clinical research ed.). Schaumburg, F., Alabi, A., Kokou, C., Grobusch, M. P., K??ck, R., Kaba, H., Becker, K., Adegnika, A. A., Kremsner, P. G., Peters, G. and Mellmann, A. (2013) ‘High burden of extended-spectrum ??-lactamase-producing Enterobacteriaceae in Gabon’, Journal of Antimicrobial Chemotherapy, 68(9), pp. 2140–2143. Schaumburg, F., Alabi, A., Kokou, C., Grobusch, M. P., Kock, R., Kaba, H., Becker, K., Adegnika, A. A., Kremsner, P. G., Peters, G. and Mellmann, A. (2013) ‘High burden of 71 University of Ghana http://ugspace.ug.edu.gh extended-spectrum-beta-lactamase-producing Enterobacteriaceae in Gabon.’, The Journal of antimicrobial chemotherapy, 68(9), pp. 2140–2143. Schooneveldt, J. M., Nimmo, G. R. and Giffard, P. (1998) ‘Detection and characterisation of extended-spectrum beta-lactamases in Klebsiella pneumoniae causing nosocomial infection’, Pathology, 30(2), pp. 164–168. Spadafino, J. T., Cohen, B., Liu, J. and Larson, E. (2014) ‘Temporal trends and risk factors for extended-spectrum beta-lactamase-producing Escherichia coli in adults with catheter-associated urinary tract infections’, Antimicrobial Resistance and Infection Control, 3(1), p. 39. Stapleton, P. D., Shannon, K. P. and French, G. L. (1999) ‘Construction and characterization of mutants of the TEM-1 beta-lactamase containing amino acid substitutions associated with both extended-spectrum resistance and resistance to beta-lactamase inhibitors.’, Antimicrobial agents and chemotherapy, 43(8), pp. 1881–7. Stedt, J., Bonnedahl, J., Hernandez, J., Waldenström, J., McMahon, B. J., Tolf, C., Olsen, B. and Drobni, M. (2015) ‘Carriage of CTX-M type extended spectrum β-lactamases (ESBLs) in gulls across Europe’, Acta Veterinaria Scandinavica, 57(1), p. 74. Storberg, V. (2014) ‘ESBL-producing Enterobacteriaceae in Africa a non-systematic literature review of research published 2008 2012’, Infection Ecology & Epidemiology, 1, p. 20342. Stürenburg, E., Lang, M., Horstkotte, M. A., Laufs, R. and Mack, D. (2004) ‘Evaluation of the MicroScan ESBL plus confirmation panel for detection of extended-spectrum β-lactamases in clinical isolates of oxyimino-cephalosporin-resistant Gram-negative bacteria’, Journal of Antimicrobial Chemotherapy, 54(5), pp. 870–875. 72 University of Ghana http://ugspace.ug.edu.gh Stürenburg, E. and Mack, D. (2003) ‘Extended-spectrum beta-lactamases: implications for the clinical microbiology laboratory, therapy, and infection control.’, The Journal of infection, 47(4), pp. 273–95. Tängdén, T., Cars, O., Melhus, Å. and Löwdin, E. (2010) ‘Foreign travel is a major risk factor for colonization with Escherichia coli producing CTX-M-type extended-spectrum β-lactamases: A prospective study with Swedish volunteers’, Antimicrobial Agents and Chemotherapy, 54(9), pp. 3564–3568. Tansarli, G. S., Poulikakos, P., Kapaskelis, A. and Falagas, M. E. (2014) ‘Proportion of extended-spectrum β-lactamase (ESBL)-producing isolates among Enterobacteriaceae in Africa: Evaluation of the evidence-systematic review’, Journal of Antimicrobial Chemotherapy, 69(5), pp. 1177–1184. Tärnberg, M., Östholm-Balkhed, Å., Monstein, H. J., Hällgren, A., Hanberger, H. and Nilsson, L. E. (2011) ‘In vitro activity of beta-lactam antibiotics against CTX-M-producing Escherichia coli’, European Journal of Clinical Microbiology and Infectious Diseases, 30(8), pp. 981–987. Tellevik, M. G., Blomberg, B., Kommedal, Ø., Maselle, S. Y., Langeland, N. and Moyo, S. J. (2016) ‘High prevalence of faecal carriage of esbl-producing Enterobacteriaceae among children in Dar es Salaam, Tanzania’, PLoS ONE, 11(12). The Clinical and Laboratory Standards Institute (2016) M100S Performance Standards for Antimicrobial Susceptibility Testing, Clinical and Laboratory Standards Institute, Wayne, PA. Thenmozhi, S., Moorthy, K., Sureshkumar, B. T. and Suresh, M. (2014) ‘Antibiotic Resistance Mechanism of ESBL Producing Enterobacteriaceae in Clinical Field: A Review’, International 73 University of Ghana http://ugspace.ug.edu.gh Journal of Pure & Applied Bioscience, 2(3), pp. 207–226. Thomson, K. S. and Sanders, C. C. (1992) ‘Detection of extended-spectrum ??-lactamases in members of the family Enterobacteriaceae: Comparison of the double-disk and three- dimensional tests’, Antimicrobial Agents and Chemotherapy, 36(9), pp. 1877–1882. Titelman, E., Hasan, C. M., Iversen, A., Nauclér, P., Kais, M., Kalin, M. and Giske, C. G. (2014) ‘Faecal carriage of extended-spectrum β-lactamase-producing Enterobacteriaceae is common 12 months after infection and is related to strain factors’, Clinical Microbiology and Infection, 20(8), pp. O508-515. Tzouvelekis, L. S. and Bonomo, R. A. (1999) ‘SHV-type beta-lactamases’, Curr Pharm Des, 5(11), pp. 847–864. Vahaboglu, H., Coskunkan, F., Tansel, O., Ozturk, R., Sahin, N., Koksal, I., Kocazeybek, B., Tatman-Otkun, M., Leblebicioglu, H., Ozinel, M. A., Akalin, H., Kocagoz, S. and Korten, V. (2001) ‘Clinical importance of extended-spectrum beta-lactamase (PER-1-type)-producing Acinetobacter spp. and Pseudomonas aeruginosa strains.’, Journal of medical microbiology, 50(7), pp. 642–5. Vercauteren, E., Descheemaeker, P., Ieven, M., Sanders, C. C. and Goossens, H. (1997) ‘Comparison of screening methods for detection of extended-spectrum beta-lactamases and their prevalence among blood isolates of Escherichia coli and Klebsiella spp. in a Belgian teaching hospital.’, Journal of clinical microbiology, 35(9), pp. 2191–7. Wang, J., Stephan, R., Zurfluh, K., Hächler, H. and Fanning, S. (2015) ‘Characterization of the genetic environment of blaESBL genes, integrons and toxin-antitoxin systems identified on large 74 University of Ghana http://ugspace.ug.edu.gh S transferrable plasmids in multi-drug resistant Escherichia coli’, Frontiers in Microbiology, 6(JAN). Wayne and Pa (2007) ‘Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing’, 17th informational supplement. Wayne, PA: CLSI, p. M100– S17. Wener, K. M., Schechner, V., Gold, H. S., Wright, S. B. and Carmeli, Y. (2010) ‘Treatment with fluoroquinolones or with ??-lactam-??-lactamase inhibitor combinations is a risk factor for isolation of extended-spectrum- ??-lactamase-producing klebsiella species in hospitalized patients’, Antimicrobial Agents and Chemotherapy, 54(5), pp. 2010–2016. Wiegand, I., Geiss, H. K., Mack, D., Stürenburg, E. and Seifert, H. (2007) ‘Detection of extended-spectrum beta-lactamases among Enterobacteriaceae by use of semiautomated microbiology systems and manual detection procedures’, Journal of Clinical Microbiology, 45(4), pp. 1167–1174. 75 University of Ghana http://ugspace.ug.edu.gh APPENDIX Appendix 1: Identification of immunosuppression/immunocompetent patient  Criteria for immunosuppression will be as defined by Salisbury et al., 2006 Immunocompromised patients will be defined as patients with suppression (as by drugs or disease) of the immune response.The following will be regarded as causes of immunosuppression. Systemic illnesses: · Diabetes mellitus · Chronic alcoholism · Renal or hepatic failure · Autoimmune disorders such as systemic lupus erythematosus or rheumatoid arthritis · CNS infection Immunosuppressive treatment · Corticosteroids . Polyclonal immunoglobulins such as antilymphocyte globulin, and monoclonal immunoglobulins such as daclizumab (both monoclonal and polyclonal immunoglobulins target cellular immunity alone by depleting lymphocytes)n Antimetabolites:Calcineurin inhibitors which prevent T cell transcription, such as cyclosporine. Rapamycin which block the mTOR kinase in lymphocytes, such as everolimus. Mitosis inhibitors which block purine metabolism, such as azathioprine · Ionizing radiation · Biological alkylating agents such as cyclophosphamide and chlorambucil Immunosuppression is clinically indicated in three distinct situations: · The post-transplant period, to prevent graft rejection and graft-versus-host reactions 76 University of Ghana http://ugspace.ug.edu.gh · . The presence of an autoimmune or hypersensitivity disorder which causes self- antigens to be identified as foreign targets of immune attack, and leads to tissue and organ damage, and the occurrence of lymphoproliferative disorders  At the hospital, immunocompetent patients will be patients…. (1) with no major organ or bone marrow transplant, or a diagnosis of HIV, severe combined immunodeficiency, or Wiskott-Aldrich syndrome before the baseline date; (2) without any record of prescription of an immunosuppressive drug (azathioprine, sulfasalazine, methotrexate, cyclosporine, and leflunomide) in the 1 months before baseline date; and (3) without any record of a steroid prescription at a defined dose or higher (dexamethasone 3 mg daily, hydrocortisone 80 mg daily, prednisolone 40 mg daily for >1 week, and cortisone 100 mg daily) in the 1 month before baseline date. 77 University of Ghana http://ugspace.ug.edu.gh Appendix2 INFORMATION SHEET PROJECT TOPIC: Intestinal carriage with extended-spectrum Beta-lactamase producing enterobacteria in immunocompetent patients . PURPOSE OF STUDY:Towards the Control of Antibiotic Drug Resistance in Ghana COLLABORATING INSTITUTIONS:University of Ghana School of Biomedical and Allied Health Sciences, Department of Medical Laboratory Sciences; University of Ghana Hospital, Legon). Invitation:This is an invitation for you to participate in a study which aims to improve our knowledge on infections and antibiotic resistance in the hospital. This study will last from March to May 2017. Your participation in this study will involve your approval to provide us with a faecal specimen during this period of hospitalization. You will also be required to help us fill a simple questionnaire with the help of an assistant. Benefits: There will be no financial remuneration for your participation. Your participation will be of no cost to you. Your participation in this study will provide data that will inform policies and measures aimed at controlling the spread of bacterial infections and antibiotic resistance in the hospital. Any important results during the course of study that will be of benefit to your health will be made available to you or your physician for appropriate medication. The study will also help us document the extent of the antibiotic resistance problem in the hospital, as well as implement control and monitoring efforts in reducing this menace in Ghana. 78 University of Ghana http://ugspace.ug.edu.gh Hazard of study:There is no harm or discomfort associated with your participation in this study. Some of the questions in the questionnaire may, however, prove embarrassing. Procedure for sample collection: The procedure to be used for stool collection in this study will be the same as those used in the routine laboratory stool collection. This will be done by qualified attending nurses or physicians on duty. Use of patient’s sample: Bacteria will be isolated from the faecal specimens. The bacteria will be studied for antibiotic resistance and preserved for future investigation. The stool material will be preserved for as long as possible for further investigations. Subjects right to refuse or withdraw: Your participation in the study is completely voluntary. All information related to your participation would be kept strictly confidential. Stool material will be number coded. You are free to refuse permission to participate and this will in no way affect how you will be treated at this hospital. If at any point in time during the study you take a decision not to participate any further, you are at liberty to do so immediately without any further discussion. If you have any problems or questions about this study, feel free to contact the following: 1. Obeng Nkrumah Noah - Department of Medical Laboratory Science, University of Ghana School of Biomedical and Allied Health Sciences. Tel : 0548394763 2. Gloria Dela Tawiah - Department of Medical Laboratory Science, University of Ghana School of Biomedical and Allied Health Sciences. 0542701668 79 University of Ghana http://ugspace.ug.edu.gh PARTICIPANTS CONSENT Participant Declaration: I,……………………………………………………………………………..of…………… …………………….., having understood the contents of the attached sheet, after it has been thoroughly explained together with this consent form to me in ……………………………….(specify language) agreed to participate in the Antibiotic resistance study. Name of Participant: ………………………………………………………………….. Sex: ……………………………………….Age: ……………………………………… Signature……………………………………………………………………………….. OR Thumbprint of participant:………………………………………………………... Witness: …………………………………………………………………………………………... Date: ……………………………………………………………………………………. Date: Signature: 80 University of Ghana http://ugspace.ug.edu.gh Appendix 3 Structured Questionnaire for Interviews Towards the determination of risk factors for ESBL faecal carriage Intestinal carriage with extended-spectrum beta-lactamase producing enterobacteria inimmunocompetent patients Patient code: Q 1. Personal information: Q1.1 Name: Q1.2 Date of birth: Date of admission: Q1.3 Gender: Female:___ Male:____ Ward name: Q1.4 …………………………….. Number of beds: …………………………….. Number of patients in ward: …………………………….. Number of healthcare staff: …………………………….. Flush toilet in the ward: Y N : ‘N ’ …………………... Indicate number ……………… Source of water: ; k ; ( )………….. 81 University of Ghana http://ugspace.ug.edu.gh Q1.5 Admitted from home current hospital another healthcare facility Q2. Questions of underlying diseases: Do you suffer from any of the following diseases? I do not Admitting diagnosis: Yes: No: know: Q2.1 Haematological disorders: Q2.2 Respiratory infections: Q2.3 Diarrhoea: Q2.4 Diabetes: Q2.5 Cancer: Q2.6 HIV/AIDS: Q2.7 Liver cirrhosis: Q2.8 Alcoholism: Q2.9 Infections since admission Q2.10 Surgery since admission Q2.11 Functional status: Need help of any sort 82 University of Ghana http://ugspace.ug.edu.gh Q2.12 Immunosuppression (of any type) Steroids Chemotherapy in past 3 months Radiation in past 3 months ( ):………………………………………... Q2.13 Gastro-oesophageal ………………………………. Q3. Questions of underlying patient’s lifestyle: Yes No Q3.1 Alcohol hand rubs/sanitizer If yes, indicate how often you use this in a day: Once ; Twice ; Thrice ; > Thrice ; as often as possible Q3.2 How often do you wash your hands? Yes No once Yes No Q3.3 Employment Yes No Q3.4 Current smoking 83 University of Ghana http://ugspace.ug.edu.gh Yes No Q3.5 Alcoholism Education Yes No Q3.6 Indicate status: Primary ; Secondary ; Tertiary ; None Q3.6 : …………………………………………... Q3.6 ………………… Q3.7 G …………………………………………………….. Q3.8 Number of person in the household Q3.9 Toilet facility in household Q3.10 ………………………………….. Q4.History of hospitalization Yes: No: Hospitalization in the past 1 year Q.4.1 Number of hospitalization…………………………………………………. ………………………………….. Yes: No: Q.4.2 Q.4.3 Yes No Invasive procedure of any type in past 1 year (endoscopy, gastroscopy, sigmoidoscopy, colonoscopy, etc.) Q.4.4 Yes No 84 University of Ghana http://ugspace.ug.edu.gh Presence of central vascular catheter Presence of peripheral vascular catheter Presence of urinary catheter Presence of intubation Use of medications that affect intestinal flora Yes No Drugs that neutralize stomach acids Proton pump inhibitors Q.4.5 H2 blockers Yes No Used antibiotics in last 3 months Used antibiotics without prescription Q.4.6 Indicate type …………………….. Q.4.7 ………………………………………………………………………… ………………………………………………… ………………………………………………………………… contact in the past ………………………………………………………………………… Q4.8 85