University of Ghana http://ugspace.ug.edu.gh UNIVERSITY OF GHANA COLLEGE OF HEALTH SCIENCES NASAL COLONIZATION WITH METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS (MRSA) AMONG HIV-INFECTED CHILDREN BY FLEISCHER CHARLES KOTEY (10555254) THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON, IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE AWARD OF MPHIL MEDICAL MICROBIOLOGY DEGREE. JULY, 2018. i University of Ghana http://ugspace.ug.edu.gh DECLARATION I, Fleischer Charles Kotey, declare that the work presented in this thesis is the result of my own research work carried out in the Department of Medical Microbiology Research Laboratory, School of Biomedical and Allied Health Sciences (SBAHS), Korle Bu, under the supervision of Prof. Eric Sampane-Donkor (SBAHS) and Dr. Nicholas T. K. D. Dayie (SBAHS), and that all references cited in this work have been duly acknowledged. Sign………………………………………… Date…………………………………… Mr. Fleischer Charles Kotey (Student) Sign………………………………………... Date……………………………………. Prof. Eric Sampane-Donkor (Main Supervisor) Sign………………………………………. Date……………………………………. Dr. Nicholas T. K. D. Dayie (Co-Supervisor) i University of Ghana http://ugspace.ug.edu.gh DEDICATION I dedicate this work to my lovely wife, Mrs. Rhoda Kotey, other members of my family, and my friends. ii University of Ghana http://ugspace.ug.edu.gh ACKNOWLEDGEMENT I deeply appreciate the efforts of the following individuals: my supervisors (Prof. Eric Sampane- Donkor and Dr. Nicholas T. K. D. Dayie), both of the Department of Medical Microbiology, SBAHS; Drs. Samuel Duodu and Vincent Amarh of the Department of Biochemistry, Cell and Molecular Biology/WACCBIP; Dr. Edem Tettey of the Department of Community Health; Dr. Mrs. Patience Borkor Tetteh-Quarcoo, Prof. Mercy Jemimah Newman, Prof. Julius Abraham Addo Mingle, Dr. Japheth Awueletey Opintan, Miss Mary-Magdalene Osei, Mr. Prince Jonathan Pappoe-Ashong, Mr. Amos Akwumena, and Mrs. Edith Owiredu, all of the Department of Medical Microbiology, SBAHS. I would also like to thank Mr. and Mrs. Gyimah and the entire staff of the Princess Marie Louis Children’s Hospital (PML), especially, the HIV Clinic. Finally, I laud the College of Health Sciences of the University of Ghana for awarding me a postgraduate scholarship for my study. iii University of Ghana http://ugspace.ug.edu.gh ABSTRACT Background: Methicillin-resistant Staphylococcus aureus (MRSA) poses a public health threat because it is extensively resistant to antimicrobials, is associated with persistent outbreaks in hospital and community settings, and is associated with markedly increased healthcare costs. Moreover, HIV-infected persons are at a higher risk for colonization with MRSA, and could potentially disseminate the pathogen to other individuals. In Ghana, little is known about MRSA in relation to at-risk populations, such as HIV-infected children. General aim: The aim of this study was to investigate nasal carriage of S. aureus and MRSA among HIV-infected and uninfected children in Accra, including the prevalence, risk factors and antibiogram. Methodology: This study was cross-sectional, and involved 107 HIV-infected children recruited at the Princess Marie Louis Children’s Hospital (PML) in Accra and an equal number of sex- and age group-matched apparently healthy children without HIV infection (control group) recruited from PML and its environs. Nasal swab specimens were collected from the study participants and cultured. S. aureus isolates were confirmed by the tube coagulase test, while MRSA was confirmed via PCR targeting the mecA gene. S. aureus susceptibility to standard antimicrobial agents was tested by the Kirby Bauer method. Antimicrobials tested included tetracycline (30 µg), erythromycin (15 µg), gentamicin (10 µg), rifampicin (5 µg), cotrimoxazole (1.25 + 23.75 µg), penicillin (10 µg), clindamycin (2 µg), fusidic acid (10 µg), cefoxitin (30 µg), linezolid (10 µg), and vancomycin (30 µg). A pretested structured questionnaire was also used to obtain data on demographic, household, and clinical features of the study participants. Binary logistic regression was performed to identify predisposing factors for S. aureus and MRSA carriage among both the HIV-infected and uninfected children. Results: The carriage prevalence of S. aureus and MRSA were 44.9% (n = 48) and 5.6% (n = 6) respectively among the HIV-infected individuals, and the corresponding values within the control group were 23.4% (n = 25) and 0.9% (n = 1). HIV infection was significantly associated with S. aureus colonization (p = 0.001; OR = 2.67), but not MRSA colonization (p = .055). The only significant predictor of S. aureus colonization in both study groups was absence of colonization with coagulase-negative Staphylococci (CONS): HIV-infected individuals (p < 0.001; OR = 0.078); HIV-uninfected individuals (p < 0.001; OR = 0.038). Also, the only significant predictor iv University of Ghana http://ugspace.ug.edu.gh of MRSA colonization among the HIV-infected participants was regular hand washing with soap (p = 0.043; OR = 6.462). None of the variables assessed showed significant associations with MRSA colonization among the HIV-uninfected participants. In both study groups, the S. aureus isolates showed no resistance to fusidic acid, linezolid and vancomycin. For the other antimicrobials, the resistance rates recorded in the HIV-infected and uninfected participants respectively were penicillin (98.1% vs. 96%), cotrimoxazole (62.3% vs. 72%), tetracycline (49.1% vs. 40%), rifampicin (30.2% vs. 36%), erythromycin (26.4% vs. 44%), clindamycin (18.9% vs. 52%), gentamicin (15.1 vs. 16%), and cefoxitin (11.3% vs. 4%). The proportion of S. aureus isolates that were multidrug resistant (MDR) was 62.3% (33/53) in the HIV-infected group and 80% (20/25) in the control group. Conclusions: Prevalence of MRSA appears to be generally low among both HIV-infected and HIV-uninfected children in Accra. HIV infection is a risk factor for nasal colonization with S. aureus among children in Accra, but may not be for MRSA. Probably due to the low MRSA carriage, determinants of MRSA nasal colonization among the study participants appear to be very limited, and this hardly involves demographic, household, and clinical features. Both HIV-infected and uninfected children are reservoirs of multidrug resistant S. aureus, which are entirely susceptible to fusidic acid, linezolid, and vancomycin. v University of Ghana http://ugspace.ug.edu.gh TABLE OF CONTENTS DECLARATION ........................................................................................................................ i DEDICATION ........................................................................................................................... ii ACKNOWLEDGEMENT ......................................................................................................... iii ABSTRACT ............................................................................................................................ iiv TABLE OF CONTENTS .......................................................................................................... vi LIST OF TABLES ......................................................................................................................x LIST OF FIGURES .................................................................................................................. xi LIST OF ABBREVIATIONS.............................................................................................. .….xii CHAPTER ONE .........................................................................................................................1 1.0 INTRODUCTION .................................................................................................................1 1.1 Background .......................................................................................................................1 1.2 Problem statement .............................................................................................................2 1.3 Justification of the study ....................................................................................................3 1.4 General aim .......................................................................................................................4 1.5 Specific objectives .............................................................................................................4 CHAPTER TWO ........................................................................................................................5 2.0 LITERATURE REVIEW ......................................................................................................5 2.1 Characteristics and infections of Staphylococcus aureus ....................................................5 vi University of Ghana http://ugspace.ug.edu.gh 2.2 Virulence factors and pathogenesis of S. aureus ................................................................5 2.3 S. aureus and antimicrobial resistance. ...............................................................................7 2.4 Treatment of S. aureus infections .......................................................................................8 2.5 Methicillin-resistant Staphylococcus aureus (MRSA) ........................................................9 2.5.1 Epidemiology of MRSA ..............................................................................................9 2.5.2 Risk factors for S. aureus and MRSA colonization .................................................... 10 2.5.3 MRSA in Ghana ........................................................................................................ 12 2.5.4 MRSA nasal colonization and HIV-infected individuals ............................................ 15 2.5.5 Control of MRSA ...................................................................................................... 17 CHAPTER THREE ................................................................................................................... 19 3.0 METHODOLOGY .............................................................................................................. 19 3.1 Study area ........................................................................................................................ 19 3.2 Study design and sampling ............................................................................................... 19 3.3 Specimen and risk factors data collection ......................................................................... 20 3.4 Analysis of specimen ....................................................................................................... 21 3.5 Identification of Staphylococcus aureus, MRSA, and other bacteria ................................. 21 3.6 Antimicrobial susceptibility testing .................................................................................. 22 3.7 Molecular investigations .................................................................................................. 22 3.8 Ethical considerations ...................................................................................................... 24 3.9 Data analysis.................................................................................................................... 24 vii University of Ghana http://ugspace.ug.edu.gh CHAPTER FOUR ..................................................................................................................... 26 4.0 RESULTS ........................................................................................................................... 26 4.1 Demographic, household, and clinical characteristics of the study participants ................. 26 4.2 Bacteria isolated from the HIV-infected and uninfected children ...................................... 30 4.3 Risk factors for S. aureus and MRSA colonization among the study participants ............. 34 4.4 Antimicrobial resistance patterns of the S. aureus and MRSA isolates of the study participants………………………………………………………………………………..…...36 CHAPTER FIVE ...................................................................................................................... 40 5.0 DISCUSSION ..................................................................................................................... 40 5.1 Bacterial flora colonizing the anterior nares of the study participants ............................... 40 5.2 The relationship between HIV infection and colonization with S. aureus and MRSA ....... 41 5.3 Risk factors for S. aureus and MRSA colonization ........................................................... 45 5.4 Antimicrobial resistance patterns of the S. aureus and MRSA isolates ............................. 47 CHAPTER SIX ......................................................................................................................... 52 6.0 CONCLUSIONS, LIMITATIONS, AND RECOMMENDATIONS……………………….52 6.1 Conclusions ..................................................................................................................... 52 6.2 Recommendations............................................................................................................ 52 6.3 Limitations ...................................................................................................................... 53 REFERENCES ......................................................................................................................... 54 APPENDIX I ............................................................................................................................ 83 viii University of Ghana http://ugspace.ug.edu.gh APPENDIX II ........................................................................................................................... 86 APPENDIX III .......................................................................................................................... 89 ix University of Ghana http://ugspace.ug.edu.gh LIST OF TABLES Table 1: Demographic and household characteristics of the study participants ........................... 28 Table 2: Clinical features of the study participants..................................................................... 29 Table 3: Bacteria isolated from the study participants ................................................................ 31 Table 4: Risk factors for S. aureus and MRSA colonization ...................................................... 35 Table 5: Antibiogram of the S. aureus isolates........................................................................... 37 Table 6: Antimicrobial resistance patterns of the MRSA isolates ............................................... 39 x University of Ghana http://ugspace.ug.edu.gh LIST OF FIGURES Figure 1: Screening of the cefoxitin-resistant S. aureus isolates for mecA gene carriage ............ 33 Figure 2: Screening of the cefoxitin-resistant S. aureus isolates for nucA gene carriage............. 33 Figure 3: Rates of resistance of S. aureus isolates to standard antimicrobials ............................. 38 xi University of Ghana http://ugspace.ug.edu.gh LIST OF ABBREVIATIONS AIP……………………………………………………...………………….. Autoinducing peptide ATCC………………………………………………………….American Type Culture Collection BMI…………………………………………………………...………………….Body mass index CA-MRSA…………………………………………………………Community-associated MRSA Cef…………………………………………………………….………………………….Cefoxitin CI…………………………………………………………………...………….Confidence interval Cln…………………………………………………………………………………….Clindamycin CONS…………………………………………………………Coagulase-negative Staphylococci Cot………………………………………………………………………………….Cotrimoxazole CO2…………………………………………………………………………………Carbon dioxide DNA………………………………………………………………….…….Deoxyribonucleic acid dNTP…………………………………………………………...Deoxyribonucleoside triphosphate EPRC………………………………………………….…Ethical and Protocol Review Committee Ery………………………………………………...………………………………….Erythromycin FOH…………………………………………………Frequency of hospitalization in the past year Gen…………………………………………………………………………………….Gentamicin HA-MRSA… ………………………………………………….....…Healthcare-associated MRSA xii University of Ghana http://ugspace.ug.edu.gh HIV……………………………………….……………………..Human Immunodeficiency Virus KBTH……………………..………………………………………… Korle Bu Teaching Hospital LA-MRSA……………………………………………………….….. Livestock-associated MRSA LB…………………………………...……………………………….…………….Lysogeny broth MDR……………………………………...…………………………………….Multidrug resistant MgCl2…………………………………………………………………………Magnesium chloride MSSA………………………………….………… Methicillin-susceptible Staphylococcus aureus MRSA……………………………………………….Methicillin-resistant Staphylococcus aureus N/A……………………………………………………………...…………………..Not applicable OR………………………………………………………………………………………Odds ratio PCR………………………………………………………………..…...Polymerase chain reaction Pen………………………………………………………………………………………..Penicillin PML………………………………………………..…...Princess Marie Louis Children’s Hospital PVL…………………………………………………………………..Panton-Valentine leucocidin Res……………………………………………………………………….………………..Resistant Rif………………………………………………………………………...…………….Rifampicin RNase………………………………………………………………………………...Ribonuclease Sen……………………………………………………………………………………..….Sensitive xiii University of Ghana http://ugspace.ug.edu.gh SSTI………………………………………………………………….Skin and soft tissue infection TB…………………………………………………………………………………..…Tuberculosis Tet……………………………………………………………………………………..Tetracycline TMP-SMZ……………………………………………………...Trimethoprim-sulphamethoxazole °C…………………………………...…………………………………………….Degree Celsius χ2……………………………………..…………………………………………………Chi-square xiv University of Ghana http://ugspace.ug.edu.gh CHAPTER ONE 1.0 INTRODUCTION 1.1 Background Staphylococcus aureus causes a broad spectrum of clinically important infections in humans, including meningitis, septicaemia, pneumonia, osteomyelitis and endocarditis (Todar, 2006). Although the pathogen can be carried at several anatomical sites, including the axillae, perineum, vagina, gastrointestinal tract, pharynx, and the skin, its ecological niche is the anterior nares of the nose (Williams, 1963). Among individuals of the general population, some 50% are apparently resistant to S. aureus colonization (Hu et al., 1995; Eriksen et al., 1995; Kluytmans et al., 1997; Nouwen et al., 2004). In contrast, 20% of individuals are estimated to be persistent carriers, and the other 30% carry the pathogen intermittently (Kluytmans et al., 1997; Nouwen et al., 2004). Several factors have been associated with colonization with S. aureus, and these include previous intravenous drug use, hospitalization, previous ICU admission, cellulitis at hospital admission, skin ulcers at hospital admission, chronic haemodialysis, non-ambulatory status, diabetes mellitus, neoplasm, presence of a central venous catheter, previous antibacterial therapy, previous colonization or infection with MRSA, and HIV infection (Tacconelli et al., 2004; Cenizal et al., 2008; Kyaw et al., 2012; Farley et al., 2015; Kotpal et al., 2016). Furthermore, S. aureus carriers can transfer carrier states to other household members (Peacock et al., 2003; Bogaert et al., 2004). S. aureus strains that display resistance to methicillin are identified as methicillin-resistant Staphylococcus aureus (MRSA); such strains are additionally resistant to all beta-lactam antimicrobials (File Jr. et al., 2012; Ho et al., 2012; Polenakovik & Pleiman, 2013), with reports 1 University of Ghana http://ugspace.ug.edu.gh on the emergence of resistance to ceftaroline, another beta-lactam antimicrobial, however, occurring quite recently (Mendes et al., 2012; Falagas et al., 2013; Alm et al., 2014; Long et al., 2014; Egyir et al., 2015; Strommenger et al., 2015). The remnants of the S. aureus strains are sensitive to methicillin, and are collectively called methicillin-susceptible Staphylococcus aureus (MSSA). Because MRSA is primarily a key nosocomial pathogen, it is usually called healthcare- associated MRSA (HA-MRSA) (Moran et al., 2006). Besides HA-MRSA, MRSA strains transmitted in community settings, called community-associated MRSA (CA-MRSA), have been reported (Camargo et al., 2013; Casey et al., 2013; Joore et al., 2013; Loeffler et al., 2013). Strains of the pathogen adapted to livestock, called livestock-associated MRSA (LA-MRSA), also exist (Haenni et al., 2012; Quitoco et al., 2013). 1.2 Problem statement Back in 1970, MRSA was implicated in just 2% of S. aureus infections (O’Toole et al., 1970). By 2006, the pathogen had spread rapidly, and had caused up to 70% of S. aureus infections (Hsueh et al., 2002; NNIS, 2004; Tiemersma et al., 2004; Amaral et al., 2005; EARSS, 2006). In Europe, it is implicated in 44% of all healthcare-associated infections (ECDC/EMEA 2009). Worse yet, its infections result in extended hospitalization periods and higher healthcare costs (De Kraker et al., 2011). In the United States for instance, over ninety-four thousand new invasive MRSA infections are estimated to occur annually, resulting in more than eighteen thousand deaths. Hospitalization for infections of MRSA cost $14,000, as compared to that for all other stays ($7,600), recording double the duration of hospitalization (Elixhauser & Steiner, 2007; Klevens et al., 2007). Similarly, data from 31 European countries showed over twenty-seven thousand episodes of MRSA blood stream infections which resulted in more than five thousand deaths and more than two hundred and fifty days of hospitalization (De Kraker et al., 2011). 2 University of Ghana http://ugspace.ug.edu.gh Individuals with HIV infection are at a greater risk for colonization with CA-MRSA (Hidron et al., 2005; Shet et al., 2009; Popovich et al., 2013). Studies across different geographical areas have reported high MRSA carriage prevalence of up to 16% in individuals with HIV infection (Cenizal et al., 2008; Farley et al., 2015; Hassanzadeh et al., 2015; Lemma et al., 2015). This is of major concern, as significant associations exist between MRSA colonization and a higher risk of subsequent infections (Hidron et al., 2005; Wertheim et al., 2005; Popovich et al., 2013; Zervou et al., 2014). Generally, people with HIV infection have an18-fold increased risk of acquiring CA- MRSA infections (Crum-Cianflone et al., 2007). Furthermore, MRSA-colonized individuals could potentially disseminate the pathogen to other individuals (Imaz et al., 2015), and the occurrence of MRSA in patients is a significant predictor of higher morbidity and mortality (Klein et al., 2007; Burkey et al., 2008; Ganga et al., 2009). In Ghana, surveillance data have reported MRSA prevalence of 0.3–33% (Donkor & Nartey, 2007; Odonkor et al., 2012; Egyir et al., 2014a; Egyir et al., 2014b; Egyir et al., 2016). Since 2012, there have been several outbreaks of MRSA in Ghana, and the public health threat and substantial untoward economic impact associated with this pathogen places it high on the agenda of public health concerns in the country (Donkor et al., 2018). As part of the overall strategy in addressing the MRSA menace in Ghana, there is a need for surveillance of the pathogen among risk populations, such as individuals with HIV infection. 1.3 Justification of the study Despite the clinical significance of MRSA nasal carriage in HIV-infected individuals, very few studies have been carried out on the subject in Africa. These few African studies seem to be centred on MRSA prevalence, without identifying the risk factors for carriage (Cotton et al., 2008; Heysell et al., 2011; Olalekan et al., 2012; Egyir et al., 2016). Thus, gaps in knowledge exist concerning 3 University of Ghana http://ugspace.ug.edu.gh factors that predispose HIV-infected individuals to nasal carriage of MRSA in the sub region. An insight into such risk factors is however essential for tailoring preventive strategies in this risk group (Nguyen et al., 1999). In Ghana, a study evaluating Streptococcus pneumoniae carriage in the nasopharynx of HIV-infected children reported a 3.4% MRSA carriage prevalence (Sampane- Donkor et al., 2017). This is noteworthy, as S. aureus occurs mainly in the anterior nares, and hence highlights the need for nasal MRSA surveillance among HIV-infected individuals. Such data would enhance the management of S. aureus and MRSA infections in HIV-infected children in Ghana. 1.4 General aim The aim of the study was to investigate S. aureus and MRSA colonization among HIV-infected and uninfected children attending the outpatient clinic of the Princess Marie Louis Children’s Hospital (PML). 1.5 Specific objectives The specific objectives of this study were: • To describe the bacterial flora colonizing the anterior nares of HIV-infected and uninfected children visiting the outpatient clinic of Princess Marie Louis Children’s Hospital • To ascertain if HIV infection predisposes to S. aureus and MRSA colonization • To determine the risk factors for colonization with S. aureus and MRSA among the HIV- infected and uninfected children • To determine the antimicrobial resistance patterns of the S. aureus and MRSA isolates of the study participants 4 University of Ghana http://ugspace.ug.edu.gh CHAPTER TWO 2.0 LITERATURE REVIEW 2.1 Characteristics and infections of Staphylococcus aureus S. aureus exist as Gram-positive cocci, mostly in the arrangement of grapelike clusters; they are normally not encapsulated, are non-motile, with spherical cells about 1µm in diameter, and do not form spores (Haghkhah, 2003; Greenwood et al., 2012). Also, S. aureus occur as commensals on human skins and animals, and in the respiratory, urogenital, and digestive tracts (Haghkhah, 2003; Acton et al., 2009). The pathogen often spreads from the nose to wounds via the hands, through such events as nose picking (Lowe et al., 1998; Todar, 2006). It produces several pathogenicity factors which act in symphony, causing infections such as meningitis, septicaemia, pneumonia, osteomyelitis, pyomyositis, recurrent furunculosis, impetigo, and botryomycosis (Crossley & Archer, 1997; Lowe et al., 1998). Also, S. aureus is mostly implicated as the etiology of infective endocarditis in the developed world (Fowler et al., 2005). 2.2 Virulence factors and pathogenesis of S. aureus Several studies (Lin & Peterson, 2010; Mandal, 2012; Mwambete & Rugemalila, 2015) have revealed that several virulence factors facilitate the adhesion of S. aureus to the surface of eukaryotic cells (mucosal epithelium) via a ligand-receptor interaction, promoting the evasion of the immune system, with resultant colonization of the human skin, catalyzing the production of harmful toxic effects to the patient. Mwambete & Rugemalila (2015) posits that basically, two hallmarks of pathogenic bacteria are central to the mechanisms by which they cause diseases, namely invasiveness and toxigenesis. Essentially, microbial infection commences with colonization of host tissues, and after the development of tissue adherence mechanisms and 5 University of Ghana http://ugspace.ug.edu.gh evasion of host immune system (innate and adaptive immune responses), transits into a diseased state in the host. Colonization with S. aureus could be due to a variety of factors, both of the host and the pathogen (Peacock et al., 2001, 2003). Host proteins, such as fibrinogen, collagen, and keratin are targets for S. aureus binding and adherence (Johannessen et al., 2012). As an example, the biocidal agent, triclosan, is used in a variety of products, ranging from toothpaste and soaps, to medical devices, such as sutures and catheters (to prevent microbial infections) (Storch et al., 2004; Halden & Paull, 2005; Jones et al., 2006). However, this biocide has been reported to enhance S. aureus binding to those host proteins (fibrinogen, collagen, and keratin), indicating that use of products containing triclosan could promote S. aureus colonization (Syed et al., 2014). Jenkins et al. (2015) conducted a study to determine virulence genes contained in two S. aureus isolates. The study analyzed 23 putative virulence factors of S. aureus, such as secreted toxins, carbohydrate adhesins, plus proteins secreted during the acquisition of metal cations and evasion of the immune system. It was observed that FhuD, sdrC, sstD, fnbA, and hla consistently increased during the transition of S. aureus from colonization to invasion, indicating their vital roles in staphylococcal pathogenesis. The results also highlight the mode with which S. aureus transits the expression of virulence genes between commensal and invasive pathogens. The outcome of this study lends credence to findings of previous studies (Powers & Wardenbeurg, 2014; Mwambete & Rugemalila, 2015) regarding the association of genes and proteins of S. aureus in several disease states, and provides ground-breaking information on genes that are instrumental to nasal colonization, early bloodstream infection, and thromboembolic lesions. In their study, Mwambete & Rugemalila (2015) further stated that virulence determinants of S. aureus are often transmitted to other organisms of the same species or genera via 1) horizontal 6 University of Ghana http://ugspace.ug.edu.gh gene transfer; 2) transmission of mobile genetic elements; 3) or other compensatory or adaptive mutations, such as the presence of systems that either activate or repress CbrA-CbrB genes (Beceiro et al., 2013; Bernier et al., 2013; Vuotto et al., 2014). These modes form the major genetic mechanism of colonization and spread of virulence and pathogenesis (Mwambete & Rugemalila, 2015). 2.3 S. aureus and antimicrobial resistance In 1941, 90% of staphylococcal infections were susceptible to penicillin; however, within a short while (in 1945), penicillin-resistant S. aureus strains emerged (Korn et al., 2001; Shehabel-Din et al., 2003). Penicillin resistance emerged through the production of beta-lactamase by the organisms; the beta lactamase breaks up the beta-lactam ring of the penicillin molecule (Pantosti et al., 2007). Fourteen years later, semi-synthetic penicillins were developed to counteract penicillinase hydrolysis. These semi-synthetic pencillins include methicillin, dicloxacillin, nafcillin and oxacillin. These were introduced (especially methicillin) as therapeutic agents for treating S. aureus infections that do not respond to penicillin therapy (Enright et al., 2002; Haghkhah, 2003). Nonetheless, methicillin resistance has also emerged, with organisms displaying this resistance classified as HA-MRSA, CA-MRSA, and LA-MRSA (Camargo et al., 2013; Casey et al., 2013; Joore et al., 2013; Loeffler et al., 2013; Quitoco et al., 2013). It was reported in the UK, that 30-50% of S. aureus strains, and over 50% of the coagulase-negative staphylococci were methicillin-resistant. In S. aureus, resistance to methicillin occurs when the organism acquires the mecA gene, a gene reported to encode PBP2a – a novel penicillin-binding protein – which is not bound by methicillin (Crossley & Archer, 1997). Vancomycin was developed to treat MRSA infections in several countries, such as some Asian countries, Brazil, USA, etc.; however, its therapeutic success was for a short while as resistance to 7 University of Ghana http://ugspace.ug.edu.gh the drug was reported among MRSA strains (Tiwari et al., 2006; Saha et al., 2008; CDC, 2013; Askari et al., 2013; PAHO/WHO, 2013). Though this phenomenon is rare, and factors contributive to it are difficult to pinpoint, findings from some studies have revealed that resistance to vancomycin is due to the inability of vancomycin to disrupt peptidoglycan fusion (Whitener et al., 2004; Tenover et al., 2004; CDC, 2013; PAHO/WHO, 2013). CA-MRSA and HA-MRSA are generally characteristically different from each other (Tristan et al., 2007). CA-MRSA frequently causes skin and soft tissue infection (SSTI) and serious infections like osteomyelitis, necrotizing fasciitis and pneumonia, bacteraemia, and endocarditis (Bassetti et al., 2010; Sola et al., 2012). Furthermore, in comparison with HA-MRSA, CA-MRSA characteristically retains susceptibility to majority of the non-beta-lactam antimicrobials, including tetracyclines and cotrimoxazole. In addition, CA-MRSA is often associated with the production of Panton-Valentine leukocidin (PVL), which causes polymorphonuclear leucocyte lysis and tissue necrosis (Tristan et al., 2006; Boyle-Vavra & Daum, 2007). 2.4 Treatment of S. aureus infections Findings of some studies (Markowitz, 1992; Kaka et al., 2006) revealed that linezolid (equivalent to vancomycin), trimethoprim-sulfamethoxazole (TMP-SMZ), doxycycline, clindamycin, and rifampin (combined with other agents) have been used in treating MRSA infections in HIV- infected individuals (Hidron et al., 2010). It must be noted, however, that there are limited cases of randomized controlled trials supporting the efficacy of these drugs (Sakoulas et al., 2003; Forrest & Tamura, 2010; Bartash & Nori, 2017). Linezolid was reported as a very effective aminopenicillin/β-lactamase inhibitor when treating diabetic foot infections; though there have been cases of resistance to this drug, these have not been clinically significant (Tsiodras et al., 2001; Howe et al., 2002; Lipsky et al., 2004; Morales et al., 2010). However, in a study conducted 8 University of Ghana http://ugspace.ug.edu.gh by Vinh & Rubinstein (2009), it was discovered that linezolid was associated with myelosuppression, including anaemia and thrombocytopenia (though reversible after discontinuation). Moreover, incidences of neurotoxicity have been reported among patients who had been on linezolid therapy for greater than 28 days (Bressler et al., 2004; Ferry et al., 2005; Vinh & Rubinstein, 2009). TMP-SMZ, according to the study outcome of Markowitz et al. (1992), can inhibit MRSA in vitro than most drugs, including linezolid and clindamycin. Similar to vancomycin, it can also be readily used for treating uncomplicated MRSA SSTIs in HIV-infected patients (Hidron et al., 2010). However, there are few reported cases of TMP-SMZ resistance in HIV-infected individuals (Diep et al., 2008). While some studies have reported that clindamycin is potent for inhibiting PVL and treating MRSA infections in HIV-infected individuals (Daum, 2007; Dumitrescu et al., 2007; Stevens et al., 2007), a study by Shet et al. (2009) revealed that almost half the proportion of S. aureus isolated from participants in their study (42.9%) were resistant to clindamycin, indicating the need for caution in its use. Rifampin has also been shown to be very potent against MRSA infections in HIV-infected individuals, especially when combined with other agents; however, according to Kaka et al. (2006), it could be antagonistic when combined with TMP-SMZ. 2.5 Methicillin-resistant Staphylococcus aureus (MRSA) 2.5.1 Epidemiology of MRSA Various studies across the globe have reported varying carriage prevalence of MRSA: 12% in the USA (Rabinowitz et al., 2012), 7.3% in Italy, 8.1% in Spain, 7.1% in Israel, and 14.6% in France (Bilavsky et al., 2012). 9 University of Ghana http://ugspace.ug.edu.gh In Africa, there is limited data on MRSA. One multicentre study which involved five major towns in Africa reported a prevalence of 15% (Breurec et al., 2011). MRSA prevalence of 20% and 45% were reported in Nigeria (Ghebremedhin et al., 2009) and Algeria (Bekkhoucha et al., 2009) respectively. In Ghana, surveillance data have reported MRSA prevalence of 3-33% in the general population (Donkor & Nartey, 2007; Odonkor et al., 2012; Egyir et al., 2014a). Furthermore, most MRSA strains in Africa share this common trait: they harbour the PVL genes, lukS/F-pv, at rates exceeding those of strains from the rest of the world, and this attribute of strains from Africa makes them similar to CA-MRSA strains (0.55% vs. 0.10%) (Breurec et al., 2011; David et al., 2011; Ruimy et al., 2008; Shittu et al., 2011). 2.5.2 Risk factors for S. aureus and MRSA colonization Several risk factors for S. aureus and MRSA colonization have been reported, with HIV infection reported as an independent determinant of colonization with both S. aureus and MRSA (Miller et al., 2003; Hidron et al., 2005). Generally, age, gender, close contact among children residing in the same household, homelessness, current antibiotic use, active smoking, and diabetes mellitus have all been reported to predict S. aureus nasal carriage (Miller et al., 2003; Bogaert et al., 2004; Nouwen et al., 2004; Miller et al., 2009; Regev-Yochay et al., 2009; Olsen et al., 2012). Among HIV-infected individuals, factors that reportedly predispose to S. aureus colonization include male gender, antimicrobial therapy in hospitalized patients, HIV infection in patients greater than 42 years of age, and prior hospitalization (Seybold et al., 2009; Lemma et al., 2015). Interestingly, Seybold et al. (2009) reported that HIV infection predicts S. aureus nasal colonization only in patients above the median age of 42 years, but not in younger patients. They 10 University of Ghana http://ugspace.ug.edu.gh further demonstrated that history of hospitalization was not a determinant of S. aureus colonization in individuals with HIV infection, a report recently corroborated by Lemma et al. (2015). Lemma et al. (2015) additionally reported that HIV-infected children who had CD4 counts higher than 350 million cells/L were at a higher risk for S. aureus carriage. This seems somewhat surprising, as having lower CD4 counts has been associated with MRSA colonization by several studies (McDonald et al., 2003; Cenizal et al., 2008; Szumowski et al., 2009; Ramsetty et al., 2010; Heysell et al., 2011; Kyaw et al., 2012). Indeed, the relationship between MRSA colonization and having lower CD4 counts is a curious one, as many other studies have failed to show lower CD4 counts as a significant determinant of MRSA colonization (Villacian et al., 2004; Padoveze et al., 2008; Shet et al., 2009). Additional recognized determinants of MRSA colonization among those with HIV infection include age, lower income, history of pneumonia, lymphoma, prior staphylococcal infection (MSSA or MRSA), skin abscess, not receiving antibiotics, crowding (5 or more members in a household), history of hospitalization of household members for more than twice within twelve months, prior/recent hospitalization, use of street drugs, and incarceration (Cenizal et al., 2008; Kyaw et al., 2012; Zervou et al., 2014; Vieira et al., 2016). Recent hospitalization, substance abuse, and incarceration are determinants of MRSA colonization among those without HIV infection also, together with such risk factors as area of residence, sexual behaviour, antimicrobial usage within 3 months prior to admission, diagnosis of SSTI at admission, and chronic dialysis (Hidron et al., 2005; Shet et al., 2009; Szumowski et al., 2009; Popovich et al., 2013; Zacharioudakis et al., 2014). 11 University of Ghana http://ugspace.ug.edu.gh In their studies, Chambers (2001) and Otter & French (2011) reported that patients admitted to rooms that had been inhabited by MRSA-colonized individuals or currently sharing rooms with MRSA-colonized individuals are at significant risk of colonization with MRSA. The results of Chambers’ two separate studies involving 1) 8 patients admitted to a room that had been hitherto occupied by MRSA patient, and 2) 472-bed acute-care teaching hospital of which MRSA-positive patients were present (as inpatients), showed that these exposures led to MRSA acquisition. Also, in a study involving 198 patients who were sharing rooms with patients who had unrecognized MRSA colonization over a period of 8 years (1996-2004), Otter & French (2011), reported that 12.6% of the patients acquired MRSA strains that were similar to those of their roommates. 2.5.3 MRSA in Ghana Studies on MRSA have not been widely conducted in Ghana, leaving a huge gap in knowledge regarding the dynamics of the pathogen in the country. Notably, with the exception of the study that Donkor and Nartey (2007) conducted in Ghanaian children below five years of age, the few MRSA studies conducted in the country have been recent, with the reports spanning from 2012 to date. The study by Donkor and Nartey (2007) itself was not primarily focused on MRSA, but on bacterial organisms in general. A study by Egyir et al. (2016) conducted among HIV-infected individuals reported 8% and 0% nasal carriage prevalence of S. aureus and MRSA, with the S. aureus isolates belonging to the spa types t304, t084, t645, t10828, t311, t774, and t091. Resistance of the S. aureus isolates to individual antimicrobials were 100% for penicillin, 40% for tetracycline, and 10% each for rifampicin, fusidic acid, norfloxacin, erythromycin, and sulfamethoxazole trimethoprim, with 30% of the S. aureus isolates being multidrug resistant (MDR). The S. aureus and MRSA prevalence reported by Egyir et al. (2016) contrasts a previous report by the study group (Egyir et al., 2014a) 12 University of Ghana http://ugspace.ug.edu.gh in the community. That study reported an overall MRSA prevalence of 0.2%, and S. aureus nasal carriage prevalence of 21%; the prevalence was significantly higher in the urban study site (28%) than in the rural study site (11%). Apart from the high rates of resistance to penicillin (91%) and tetracycline (25%), the antimicrobial resistance rates recorded for the S. aureus isolates sampled from the study participants were generally low, being below 5% against each of fusidic acid, cefoxitin, erythromycin, and norfloxacin. The S. aureus isolates belonged to eleven MLST clonal complexes (CC8, CC152, CC45, CC15, CC121, CC97, CC30, CC5, CC508, CC9, and CC707), and were higher in the prevalence of PVL in the urban study site than in the rural study site. An earlier study at the Korle Bu Teaching Hospital (KBTH) reported S. aureus carriage prevalence of 13.9% and 23.3% in healthcare workers and inpatients respectively, and MRSA prevalence of 0% and 1.3% respectively in healthcare workers and inpatients (Egyir et al., 2013). The rates of resistance of the S. aureus isolates against various antimicrobials were as follows: penicillin (93%), tetracycline (28%) and fusidic acid (12%) cefoxitin (6%), erythromycin (5%), clindamycin (3%), trimethoprim-sulphametoxazole (3%), norfloxacin (2%), gentamicin (2%), rifampicin (1%) and mupirocin (1%), and linezolid (0%), with 13.3% of the S. aureus isolates being MDR. The S. aureus isolates belonged to 55 spa types, the most common ones being: t084, t355, t127, t002, t537, t008, t304, t630, t861, t1510, t10821, t314, t363, t701, t1476, t2649, t2700, and t10822. Also, healthcare workers (p = 0.005) and patients hospitalized for seven days or less (p = 0.007) had a higher probability of being S. aureus carriers. Another study at KBTH (Sampane-Donkor et al., 2017) investigating of Streptococcus pneumoniae carriage in the nasopharynx of HIV-infected children reported S. aureus and MRSA carriage prevalence to be 22% and 3.4% respectively. Furthermore, S. aureus resistance was highest for penicillin (100%), followed by tetracycline (80.8%), cefuroxime (73.1%), erythromycin (38.5%), ciprofloxacin (19.2%), gentamicin (23.8%) 13 University of Ghana http://ugspace.ug.edu.gh and cefoxitin (7.7%), with 84.6% of the S. aureus isolates being MDR (Sampane-Donkor et al., 2017). Also in Ghana, Eibach et al. (2017) reported that 22.1% of children they sampled in their study were S. aureus-colonized, and the carriage prevalence increased to 27.2% in the rainy seasons. Furthermore, 2% of the isolates were demonstrated to be MRSA, 13% displayed resistance to more than two different antimicrobial classes, and 58% carried PVL. The study also revealed that more females (43.7%) were colonized in comparison to fewer males (35.2%). Eibach et al.’s (2017) study showed that S. aureus prevalence among Ghanaian children is dependent on age, sex and seasonality. In comparison to the low MRSA prevalence of 0–3.4% referred to earlier, higher MRSA prevalence have been reported by other studies. Donkor & Nartey (2007), referred to earlier, reported a 15% MRSA nasal carriage prevalence among children at KBTH. Likewise, Odonkor et al. (2012) and Karikari et al. (2017) respectively reported MRSA prevalence of 33.6% in a study involving five hospitals in Accra and 34.8% at the Komfo Anokye Teaching Hospital. The latter two studies however did not focus on colonization, but rather on clinical samples. The method for screening for MRSA may have accounted for the seemingly higher prevalence reported in the studies of Donkor & Nartey (2007), Odonkor et al. (2012) and Karikari et al. (2017). These three studies employed phenotypic MRSA screening methods, whereas the others mentioned earlier employed the technique of molecularly detecting the mecA gene. Recent reports have however reported the novel mecC gene as another molecular mediator of methicillin resistance (Cartwright et al., 2013; Petersen et al., 2013; Becker et al., 2014; García-Garrote et al., 2014; Paterson et al., 2014). Thus studies relying on screening for the mecA gene alone as a means 14 University of Ghana http://ugspace.ug.edu.gh of detecting MRSA, and not in conjunction with phenotypic or mecC gene screening could potentially underestimate the MRSA prevalence. Recently, a study by Saba et al. (2017) sought to ascertain the prevalence and antimicrobial susceptibility patterns of S. aureus and MRSA within the confines of three hospitals. The study was approached via the collection of 120 swab samples from door handles (78%), stair railings (7%), and other points of contact (8%) at the research sites. In total the prevalence of S. aureus was 39%. Of these isolates, 17% were putative MRSA isolates, accounting for an overall prevalence of 0.07%. Among the isolates, one (1) was resistant to oxacillin, cefoxitin, ciprofloxacin, ampicillin, erythromycin, tetracycline, sulfamethoxazole-trimethoprim and streptomycin; five (5) were multi-drug resistant, while the remaining three displayed resistance to two antimicrobials. By implication, Saba et al.’s (2017) study underscores the importance of regular and effective cleaning of door handles and other points of contact (such as stair railings, pipe-taps) in hospitals. It also lends credence to the need for further investigation into whether isolates from door handles or stair railings could be an important factor in nosocomial diseases in several hospitals in Ghana. 2.5.4 MRSA nasal colonization and HIV-infected individuals Most of the studies reporting on MRSA nasal colonization among the HIV-infected are from the developed world (Cenizal et al., 2008; Giuliani et al., 2010; Kyaw et al., 2012; Farley et al., 2015; Hassanzadeh et al., 2015; Imaz et al., 2015; Kotpal et al., 2016). Very few of such studies have been carried out in Africa, providing data on MRSA carriage prevalence and antimicrobial resistance profiles, without reporting on the risk factors for colonization (Amir et al., 1995; Cotton et al., 2008; Heysell et al., 2011; Olalekan et al., 2012; Egyir et al., 2016). 15 University of Ghana http://ugspace.ug.edu.gh Cenizal et al. (2008) assessed MRSA colonization and its risk factors among 146 HIV-infected ambulatory patients attending the HIV clinic of Parkland Hospital in Texas, USA. They reported a nasal carriage prevalence of 10.3% for MRSA, with one participant having axillary colonization also. Similarly, Hassanzadeh et al. (2015) reported a 12.8% MRSA nasal carriage prevalence in a group of HIV-infected individuals in Iran. A parallel report indicated a 9.19% MRSA nasal carriage prevalence among HIV-infected adults of Johns Hopkins University Hospital (Farley et al., 2015). In stark contrast, Giuliani et al. (2010) reported a 0% nasal carriage prevalence of MRSA among HIV-1-infected men who have sex with men in Rome, Italy, even though S. aureus nasal carriage prevalence was 23.1%. Likewise, Imaz et al. (2015) reported S. aureus carriage prevalence of 32.6% and 2.7% in the anterior nares and pharynx respectively and MRSA carriage prevalence of 1% and 2% at those respective anatomical sites among HIV-infected patients in Barcelona, Spain. Kyaw et al. (2012) reported a 5.1% MRSA nasal carriage prevalence among HIV-infected outpatients in Singapore. In a study that Kotpal et al. (2016) conducted among HIV-infected individuals attending a teaching hospital, they reported 44% and 5.98% respectively for S. aureus and MRSA nasal carriage prevalence. In Ghana, a study by Egyir et al. (2016) reported 8% and 0% S. aureus and MRSA nasal carriage prevalence, and a 30% nasal carriage prevalence for MDR S. aureus isolates. Another study by Sampane-Donkor et al. (2017) investigating Streptococcus pneumoniae carriage in the nasopharynx of HIV-infected children reported a 3.4% MRSA carriage prevalence. 16 University of Ghana http://ugspace.ug.edu.gh In neighbouring Nigeria, S. aureus and MRSA nasal carriage prevalence of 33% and 16% respectively were reported among the HIV-infected population as opposed to the 21% and 8% in the HIV-uninfected participants. The isolates from the HIV-infected individuals were additionally more resistant to other antimicrobials than were those from those without HIV infection (Olalekan et al., 2012). 2.5.5 Control of MRSA Generally, measures that are utilized for controlling MRSA in HIV-positive patients include screening for MRSA carriage, improvement of hygiene, isolation of colonized/infected patients, ward closures and, in some situations, decolonization (Muto et al, 2003). With regard to improvement of hygiene, due to their hands being key vectors for nosocomial transmission of MRSA (Ogston, 1984), healthcare workers (exposed to MRSA) are obliged to maintain a high level of hand hygiene at the points of entry and exit of a MRSA patient’s room so as not to transmit it to non-colonized patients. Since the timing of hand hygiene, its efficacy in terms of approaches and compliance by health workers are paramount to achieving any success in this regard, it has been asserted that observance of hand hygiene should be paramount in the following settings: before and after touching a patient or his/her surroundings, before any aseptic procedure, and following exposure to body fluids (Sax et al., 2007). Generally, key ways through which individuals observe hand hygiene include applying hand sanitizers and/or washing hands with soap (Pittet et al., 1999; Bischoff et al., 2000). However, in light of the reports by Meers (1978), Archibald et al. (1997), Klausner et al. (1999), and recent reports by Syed et al. (2014) and Tetteh-Quarcoo et al. (2016), the promotion of hand hygiene as a means of controlling MRSA may require reexamination. According to Meers (1978), frequent hand washing with soap could minimally reduce, or potentially increase, bacterial load of the 17 University of Ghana http://ugspace.ug.edu.gh hands. Moreover, microbial contamination of soaps could occur (Archibald et al., 1997; Klausner et al., 1999). Also, according to Ojajärvi (1980) and Faoagali et al. (1999), at times, hand washing could fail to remove S. aureus and MRSA from the hands. The observations made by Meers (1997) and Ojajärvi (1980) seem to be mirrored by the report by Tetteh-Quarcoo et al. (2016), who evaluated the microbiological quality of water used for hand washing in preschools; the researchers reported that water from all the schools sampled were heavily contaminated with microbes, mainly, staphylococci. A further twist to the campaign on hand hygiene is the report of Syed (2014), in which triclosan, a component of many soaps and hand sanitizers, was shown to promote S. aureus colonization. 18 University of Ghana http://ugspace.ug.edu.gh CHAPTER THREE 3.0 METHODOLOGY 3.1 Study area This study was conducted at the Princess Marie Louise Children’s Hospital (PML) in Accra, the capital city of Ghana. According to the Ghana Statistical Service (2012), the city is inhabited by about two million people, and has 27 hospitals. PML is the only children’s hospital in Ghana. Its HIV clinic, which operates on Tuesdays and Thursdays, attends to about 414 patients – 150 children and 264 adults – per year (personal communication). 3.2 Study design and sampling The study was cross-sectional, and involved 107 children with HIV infection and an equal number of sex- and age group-matched apparently healthy HIV-uninfected children (control group) recruited between January and July, 2017. The HIV-infected participants were recruited from among HIV-infected children attending the outpatient HIV clinic of the hospital, whilst the control group was recruited from the environs of the hospital. The inclusion criteria for selection of the HIV-infected participants included: being an HIV-infected individual in a steady state, being less than 15 years of age, and being an outpatient. In the selection of the participants of the control group, the inclusion criteria satisfied were: being HIV-negative, being apparently healthy, and being less than 15 years of age. In both study groups, the exclusion criteria were: being on antimicrobials (other than cotrimoxazole) two weeks prior to sampling, having known co-morbidities, and inability to determine the HIV status of potential participants. 19 University of Ghana http://ugspace.ug.edu.gh The minimum sample size was determined as follows: n = z² x p (1- p) m² Description: n= minimum sample size z = confidence level at 95% (standard value of 1.96) m = margin of error at 5% (standard value of 0.05) p = estimated MRSA nasopharyngeal carriage prevalence = 3.4% or 0.034 (Sampane-Donkor et al., 2017). n = 1.962× 0.034 (1- 0.034) = 50.57 (0.05)2 Thus the minimum sample size was calculated to be 51. In order to further increase the statistical power of the study, the sample size was increased to 107. 3.3 Specimen and risk factors data collection Anterior nasal swabs were obtained from the study participants between January and July, 2017. The swab specimens were collected by a trained paediatrician after obtaining informed consent from the guardians of the study participants. For each participant, a sterile cotton swab was rotated five times in both anterior nares. The swab specimen was then placed in a pre-labeled vial containing 1ml skim milk-tryptone-glucose-glycerin (STGG) medium and cut aseptically with a pair of scissors (which had been disinfected using a 70% alcohol wipe) such that the swab and a part of its handle, totalling about 4cm in length, would remain in the medium-contained vial. The cap of the vial was then tightened, and the specimen was maintained on ice, and transported within 20 University of Ghana http://ugspace.ug.edu.gh four hours to the research laboratory of the Department of Medical Microbiology (SBAHS). The specimens were then vortexed for about two minutes and stored in a -80 centigrade freezer until needed. Furthermore, a pretested structured questionnaire (Appendix III) was used to collect data on risk factors for S. aureus carriage from the study participants. The questionnaire was divided into three parts, namely, demography, household characteristics, and clinical features, and the responses were obtained by interview and review of patients’ folders. 3.4 Analysis of specimen The specimens were pre-enriched in 5ml of tryptic soy broth, and after 24 hours of incubation at 37ºC, inoculated with a sterile loop on blood, chocolate, and MacConkey agars. The blood agar and chocolate agar plates were incubated at 37ºC in 5% CO2, whereas the MacConkey agar plates were incubated aerobically at 37ºC. The plates were examined for growth after 18–24 hours. 3.5 Identification of Staphylococcus aureus, MRSA, and other bacteria Following the guidelines by Baron et al. (1994), S. aureus colonies were presumptively identified from the primary plates based on colonial morphology. These were thereafter touched and streaked onto blood agar plates, and thereafter incubated at 37ºC in 5% CO2 for 18–24 hours. The plates were subsequently examined for growth and identified based on colonial morphology, haemolysis, Gram staining, catalase test and tube coagulase test. S. aureus isolates were screened for cefoxitin resistance by the Kirby Bauer method using Mueller-Hinton agar plates. After incubation, isolates that showed zones of inhibition of ≤ 22mm were interpreted as cefoxitin-resistant, and were identified as MRSA. Cefoxitin-resistant S. aureus isolates were screened for carriage of the mecA and nucA genes. 21 University of Ghana http://ugspace.ug.edu.gh Other bacterial colonies that grew on the plates were identified by observing their colonial morphologies, reactions to Gram’s stain, and their response to standard biochemical tests, including catalase, tube coagulase, oxidase, triple sugar iron, citrate and indole tests. 3.6 Antimicrobial susceptibility testing Following the Clinical and Laboratory Standards Institute (CLSI, 2017) guidelines, susceptibility of S. aureus to standard antimicrobials was tested by the Kirby Bauer method, using the following antimicrobials: tetracycline (30 µg), erythromycin (15 µg), gentamicin (10 µg), rifampicin (5 µg), cotrimoxazole (1.25 + 23.75 µg), penicillin (10 µg), clindamycin (2 µg), fusidic acid (10 µg), cefoxitin (30 µg), linezolid (10 µg), and vancomycin (30 µg). Each test isolate was emulsified in peptone water to create a suspension similar in turbidity to that of 0.5% McFarland standard, with the help of a nephelometer. A sterile cotton swab was dipped into the suspension, and the swab was pressed against the interior walls of the container to drain excess fluid. The resultant swab was thereafter swabbed evenly across the entire surface of a Mueller Hinton agar plate, in three different dimensions, to obtain a semi-confluent growth following incubation. The plates were incubated at 37ºC for 18–24 hours, after which the zones of inhibitions around the antimicrobial discs were measured and interpreted according to the breakpoints of CLSI (2017). The control S. aureus strain used was ATCC 25923. 3.7 Molecular investigations Extraction of genomic DNA was done from overnight Lysogeny broth (LB) cultures of the seven cefoxitin-resistant S. aureus isolates (for both the HIV-infected and uninfected participants) and a positive control isolate using the Zymo Research extraction kit, following the instructions of the manufacturer. 22 University of Ghana http://ugspace.ug.edu.gh For quality control purposes, 5 µL of the extracted DNA from each isolate was mixed with 2 µL of bromophenol blue gel loading buffer and ran on a 1.2% agarose gel, and the bands visualized by UV illumination. Carriage of the mecA and nucA genes were detected by conventional PCR amplification using the extracted DNA samples as templates. The negative control used was RNase-free water. The total reaction volume for the PCR was 50 uL, consisting of the genomic DNA (of final concentration 60 ng/µL), PCR water, primers (of final concentration 0.2 µM), Taq polymerase (of final concentration 1.25 U/µL), MgCl2 (of final concentration 2 mM), and dNTPs (of final concentration 200 µM). The amplicons were visualized by UV illumination, preceded by separation by a 1.2% agarose gel electrophoresis. For the mecA PCR, the primer sequences used were ATCGATGGTAAAGGTTGGC (forward primer) and AGTTCTGCAGTACCGGATTTGC (reverse primer) (Sajith Khan et al., 2012), and the cycling conditions were: initial denaturation at 95°C for 3 minutes; denaturation at 94°C for 1 minute; annealing at 55°C for 30 seconds; extension at 72°C for 1 minute; final extension at 72°C for 6 minutes; the total number of cycles was 33. Using the same cycling conditions as those used in the mecA PCR, a nucA PCR was performed on all the DNA samples, including those of cefoxitin-resistant S. aureus descent that showed no bands for the mecA genes, in order to ascertain that S. aureus ancestors of those DNA samples were in fact, S. aureus (Brakstad et al., 1992). The primer sequences used were GCGATTGATGGTGATACGGTT (forward primer) and AGCCAAGCCTTGACGAACTAAAGC (reverse primer) (Brakstad et al., 1992). 23 University of Ghana http://ugspace.ug.edu.gh 3.8 Ethical considerations All procedures undertaken in this study were done in consonance with ethical guidelines, including demonstrating a high measure of respect for the rights and confidentiality of all the study participants. Approval for the conduction of this study was given by the Ethical and Protocol Review Committee of the College of Health Sciences, with protocol identification number “CHS- Et/M.3 – P 4.4/2016-2017”. Furthermore, parents/guardians of the children gave their informed consent before the children were recruited as study participants, and children between six and fourteen years of age were required to give their assent. In addition, the risks and benefits associated with the study were clearly explained to the prospective study participants in order for them to make an informed choice of enrolling in the study. All data, both electronic and physical, were stored in secure password-protected archival systems. 3.9 Data analysis Data were analyzed with the help of Stata, version 14. Data on the bacterial flora colonizing the study participants, and data on resistance of S. aureus to the antimicrobials tested were summarized using descriptive statistics. Independent sample Chi-square tests were performed to determine the association between HIV infection and S. aureus and MRSA colonization, and also, within each group, association between individual categorical risk factors and S. aureus and MRSA colonization. A point biserial correlation was performed to determine association between risk factors that were continuous variables and S. aureus and MRSA colonization. Finally, risk factors that showed significant association with colonization in the Chi-square and point biserial correlation tests were put in a binary logistic regression model to determine their predictive value of colonization. 24 University of Ghana http://ugspace.ug.edu.gh The significance of each predictor variable of colonization was assessed by determining the p value, odds ratio, and confidence interval; p values less than 0.05 were considered significant. 25 University of Ghana http://ugspace.ug.edu.gh CHAPTER FOUR 4.0 RESULTS 4.1 Demographic, household, and clinical characteristics of the study participants A total of one hundred and seven (107) each of HIV-infected and uninfected children were recruited in this study; their demographic and household features are presented in Table 1. For each group, the males and females comprised 54.2 and 45.8% respectively. The mean BMI recorded for the HIV-infected and HIV-uninfected participants were 16.41 Kg/m2 and 17.66 Kg/m2 respectively. The mean age of the HIV-infected participants was 6.36 years, and for the HIV-uninfected participants, it was 6.32 years. With the exception of those aged less than 1 year who comprised 1.9% in each study group, the age distribution was similar for the rest of the age groups in both study groups, namely, 1–4years (38.3% in the HIV-infected group and 37.4% in the HIV-uninfected group), 5–9 years (32.7% in the HIV-infected group and 36.4% in the HIV- uninfected group), and > 9 years (27.1% in the HIV-infected group and 24.3% in the HIV- uninfected group). For both groups, a greater proportion of the participants were currently enrolled in school (74.8% for the HIV-infected and 83.2% for the HIV-uninfected group), rarely washed their hands with soap (92.5% in the HIV-infected group and 95.3% in the HIV-uninfected group), and lived in compound houses (86% for the HIV-infected and 84.1% for the HIV-uninfected group). Similarly, the number of individuals per household decreased across < 5 (61.7% for the HIV-infected and 58.9% for the control group), 5–10 persons (35.5% for the HIV-infected and 40.2% for the control group), and 11–20 persons (2.8%% for the HIV-infected and 0.9% for the control group), and less than 4% of the participants lived in households which had health worker. 26 University of Ghana http://ugspace.ug.edu.gh In the HIV-infected group, a greater proportion of the participants were on cotrimoxazole prophylaxis (88.8%) and antiretroviral therapy (89.7%), and indicated that they practice self- medication (58.9%, which is higher than the 41.1% recorded in the HIV-uninfected group). Also, a greater proportion of them had been hospitalized in the past year than those in the HIV-uninfected group (29.9% vs. 11.2%), with 68.9% (as opposed to 100% in the HIV-uninfected group) of that proportion being hospitalized once and 31.1% (as opposed to 0% in the HIV-uninfected group) of them being hospitalized twice. None of the participants in both groups had a chronic skin condition or a history of surgery. However, more participants in the HIV-infected group had a history of pneumonia (4.7% vs. 0.9%) and tuberculosis (6.5% vs. 0%) than the HIV-uninfected group. The clinical features of the study participants are presented in Table 2 below. 27 University of Ghana http://ugspace.ug.edu.gh Table 1: Demographic and household characteristics of the study participants Demographic and household HIV-infected HIV-uninfected characteristics Number % Number % Age < 1year 2 1.9 2 1.9 1–4 years 41 38.3 40 37.4 5–9 years 35 32.7 39 36.4 > 9 years 29 27.1 26 24.3 Gender Male 58 54.2 58 54.2 Female 49 45.8 49 45.8 Current school enrolment Yes 80 74.8 89 83.2 No 27 25.2 18 16.8 Type of residence Self-contained 15 14 17 15.9 Compound 92 86 90 84.1 Number of individuals in household < 5 66 61.7 63 58.9 5–10 persons 38 35.5 43 40.2 11–20 persons 3 2.8 1 0.9 Presence of health worker in household Yes 4 3.7 3 2.8 No 103 96.3 104 97.2 Hand washing with soap Rarely 99 92.5 102 95.3 Often 8 7.5 5 4.7 BMI (HIV-infected) (̅̅𝑋̅, 𝑆𝐷) = 16.41, 9.06 Kg/m2; BMI (HIV-uninfected)̅̅(𝑋̅, 𝑆𝐷) = 17.66, 3.87Kg/m2 28 University of Ghana http://ugspace.ug.edu.gh Table 2: Clinical features of the study participants Clinical features HIV-infected HIV-uninfected Number % Number % Self-reported self-medication Yes 63 58.9 44 41.1 No 44 41.1 63 58.9 Cotrimoxazole prophylaxis Yes 95 88.8 0 0 No 12 11.2 107 100 Antiretroviral therapy Yes 96 89.7 0 0 No 11 10.3 107 100 History of hospitalization in the past year Yes 32 29.9 12 11.2 No 75 70.1 95 88.8 Frequency of hospitalization in the past year 0 75 70.1 95 88.8 1 22 20.6 12 11.2 2 10 9.3 0 0 Chronic skin condition Yes 0 0 0 0 No 107 100 107 100 History of pneumonia Yes 5 4.7 1 0.9 No 102 95.3 106 99.1 History of TB Yes 7 6.5 0 0 No 100 93.5 107 100 History of surgery Yes 0 0 0 0 No 107 100 107 100 Mean CD4 count of HIV-infected participants = 731.20 ± 641.98 cells/mm3 29 University of Ghana http://ugspace.ug.edu.gh 4.2 Bacteria isolated from the HIV-infected and uninfected participants The bacterial flora present in the anterior nares of the participants of both study groups was diverse, comprising both Gram-positives and Gram-negatives. Two bacterial species alternately dominated in both groups. Among the HIV-infected participants, S. aureus was the dominant bacterium, accounting for 44.9%, followed by coagulase-negative Staphylococci (CONS) (43.0%). In the HIV-uninfected group, CONS dominated (55.1%), followed by S. aureus (23.4%). Details of bacteria isolated from the study participants are presented in Table 3 below. 30 University of Ghana http://ugspace.ug.edu.gh Table 3: Bacteria isolated from the study participants Bacteria isolated HIV-infected HIV-uninfected Number Prevalence Number Prevalence (%) (%) Staphylococcus aureus 48 44.9% 25 23.4% MRSA 6 5.6% 1 0.9% CONS 46 43.0% 59 55.1% Moraxella catarrhalis 4 3.7% 2 1.9% Diphtheroids 3 2.8% 9 8.4% Streptococcus viridans 2 1.9% 0 0.0% Streptococcus 3 2.8% 0 0.0% pneumoniae Klebsiella spp 3 2.8% 0 0.0% Klebsiella pneumoniae 1 0.9% 0 0.0% Pseudomonas 1 0.9% 0 0.0% aeruginosa Micrococcus spp. 1 0.9% 2 1.9% Citrobacter koseri 1 0.9% 0 0.0% 31 University of Ghana http://ugspace.ug.edu.gh It is observed from Table 3 above that the S. aureus carriage prevalence was higher among the HIV-infected participants than the HIV-uninfected participants (44.9% vs. 23.4%). This observation was similar for the MRSA carriage prevalence (5.6% vs. 0.9%). The Chi-square test indicated a significant association between HIV infection and S. aureus colonization, but not for MRSA colonization, {[S. aureus χ2 (1, n = 107) = 10.99, p = .001]; [MRSA χ2 (1, n = 107) = 3.69, p = .055]}. The odds ratio (OR) for S. aureus colonization was found to be 2.67, implying that, the odds of an individual to carry S. aureus was about 2.7 times higher if the individual is HIV infected than if not infected. As observed in Figure 1 below, two of the seven cefoxitin-resistant S. aureus isolates screened for carriage of the mecA gene did not yield positive results. These isolates, together with the other cefoxitin-resistant S. aureus isolates however showed positive results for the presence of the nucA gene, confirming them to be S. aureus (Brakstad et al., 1992). This is evident in Figure 2 below. 32 University of Ghana http://ugspace.ug.edu.gh L Is1 Is2 Is3 Is4 Is5 Is6 Is7 +C -C L Figure 1: Screening of the cefoxitin-resistant S. aureus isolates for mecA gene carriage In the figure, L represents Ladder; Is represents Isolate; +C represents positive control; -C represents negative control Is1 Is2 Is3 Is4 Is5 Is6 Is7 +C -C L Figure 2: Screening of the cefoxitin-resistant S. aureus isolates for nucA gene carriage In the figure, L represents Ladder; Is represents Isolate; +C represents positive control; -C represents negative control 33 University of Ghana http://ugspace.ug.edu.gh 4.3 Risk factors for S. aureus and MRSA colonization among the study participants In the logistic regression analysis, the main predictor of S. aureus colonization was absence of colonization with CONS, in both the HIV-infected and HIV-uninfected participants. This indicates that colonization with CONS is protective of S. aureus colonization, regardless of HIV infection status. By inference, absence of colonization with CONS was not a unique risk factor for S. aureus colonization among the HIV-infected participants. Furthermore, the main predictor of MRSA colonization was regular hand washing with soap. The risk factors for S. aureus and MRSA colonization are presented in Table 4 below. 34 University of Ghana http://ugspace.ug.edu.gh Table 4: Risk factors for S. aureus and MRSA colonization HIV-infected HIV-uninfected Risk factor OR (95% CI) p value OR (95% CI) p value Colonization with 0.078 (0.028–0.217) < 0.001 0.038 (0.008–0.174) < 0.001 CONS* Regular hand 6.462 (1.06–39.395) 0.043 N/A N/A washing with soap+ *associated with S. aureus colonization +associated with MRSA colonization N/A = Not applicable 35 University of Ghana http://ugspace.ug.edu.gh 4.4 Antimicrobial resistance patterns of the S. aureus and MRSA isolates of the study participants The highest proportions of S. aureus resistance to the various antimicrobials was recorded for penicillin (98.1% in the HIV-infected and 96% in the control group) and cotrimoxazole (61% in the HIV-infected and 72% in the control group), with no isolate recording resistance against fusidic acid, linezolid, and vancomycin (Figure 5). The proportion of multidrug resistant (MDR) S. aureus was 62.3% (33/53) in the HIV-infected group and 80% (20/25) in the control group. In the HIV- infected group, the rates of antimicrobial resistance among the MDR isolates decreased across penicillin (100%, n = 33), cotrimoxazole (90.9%, n = 30), tetracycline (57.6%, n = 19), rifampicin (42.4%, n = 14), erythromycin (39.4%, n = 13), clindamycin (30.3%, n = 10), gentamicin (24.2%, n = 8), and cefoxitin (18.2%, n = 6). In the control group, the rates of antimicrobial resistance among the MDR isolates decreased across penicillin (95%, n = 19), cotrimoxazole (90%, n = 18), clindamycin (55%, n = 11), erythromycin (55%, n = 11), tetracycline (50%, n = 10), rifampicin (45%, n = 9), gentamicin (20%, n = 4), and cefoxitin (5%, n = 1). The antibiograms of the study isolates for both study groups are presented in Tables 9 and 10. 36 University of Ghana http://ugspace.ug.edu.gh Table 5: Antibiogram of the S. aureus isolates HIV-infected HIV-uninfected Antibiogram n Antibiogram n Pen 6 Pen 3 Tet-Pen 7 Pen-Cln 2 Tet-Cot 1 Cot-Pen-Cln 1 Cot-Pen 6 Tet-Cot-Pen 1 Rif-Pen 2 Gen-Cot-Pen 1 Tet-Cot-Pen 9 Ery-Cot-Cln 1 Ery-Cot-Pen 1 Ery-Rif-Pen-Cln 1 Tet-Pen-Cln 1 Ery-Cot-Pen-Cln 1 Rif-Cot-Pen 1 Ery-Gen-Cot-Pen 1 Rif-Pen-Cln 1 Tet-Ery-Cot-Pen 1 Ery-Rif-Cot-Pen 1 Tet-Cot-Pen-Cln 1 Rif-Cot-Pen-Cln 1 Tet-Gen-Rif-Pen 1 Rif-Pen-Cln-Cef 2 Tet-Rif-Cot-Pen 1 Gen-Cot-Pen-Cef 1 Tet-Ery-Cot-Pen 1 Ery-Cot-Pen-Cef 1 Rif-Cot-Pen-Cln 1 Tet-Ery-Cot-Pen 1 Tet-Ery-Cot-Pen 1 Tet-Rif-Cot-Pen-Cln 1 Gen-Rif-Cot-Pen 1 Tet-Gen-Rif-Cot-Pen 1 Ery-Rif-Cot-Pen-Cln 2 Tet-Ery-Gen-Cot-Pen 2 Tet-Cot-Pen-Cln-Cef 1 Tet-Ery-Cot-Pen-Cln 1 Tet-Ery-Rif-Cot-Pen-Cln 2 Tet-Ery-Rif-Cot-Pen 1 Ery-Gen-Rif-Cot-Pen 1 Ery-Rif-Pen-Cln-Cef 1 Ery-Gen-Rif-Cot-Pen-Cln 1 Tet-Ery-Gen-Rif-Cot-Pen 1 Tet-Ery-Gen-Rif-Cot-Pen-Cln- 1 Cef Pen = Penicillin; Tet = Tetracycline; Cot = Cotrimoxazole; Rif = Rifampicin; Ery = Erythromycin; Cln = Clindamycin; Gen = Gentamicin; Cef = Cefoxitin 37 University of Ghana http://ugspace.ug.edu.gh 100 80 60 40 20 0 Antibiotics S. aureus isolates from HIV-infected participants (n=53) S. aureus isolates from HIV-uninfected participants (n=25) Figure 3: Rates of resistance of S. aureus isolates to standard antimicrobials 38 Resistance (%) University of Ghana http://ugspace.ug.edu.gh Table 6: Antimicrobial resistance patterns of the MRSA isolates Antimicrobials Is1 Is2 Is3 Is4 Is5 Is6 Is7 Tetracycline Sen Sen Sen Sen Res Sen Res Erythromycin Sen Res Sen Res Res Sen Sen Gentamicin Res Sen Sen Sen Res Sen Sen Rifampicin Sen Sen Res Res Res Res Sen Cotrimoxazole Res Res Sen Sen Res Sen Res Penicillin Res Res Res Res Res Res Res Clindamycin Sen Sen Res Res Res Res Res Fusidic acid Sen Sen Sen Sen Sen Sen Sen Cefoxitin Res Res Res Res Res Res Res Linezolid Sen Sen Sen Sen Sen Sen Sen Vancomycin Sen Sen Sen Sen Sen Sen Sen Sen = Sensitive; Res = Resistant; Is = Isolate 39 University of Ghana http://ugspace.ug.edu.gh CHAPTER FIVE 5.0 DISCUSSION 5.1 Bacterial flora colonizing the anterior nares of the study participants One aspect of this study investigated the bacterial flora colonizing the anterior nares of the HIV- infected and uninfected participants. The bacterial flora present in the anterior nares of the participants in both study groups was diverse, comprising both Gram-positives and Gram- negatives. This diversity is somewhat similar to that reported by Donkor and Nartey (2007) in participants less than five years old, except that in that study, additional organisms (Streptococcus pyogenes, Enterobacter spp., Escherichia coli, Morganella morgana, and Pseudomonas spp.) were isolated. In the current study, two bacterial species alternately dominated in both groups. Among the HIV-infected participants, S. aureus was the dominant bacterium, accounting for 44.9%, followed by coagulase-negative Staphylococci (CONS) (43.0%). In contrast, within the control group, CONS was predominant (55.1%), followed by S. aureus (23.4%). This observation in the control group further contrasts the study outcome of Donkor & Nartey (2007) in which the predominant organism was S. aureus (49%), followed by CONS (27.4%). These findings additionally contrast earlier findings of Sampane-Donkor et al. (2017) who recorded Moraxella catarrhalis as the predominant bacterium (39.8%) and CONS as second highest frequently isolated bacterium among HIV-infected children in Ghana. Though the bacterial diversity among the HIV- infected participants in their study was similar to that observed in the present study, Neisseria meningitidis, which was isolated in that study was not isolated among the HIV-infected participants in this study. It is noted however, that Sampane-Donkor and his colleagues used swabs obtained from the nasopharynx, which is the ecological niche of the bacterium they primarily 40 University of Ghana http://ugspace.ug.edu.gh investigated, Streptococcus pneumoniae. This difference in the source of specimens from study participants likely accounted for the difference in bacterial dominance and diversity identified in this study compared to that of Sampane-Donkor et al.’s (2017). That S. aureus colonization was lower among the HIV-uninfected participants compared to the HIV-infected participants could be as a result of the dominance of CONS. This is probably the case since Paharik et al. (2017) have indicated elsewhere that CONS prevent S. aureus colonization by inhibiting agr quorum sensing in S. aureus using its autoinducing peptide (AIP). Moreover, earlier studies by Iwase et al. (2010) and Olson et al. (2014) demonstrated that Staphylococcus epidermidis, one of the organisms categorized as CONS, prevents S. aureus colonization. 5.2 The relationship between HIV infection and colonization with S. aureus and MRSA Another objective of this study was to investigate the relationship between HIV infection and S. aureus and MRSA colonization. From available literature, this study seems to be the first in Africa to have investigated S. aureus and MRSA nasal carriage among children harboring HIV infection in comparison with children without HIV infection. Overall, this study identified HIV infection as a risk factor for S. aureus colonization, but not for MRSA colonization. The results indicate a significantly higher S. aureus prevalence among the HIV-infected participants (44.9%), which was significantly higher than the 23.4% prevalence observed in the control arm of the study (44.9% vs. 23.4%; p = 0.001). It is also in stark contrast with the 8% prevalence reported in an earlier study involving HIV-infected individuals in Ghana (Egyir et al., 2016). It should be noted however that the participants in Egyir et al.’s (2016) study were adults and consisted of both inpatients and outpatients, whereas those in the current study were 41 University of Ghana http://ugspace.ug.edu.gh ambulatory children. Even though another earlier study among HIV-infected children in Ghana also reported a relatively lower prevalence of 22.0%, it is noted that these researchers used swabs from the nasopharynx (Sampane-Donkor et al., 2017), which is not an ecological niche for S. aureus. That the source of swabs used to determine prevalence of S. aureus influence the rate of prevalence is attested to by the findings of other researchers in Africa (Lemma et al., 2015). These researchers recorded a higher prevalence for S. aureus from the nasal specimens (51.5%) than from the perineal swabs, at rates about half of the values for nasal carriage. Although the S. aureus nasal carriage prevalence reported in the current study (44.9%) is lower than what was reported by Lemma et al. (2015), it is higher than the 33% and 25% reported by Olalekan et al. (2012) and Heysell et al. (2013) respectively. Nonetheless, when the S. aureus prevalence is considered in totality (44.9% in the HIV-infected and 23.4% in the control group), it does compare well with that reported by Olalekan et al. (2012) among adults with HIV infection. In their study, the S. aureus nasal colonization prevalence was significantly higher in the HIV-infected group than the control group (33% vs. 21%; p = 0.0001). Moreover, it should be noted that the study of Heysell et al. (2013) referred to earlier was conducted among TB in-patients with advanced HIV infection. The S. aureus prevalence observed among HIV-infected individuals in the current study is consistent with those reported by studies conducted outside Africa too. It is most comparable to the case-control study carried out in India by Kotpal et al. (2016) who reported a 44% S. aureus nasal carriage prevalence among HIV-infected individuals; this prevalence was significantly higher than that observed in the control group in their study (44% vs. 24%; p = 0.035). Results similar to this finding was reported by D’Avila et al. (2008) in Brazil. These researchers found that S. aureus nasopharyngeal colonization was higher among HIV-1-infected children than those without the infection (45.16% vs. 12.9%, p = 0.001). Also, Imaz et al. (2015) reported a nasal and 42 University of Ghana http://ugspace.ug.edu.gh pharyngeal S. aureus colonization prevalence of 32.6% and 2.7% respectively among a group of HIV-infected individuals in Spain. Similarly, Datta et al. (2008) found the prevalence of S. aureus nasal carriage to range between 36.5% and 48% across study sites in Switzerland, further supporting the results of this study. HIV infection is reported to be an independent determinant of S. aureus colonization (Hidron et al., 2010). The situation was no different in this study group, which recorded a higher prevalence of S. aureus. That the HIV-infected group recorded a higher prevalence of S. aureus than the control group could have been attributed to immunosuppression, except that in this group of children with HIV infection, the mean CD4 count was 731.2 cells/mm3, and that falls within the normal range (500–1500 cells/mm3) (www.hiv.va.gov/patient/diagnosis/labs-CD4-count.asp). Moreover, in this cohort, the level of CD4 counts did not have a significant association with S. aureus colonization (p = 0.678). However, it has been noted elsewhere that immunosuppression is linked with a higher risk of colonization of PVL-positive S. aureus (Schaumburg et al., 2014). Furthermore, S. aureus isolates from Africa are known to have a higher prevalence of PVL, a toxin which among other things enhances adherence of S. aureus to extracellular matrix, thus facilitating successful colonization. With regard to nasal carriage of MRSA, the prevalence was also higher in the HIV-infected group than the control group, albeit not statistically significant (5.6% vs. 0.9%; p = 0.055). It must be noted, however, that the p value for the observed difference was marginally above the alpha level of 0.05, indicating that an increase in sample size could possibly render the difference observed as significant. Nonetheless, the absence of statistical significance with regard to the difference in MRSA colonization between the HIV-infected and control groups is similar to the observation made in Nigeria by Olalekan et al. (2012), whose higher MRSA prevalence among HIV-infected 43 University of Ghana http://ugspace.ug.edu.gh participants was not significantly different from that recorded within the control group (16% vs. 8%; p = 0.13). The observed MRSA nasal carriage prevalence among the HIV-infected is higher than the 0% reported by Egyir et al. (2016) among HIV-infected adults, and marginally higher than that reported in the nasopharynx of HIV-infected children (3.4%) by another Ghanaian study (Sampane-Donkor et al., 2017). It is however substantially lower than the 16.8% and 21% reported by Lemma et al. (2015) in Ethiopia and Heysell et al. (2013) in South Africa respectively. Almost half (42%) of the participants in the study of Lemma et al. (2015) were designated to be at WHO stage III and IV HIV infection, an indication of advanced HIV infection. The participants in the study of Heysell et al. (2013) were residents of an HIV endemic region, had advanced HIV infection (median CD4+ count = 37 cells/mm3), were co-infected with TB, and were also hospitalized. Notably, hospitalization could promote MRSA dissemination via contaminated surfaces or direct contact with MRSA-colonized patients/health care providers (Vyas et al., 2014). These may account for why the two studies (Lemma et al., 2015; Heysell et al. 2013) recorded a markedly higher MRSA prevalence than the current study. With regard to similar studies conducted outside Africa, the MRSA nasal carriage prevalence observed among the HIV-infected individuals relative to the control group (5.6% vs. 0.9%; p = 0.055) is consistent with that reported by Kotpal et al. (2016) in India (6% vs. 2%). Unfortunately, the researchers failed to report whether or not this observed difference in prevalence was statistically significant. The MRSA prevalence observed in the current study group is however higher than the 0–1% reported by Giuliani et al. (2010) and Imaz et al. (2015) among HIV-infected individuals in Italy and Spain respectively. Yet, it is lower than the 9.19–10.3% reported by Farley et al. (2015) and Cenizal et al. (2008) among individuals with HIV infection in USA. 44 University of Ghana http://ugspace.ug.edu.gh Although it has been reported in earlier studies that persons harboring HIV infection are predisposed to MRSA colonization (Hidron et al., 2005; Shet et al., 2009; Popovich et al., 2013; Zervou et al., 2014), this study found no such association. The reason for this observation is unclear, but could be multifactorial: The study participants were in steady state, and their health had not deteriorated to an extent that would require hospitalization; in fact, their mean CD4+ count was 731.2 cells/mm3, 89.7% of the participants were on antiretroviral therapy, and only 29.9% of them had been hospitalized in the year prior to the commencement of the study. Antiretroviral therapy has been demonstrated to counter some of the immunologic abnormalities that predispose HIV-infected persons to colonization with MRSA (Imaz et al., 2010). Moreover, lower CD4 counts, prior hospitalization and hospitalization have all been associated with a higher rate of MRSA colonization (Vyas et al., 2014; Zervou et al., 2014). 5.3 Risk factors for S. aureus and MRSA colonization This study additionally aimed to identify specific risk factors that could improve insight on the dynamics of S. aureus and MRSA nasal colonization among HIV-infected children in Ghana. Among the independent variables evaluated as risk factors for S. aureus and MRSA colonization, absence of colonization with CONS was identified as a determinant of S. aureus carriage, regardless of HIV infection status. Colonization with CONS appears to be protective of S. aureus colonization. This finding is supported by the reports of Iwase et al. (2010), Olson et al. (2014), and Paharik et al. (2017) referred to earlier. The other independent variables evaluated were demonstrated not to be predictors of S. aureus colonization. Elsewhere, some of these variables, such as age, gender, and history of hospitalization, have been identified as predictors of S. aureus colonization (Miller et al., 2003; Bogaert et al., 2004; Nouwen et al., 2004; Miller et al., 2009; Regev-Yochay et al, 2009; Seybold 45 University of Ghana http://ugspace.ug.edu.gh et al., 2009; Lemma et al., 2015). The inability of these variables to predict colonization in this study could possibly be as a result of variations of the current population from that of the populations in other studies. With regard to MRSA colonization, none of the variables were demonstrated to be predictive of colonization among the HIV-uninfected individuals. This was expected, given that only one HIV- uninfected participant was MRSA-colonized. Regular hand washing was shown to be a significant predictor of MRSA colonization among the HIV-infected participants. HIV-infected participants who regularly washed their hands with soap were 6.462 times more likely to be MRSA-colonized. This finding is interesting, as good hygiene practices have been promoted as a means of controlling the spread of infections of several pathogens for many years (Khan, 1982; Garner & Favero, 1986; Stanton & Clemens, 1987; Wilson et al., 1991; Pinfold & Horan, 1996; Widmer, 2000; Freeman et al., 2014). Nonetheless, the finding that regularly washing the hands with soap is a determinant of MRSA colonization is supported by a recent study by Syed et al. (2014). That study demonstrated that triclosan, a biocidal component of soaps and many skin care products, was commonly present in nasal secretions, and facilitated S. aureus binding with nasal proteins, such as keratin, fibronectin, and collagen. Consequently, hand washing with soaps that contain triclosan could potentially predispose individuals to S. aureus and MRSA carriage. Moreover, the study by Tetteh-Quarcoo et al. (2016) highlights the potential for dissemination of the pathogen through water of poor microbiological quality, and this may have contributed to the finding that regular hand washing with soap promotes S. aureus and MRSA carriage. 46 University of Ghana http://ugspace.ug.edu.gh 5.4 Antimicrobial resistance patterns of the S. aureus and MRSA isolates Finally, this study investigated the antimicrobial resistance patterns of S. aureus and MRSA isolated from the HIV-infected and uninfected participants. No resistance was recorded for fusidic acid, linezolid, and vancomycin among the S. aureus isolates in both the HIV-infected and the control groups. This rate of fusidic acid resistance contrasts the higher rate reported in another cohort of HIV-infected individuals (10%) (Egyir et al., 2016) and another study in the general population (12%) (Egyir et al., 2013), but consistent with the low rates of 0–2.4% reported by Egyir et al. (2014a), Egyir et al. (2014b), and Dekker et al. (2016). Moreover, the rate of linezolid and vancomycin resistance recorded for S. aureus in this study are consistent with those reported in earlier studies (Egyir et al., 2013; Dekker et al., 2016). These three antimicrobials are not widely available in the country, are quite expensive, and are rarely used or abused. Hence the low rates of resistance recorded against them in this study was expected. The HIV-infected group recorded higher resistance rates for penicillin, tetracycline, and cefoxitin than did the control group. This finding corroborates that of the study of (Olalekan et al., 2016) in which the S. aureus isolates carried by the HIV-infected participants recorded higher rates of antimicrobial resistance than did the control. However, the control group carried S. aureus isolates with higher antimicrobial resistance rates for five antimicrobials (erythromycin, cotrimoxazole, rifampicin, clindamycin, and gentamicin). To put the higher resistance rates recorded against five antibiotics within the control group in perspective, it must be noted that the percentage resistance recorded within the control group was based on a total number of twenty-five (25) S. aureus isolates, whereas that in the HIV-infected group was based on a total of fifty-two (52) S. aureus isolates. This may the reason behind the seemingly higher resistance rates to erythromycin, 47 University of Ghana http://ugspace.ug.edu.gh cotrimoxazole, rifampicin, clindamycin, and gentamicin within the control group as opposed to the HIV-infected group. In both study groups, the S. aureus isolates were ˃ 95% penicillin resistant, ˃ 60% cotrimoxazole resistant, ≥ 40% tetracycline resistant, ˃ 25% erythromycin and rifampicin resistant, ˃ 20% clindamycin resistant, ˃ 15% gentamicin, and ≥ 4% cefoxitin resistant. These rates of antimicrobial resistance are comparable to what have been observed by other researchers (Olalekan et al., 2012; Kotpal et al., 2015; Dekker et al., 2016; Egyir et al., 2016; Sampane-Donkor et al., 2017). The high rates of resistance to tetracylcline, cotrimoxazole, and penicillin in both groups is not surprising, as for several years, high rates of resistance have been displayed against these drugs by several microorganisms – clinical isolates and normal intestinal flora from healthy individuals (Donkor & Nartey, 2007). In fact, cotrimoxazole has been used as prophylaxis among HIV- infected individuals for years. Rifampicin resistance was higher in S. aureus isolated from the HIV-infected individuals in this study than those reported among another HIV-infected cohort (10%) (Egyir et al., 2016), and in the general population (0–1%) (Egyir et al., 2013; Egyir et al., 2014b). The occurrence of rifampicin resistant S. aureus isolates in this cohort at such a high rate (42%) has serious clinical implications as rifampicin is part of the therapeutic agents used in treating MRSA infections and infections of Streptococcus pneumoniae, a pathogen which has been associated with immunosuppression (Forrest & Tamura, 2010). Furthermore, if these circulating resistant strains were to transfer their rifampicin resistance attribute to any of the organisms designated as part of the Mycobacterium tuberculosis complex, it could potentially negatively impact TB chemotherapy, for two main reasons. First, rifampicin is a major frontline drug used in the 48 University of Ghana http://ugspace.ug.edu.gh management of TB infections (Mitchison, 2000). Second, HIV-infected individuals are prone to TB infections (Egyir et al., 2016). Resistance to cefoxitin is a marker for resistance to methicillin, also a predictor of multidrug resistance, including resistance to beta-lactam antimicrobials. The rate of resistance demonstrated against cefoxitin by the S. aureus isolates among the HIV-infected in this study is comparatively higher than the 0–7.7% reported in other cohorts of HIV-infected individuals (Egyir et al., 2016; Sampane-Donkor et al., 2017) and other studies in the general population (1.6–6%) (Egyir et al., 2014a; Egyir et al., 2014b). Of the seven cefoxitin-resistant S. aureus isolates, five (four in the HIV-infected and one in the control group) demonstrated positive results for carriage of the mecA gene, which in S. aureus, predominantly confers resistance to methicillin (Crossley& Archer, 1997). The other two cefoxitin-resistant isolates (both in the HIV group) did not show positive results for mecA gene carriage. Hence, methicillin resistance in these isolates may be mediated by the novel methicillin resistance gene, the mecC gene, rather than the initially reported mecA gene. In fact, mecC-mediated methicillin resistance is emerging, and has been widely reported (Cartwright et al., 2013; Petersen et al., 2013; Becker et al., 2014; García-Garrote et al., 2014 Paterson et al., 2014). Multidrug resistant S. aureus isolates were higher in number in the HIV-infected group (n = 33) than the control group (n = 20), but when considered proportion-wise, they were higher in the control group than in the HIV-infected individuals (80% vs. 62.3%). The MDR isolates were predominantly resistant to penicillin (100% in the HIV-infected group and 95% in the control group) and cotrimoxazole (90.9% in the HIV-infected group and 90% in the control group). The rate of MDR S. aureus isolates recorded in this study is within the range of 30–84.6% reported in other HIV-infected cohorts (Egyir et al., 2016), but higher than what have been recorded in studies 49 University of Ghana http://ugspace.ug.edu.gh involving the general population (6–35.7%) (Egyir et al., 2014a; Egyir et al., 2014b; Dekker et al., 2016). These rates of multidrug resistance are alarming, though not surprising. In Ghana and many other developing countries, antimicrobials could be obtained without any prescriptions (Lee et al., 1991; Adu-Sarkodie, 1997; Reeves, 2007). Also, self-medication with antimicrobials is common practice, with the prevalence reportedly being 70–75% (Adu-Sarkodie, 1997; Donkor et al., 2012a). In the study by Donkor et al. (2012a), they reported that about half of the study respondents did not complete an antimicrobial course. Furthermore, antimicrobial misuse is high in animal husbandry in Ghana (Donkor et al., 2012b), and occurs at the hospital level too (Bosu & Ofori- Adjei, 2000). Since this study was carried out in a hospital setting, these highly resistant isolates could potentially be culprits in nosocomial infections, and the resistant states could be transferred to other organisms. They could also be transmitted to non-carriers, who could subsequently further disseminate them. This is because a greater proportion of the study participants were currently enrolled in school (74.8% for the HIV-infected and 83.2% for the comparison group) and lived in compound houses (86% for the HIV-infected and 84.1% for the comparison group). These high rates of resistance are therefore of public health concern, and need to be addressed, as community outbreaks with such highly resistant organisms could be imminent. Nonetheless, the high rates of penicillin and tetracycline resistance do not have much clinical relevance, since these two antimicrobials are not routinely used in treating S. aureus infections. However, the high rate of cotrimoxazole resistance is of high clinical significance, as the antimicrobial is routinely administered to HIV-infected individuals as prophylaxis. The absence of resistance to fusidic acid, linezolid, and vancomycin, even in MRSA isolates, suggests that these 50 University of Ghana http://ugspace.ug.edu.gh antimicrobials remain effective therapeutic options for managing any MRSA infections that may develop in this cohort of HIV-infected children. 51 University of Ghana http://ugspace.ug.edu.gh CHAPTER SIX 6.0 CONCLUSIONS, RECOMMENDATIONS, AND LIMITATIONS 6.1 Conclusions The main conclusions of the study are as follows: Among the HIV-infected children, the bacteria that predominantly colonized the anterior nares were S. aureus (44.9%) and coagulase negative staphylococci (43%); in the control group, the predominant bacteria were coagulase negative staphylococci (55.1%) and S. aureus (23.4%). Furthermore, HIV infection was a significant risk factor for S. aureus colonization among children in Accra, but may not be for MRSA colonization, with the odds of individuals to be colonised with S. aureus being about 2.7 times higher if the individual was HIV-infected (OR = 2.67). Also, absence of colonization with CONS was a risk factor for S. aureus colonization, regardless of HIV infection status. Moreover, regular hand washing with soap was significantly associated with MRSA colonization among the HIV-infected participants, which could possibly be due to triclosan in soaps/detergents used for hand washing. Finally, both HIV-infected and uninfected children are reservoirs of multidrug resistant S. aureus, which are entirely susceptible to fusidic acid, linezolid, and vancomycin. 6.2 Recommendations Based on the findings in this study, the following are recommended: First, since this cohort of HIV-infected children had a high prevalence of S. aureus colonization, monthly nasal mupirocin application (Gordon et al., 2010) could be included in the management 52 University of Ghana http://ugspace.ug.edu.gh of this cohort of patients to reduce their rates of colonization and hence their risk of acquiring S. aureus infections. Furthermore, additional studies need to be carried out in the study area, with a specific focus on molecular characterization of S. aureus clones carried by HIV-infected and uninfected individuals. Other studies could also be conducted to further investigate the role hand washing with soap plays in MRSA colonization. Finally, the high rates of S. aureus resistance to cotrimoxazole indicates that the use of this antimicrobial as prophylaxis in HIV-infected participants needs reevaluation. 6.3 Limitations The limitations of the study include the following: This study was cross-sectional in nature, so does not distinguish between persistent and intermittent carriers. Furthermore, some of the intermittent carriers may have been missed, given that intermittent carriers were probably not colonized at the time of sampling. To add to, the S. aureus and MRSA colonization prevalence reported may have been underestimated, since only one anatomical site, the anterior nares, was sampled. Some studies have reported that nasal screening alone could underestimate carriage by at least one-third (Zervou et al., 2014). Moreover, although children with known co-morbidities were excluded from the study, there may have been some study participants with unknown co-morbidities. Also, even though the S. aureus isolates were all sensitive to vancomycin, this was not confirmed by determination of the minimum inhibitory concentration of vancomycin. 53 University of Ghana http://ugspace.ug.edu.gh REFERENCES Acton, D. S., Plat-Sinnige, M. J., van Wamel, W., de Groot, N., & van Belkum, A. (2009). Intestinal carriage of Staphylococcus aureus: how does its frequency compare with that of nasal carriage and what is its clinical impact? European Journal of Clinical Microbiology and Infectious Diseases, 28, 115–127. https://doi.org/10.1007/s10096-008-0602-7. Adu-Sarkodie, Y. A. (1997). Antimicrobial self medication in patients attending a sexually transmitted diseases clinic. International Journal of STD and AIDS, 8, 456–458. Doi:10.1258/0956462971920343. Alm, R. A., McLaughlin, R. E., Kos, V. N., Sader, H. S., Iaconis, J. P., & Lahiri, S. D. (2014). Analysis of Staphylococcus aureus clinical isolates with reduced susceptibility to ceftaroline: an epidemiological and structural perspective. Journal of Antimicrobial Chemotherapy, 69, 2065–2075. https://doi.org/10.1093/jac/dku114. Amaral, M. M., Coelho, L. R., Flores, R. P., Souza, R. R., Silva-Carvalho, M. C., Teixeira, L. A., et al. (2005). The predominant variant of the Brazilian epidemic clonal complex of methicillin-resistant Staphylococcus aureus has an enhanced ability to produce biofilm and to adhere to and invade airway epithelial cells. The Journal of Infectious Diseases, 192 (5), 801–810. https://doi.org/10.1086/432515. Amir, M., Paul, J., Batchelor, B., Kariuki, S., Ojoo, J., Waiyaki, P., et al. (1995). Nasopharyngeal carriage of Staphylococcus aureus and carriage of tetracycline-resistant strains associated with HIV-seropositivity. European Journal of Clinical Microbiology and Infectious Diseases, 14, 34–40. https://doi.org/10.1007/BF02112615. Archibald, L. K., Corl, A., Shah, B., Schulte, M., Arduino, M. J., Aguero, S., et al. (1997). Serratia 54 University of Ghana http://ugspace.ug.edu.gh marcescens outbreak associated with extrinsic contamination of 1% chlorxylenol soap. Infection Control and Hospital Epidemiology, 18 (10), 704–709. https://doi.org/10.2307/30141511. Askari, E., Tabatabai, S. M., Arianpoor, A., & Naderi-Nasab, M. (2013). vanA-positive vancomycin-resistant Staphylococcus aureus: systematic search and review of reported cases. Infectious Disease in Clinical Practice, 21 (2), 91–93. Doi:10.1097/IPC.0b013e31826e8199. Baron, J. E., Peterson, L. R., & Finegold, S. M. (1994). Bailey and Scott Diagnostic Microbiology, 9th ed.; C.V. Mosby Co.: St. Louis, MO, USA. Bartash, R., & Nori, P. (2017). Beta-lactam combination therapy for the treatment of Staphylococcus aureus and Enterococcus species bacteremia: a summary and appraisal of the evidence. International Journal of Infectious Diseases, 63, 7–12. https://doi.org/10.1016/j.ijid.2017.07.019. Bassetti, M., Nicco, E., Malgorzata, M., Viscoli, C., Valbusa, A., Bongiorno, D., et al. (2010). Community associated methicillin resistant Staphylococcus aureus (CA-MRSA) infective endocarditis in Italy. Journal of Infection, 61 (4), 353–355. Doi:10.1016/j.jinf.2010.07.014. Beceiro, A., Tomás, M. & Bou, G. (2013). Antimicrobial resistance and virulence: a successful or deleterious association in the bacterial world? Clinical Microbiology Reviews, 26 (2), 185– 230. Doi:10.1128/CMR.00059-12. Becker, K., Ballhausen, B., Köck, R., & Kriegeskorte, A. (2014). Methicillin resistance in Staphylococcus isolates: the “mec alphabet” with specific consideration of mecC, a homolog associated with zoonotic S. aureus lineages. International Journal of Medical Microbiology, 304 (7), 794–704. Doi:10.1016/j.ijmm.2014.06.007. 55 University of Ghana http://ugspace.ug.edu.gh Bekkhoucha, S. N., Cady, A., Gautier, P., Itim, F., & Donnio, P. Y. (2009). A portrait of Staphylococcus aureus from the other side of the Mediterranean Sea: molecular characteristics of isolates from western Algeria. European Journal of Clinical Microbiology and Infectious Diseases, 28, 553–555. http://doi.org/10.1007/s10096-008-0660-x. Bernier, S. P., Lebeaux, D., DeFrancesco, A. S., Valomon, A., Soubigou, G., Coppee, J.-Y., et al. (2013). Starvation, together with the SOS response, mediates high biofilm-specific tolerance to the fluoroquinolone ofloxacin. PLoS Genetics, 9 (1), e1003144. Doi:10.1371/journal.pgen.1003144. Bilavsky, E., Lerman, Y., Rabinovich, A., Salomon, J., Lawrence, C., Rossini, A., et al. (2012). Carriage of methicillin-resistant Staphylococcus aureus on admission to European rehabilitation centres – a prospective study. Clinical Microbiology and Infection, 18 (6). https://doi.org/10.1111/j.1469-0691.2012.03851.x. Bischoff, W. E., Reynolds, T. M., Sessler, C. N., Edmond, M. B., & Wenzel, M. P. (2000). Handwashing compliance by health care workers: the impact of introducing an accessible, alcohol-based hand antiseptic. Archives of Internal Medicine, 160 (7), 1017–21. Doi:10.1001/archinite.160.7.1017. Bogaert, D., van Belkum, A., Sluijter, M., Luijendijk, A., de Groot, R., Rümpke, H. C., et al. (2004). Colonisation by Streptococcus pneumoniae and Staphylococcus aureus in healthy children. The Lancet; 363 (9424), P1871–P1872. https://doi.org/10.1016/S0140- 6736(04)16357-5. Bosu, W. K., & Ofori-Adjei, D. (2000). An audit of prescribing practice in health care facilities of the Wassa West district of Ghana. West African Journal of Medicine, 19 (4), 298–303. 56 University of Ghana http://ugspace.ug.edu.gh Boyle-Vavra, S., & Daum, R. S. (2007). Community-acquired methicillin-resistant Staphylococcus aureus: the role of Panton-Valentine leukocidin. Laboratory Investigations, 87, 3–9. https://doi.org/10.1038/labinvest.3700501. Brakstad, O. G., Aasbakk, K., & Maeland, J. A. (1992). Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. Journal of Clinical Microbiology, 30 (7), 1654–1660. Bressler, A. M., Zimmer, S. M., Gilmore, J. L., & Somani, J. (2004). Peripheral neuropathy associated with prolonged use of linezolid. Lancet Infectious Diseases, 4 (8), 528–531. https://doi.org/10.1016/S1473-3099(04)01109-0. Breurec, S., Fall, C., Pouillot, R., Boisier, P., Brisse, S., & Diene-Sarr, F., et al. (2011). Epidemiology of methicillin-susceptible Staphylococcus aureus lineages in five major African towns: high prevalence of Panton-Valentine leukocidin genes. Clinical Microbiology and Infection, 17 (4), 633–639. https://doi.org/10.1111/j.1469-0691.2010.03320.x. Burkey, M. D., Wilson, L. E., Moore, R. D., Lucas, G. M., Francis, J., & Gebo, K. A. (2008). The incidence and risk factors for MRSA bacteraemia in an HIV-infected cohort in the HAART era. HIV Medicine, 9 (10), 858–862. Doi: 10.1111/j.1468-1468-1293.2008.00629.x. Camargo, C. H., da Cunha, M. D. E. L., Bonesso, M. F., da Cunha, F. P., Barbosa, A. N., & Fortaleza, C. M. (2013). Systemic CA-MRSA infection following trauma during soccer match in inner Brazil: clinical and molecular characterization. Diagnostic Microbiology and Infectious Disease, 76 (3), 372–374. https://doi.org/10.1016/j.diagmicrobio.2013.03.013. Cartwright, E. J. P., Paterson, G. K., Raven, K. E., Harrison, E. M., Gouliouris, T., Kearns, A., et al. (2013). Use of VITEK 2 antimicrobial susceptibility profile to identify mecC in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology, 57 University of Ghana http://ugspace.ug.edu.gh Doi:10.1128/JCM.00847-13. Casey, J. A., Cosgrove, S. E., Stewart, W. F., Pollak, J., & Schwartz, B. S. (2013). A population- based study of the epidemiology and clinical features of methicillin-resistant Staphylococcus aureus infection in Pennsylvania, 2001-2010. Epidemiology and Infection, 141 (6), 1166– 1179. Doi: 10.1017/S0950268812001872. Centers for Disease Control and Prevention (2013). Antibiotic resistance threats in the United States. Available from: cdc.gov/ drugresistance/threat-report-2013/ Cenizal, M. J., Hardy, R. D., Anderson, M., Katz, K., & Skiest, D. J. (2008). Prevalence of and risk factors for methicillin-resistant Staphylococcus aureus (MRSA) nasal colonization in HIV-infected ambulatory Patients. Journal of Acquired Immune Deficiency Syndrome, 48 (5), 567–571. Doi: 10.1097/QAI.0b013e31817e9b79. Chambers, H. F. (2001). The changing epidemiology of Staphylococcus aureus?. Emerging Infectious Diseases, 7 (2), 178–182. http://dx.doi.org/10.3201/eid0702.700178. CLSI. (2017). Performance standards for antimicrobial susceptibility testing. 27th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute. Cotton, M. F., Wasserman, E., Smit, J., Whitelaw, A., & Zar, H. J. (2008). High incidence of antimicrobial resistant organisms, including extended spectrum β-lactamase producing Enterobacteriaceae and methicillin-resistant Staphylococcus aureus in nasopharyngeal and blood isolates of HIV-infected children from Cape Town, South Africa. BMC Infectious Diseases, 8, 40. Doi: 10.1186/1471-2334-8-40. Crossley, K. B., & Archer, G. L. (1997). The staphylococci in human disease. New York: Churchill Livingston. 58 University of Ghana http://ugspace.ug.edu.gh Crum-Cianflone, N. F., Burgi, A. A., & Hale, B. R. (2007). Increasing rates of community- acquired methicillin-resistant Staphylococcus aureus infections among HIV-infected persons. International Journal of STD & AIDS, 18 (8), 521–526. https://doi.org/10.1258/095646207781439702. Daum, R. S. (2007). Skin and soft-tissue infections caused by methicillin-resistant Staphylococcus aureus. The New England Journal of Medicine, 357 (4), 380–390. Doi: 10.1056/NEJMcp070747. David, M. Z., Boyle-Vavra, S., Zychowski, D. L., & Daum, R. S. (2011). Methicillin-susceptible Staphylococcus aureus as a predominantly healthcare-associated pathogen: a possible reversal of roles? PLoS One, 6 (4), e18217. Doi: 10.1371/journal.pone.0018217. D’Avila, N. E. M., Zhang, L., Miller, R. G., D’Avila, A. C., Conceição, A. P. C, & Boffo, M.S. (2008). High prevalence of nasopharyngeal colonization by Staphylococcus aureus among children with HIV-1 infection in extreme Southern Brazil. Journal of Tropical Pediatrics, 54 (6), 410–412. https://doi.org/10.1093/tropej/fmn051. Datta, F., Erb, T., Heininger, U., Gervaix, A., Schaad, U. B., Berger, C., et al. (2008). A multicenter, cross-sectional study on the prevalence and risk factors for nasal colonization with Staphylococcus aureus in patients admitted to children’s hospitals in Switzerland. Clinical Infectious Diseases, 47 (7), 923–926. https://doi.org/10.1086/591700. De Kraker, M. E., Wolkewitz, M., Davey, P. G., Koller, W., Berger, J., Nagler, J., et al. (2011). Clinical impact of antimicrobial resistance in European hospitals: excess mortality and length of hospital stay related to methicillin-resistant Staphylococcus aureus bloodstream infections. Antimicrobial Agents and Chemotherapy, 55 (4), 1598–1605. Doi:10.1128/AAC.01157-10. 59 University of Ghana http://ugspace.ug.edu.gh Dekker, D., Wolters, M., Mertens, E., Boahen, K. G., Krumkamp, R., Eibach, D., et al. (2016). Antibiotic resistance and clonal diversity of invasive Staphylococcus aureus in the rural Ashanti Region, Ghana. BMC Infectious Diseases, 16 (1), 1–6. http://doi.org/10.1186/s12879-016-2048-3. Diep, B. A., Chambers, H. F., Graber, C. J., Szumowski, J. D., Miller, L. G., Han, L. L., et al. (2008). Emergence of multidrug-resistant, community-associated, methicillin-resistant Staphylococcus aureus clone USA300 in men who have sex with men. Annals of Internal Medicine, 148 (4), 249–257. Donkor, E. S., Jamrozy, D., Mills, R. O., Dankwah, T., Amoo, P. K., Egyir, B., et al. (2018). A genomic infection control study for Staphylococcus aureus in two Ghanaian hospitals. Infection and Drug Resistance, 11, 1757–1765. https://doi.org/10.2147/IDR.S167639. Donkor, E. S., & Nartey, E. (2007). Nasal colonisation of antibiotic resistant bacteria in Ghanaian children less than five years of age. Internet Journal of Microbiology; 5 (2), 1–5. Donkor, E. S., Tetteh-Quarcoo, P. B., Nartey, P., & Agyeman, I. O., (2012a). Self-medication practices with antibiotics among tertiary level students in Accra, Ghana: a cross-sectional study. International Journal of Environmental Research and Public Health, 9 (10), 3519– 3529. Doi:10.3390/ijerph9103519. Donkor, E. S., Newman, M. J., & Yeboah-Manu, D. (2012b). Epidemiological aspects of non- human antibiotic usage and resistance: implications for the control of antibiotic resistance in Ghana. Tropical Medicine and International Health, 17 (4), 462–468. Doi:10.1111/j.1365- 3156.2012.02955.x. Dumitrescu, O., Boisset, S., Badiou, C., Bes, M., Benito, Y., Reverdy, M.-E., et al. (2006). Effect 60 University of Ghana http://ugspace.ug.edu.gh of antibiotics on Staphylococcus aureus producing panton-valentine leukocidin. Antimicrobial Agents and Chemotherapy, 51 (4), 1515–1519. Doi: 10.1128/AAC.01201-06. Egyir, B., Guardabassi, L., Nielsen, S. S., Larsen, J., Addo, K. K., Newman, M.J., et al. (2013). Prevalence of nasal carriage and diversity of Staphylococcus aureus among inpatients and hospital staff at Korle Bu Teaching Hospital, Ghana. Journal of Global Antimicrobial Resistance, 1, 189–193. Doi:10.1016/j.jgar.2013.05.006. Egyir, B., Guardabassi, L., Sørum, M., Nielsen, S. S., Kolekang, A., Frimpong, E, et al. (2014a). Molecular epidemiology and antimicrobial susceptibility of clinical Staphylococcus aureus from healthcare institutions in Ghana. PLoS ONE, 9 (2), 1–7. http://doi.org/10.1371/journal.pone.0089716. Egyir, B., Guardabassi, L., Esson, J., Nielsen, S. S., Newman, M. J., Addo, K. K., et al. (2014b). Insights into nasal carriage of Staphylococcus aureus in an urban and a rural community in Ghana. PLoS ONE, 9 (4), 1–7. http://doi.org/10.1371/journal.pone.0096119. Egyir, B., Guardabassi, L., Monecke, S., Addo, K. K., Newman, M. J. (2015). Methicillin-resistant Staphylococcus aureus strains from Ghana include USA300. Journal of Global Antimicrobial Resistance; 3 (1), 26–30. Doi: 10.1016/j.jgar.2014.11.006. Egyir, B., Oteng, A. A., Owusu, E., Newman, M. J., Addo, K. K., & Rhod-Larsen, A. (2016). Characterization of Staphylococcus aureus from Human Immunodeficiency Virus (HIV) patients in Accra, Ghana. The Journal of Infection in Developing Countries, 10 (5), S453– S456. http://doi.org/10.3855/jidc.7428 Eibach, D., Nagel, M., Hogan, B., Azuure, C., Krumkamp, R., Dekker, D., et al. (2017). Nasal carriage of Staphylococcus aureus among children in the Ashanti Region of Ghana. PLoS 61 University of Ghana http://ugspace.ug.edu.gh ONE, 12 (1), e0170320. http://doi.org/10.1371/journal.pone.0170320. Elixhauser, A., & Steiner, C. (2007). Infections with methicillin-resistant Staphylococcus aureus (MRSA) in U.S. hospitals, 1993–2005: statistical brief #35. Agency for Health Care Policy and Research; Rockville, MD. Enright, M. C., Robinson, D. A, Randle, G., Feil, E. J., Grundmann, H., & Spratt, B. G. (2002). The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proceedings of the National Academy of Sciences of the United States of America, 99 (11), 7687–7692. https://doi.org/10.1073/pnas.122108599. Eriksen, N. H., Espersen, F., Rosdahl, V. T., & Jensen, K. (1995). Carriage of Staphylococcus aureus among 104 healthy persons during a 19-month period. Epidemiology and Infection, 115 (1), 51–60. European Antimicrobial Resistance Surveillance System: Annual Report (2006); available from URL http://www.rivm.n l/earss/Images/EARSS%202006%20Def_tcm61-44176.pdf. European Centre for Disease Prevention and Control/European Medicines Agency (ECDC/EMEA). Technical report. The bacterial challenge: time to react. Stockholm, Sweden: ECDC/EMEA; 2009. http://ecdc.europa.eu/en/ publications/Publications/0909 TER The Bacterial Challenge Time to React. pdf [accessed 14.10.17] Falagas, M. E., Karageorgopoulos, D. E., Leptidis, J., & Korbila, I. P. (2013). MRSA in Africa: filling the global map of antimicrobial resistance. PLoS ONE, 8 (7), e68024. Doi: 10.1371/journal.pone.0068024. Faoagali, J. L., George, N., Fong, J., Davi, J., & Dowser, M. (1999). Comparison of the antibacterial efficacy of 4% chlorhexidine gluconate and 1% triclosan handwash products in 62 University of Ghana http://ugspace.ug.edu.gh an acute clinical ward. American Journal of Infection Control, 27 (4), 320–326. https://doi.org/10.1016/S0196-6553(99)70051-9. Farley, J. E., Hayat, M. J., & Carroll, K. (2015). Prevalence and risk factors for methicillin-resistant Staphylococcus aureus in an HIV-positive cohort. American Journal of Infection Control, 43 (4), 329–335. http://doi.org/10.1016/j.ajic.2014.12.024. Ferry, T., Thomas, D., Genestier, A.-L., Bes, M., Lina, G., Vandenesch, F., et al. (2005). Comparative prevalence of superantigen genes in Staphylococcus aureus isolates causing sepsis with and without septic shock. Clinical Infectious Diseases, 41 (6), 771–777. https://doi.org/10.1086/432798. File Jr., T. M., Wilcox, M. H., & Stein, G. E. (2012). Summary of ceftaroline fosamil clinical trial studies and clinical safety. Clinical Infectious Diseases, 55, (Suppl 3), S173–S180. https://doi.org/10.1093/cid/cis559. Freeman, M. C., Stocks, M. E., Cumming, O., Jeandron, A., Higgins, J. P. T., Wolf, J., et al. (2014). Hygiene and health: systematic review of handwashing practices worldwide and update of health effects. Tropical Medicine and International Health, 19 (8), 906–916. http://doi.org/10.1111/tmi.12339. Forrest, G. N. & Tamura, K. (2010). Rifampin combination therapy for nonmycobacterial infections. Clinical Microbiology Reviews, 23 (1), 14–34. Doi: 10.1128/CMR.00034-09. Fowler Jr., V. G., Miro, J. M., Hoen, B., Cabell, C. H., Abrutyn, E., Rubinstein, E., et al. (2005). Staphylococcus aureus endocarditis: a consequence of medical progress. Journal of the American Medical Association, 293 (24), 3012–3021. http: //dx.doi.org/10.1001/jama.293.24.3012. 63 University of Ghana http://ugspace.ug.edu.gh Ganga, R., Riederer, K., Sharma, M., Fakih, M. G., Johnson, L. B., Shemes, S., et al. (2009). Role of SCCmec type in outcome of Staphylococcus aureus bacteremia in a single medical center. Journal of Clinical Microbiology, 47 (3), 590–595. Doi: 10.1128/JCM.00397-08. García-Garrote, F., Cercenado, E., Marín, M., Bal, M., Trincado, P., Corredoira, J., et al. (2014). Methicillin-resistant Staphylococcus aureus carrying the mecC gene: emergence in Spain and report of a fatal case of bacteraemia. Journal of Antimicrobial. Chemotherapy, 69, 45–50. Doi: 10.1093/jac/dkt327. Garner J. S., & Favero, M. S. (1986). Guidelines for handwashing and hospital environmental control, 1985 supersedes guideline for hospital environmental control published in 1981. American Journal of Infection Control, 14 (3), 110–129. Ghana Statistical Service. (2012). 2010 Population and housing census: Summary report of final results. Accra: Ghana Statistical Service. Ghebremedhin, B., Olugbosi, M. O., Raji, A. M., Layer, F., Bakare, R. A., & Ko, W. (2009). Emergence of a community-associated methicillin-resistant Staphylococcus aureus strain with a unique resistance profile in Southwest Nigeria. Journal of Clinical Microbiology, 47 (9), 2975–2980. http://doi.org/10.1128/JCM.00648-09. Giuliani, M., Longo, B., Latini, A., Prignano, G., Monaco, M., De Santis, A., et al. (2010). No evidence of colonization with community-acquired methicillin-resistant Staphylococcus aureus in HIV-1-infected men who have sex with men. Epidemiology and Infection, 138, 738–742. http://doi.org/10.1017/S0950268810000130. Gordon, R. J., Chez, N., Jia, H., Zeller, B., Sobieszczy, M., Brennan, C., et al. (2010). The NOSE study (Nasal Ointment for Staphylococcus aureus Eradication): A randomized controlled trial 64 University of Ghana http://ugspace.ug.edu.gh of monthly mupirocin in HIV-infected individuals. Journal of Acquired Immune Deficiency Syndrome, 55 (4), 466–472. Doi:10.1097/QAI.0b013e3181ec2a68. Greenwood, D., Barer, M., Slack, R., & Irving, W. (2012). Medical Microbiology. A guide to Microbial Infections: Pathogenesis, immunity, laboratory investigation and control. (D. Greenwood, M. Barer, R. Slack, & W. Irving, Eds.) (18th Edition). Elsevier Ltd. Haenni, M., Saras, E., Châtre, P., Médaille, C., Bes, M., Madec J. Y., et al. (2012). A USA300 variant and other human-related methicillin-resistant Staphylococcus aureus strains infecting cats and dogs in France. Journal of Antimicrobial Chemotherapy, 67, 326–329. Doi: 10.1093/jac/dkr499. Haghkhah, M. (2003). Study of virulence factors of Staphylococcus aureus. PhD thesis, University of Glassgow. Halden, R. U., & Paull, D. H. (2005). Co-occurrence of triclocarban and triclosan in U.S. water resources. Environmental Science and. Technology, 39, 1420–1426. http://dx.doi.org/10.1021/es049071e. Hassanzadeh, P., Hassanzadeh, Y., Mardaneh, J., Rezal, E., & Motamedifar, M. (2015). Isolation of methicillin-resistant Staphylococcus aureus ( MRSA ) from HIV patients referring to HIV Referral Center, Shiraz, Iran, 2012. Iranian Journal of Medical Sciences, 40 (6), 526–530. Heysell, S. K., Shenoi, S. V., Catterick, K., Thomas, T. A., & Friedland, G. (2011). Prevalence of methicillin-resistant Staphylococcus aureus nasal carriage among hospitalized patients with tuberculosis in rural Kwazulu-Natal. South African Medical Journal, 101 (5), 332–334. Hidron, A. I., Kempker, R., Moanna, A., & Rimland, D. (2010). Methicillin-resistant Staphylococcus aureus in HIV-infected patients. Infection and Drug Resistance, 3, 73–86. 65 University of Ghana http://ugspace.ug.edu.gh Hidron, A. I., Kourbatova, E. V., Halvosa, J. S., Terrell, B. J., Mcdougal, L. K., Tenover, F. C., et al. (2005). Risk factors for colonization with methicillin-resistant Staphylococcus aureus (MRSA) in Patients Admitted to an Urban Hospital : Emergence of Community-Associated MRSA Nasal Carriage. Clinical Infectious Diseases, 41 (2), 159–166. Doi: 10.1086/430910. Ho, T. T., Cadena, J., Childs, L. M., Gonzalez-Velez, M., & Lewis, J. S. (2012). Methicillin- resistant Staphylococcus aureus bacteraemia and endocarditis treated with ceftaroline salvage therapy. Journal of Antimicrobial Chemotherapy, 67 (5), 1267–1270. Doi: 10.1093/jac/dks006. Howe, R. A., Noel, A., Bowker, K. E., Enne, V. I., Walsh, T. R., & MacGowan, A. P. (2002). Emergence of linezolid (LIN) resistance in Staphylococcus aureus can be associated with loss of erythromycin (ERY) resistance. In Program and Abstracts of the Forty-second Interscience Conference on Antimicrobial Agents and Chemotherapy, San Diego, CA, USA, 2002. Abstract C1-1608, p. 75. American Society for Microbiology, Washington, DC, USA. Hsueh, P. R., Liu, C. Y., & Luh, K. T. (2002). Current status of antimicrobial resistance in Taiwan. Emerging Infectious Diseases, 8 (2), 132–137. Doi: 10.3201/eid0802.010244. Hu, L., Umeda, A., Kondo, S., & Amako, K. (1995). Typing of Staphylococcus aureus colonising human nasal carriers by pulsed-field gel electrophoresis. Journal of Medical Microbiology, 42 (2), 127–32. Doi: 10.1099/00222615-42-2-127. Imaz, A., Camoez, M., Yacovo, S., Di Gasch, O., Dominguez, M. A., Vila ,A., et al. (2015). Prevalence of methicillin-resistant Staphylococcus aureus colonization in HIV-infected patients in Barcelona, Spain: a cross-sectional study. BMC Infectious Diseases, 15, 243. http://doi.org/10.1186/s12879-015-0991-z. 66 University of Ghana http://ugspace.ug.edu.gh Iwase, T., Uehara, Y., Shinji, H., Tajima, A., Seo, H., Takada, K. et al. (2010). Staphylococcus epidermidis Esp inhibits Staphylococcus aureus biofilm formation and nasal colonization. Nature, 465 (7296), 346–349. http://doi.org/10.1038/nature09074. Jenkins, A, Diep, B. A., Mai, T. T., Vo, N. H., Warrener, P., Suzich, J., et al. (2015). Differential expression and roles of Staphylococcus aureus virulence determinants during colonization and disease. mBio, 6 (1), e02272-14. Doi:10.1128/mBio.02272-14. Johannessen, M, Sollid, J. E., & Anne-Merethe, H. (2012). Host- and microbe determinants that may influence the success of S. aureus colonization. Frontiers in Cellular and Infection Microbiology, 2, 56. Doi: 10.3389/fcimb.2012.00056. Jones, G. L., Muller, C. T., O’Reilly, M., & Stickler, D. J. (2006). Effect of triclosan on the development of bacterial biofilms by urinary tract pathogens on urinary catheters. Journal of Antimicrobial Chemotherapy, 57 (2), 266–272. http://dx.doi.org/10.1093/jac/dki447. Joore, I. K. C. W., Rooijen, M. S., Van, M. F. S., Loeff, D., Neeling, A. J., De Dam, A., et al. (2013). Low prevalence of methicillin-resistant Staphylococcus aureus among men who have sex with men attending an STI clinic in Amsterdam: a cross-sectional study. BMJ Open, 3 (3), 1–8. http://doi.org/10.1136/bmjopen-2012-002505. Kaka, A. S., Rueda, A. M., Shelburne III, S. A., Hulten, K., Hamill, R. J., & Musher, D. M. (2006). Bactericidal activity of orally available agents against methicillin-resistant Staphylococcus aureus. Journal of Antimicrobial Chemotherapy, 58 (3), 680–683. https://doi.org/10.1093/jac/dkl283. Karikari, A. B., Frimpong, E., & Owusu-ofori, A. (2017). Methicillin-resistant Staphylococcus aureus among patients in a teaching hospital in Ghana. International Journal of One 67 University of Ghana http://ugspace.ug.edu.gh Health, 3, 46–49. http://doi.org/10.14202/IJOH.2017.46-49. Khan, M. U. (1982). Interruption of shigellosis by hand washing. Transactions of the Royal Society of Tropical Medicine and Hygiene, 76 (2), 164–168. Klausner, J. D., Zukerman, C., Limaye, A. P., & Corey, L. (1999). Outbreak of Stenotrophomonas maltophilia bacteremia among patients undergoing bone marrow transplantation: association with faulty replacement of handwashing soap. Infection Control and Hospital Epidemiology, 20: 756–758. https://doi.org/10.1086/501578. Klein, E., Smith, D. L., & Laxminarayan, R. (2007). Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999-2005. Emerging Infectious Diseases, 13 (12), 1840–1846. Doi: 10.3201/eid1312.070629. Klevens, R. M., Morrison, M. A., Nadle, J., Petit, S., Gershman, K., Ray, S., et al. (2007). Invasive methicillin-resistant Staphylococcus aureus infections in the United States. Journal of the American Medical Association, 298 (15), 1763–1771. Doi: 10.1001/jama.298.15.1763. Kluytmans, J., van Belkum, A., & Verbrugh, H. (1997). Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks. Clinical Microbiology Reviews, 10 (3), 505–520. Korn, G. P., Martino, M. D., Mimica, I. M., Mimica, L. J, Chiavone, P. A., & Musolino, L. R. (2001). High frequency of colonization and absence of identifiable risk factors for methicillin- resistant Staphylococcus aureus (MRSA) in intensive care units in Brazil. Brazilian Journal of Infectious Diseases, 5 (1), 1–7. http://dx.doi.org/10.1590/S1413-86702001000100001. Kotpal, R. S. K. P., Bhalla, P., Dewan, R., & Kaur, R. (2016). Incidence and risk factors of nasal carriage of Staphylococcus aureus in HIV-infected individuals in comparison to HIV- 68 University of Ghana http://ugspace.ug.edu.gh uninfected individuals: A case-control study. Journal of the International Association of Providers of AIDS Care, 15(2), 141–147. http://doi.org/10.1177/2325957414554005. Kyaw, W. M., Lee, L. K., Siong, W. C., Chow, A., Ping, A. C. L., Ang, B., et al. (2012). Prevalence of and risk factors for MRSA colonization in HIV-positive outpatients in Singapore. AIDS Research and Therapy, 9 (33), 1–6. Retrieved from http://www.aidsrestherapy.com/content/9/1/33. Lee, P. R., Lurie, P., Silverman, M. M., & Lydecker, M. (1991). Drug promotion and labelling in the developing countries: an update. Journal of Clinical Epidemiology, 44, 49–55. https://doi.org/10.1016/0895-4356(91)90113-N. Lemma, M. T., Zenebe, Y., Tulu, B., Mekonnen, D., & Mekonnen, Z. (2015). Methicillin resistant Staphylococcus aureus among HIV infected pediatric patients in Northwest Ethiopia: carriage rates and antibiotic co-resistance profiles. PLoS ONE, 10 (9), 1–10. http://doi.org/10.1371/journal.pone.0137254. Lin, Y.-C. & Peterson, M. L. (2010). New insights into the prevention of staphylococcal infections and toxic shock syndromes. Expert Review of Clinical Pharmacology., 3 (6), 753–767. Doi: 10.1586/ecp.10.121. Lipsky, B. A., Berendt, A.R., Deery, H. G., Embil, J. M., Joseph, W. S., Karchmer, A. W., et al. (2004). Diagnosis and treatment of diabetic foot infections. Clinical Infectious Diseases, 39 (7), 885–910. https://www.jstor.org/stable/4462822. Loeffler, A., Mccarthy, A., Lloyd, D. H., Musilová, E., Pfeiffer, D. U., & Lindsay, J. A. (2013). Whole-genome comparison of meticillin-resistant Staphylococcus aureus CC22 SCCmec IV from people and their in-contact pets. Veterinary Dermatology, 24 (5), 538–e128. Doi: 69 University of Ghana http://ugspace.ug.edu.gh 10.1111/vde.12062. Long, S. W., Olsen, R. J., Mehta, S. C., Palzkill, T., Cernoch, P. L., Perez, K. K. et al. (2014). PBP2a mutations causing high-level ceftaroline resistance in clinical methicillin-resistant Staphylococcus aureus isolates. Antimicrobial Agents and Chemotherapy, 58 (11), 6668– 6674. Doi: 10.1128/AAC.03622-14. Lowe, A. M., Beattie, D. T., & Robert, L. (1998). Identification of novel staphylococcal virulence genes by in vivo expression technology, Molecular Microbiology, 27 (5), 967–976. https://doi.org/10.1046/j.1365-2958.1998.00741.x. Mandal A (2012). What is Staphylococcus aureus. http://www.NewsMedical.net/health. Retrieved 7/7/2016. Markowitz, N., Quinn, E. L., & Saravolatz, L. D. (1992). Trimethoprim-sulfamethoxazole compared with vancomycin for the treatment of Staphylococcus aureus infection. Annals of Internal Medicine, 117 (5), 390–398. Doi: 10.7326/0003-4819-117-5-390. McDonald, L. C., Lauderdale, T.-S., Lo, H.-J., Tsai, J.-J., & Hung, C.-C. (2003). Colonization of HIV-infected outpatients in Taiwan with methicillin-resistant and methicillin-susceptible Staphylococcus aureus. International Journal of STD & AIDS, 14 (7), 473–477. https://doi.org/10.1258/095646203322025786. Meers, P. D., & Yeo, G. A. (1978). Shedding of bacteria and skin squames after hand washing. Journal of Hygiene (London), 81 (1), 99–105. Mendes, R. E., Tsakris, A., Sader, H. S., Jones, R. N., Biek, D., McGhee, P., et al. (2012). Characterization of methicillin-resistant Staphylococcus aureus displaying increased MICs of ceftaroline. Journal of Antimicrobial Chemotherapy, 67 (6), 1321–1324. Doi: 70 University of Ghana http://ugspace.ug.edu.gh 10.1093/jac/dks069. Miller, M., Cespedes, C., Vavagiakis, P., Klein, R. S., & Lowy, F. D. (2003). Staphylococcus aureus colonization in a community sample of HIV-infected and HIV-uninfected drug users. European Journal of Clinical Microbiology and Infectious Diseases, 22 (8), 463–469. https://doi.org/10.1007/s10096-003-0969-4. Miller, M., Cook, H. A., Furuya, E. Y., Bhat, M., Lee, M. H., Vavagiakis, P., et al. (2009). Staphylococcus aureus in the community: colonization versus infection. PLoS ONE, 4 (8), e6708. https://doi.org/10.1371/journal.pone.0006708 Mitchison DA. (2000). Role of individual drugs in the chemotherapy of tuberculosis. International Journal of Tuberculosis and Lung Disease, 4 (9), 796–806. Morales, G., Picazo, J. J., Baos, E., Candel, F. J., Arribi, A., Peláez, B. et al. (2010). Resistance to linezolid is mediated by the cfr gene in the first report of an outbreak of linezolid-resistant Staphylococcus aureus. Clinical Infectious Diseases, 50 (6), 821–825. https://doi.org/10.1086/650574. Moran, G. J., Krishnadasan, A., Gorwitz, R. J., Fosheim, G. E., Mcdougal, L. K., Carey, R. B., et al. (2006). Methicillin-resistant S. aureus infections among patients in the emergency department. The New England Journal of Medicine, 355 (7), 666–674. Doi: 10.1056/NEJMoa055356. Muto, C. A., Jernigan, J. A., Ostrowsky, B. E., Richet, H. M., Jarvis, W. R., Boyce, J. M., et al. (2003). SHEA guideline for preventing nosocomial transmission of multidrug-resistant strains of Staphylococcus aureus and Enterococcus. Infection Control and Hospital Epidemiology, 24 (5), 362–386. Doi: 10.1086/502213. 71 University of Ghana http://ugspace.ug.edu.gh Mwambete, K. D., & Rugemalila, D. (2015). Antibiotic resistance profiles of bacteria isolated from surgical wounds in tertiary hospitals, Tanzania. International Journal of Current Microbiology and Applied Sciences, 4 (1), 448–455. National Nosocomial Infections Surveillance (NNIS) System Report, data summary from January 1992 through June 2004, issued October 2004. (2004). American Journal of Infection Control, 32, 470–485. http://doi.org/10.1016/j.ajic.2004.10.001. Nguyen, M. H., Kauffman, C. A., Goodman, R. P., Squier, C., Arbeit, R. D., Singh, N., et al. (1999). Nasal carriage of and infection with Staphylococcus aureus in HIV-infected patients. Annals of Internal Medicine, 130 (3), 221–225. Doi: 10.7326/0003-4819-130-3-199902020- 00026. Nouwen, J., Boelens, H., van Belkum, A., & Verbrugh, H. (2004). Human factor in Staphylococcus aureus nasal carriage. Infection and Immunity, 72 (11), 6685–6688. Doi: 10.1128/IAI.72.11.6685-6688.2004. Odonkor, S. T., Newman, M. J., & Addo, K. K. (2012). Prevalence and antibiotic susceptibility profile of methicillin-resistant Staphylococcus aureus in Accra, Ghana. Microbiology Research, 3 (2), 84–87. https://doi.org/10.4081/mr.2012.e20. Ojajärvi, J. (1984). Effectiveness of hand washing and disinfection methods in removing transient bacteria after patient nursing. The Journal of Hygiene (London), 85 (2), 193–203. Ogston, A. (1984). On abscesses. Reviews of Infectious Diseases, 6 (1), 1. https://doi.org/10.1093/clinids/6.1.122. Olalekan, A. O., Schaumburg, F., Nurjadi, D., Dike, A. E., Ojurongbe, O., Kolawole, D. O., et al. (2012). Clonal expansion accounts for an excess of antimicrobial resistance in 72 University of Ghana http://ugspace.ug.edu.gh Staphylococcus aureus colonizing HIV-positive individuals in Lagos, Nigeria. International Journal of Antimicrobial Agents, 40 (3), 268–272. doi: 10.1016/j.ijantimicag.2012.05.016. Olsen, K., Falch, B. M., Danielsen, K., Johannessen, M., Ericson, S. J. U., Thune, I., et al. (2012). Staphylococcus aureus nasal carriage is associated with serum 25- hydroxyvitamin D levels, gender and smoking status. The Tromsø Staph and Skin Study. European Journal of Clinical Microbiology & Infectious Diseases, 31 (4), 465–473. Doi: 10.1007/s10096-011-1331-x. Olson, M. E., Todd, D. A., Schaeffer, C. R., Paharik, A. E., Van Dyke, M. J., Büttner, H., et al. (2014). Staphylococcus epidermidis agr quorum-sensing system: signal identification , cross talk , and importance in colonization. Journal of Bacteriology, 196 (19), 3482–3493. http://doi.org/10.1128/JB.01882-14 Otter, J. A., & French, G. L., (2011). Community-associated methicillin-resistant Staphylococcus aureus strains as a cause of healthcare-associated infection. Journal of Hospital Infection, 79 (3), 189–193. https://doi.org/10.1016/j.jhin.2011.04.028. O’Toole, R. D., Drew, W. L., Dahlgren, B. J., & Beaty, H. N. (1970). An outbreak of methicillin- resistant Staphylococcus aureus infection – Observations in hospital and nursing home. Journal of the American Medical Association, 213 (2), 257–263. Doi:10.1001/jama.1970.03170280017003. Padoveze, M. C., de Jesus, P. R., Blum-Menezes, D., Bratfich, O. J., & Moretti, M. L. (2008). Staphylococcus aureus nasal colonization in HIV outpatients: persistent or transient? American Journal of Infection Control, 36 (3), 187–191. Doi: 10.1016/j.ajic.2007.05.012. Paharik, A. E., Parlet, C. P., Chung, N., Van Dyke, M. J., Cech, N. B., & Horswill, A. R. (2017). Coagulase-negative staphylococcal strain prevents Staphylococcus aureus colonization and 73 University of Ghana http://ugspace.ug.edu.gh skin infection by blocking quorum sensing. Cell Host and Microbe, 22 (6), 746–756. http://doi.org/10.1016/j.chom.2017.11.001 Pan America Health Organization/World Health Organization. (2013). Epidemical alert: vancomycin-resistant Staphylococcus aureus. Available from: paho.org/hq/index.php?option=com_ docman&task=doc_view&gid=22187&itemid Pantosti, A., Sanchini, A., & Monaco, M. (2007). Mechanisms of antibiotic resistance in Staphylococcus aureus. Future Microbiology, 2 (3), 323–334. Doi: 10.2217/17460913.2.3.323. Paterson, G. K., Morgan, F. J. E., Harrison, E. M., Cartwright, E. J. P., Török, M. E., Zadoks R. N., et al. (2014). Prevalence and characterization of human mecC methicillin-resistant Staphylococcus aureus isolates in England. Journal of Antimicrobial Chemotherapy, 69 (4), 907–910. https://doi.org/10.1093/jac/dkt462. Peacock, S. J., de Silva, I ., & Lowy, F. D. (2001). What determines nasal carriage of Staphylococcus aureus?. Trends in Microbiology, 9 (12), 605–610. https://doi.org/10.1016/S0966-842X(01)02254-5. Peacock, S. J., Justice, A., Griffiths, D., de Silva, G. D., Kantzanou, M. N., et al. (2003). Determinants of acquisition and carriage of Staphylococcus aureus in infancy. Journal of Clinical Microbiology, 41 (12), 5718–5125. Doi: 10.1128/JCM.41.12.5718-5725.2003. Petersen, A., Stegger, M., Heltberg, O., Christensen, J., Zeuthen, A., Knudsen LK, et al. (2013). Epidemiology of methicillin-resistant Staphylococcus aureus carrying the novel mecC gene in Denmark corroborates a zoonotic reservoir with transmission to humans. Clinical Microbiology and Infection, 19, E16–E22. Doi: 10.1111/1469-0691.12036. 74 University of Ghana http://ugspace.ug.edu.gh Pinfold, J. V., & Horan, N. J. (1996). Measuring the effect of a hygiene behaviour intervention by indicators of behaviour and diarrhoeal disease. Transactions of the Royal Society of Tropical Medicine and Hygiene, 90 (4), 366–371. Pittet, D., Mourouga, P., & Perneger, T. V. (1999). Compliance with handwashing in a teaching hospital. Infection Control Program. Annals of Internal Medicine, 130 (2), 126–130. Doi: 10.7326/0003-4819-130-2-199901190-00006. Polenakovik, H. M., & Pleiman, C. M. (2013). Ceftaroline for methicillin-resistant Staphylococcus aureus bacteraemia: case series and review of the literature. International Journal of Antimicrobial Agents, 42 (5), 450–455. Doi:10.1016/j.ijantimicag.2013.07.005. Popovich, K. J., Hota, B., Aroutcheva, A., Kurien, L., Patel, J., Lyles-banks, R., et al. (2013). Community-associated methicillin-resistant Staphylococcus aureus colonization burden in HIV-Infected Patients. Clinical Infectious Diseases, 56 (8), 1067–1074. http://doi.org/10.1093/cid/cit010. Powers, M. E., & Wardenburg, J. B. (2014). Igniting the fire: Staphylococcus aureus virulence factors in the pathogenesis of sepsis. PLoS Pathogens, 10 (2), e1003871. Doi:10.1371/journal.ppat.1003871. Quitoco, I. M., Raimundo, M. S., Silva-Carvalho, M. C., Souza, R. R., Beltrame, C. O., de Oliveira, T. F., et al. (2013). First report in South America of companion animal colonization by the USA1100 clone of community-acquired methicillin-resistant Staphylococcus aureus (ST30) and by the European clone of methicillin-resistant Staphylococcus pseudintermedius (ST71). BMC Research Notes, 6, 336. Doi: 10.1186/1756-0500-6-336. Rabinowitz RP, Kufera JA, & Makley MJ. (2012). A hidden reservoir of methicillin-resistant 75 University of Ghana http://ugspace.ug.edu.gh Staphylococcus aureus and vancomycin-resistant Enterococcus in patients newly admitted to an acute rehabilitation hospital. Physical Medicine and Rehabilitation, 4 (1), 18–22. Doi: 10.1016/j.pmrj.2011.09.011. Ramsetty, S. K., Stuart, L. L., Blake, R. T., Parsons, C. H., & Salgado, C. D. (2010). Risks for methicillin-resistant Staphylococcus aureus colonization or infection among patients with HIV infection. HIV Medicine, 11 (6), 389–394. https://doi.org/10.1111/j.1468- 1293.2009.00802.x. Reeves, D. (2007). The 2005 Garrod lecture: the changing access of patients to antibiotics – for better or worse?. Journal of Antimicrobial Chemotherapy, 59 (3), 333–341. https://doi.org/10.1093/jac/dkl502. Regev-Yochay, G., Raz, M., Carmeli, Y., Shainberg, B., Navon-Venezia, S., Pinco, E., et al. (2009). Parental Staphylococcus aureus carriage is associated with Staphylococcal carriage in young children. The Pediatric Infectious Disease Journal, 28 (11), 960–965. Doi: 10.1097/INF.0b013e3181a90883. Ruimy R, Maiga A, Armand-Lefevre L, Maiga I, & Diallo A, Koumaré, A. K., et al. (2008) The carriage population of Staphylococcus aureus from Mali is composed of a combination of pandemic clones and the divergent Panton-Valentine leukocidin-positive genotype ST152. Journal of Bacteriology, 190, 3962–3968. Doi: 10.1128/JB.01947-07. Saba, C. K. S., Amenyona, J. K., & Kpordze, S. W. (2017). Prevalence and pattern of antibiotic resistance of Staphylococcus aureus isolated from door handles and other points of contact in public hospitals in Ghana. Antimicrobial Resistance and Infection Control, 6, 44. http://doi.org/10.1186/s13756-017-0203-2. 76 University of Ghana http://ugspace.ug.edu.gh Saha, B., Singh, A. K., Ghosh, A., & Bal, M. (2008). Identification and characterization of a vancomycin-resistant Staphylococcus aureus isolated from Kolkata (South Asia). Journal of Medical Microbiology, 57 (Pt 1), 72–79. Doi: 10.1099/jmm.0.47144-0. Sajith Khan, A K, Preetha, J. S., Lakshmi, S. Y., Anandi, C., & Ramesh, R. (2012). Detection of mecA genes of methicillin-resistant Staphylococcus aureus by polymerase chain reaction. International Journal of Health and Rehabilitation Sciences, 1 (2), 64–68. Doi: 10.5455/ijhrs.000000011. Sakoulas, G., Eliopoulos, G. M., Moellering Jr., R. C., Novick, R. P., Venkataraman, L., Wennersten C. et al. (2003). Staphylococcus aureus accessory gene regulator (agr) Group II: is there a relationship to the development of intermediate-level glycopeptide resistance?. The Journal of Infectious Diseases, 187 (6), 929–938. https://doi.org/10.1086/368128. Sampane-Donkor, E., Badoe, E. V., Annan, J. A., & Nii-Trebi, N. I. (2017). Colonisation of antibiotic-resistant bacteria in a cohort of HIV infected children in Ghana. Pan African Medical Journal, 26, 1–7. http://doi.org/10.11604/pamj.2017.26.60.10981. Sax, H., Allegranzi, B., Uçkay, I., Larson, E., Boyce, J., & Pittet, D. (2007). ‘My five moments for hand hygiene’: a user-centered design approach to understand, train, monitor and report hand hygiene. Journal of Hospital Infection, 67, 9–21. Doi:10.1016/j.jhin.2007.06.004. Schaumburg, F., Alabi, A. S., Peters, G., & Becker, K. (2014). New epidemiology of Staphylococcus aureus infection from Africa. Clinical Microbiology and Infection, 20, 589– 596. Doi: 10.1111/1469-0691.12690. Seybold, U., Supthut-Schroder, B., Draenert, R., Hogardt, M., & Bogner, J. R. (2009). Prevalence and risk factors of nasal colonization with Staphylococcus aureus – association with HIV 77 University of Ghana http://ugspace.ug.edu.gh infection in older patients. Scandinavian Journal of Infectious Diseases, 41 (1), 63–66. Doi: 10.1080/00365540802460000. Shehabel-Din, S. A., El-Shafey, E., El-Hadidy, M., Bahaa El-Din, A, El-Hadidy M., & Zaghloul H. (2003). Methicillin-resistant Staphylococcus aureus: a problem in the burns unit. Egyptian Journal of Plastic and Reconstructive Surgery, 27, 1–10. Shet, A., Mathema, B., Mediavilla, J. R., Kishii, K., Mehandru, S., Jeane-Pierre, P., et al. (2009). Colonization and subsequent skin and soft tissue infection due to methicillin-resistant Staphylococcus aureus in a cohort of otherwise healthy adults infected with HIV Type 1. The Journal of Infectious Diseases, 200 (1), 88–93. http://doi.org/10.1086/599315. Shittu, A. O., Okon, K., Adesida, S., Oyedara, O., Witte, W., Strommenger, B., et al. (2011). Antibiotic resistance and molecular epidemiology of Staphylococcus aureus in Nigeria. BMC Microbiology, 11, 92. Doi: 10.1186/1471-2180-11-92. Sola, C., Paganini, H., Egea, A. L., Moyano, A. J., Garnero, A., Kevric, I., et al. (2012). Spread of epidemic MRSA-ST5-IV clone encoding PVL as a major cause of community onset staphylococcal infections in Argentinean children. PLoS ONE, 7 (1), e30487. Doi: 10.1371/journal.pone.0030487. Stanton, B. F., & Clemens, J. D. (1987). An educational intervention for altering water-sanitation behaviors to reduce childhood diarrhea in urban Bangladesh. II. A randomized trial to assess the impact of the intervention on hygienic behaviors and rates of diarrhea. American Journal of Epidemiology, 125 (2), 292–301. Stevens, D. L., Ma, Y., Salmi, D. B., McIndoo, E., Wallace, R. J., & Bryant, A. E. (2007). Impact of antibiotics on expression of virulence-associated exotoxin genes in methicillin-sensitive 78 University of Ghana http://ugspace.ug.edu.gh and methicillin-resistant Staphylococcus aureus. The Journal of Infectious Diseases, 195 (2), 202–211. https://doi.org/10.1086/510396. Storch, M. L., Rothenburger, S. J., & Jacinto, G. (2004). Experimental efficacy study of coated Vicryl plus antibacterial suture in guinea pigs challenged with Staphylococcus aureus. Surgical Infections (Larchmt.), 5 (3), 281–288. http://dx.doi.org/10.1089/sur.2004.5.281 Strommenger, B., Layer, F., Klare, I., & Werner, G. (2015). Pre-use susceptibility to ceftaroline in clinical Staphylococcus aureus isolates from Germany: is there a non-susceptible pool to be selected? PLoS One, 10 (5), e0125864. Doi: 10.1371/journal.pone.0125864. Syed, A. K., Ghosh, S., Love, N. G., Boles, B. R., Skaar, E., & Hultgren, S. J. (2014). Triclosan promotes Staphylococcus aureus nasal colonization. mBio, 5 (2), e01015–13. Doi: 10.1128/mBio.01015-13. Szumowski, J. D., Wener, K. M., Gold, H. S., Wong, M., Venkataraman, L., Runde, C. A., et al. (2009). Colonization, behavioral risk factors, and skin and soft-tissue infection at an ambulatory clinic serving a large population of HIV-infected men who have sex with men. Clinical Infectious Diseases, 49 (1), 118–121, https://doi.org/10.1086/599608. Tacconelli, E., Venkataraman, L., De Girolami, P. C., & D’Agata E. M. (2004). Methicillin- resistant Staphylococcus aureus bacteraemia diagnosed at hospital admission: distinguishing between community-acquired versus healthcare-associated strains. Journal of Antimicrobial Chemotherapy, 53, 474e479. Doi: 10.1093/jac/dkh107. Tenover, F. C., Weigel, L. M., Appelbaum, P. C., McDougal, L. K., Chaitram, J., McAllister, S., et al. (2004). Vancomycin-resistant Staphylococcus aureus isolate from a patient in Pennsylvania. Antimicrobial Agents and Chemotherapy, 48 (1), 275–280. Doi: 79 University of Ghana http://ugspace.ug.edu.gh 10.1128/AAC.48.1.275-280.2004. Tetteh-Quarcoo, P. B., Anim-Baidoo, I., Attah, S. K., Baako, B. A.-L., Opintan, J. A., Minamor, A. A., et al. (2016). Microbial content of bowl water used for communal handwashing in preschools within Accra Metropolis, Ghana. International Journal of Microbiology, 2016, 2617473. Doi: 10.1155/2016/2617473. Tiemersma, E. W., Bronzwaer, S. L., Lyytikäinen, O., Degener, J. E., Schrijnemakers, P., Bruinsma, N., et al. (2004). Methicillin-resistant Staphylococcus aureus in Europe, 1999- 2002. Emerging Infectious Diseases, 10 (9), 1627–1634. Doi: 10.3201/eid1009.040069. Tiwari, H. K., & Sen, M. R. (2006). Emergence of vancomycin-resistant Staphylococcus aureus (VRSA) from a tertiary care hospital from northern part of India. BMC Infectious Diseases, 6, 156. Doi: 10.1186/1471-2334-6-156. Todar, K. (2006). Todar's Online Textbook of Bacteriology; Department of Bacteriology, University of Wisconsin-Madison: Madison, WI, USA. Tristan, A., Ferry, T., Durand, G., Dauwalder, O., Bes, M., Lina, G., et al. (2007). Virulence determinants in community and hospital methicillin-resistant Staphylococcus aureus. Journal of Hospital Infection, 65 (2), 105–109. Doi: 10.1016/S0195-6701(07)60025-5. Tsiodras, S., Gold, H. S., Sakoulas, G., Eliopoulos, G. M., Wennersten, C., Venkataraman, L., et al. (2001). Linezolid resistance in a clinical isolate of Staphylococcus aureus. Lancet, 358 (9277), 207–208. Doi: 10.1016/S0140-6736(01)05410-1. Vieira, M. T. C., Marlow, M. A., Aguiar-Alves, F., Cruz, M. L. S., Gaspar, M. C. S., Rocha, R., et al. (2016). Living conditions as a driving factor in persistent methicillin-resistant Staphylococcus aureus colonization among HIV-infected youth. The Pediatric Infectious 80 University of Ghana http://ugspace.ug.edu.gh Disease Journal, 35 (10), 1126–1131. http://doi.org/10.1097/INF.0000000000001246. Villacian, J. S., Barkham, T., Earnest, A., & Paton, N. I. (2004). Prevalence of and risk factors for nasal colonization with Staphylococcus aureus among human immunodeficiency virus- positive outpatients in Singapore. Infection Control and Hospital Epidemiology, 25 (5), 438– 440. Doi:10.1086/502420. Vinh, D. C., & Rubinstein, E. (2009). Linezolid: a review of safety and tolerability. Journal of Infection, 59 (Supplement 1), S59–S74. Doi: 10.1016/S0163-4453(09)60009-8. Vuotto, C., Longo, F., Balice, M. P., Donelli, G., & Varaldo, P. E. (2014). Antibiotic resistance related to biofilm formation in Klebsiella pneumoniae. Pathogens, 3 (3), 743–758. Doi: 10.3390/pathogens3030743. Vyas, K. J., Shadyab, A. H., Lin, C., & Crum-cianflone, N. F. (2014). Trends and factors associated with initial and recurrent methicillin-resistant Staphylococcus aureus (MRSA) skin and soft-tissue infections among HIV-infected persons: an 18-year study. Journal of the International Association of Providers of AIDS Care, 13 (3), 206–213. http://doi.org/10.1177/2325957412473780 Wertheim, H. F. L, Melles, D. C., Vos, M. C., Leeuwen, W., Van, B. A., Verbrugh, H. A., et al. (2005). The role of nasal carriage in Staphylococcus aureus infections. The Lancet Infectious Diseases, 5 (12), 751–762. Doi: 10.1016/S1473-3099(05)70295-4. Whitener, C. J., Park, S. Y, Browne, F. A., Parent, L. J, Julian, K.., Bozdogan, B., et al. (2004). Vancomycin-resistant Staphylococcus aureus in the absence of vancomycin exposure. Clinical Infectious Diseases, 38 (8), 1049–1055. Doi: 10.1086/382357. Widmer, A. F. (2000). Replace Hand Washing with Use of a Waterless Alcohol Hand Rub ? 81 University of Ghana http://ugspace.ug.edu.gh Clinical Infectious Diseases, 31 (1), 136–143. Doi: 10.1086/313888. Williams, R. E. O. (1963). Healthy carriage of Staphylococcus aureus: its prevalence and importance. Bacteriology Reviews, 27 (1), 56–71. Wilson, J. M., Chandler, G. N., & Muslihatun, J. (1991). Hand-washing reduces diarrhoea episodes: a study in Lombok, Indonesia. Transactions of the Royal Society of Tropical Medicine and Hygiene, 85 (6), 819–821. Zacharioudakis, I. M., Zervou, F. N., Ziakas, P. D., & Mylonakis, E. (2014). Meta-analysis of methicillin-resistant Staphylococcus aureus colonization and risk of infection in dialysis patients. Journal of the American Society of Nephrology, 25 (9), 2131–2141. Doi: 10.1681/ASN.2013091028. Zervou, F. N., Zacharioudakis, I. M., Ziakas, P. D., Rich, J. D., & Mylonakis, E. (2014). Prevalence of and risk factors for methicillin-resistant Staphylococcus aureus colonization in HIV infection: a meta-analysis. Clinical Infectious Diseases, 59 (9), 1302–1311. http://doi.org/10.1093/cid/ciu559. 82 University of Ghana http://ugspace.ug.edu.gh A P P E N D I X I RESEARCH CONSENT FORM Investigator: Mr. Fleischer Charles Kotey Institution: Department of Medical Microbiology, SBAHS. Research title: Nasal colonization with methicillin-resistant Staphylococcus aureus among HIV-infected children Invitation to participate in the research: Staphylococcus aureus is a bacterium that is found in the nose and skin. It can spread to other parts of the body from these sites and cause a wide range of infections in their hosts, and can also spread to others. Some strains of this bacterium cannot be treated with methicillin because they have acquired resistance to that antimicrobial. Those strains are called methicillin-resistant Staphylococcus aureus (MRSA). MRSA strains cause a wide range of serious diseases in people, particularly, the HIV-infected, because their immune system is less able to fight diseases. Also, infections caused by MRSA are difficult to treat. It is therefore important to investigate nasal colonization of MRSA in HIV-infected children, in order to contribute information necessary in the management of these patients to promote their health. The collection process will involve a routine clinical procedure by qualified personnel. Duration of the study: Anterior nasal swabs will be collected within a three-month period. Benefits of the study: MRSA nasal colonization studies will provide a baseline data on MRSA prevalence and antimicrobial resistance among HIV/AIDS patients. This information is necessary for effective management of HIV-infected individuals. 83 University of Ghana http://ugspace.ug.edu.gh Use of collected material: Bacteria will be isolated from the samples collected from all the study participants. These samples will be destroyed by burning after 2 years. The bacteria may be subjected to genetic studies, and may be preserved in the freezer for future investigations. Potential hazards of the study: There may be a slight discomfort when taking the anterior nasal swab specimens from your ward. Participant’s rights to refuse or withdraw: If you have read this form, or the content herein has been clearly explained to you, and you have agreed to let your ward participate in this study, please note that participation is voluntary and you have the right to withdraw your consent or discontinue participation in the project at any time without penalty. It is also your right to refuse to answer questions you are not comfortable with. Confidentiality: All collected materials from your ward will be coded using numbers and letters. The privacy of your ward will be maintained in all published and written data resulting from the study. Questions, concerns, or complaints: If you have any issues relating to this study, please direct them to Prof. Eric Sampane-Donkor (0547844664), Dr. Nicholas T. K. D. Dayie (0208449415), or Mr. Fleischer Charles Kotey (0265662494), of the Department of Medical Microbiology, SBAHS. Consent for inclusion: If you agree to the inclusion of your ward in this study, please complete the form below; I ..............……………………………………………………………………………… on this day …………………….. (Day/Month/Year) attest that I understand the explanations given in the consent form and thus give permission to Mr. Fleischer Charles Kotey to include my ward in the 84 University of Ghana http://ugspace.ug.edu.gh research study titled “Nasal colonization with methicillin-resistant Staphylococcus aureus among HIV-infected children”. Signature of participant’s guardian: …………………………………........................... Contact address: .............………………………………………….. Phone number: ………………………........................................... Thumb print (where required) 85 University of Ghana http://ugspace.ug.edu.gh A P P E N D I X I I RESEARCH ASSENT FORM Investigator: Mr. Fleischer Charles Kotey Institution: Department of Medical Microbiology, SBAHS. Research title: Nasal colonization with methicillin-resistant Staphylococcus aureus among HIV-infected children Invitation to participate in the research: Staphylococcus aureus is a bacterium that is found in the nose and skin. It can spread to other parts of the body from these sites and cause a wide range of infections in their hosts, and can also spread to others. Some strains of this bacterium cannot be treated with methicillin because they have acquired resistance to that antimicrobial. Those strains are called methicillin-resistant Staphylococcus aureus (MRSA). MRSA strains cause a wide range of serious diseases in people, particularly, the HIV-infected, because their immune system is less able to fight diseases. Also, infections caused by MRSA are difficult to treat. It is therefore important to investigate nasal colonization of MRSA in HIV-infected children, in order to contribute information necessary in the management of these patients to promote their health. The collection process will involve a routine clinical procedure by qualified personnel. Duration of the study: Anterior nasal swabs will be collected within a three-month period. Benefits of the study: MRSA nasal colonization studies will provide a baseline data on MRSA prevalence and antimicrobial resistance among HIV/AIDS patients. This information is necessary for effective management of HIV-infected individuals. 86 University of Ghana http://ugspace.ug.edu.gh Use of collected material: Bacteria will be isolated from the samples collected from all the study participants. These samples will be destroyed by burning after 2 years. The bacteria may be subjected to genetic studies, and may be preserved in the freezer for future investigations. Potential hazards of the study: There may be a slight discomfort when taking the anterior nasal swab specimens from you. Participant’s rights to refuse or withdraw: If you have read this form, or the content herein has been clearly explained to you, and you have agreed to participate in this study, please note that participation is voluntary and you have the right to withdraw your consent or discontinue participation in the project at any time without penalty. It is also your right to refuse to answer questions you are not comfortable with. Confidentiality: All materials collected from you will be coded using numbers and letters. Your privacy will be maintained in all published and written data resulting from the study. Questions, concerns, or complaints: If you have any issues relating to this study, please direct them to Prof. Eric Sampane-Donkor (0547844664), Dr. Nicholas T. K. D. Dayie (0208449415), or Mr. Fleischer Charles Kotey (0265662494), of the Department of Medical Microbiology, SBAHS. Consent for inclusion: If you agree to be included in this study, please complete the form below; I .................................................…..……………………………………………… on this day …………………….. (Day/Month/Year) attest that I understand the explanations given in the consent form and thus give permission to Mr. Fleischer Charles Kotey to include me in the research study titled “Nasal colonization with methicillin-resistant Staphylococcus aureus among HIV- infected children”. 87 University of Ghana http://ugspace.ug.edu.gh Signature of participant: …………………………………........................... Contact address: .............………………………………………….. Phone number: ………………………........................................... Thumb Print (Where required) 88 University of Ghana http://ugspace.ug.edu.gh APPENDIX III MRSA PROJECT: QUESTIONNAIRE FOR ANALYSIS OF RISK FACTORS SECTION A: BIODATA/DEMOGRAPHY 1. Patient ID ……………… 2. Age …….………… 3. Sex Male/Female 4. Height ……………… 5. Weight ……………… 6. CD4 count ……………… 7. Are you enrolled in school? Yes/No SECTION B: HOUSEHOLD CHARACTERISTICS 8. Type of Residence: Residential/Compound 9. How many people live in your house? ……………… 10. How frequently do you wash your hands with soap? Rarely/Often SECTION C: MEDICAL HISTORY 11. Do you self-medicate? Yes/No 12. Are you on cotrimoxazole prophylaxis? Yes/No 13. Are you on antiretroviral drugs? Yes/No 14. Have you been hospitalized within the past year? Yes/No 15. If your answer to (14) is yes, how many times? ……………… 16. Do you have any underlying disease condition? Yes/No 89 University of Ghana http://ugspace.ug.edu.gh 17. If your answer to (16) is yes, what condition is it? …...………… 18. Do you have a chronic skin condition Yes/No 19. Have you had a history of pneumonia? Yes/No 20. Do you have a history of tuberculosis? Yes/No 21. Do you have a history of surgical procedures? Yes/No 22. Is any member of your household a health worker? Yes/No 90