SUSTAINABLE FORESTRY IN GHANA: TRACING ILLEGALLY LOGGED TIMBER SPECIES THROUGH DNA BARCODING BY EMILY AKUORKOR AMARH THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE AWARD OF MPHIL ENVIRONMENTAL SCIENCE DEGREE DECEMBER, 2014 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh i SUSTAINABLE FORESTRY IN GHANA: TRACING ILLEGALLY LOGGED TIMBER SPECIES THROUGH DNA BARCODING BY EMILY AKUORKOR AMARH (10230221) THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE AWARD OF MPHIL ENVIRONMENTAL SCIENCE DEGREE DECEMBER, 2014 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh ii DECLARATION I hereby declare that, except for references to other peoples’ work which have been duly cited, this work is the result of my own research under supervision and that this thesis has neither in whole nor in part been presented for another degree elsewhere. EMILY AKUORKOR AMARH (STUDENT) ……………………………… ………………………… (SIGNATURE) (DATE) PROF. GABRIEL K. AMEKA (PRINCIPAL SUPERVISOR) ………………………… ………………………… (SIGNATURE) (DATE) DR. TED ANNANG (CO- SUPERVISOR) …………………………… ……………………….. (SIGNATURE) (DATE) University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh iii DEDICATION I dedicate this piece of work first to the Almighty God for his constant love, mercies and protection upon me throughout my period of study, my parents Mr and Mrs Ashitey Amarh and a special friend Lt Raymond Incoom for their support throughout my education, I say God richly bless you. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh iv ACKNOWLEDGEMENT I would like to wholeheartedly express my deepest thanks to first the Almighty God, the source of every good gift and perfect present for his loving care towards me in the preparation of this project. Secondly I would like to register my sincerest gratitude and profound appreciation to Prof. Gabriel K. Ameka and Dr. Ted Annang for their advice, criticisms, contributions; guidelines and instructions they invested into making this work a success. I really appreciate all your efforts and may the Lord bless you for that wonderful gesture you showed towards me. I also wish to acknowledge Mr Amponsah, Mr Emmanuel Amponsah Adjei and Dr Kwakye Ameyaw for their assistance. My sincere gratitude also goes to my colleagues who in one way or the other assisted me with my work. Furthermore this work could not have materialized without the financial support of BSUEC Scholarship Awards from the Office of Research, Innovation & Development. I am most grateful. Finally I would like to thank my parents once again, my entire family members and all my friends especially Thomas Gyimah, Abigail Tettey and Florence Dery for their support throughout the study. I say God richly bless you. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh v ABSTRACT Forests are considered to be a strategic resource for national development and have great importance on a nation’s environment. Despite increasing concern over the loss of tropical forests and the significant local and international efforts to find solutions to the problems, the rate of deforestation in the tropics continues to increase. Though Ghana’s timber export is the fourth largest industry after gold, tourism and cocoa, her primary rain forest has reduced drastically over the years. It is imperative to make conscious efforts to save our forest and timber resources. However, the correct identification of all timber species is the first step towards their proper management. This study sought to use DNA barcoding as a tool in the identification of timber tree species that are used in commercial trade to enhance sustainable forestry in Ghana. DNA barcoding is an innovative technology appropriate to identify organisms by comparing a sequence of a standard gene region from an unknown specimen with a comprehensive database of sequences from species of established identity. Silica-dried leaf samples of timber trees species in commercial trade in southern Ghana were collected from three biodiversity hotspots in the country namely Bia National Park, Ankasa Resource Reserve and Kakum National Park and sequenced at rbcLa gene region. A success rate of 96.77% was obtained from the sequence. These sequences form the database of DNA barcodes for the identification of timber tree species in commercial trade in southern Ghana. Six timber species were sequenced to verify the utility of the database; they were successfully sequenced and matched with their counterparts in the main database. A hundred percent matching success was achieved which implies that DNA barcoding can correctly identify all timber species. A purposive sampling method was employed to determine the knowledge of plant identification, timber resource situation, timber species used on the industry and the level and the importance of forest conservation using structured University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh vi questionnaires and interview guides. Identification of plants using morphological features was the only method used by the respondents in the identification of timber species. Sawn timber was identified by the use of colour and scent produced by the wood which at times is misleading and virtually impossible for woods with the same colour and produces mild or no scent. DNA barcoding is therefore, the efficient identification tool which must be accepted and use by the timber industry to solve these identification challenges. 80% of the respondents were aware of the importance of forest conservation, however, 43% think it is irrelevant to the protection of timber trees species. To ensure the sustainability of our forest both the direct and indirect causes must be tackled simultaneously. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh vii TABLE OF CONTENTS Title Page DECLARATION ............................................................................................................................ ii DEDICATION ............................................................................................................................... iii ACKNOWLEDGEMENT ............................................................................................................. iv ABSTRACT .................................................................................................................................... v TABLE OF CONTENTS .............................................................................................................. vii LIST OF TABLES ......................................................................................................................... xi LIST OF FIGURES ...................................................................................................................... xii LIST OF ABBREVIATIONS ...................................................................................................... xiii CHAPTER ONE ............................................................................................................................. 1 1.0 INTRODUCTION .................................................................................................................... 1 1.1 Background ........................................................................................................................... 1 1.2 Problem statement ............................................................................................................ 4 1.3 Justification ...................................................................................................................... 5 1.4 Objectives of the study ..................................................................................................... 6 CHAPTER TWO ............................................................................................................................ 7 2.0 LITERATURE REVIEW ......................................................................................................... 7 2.1 State of Ghana’s Forests ................................................................................................... 7 2.2 Importance of forest ......................................................................................................... 8 2.3 Sustainable Forestry ......................................................................................................... 9 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh viii 2.4 Factors affecting sustainable forestry ............................................................................. 10 2.4.1 Effect of logging on forests ........................................................................................ 10 2.4.2 Effect of mining on forests ......................................................................................... 11 2.4.3 Shifting cultivation and forest degradation ................................................................ 12 2.4.4 Effect of Population growth on forests ....................................................................... 12 2.5 Some solutions to factors affecting sustainable forestry ................................................ 13 2.5.1 Participatory forest management and rights ........................................................... 14 2.5.2 Encouraging traditional commercial timber ........................................................... 15 2.6 DNA barcoding. ............................................................................................................. 16 2.7 Some applications of DNA barcoding ........................................................................... 17 2.8 Challenges of DNA Barcoding ...................................................................................... 19 CHAPTER THREE ...................................................................................................................... 21 3.0 MATERIALS AND METHODS ............................................................................................ 21 3.1 Study Area ...................................................................................................................... 21 3.1.1 Bia Biosphere Reserve ............................................................................................ 21 3.1.2 Ankasa Resource Reserve ....................................................................................... 24 3.1.3 Kakum National Park .............................................................................................. 26 3.2 Taxon Sampling ............................................................................................................. 28 3.3 Preparing samples for DNA Extraction ......................................................................... 28 3.4 Preparing Sample for herbarium voucher ...................................................................... 29 3.5 DNA Extraction.............................................................................................................. 30 3.6 Extraction Process .......................................................................................................... 30 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh ix 3.7 DNA Amplification ........................................................................................................ 31 3.8 DNA Sequencing And Editing ....................................................................................... 32 3.9 Social Survey.................................................................................................................. 33 3.9.1 Secondary Data ....................................................................................................... 33 3.9.2 Primary Data ........................................................................................................... 33 3.9.3 Data analysis ........................................................................................................... 34 CHAPTER FOUR ......................................................................................................................... 35 4.0 RESULTS ............................................................................................................................... 35 4.1 Timber species commonly logged and are in commercial trade in Ghana .................... 35 4.2 Characteristics of DNA Barcodes of tree species in commercial trade in Ghana .......... 37 4.3 Relationship between the tree species in commercial trade in Ghana ........................... 79 4.4 Verification of DNA database ........................................................................................ 81 4.5 Social Survey.................................................................................................................. 85 4.5.1 Demographic Characteristics of respondents.......................................................... 85 4.5.2 Timber species used for commercial trade commonly found on the Ghanaian timber market used by wood dealers and furniture producers. ......................................................... 86 4.5.3 Timber Resource Situation ..................................................................................... 89 4.5.4 Level of awareness of forest conservation methods ............................................... 90 CHAPTER FIVE .......................................................................................................................... 92 5.0 DISCUSSION ......................................................................................................................... 92 5.1 DNA Barcoding of tree species in commercial trade in Ghana ..................................... 92 5.2 Characteristics of the Respondents ................................................................................ 94 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh x 5.2.1 Common timber species found on the market used by respondents ....................... 94 5.2.2 Timber resource situation and awareness of forest conservation ........................... 96 CHAPTER SIX ............................................................................................................................. 98 6.0 CONCLUSION AND RECOMMENDATIONS ................................................................... 98 REFERENCES ........................................................................................................................... 100 APPENDICES ............................................................................................................................ 114 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh xi LIST OF TABLES Table 1: Commonly logged timber species in commercial trade and their conservation status ... 35 Table 2: Demographic characteristics of respondents. ................................................................. 86 Table 3: Preference of timber species used by furniture producers and wood dealers. ................ 88 Table 4: Perceived causes and solutions to loss of timber plants species as suggested by furniture producers and wood dealers. ......................................................................................................... 90 Table 5: Level of awareness, source of awareness and the significance of forest conservation to respondents. .................................................................................................................................. 91 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh xii LIST OF FIGURES Figure 1: Map showing the location of Bia Biosphere Reserve ................................................... 23 Figure 2: Map showing the location of Ankasa Resource Reserve .............................................. 25 Figure 3: Map showing the location of Kakum National Park. .................................................... 27 Figure 4: Cladogram of timber trees collected from the three study areas ................................... 80 Figure 5: Superimposed cladogram of both database sequences and verification sequences ...... 84 Figure 6: Common timber species found on the market used by furniture producers and wood dealers. .......................................................................................................................................... 87 Figure 7: Identification of timber species used by furniture producers and wood dealers. .......... 88 Figure 8: Changes in timber species observed by furniture producers and wood dealers. ........... 89 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh xiii LIST OF ABBREVIATIONS BP Base pairs CBOL Consortium for the barcode of life CIA Chloroform Isoanyl Alcohol CTAB Cetyltrimethyl Ammonium Bromide DNA Deoxyribonucleic acid FAO Food and agricultural organization FC Forestry Commission IUCN International Union for Conservation of Nature ICTSD International Centre for Trade and Sustainable Development NTFPs Non-timber forest products PAUP Phylogenic Analysis Using Parsimony PCR Polymerized Chain Reaction RbcLa Ribulose-1, 5-bisphosphate carboxylase/oxygenase large subunit RNA Ribonucleic acid University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 1 CHAPTER ONE 1.0 INTRODUCTION 1.1 Background Forests create a strategic resource for national development where they are found (Abugre & Kazaare, 2010). They are, therefore, considered as capital assets of utmost economic and social importance, and they exercise great and invaluable influence on a nation’s environment, not only in West and Central Africa, but also all over the world (Nani-Nutakor & Boateng, 1996). The benefits that society derives from the forest include production of wood (timber) and other non- timber forest products (NTFPS), protection and conservation of the environment (soil, water, wildlife etc.) and provision of opportunities for recreation. According to Myers (1985), forests also offer employment to many people and contribute a lot to the national economy. It has been estimated that about 60 million people are entirely dependent on forests, while more than 1.6 billion, a quarter of the world’s population also depend on forest for amenities like fuel and building materials etc (Abugre & Kazaare, 2010). The degradation of tropical forests, with the corresponding loss of global biodiversity and environmental services, has resulted in the initiation of a number of international actions to address this problem (Nielsen & Kjær, 2008). Unsustainable management of forest resources however continues, leading to a decreased forest area in large parts of the world (FAO, 2005; FAO, 2006). Besides loss of natural resources and environmental values, unsustainable management practices like illegal logging are associated with a number of negative effects such as violation of indigenous peoples’ rights and public or private ownership, violation of local financial and tax regulation, and corruption of civil servants (Tacconi, 2007). Illegal logging and University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 2 trade in illegally logged timber and wood products are the cause of many economic and ecological problems both in the producer and the consumer countries and believed to be one of the chief causes of worldwide deforestation and forest degradation in many developing countries (Degen & Fladung, 2007). Forest destruction in turn contributes up to 20 percent of global carbon dioxide emission (Lawson & MacFaul, 2010). Illegal logging also robs cash-strapped governments of vital revenues, with a devastating impact on the livelihoods of forest-dependent people and fosters corruption. Trade in illegally logged timber and wood products create market disadvantages for products from sustainable forestry (Lawson & MacFaul, 2010). Over the last decade, governments, private sectors and civil societies have recognized these impacts and have made increasing efforts to tackle these problems. A study by Asner, (2006) shows that, illegal logging of large-high value trees is often the critical first step on the road towards eventual forest destruction in primary tropical forests. Despite efforts made by governments, private sectors and civil societies to curb this menace, illegal logging continues to expand (Lawson & MacFaul, 2010). According to Scientific Correspondence (2007), taxonomy, the science of naming and classifying organisms is the foundation of biology. Its function is to identify biological specimens or fragments of biological origin, but this has been very challenging due to a scarcity of natural history specialists. According to Chase et al. (2005), there can be only few experts of taxonomy for a particular group of species worldwide, thus making it very difficult for a smooth identification of such species. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 3 Taxonomic problems are on the increase because taxonomists use largely morphological features to identify species. It is sometimes very difficult to differentiate between identical species based on morphology alone, thereby resulting in mis-identification (Scientific Correspondence, 2007). It has, therefore, become very difficult to protect vulnerable species and also identify and punish those who deal in red listed species. According to Hebert et al. (2003), the emergence of DNA barcoding as a means of species identification has the potential to address all the shortcomings in morphological and other molecular forms of identification. DNA barcoding is a technique for identifying organisms based on a short, standardized fragment of genomic DNA. The rationale of using the short DNA sequence called (universal molecular yardstick), is that “it differentiates among species of a taxon under the assumption that the sequences chosen have relatively lower ‘within-taxon’ variation than that ‘between-taxa’ which can be used in distinguishing between closely related species (Scientific Correspondence, 2007). Since the proposition of this concept and the launch of the ‘‘Barcode of Life’’ project, this simple technique has attracted attention from various experts such as taxonomists, ecologists, conservation biologists, agriculturists, plant quarantine officers, with many others using the DNA barcode (Jinbo et al., 2011). Several studies are being carried out now around the world to produce DNA barcodes like FISHBOL (barcode of fish of the world) and TREEBOL, (barcode of trees of the world) for all known organisms. Many projects are also being undertaken currently to use DNA barcoding in forensics and socio-economic development. DNA barcoding can be employed to trace illegal logging to reduce deforestation and biodiversity loss. The fight against the threat of illegal felling of timber species with its potential associated deforestation, general environmental degradation and general loss of biodiversity may benefit University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 4 immensely from the use of DNA barcoding in the proper identification of such timber species to reduce deforestation, loss of tree species and promote sustainable forestry in Ghana. 1.2 Problem statement The World Bank has estimated that up to 60% of logging in Ghana has been illegal and other estimates range from 43% to 60% (FAO, 2001). In the last 50 years, Ghana’s primary rainforest has been reduced by 90% and in the period 1990-2005, the country lost 1.9 million ha or 26% of its tropical forest cover (FAO, 2001). Large areas of forest have been destroyed by illegal logging, illegal gold mining and agricultural conversion for cacao (http://www.illegal- logging.info). Ghana’s virgin forests have been declining at a very fast rate since 1990 in spite of the numerous values of the forest resources (Abugre & Kazaare, 2010). According to FAO (2005), the average estimated annual rate of deforestation between 1990 and 2000 was 120,000 hectares; the average growing stock in the remaining forest area is only 49 m3 per hectare. At the beginning of this century, Ghana’s forest zone, which covered 8.2 million hectare, has been reduced drastically to about 1.7 million ha. Pressure on the remaining forest has increased because of the large number of wood processing plants and illegal operations (Chachu, 1989). At the current rate of wood consumption in Ghana, whether for the timber industry, illegal timber trade, or fuel wood use, the remaining fragmented forest patches will likely disappear soon unless serious changes are made immediately to combat these threats. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 5 Illegal logging has been increasingly recognized as a leading problem facing forest management globally (Abugre & Kazaare, 2010). Thus this study seeks to use DNA barcoding as an identification tool to trace illegal logging to reduce deforestation. In many instances of illegal logging and trade in illegal timber and wood products prosecution in the law courts is difficult because law enforcement officers are not able to prove beyond all reasonable doubt that the species in question is one that is prohibited by law to be logged without a valid permit (Hayman Brack &, 2002). Law enforcement officers lack the capacity to identify correctly their exhibits in court. This is because they use only morphological characteristics and these characteristics are not always reliable. In this way illegal loggers go unpunished. It normally becomes very difficult to enforce the law without accurate and precise identification of commercial trees, and trees that are illegally logged. DNA barcoding will ensure accurate and rapid identification of trees in commercial trade. 1.3 Justification Ghanaian timber exports bring US$ 400 million to the domestic economy, making it the fourth largest industry after gold, tourism and cocoa (ICTSD, 2008) but logging practices in the country have been widely criticized as unsustainable as illegal harvesting is rampant (ICTSD, 2008). In view of this, the current study is important as it will provide DNA barcode sequences of commercial timber species in the country. This will ensure the accurate identification of trees and allow the successful prosecution of illegal loggers so as to reduce illegal logging and the trade in illegal timber and wood products, thus reducing deforestation, loss of tree species and enabling sustainable forestry and development. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 6 1.4 Objectives of the study The main objective of this research is to use DNA barcoding as a tool in the identification of tree species that are used in commercial timber trade to enhance sustainable forestry in Ghana. The specific objectives are to:  Identify timber species that are commonly logged and are in commercial trade in Ghana  Identify current methods of timber identification and its challenges.  Produce DNA barcodes for commercial timber tree species in Ghana.  Verify the utility of DNA barcodes in the identification of timber trees. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 7 CHAPTER TWO 2.0 LITERATURE REVIEW 2.1 State of Ghana’s Forests Many authors indicate that, Ghana’s relatively undisturbed forests harbored abundant biodiversity (Alpert, 1993), which protect fragile soils (FAO, 2007; UNEP, 2002), and regulate the supply of scarce water resources (Glantz & Katz, 1985). However, illegal logging, deforestation and global climate change among other impacts, are significantly causing a rapid loss of biodiversity in the country (Boon et al., 2009). The degradation of forests and the loss of biodiversity in Ghana have increased sharply in recent decades (Dixon et al., 1996). Ghana’s total forest zone is currently estimated at 81,342 km2 and accounts for about 40% of the total land area, out of which about 17,845 km2 are known to be under reservation (Boon et al., 2009). The reserved forest is made up of 11,590 km² of production forests; 4,323 km² of protection forests; and about 1,980 km² of game production reserves (Siaw, 2001; Ghana Forestry Commission, 1995). Ghana, like many tropical countries, continues to lose its remaining closed forests at an alarming rate. According to Allotey (2007), the area of undisturbed forest has reduced to less than 25% of its original value and now exists in fragmented patches estimated to be about 20 to 524 km². Between 1990 and 2005, Ghana has lost about 1.9 million hectares of forest or 26% of her forests cover; the annual deforestation rate is 2.0% (Boon et al., 2009). According to FAO (2001), most of the forests have lost their pristine interior habitats that are critical for the protection of vulnerable species. It was recorded in 1992 that, Ghana was left with only about 1.5 million ha of "intact closed forest" with an annual loss of about 20,000 to agriculture, through bush fires, illegal logging and other anthropogenic activities (Agyarko, University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 8 2001; IUCN, 1992). The forests are now characterized by excessive harvesting of logs, a reduction in standing volumes of species, dwindling resource base, species depletion and loss of biodiversity (Agyarko, 2001). Allotey (2007) stated in his study that about 14% of the total permanent forest reserves in Ghana are now without adequate forest cover. National parks and other protected areas of Ghana’s territory, contain some of the richest biodiversity, but are assigned for timber production. If managed effectively, these forests could maintain their biodiversity values including viable populations of large forest-dwelling species, such as elephants, bongos, and primates; some of which are rare, threatened or endangered. 2.2 Importance of forest Forest resources are essential to social and economic activities in Africa; as a result, they are important elements in both poverty reduction and sustainable development strategies for many Sub-Saharan African countries (Tutu, 2009). It is estimated that forests account for an average of 6% of Gross Domestic Product in Africa, which is the highest in the world (NEPAD, 2003). According to FAO (2001), 15% of Ghanaians depend on the forest for their livelihood with over two-thirds of Sub-Saharan Africa’s (600 million) people directly or indirectly relying on forests for their livelihoods as well as for food security (CIFOR, 2005). Ghana obtains 70% of her energy needs through fuel wood from forest (FAO, 2001). Forests are essential in the recharging of water bodies as well as controlling water flow (Tutu & Akol, 2009). They are, therefore, vital in the health of communities, agricultural production and electricity power generation, which depends on this water. Forests also serve as habitats for numerous species in the world. They help in combating land degradation and desertification and mitigating climate change, by absorbing and sequestering carbon dioxide, a major greenhouse gas which pose serious threats to University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 9 agricultural production among other economic activity (Tutu & Akol, 2009). Despite the numerous benefits of forest to Ghana’s economy, many activities including illegal logging, bushfires and illegal mining among others contribute to the destruction of the forest and if nothing is done to minimize the rate at which the forest is being lost, the future generation will be denied of their right to enjoy the forest. 2.3 Sustainable Forestry Sustainable forestry is the managing of our forest resources to meet the needs of today without interfering with our future generations' needs (Green works, 2005). According to Cubbage (nd), sustainable forestry has become a widely accepted paradigm for forest management since 1992. Forests provide wide-range and diverse benefits to people in the world. These benefits consist of economic outputs such as the income and employment that is generated by forest industries. Well-managed forests also deliver a range of ‘social and environmental’ goods and services. Some of these goods and services include the provision of opportunities for open-access outdoor recreation. Sustainable forestry also contributes to the visual quality of the landscape. Other benefits are improving air quality, regulating water supply and water quality, and providing protection for archaeological sites (Forestry Commission, 2004). These social and environmental benefits cannot be valued in monetary terms; however, understanding the value that people place on these benefits provides useful information for the management of forest resources. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 10 2.4 Factors affecting sustainable forestry Over the years, sustainable management of the tropical forest resources has been of primary concern due to its potential impact on biological diversity and their importance in maintaining global ecological functions such as weather conditions (Ezebilo, 2004). Most of the African timber rich zones are faced with diminishing forest resources due to illegal logging activities, human and animal population pressures, shifting cultivation, global climate change among others, which have led to forest degradation (Ezebilo, 2004). Kio (1992) predicted that, within the next thirty years, unless adequate measures are taken, most humid tropical forestland area in Africa could be transformed into unproductive land and the deterioration of the savanna into desert will be accelerated. Some factors affecting sustainable forestry are discussed in the sections that follow. 2.4.1 Effect of logging on forests Logging can seriously degrade forests (Putz et al., 2001). According to Abdullhadi and Surkardjo (1981), logging activities may result in the disappearance of species thus reducing species diversity and the potential of the forest. Uncontrolled logging and illegal logging activities has considerable impacts on biodiversity conservation, forest structure and species composition and may lead to loss and fragmentation of forests (Foaham & Jonkers, 1992). Many authors have indicated declines in numbers of large tree species after logging (Okali & Ola- Adams, 1987; Primack & Lee, 1991). Even when there is a minimum of mechanization and relatively little incidental damage during extraction (Ganzhorn et al., 1990), there are declines in over storey tree size, increased abundance of a few small-stemmed species, and a decrease in larger commercial species even several decades after a logging event (Bawa & Seidler, 1997). University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 11 Logging reduces canopy cover and produces large amounts of litter fall. This fuel material renders the forest more susceptible to human-induced forest burning (Cochrane & Schulze, 1999, Nepstad et al., 1999), which is often triggered by ignition sources in adjacent cattle pastures, slash-and-burn plots, and commercial crops (Holdsworth & Uhl, 1997; Gascon et al., 2000; Barlow & Peres, 2004). 2.4.2 Effect of mining on forests Mining is very intensive and very destructive (Mather, 1991; Sands, 2005). According to Boateng (2009), even though there are a lot of important contributions of mining to the economies of many nations, its activities result in the destruction of fauna and flora habitats, changes in topography, hydrology and landscape stability. Vegetation clearance during mining presents one of the most significant threats to sustainable forestry and the conservation of biodiversity (Sarma, 2005; Adjei, 2007; Valerie, 2007). It is estimated that, about 40 % of the global terrestrial vegetation had been exchanged for mineral exploration, exploitation, and infrastructural developments (Noble et al., 1996). In Ghana, 22,000 hectares of the existing forest cover are lost annually as a result of mining and other anthropogenic activities (Hawthorne, 1990). Apart from exposing the soil to higher temperatures, vegetation clearance depletes the soil of nutrients required for vegetation growth (Lu et al., 2002), destroys key ecological processes and promotes forest and habitat fragmentation into isolated, smaller habitat patches (Saunders et al., 1991). University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 12 2.4.3 Shifting cultivation and forest degradation Shifting agriculture is the clearing of forested land for raising or growing the crops until the soil is exhausted of nutrients and/or the site is overtaken by weeds and then moving on to clear more forest (Chakravarty et al., 2012). Lands are used for a few years and then are gradually abandoned to natural vegetation for fallow periods of up to 20 or more years. According to Sponsel (2005), shifting cultivation is practiced by 240 to 500 million people on nearly one-half of the land area of the tropics, since this requires as much as 15-30 hectares to feed one person due to the lengthy fallow period generally required. In the past, shifting cultivation created little or no concerns as human populations were generally low. In recent years, however, the practice has become unsustainable in the light of the vast areas of land required by the exploding human populations. Shifting cultivation accounts for half the world's rainforest destruction (Colchester & Lohmann, 1993). 2.4.4 Effect of Population growth on forests ‘‘Since the genesis of human history, the fate of humans and trees has remained tightly bound. Forests have exerted tremendous influence on livelihoods and economic development in many societies. One of the most important concerns of this age is the question of population growth and whether the earth’s resources can sustain this rapid expansion of population in most parts of the world. This has reignited an extensive debate worldwide on the relationship between population growth, depletion of resources and environmental sustainability’’ (Asongu & Jingwa 2011). The role of population in deforestation is a contentious issue (Mather, 1991; Colchester & Lohmann, 1993; Cropper & Griffiths, 1994; Ehrhardt-Martinez, 1998; Sands, 2005). University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 13 Overpopulation is believed to be one of the causes of forest loss according to the international agencies such as FAO and intergovernmental bodies (Chakravarty et al., 2012). According to the United Nations in 2001, the world population quadrupled from 1.6 billion to 6.1 billion during the period 1900 to 2000. It is also estimated that the world’s population was 4 billion in 1975, 5 billion in 1987, 6 billion in 1999 and just recently in 2011 the world counted its 7 billionth person. In the same progressive vein, the projected estimates for 2027 and 2046 are 8 and 9 billion, respectively (United Nations, 2001). However, this rapid population growth and development has occurred unevenly throughout the world with African countries experiencing higher rates with the consequences of increasing unsustainable utilization of the forest resources. Furthermore the population of Africa increased from 233 million in 1950 to 399 million in 1980, to 633 million in 1990, and to 744 million in 1995. It is estimated that by the year 2025 the population will reach 1.5 billion (WRI and UNEP, 1996-7). Over population has put severe pressure on the land and has accelerated its rate of degradation (Boon, 2007). According to Chakravarty et al. (2012), more people require more food and space which requires more land for agriculture and habitation. This in turn results in more clearing of forests. 2.5 Some solutions to factors affecting sustainable forestry According to Chakravarty et al. (2012), the struggle to save the world’s rainforests continues and there is a growing worldwide concern about the issue. In order to save forests, we need to know why they are being destroyed which serves as the first point of solution. Distinguishing between the agents of degradation and its causes is very important in order to understand the major determinants of forest degradation. The agents of degradation include shifting cultivation by University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 14 different categories of farmers such as commercial farmers, ranchers, loggers, firewood collectors, infrastructure developers and others who are cutting down the forests. In order to address the challenge of forest destruction, there is the need to promote sustainable forest management. In order to promote sustainable forest management, it must be sustainable ecologically, economically and socially (Chakravarty et al., 2012). Achieving ecological sustainability means that the ecological values of the forest must not be degraded and if possible they should be improved. This also implies that silviculture and management should not reduce biodiversity, logging and soil erosion should be controlled, and soil fertility should not be lost, water quality on and off site should be maintained and that forest health and vitality should be safeguarded (Chakravarty et al., 2012). Some of the measures to put in place to ensure sustainable forestry in the country could include the following: participatory forest management and rights, encourage the utilization of substitutes e.g., bamboo and the use of modern technology such as DNA Barcoding in the identification of trees to provide a disincentive to illegal logging and hence ensuring sustainable forestry. 2.5.1 Participatory forest management and rights Forest is nominally owned by the state, but the reach of government and the rule of law are weak and property rights insecure (Chakravarty et al., 2012). In order for forest management to succeed, all parties with an interest in the fate of the forest should be communally involved in planning, management and profit sharing (Colchester & Lohmann, 1993). The balance of rights can be tilted strongly toward society in the form of publicly owned strictly protected areas. State University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 15 ownership and management can be retained but with sustainable timber extraction allowed. As of now much of the world’s tropical forest are state owned but community participation in forest ownership and management needs to be encouraged with restrictions on extraction and conversion (Chomitz et al., 2007). The establishment of the collaborative forest management unit by the Ghana Forestry Commission (FC) was a step in the right direction. This is because the unit has been promoting participatory forest management across the country since its inception in the early1990s. This approach has helped to reduce illegal logging since the involvement of local stakeholders in managing the forests has contributed to the reduction of forest degradation in the country. 2.5.2 Encouraging traditional commercial timber For all purposes where tropical or other timber is used, other woods or materials could be substituted. We can stop using timber and urge others to do the same. As long as there is a market for wood products, trees will continue to be cut down. Labelling schemes, aimed at helping consumers to choose environmental friendly timbers, are currently being discussed in many countries (Anon., 1990). The Bamboo and Rattan Department Programme has been set up in Ghana to promote the use of bamboo and rattan as alternatives to wood to help to reduce the pressure on our forest resources. In conclusion Ameyaw (2012), states that the fight to promote sustainable forestry by addressing factors affecting it adversely needs to be continued and it is also our moral obligation to preserve our forest so as to pass it on to the next generation, because if we fail in this regard, posterity will not forgive us. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 16 2.6 DNA barcoding. DNA barcoding is a standard tool for rapid identification of animals, fungi, microbes and plants species (Hebert et al., 2003) based on a single universal marker or DNA barcode sequence (Fretzal et al., 2008) that mutates enough to distinguish closely related species (Mendelson, 2003). It differs from molecular phylogeny in that the main goal is not to determine classification but to identify an unknown sample in terms of a known classification (Kress et al., 2005). Scientists have come to believe that DNA barcoding will provide a ‘universal key’ that will allow identification of a species by running unknown DNA sequences through a DNA barcode database (Scientific Correspondence, 2007). According to the Consortium for the Barcode of life (2012), until now, biological specimens were identified using morphological features. In some cases a trained technician could make routine identifications using morphological “keys”, but in most cases an experienced professional taxonomist is needed. If a specimen is damaged or is in an immature stage of development, even specialists may be unable to make identifications. DNA Barcoding solves these problems, because non-specialists can obtain barcodes from tiny amounts of tissue. This is not to say that traditional taxonomy has become less important, but rather that DNA barcoding can serve a dual purpose as a new tool in the taxonomists’ toolbox supplementing his/ her knowledge as well as being an innovative device for non-experts who need to make a quick identification. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 17 2.7 Some applications of DNA barcoding DNA barcoding has practical applications in several essential ways including; tracing of illegal logging and trade in endangered and threatened plant and animal species, including CITES and red list species, forensic science, verification and authentication of herbal medicines and among others. DNA barcoding has the prospect of tackling illegal logging. According to Heng (2012), DNA is nature’s barcode. It is inherent in nearly every cell in every organism, and could just be our answer to curbing illegal timber trade. DNA fingerprinting for trees based on technologies routinely used in criminal forensics holds much promise in the field of international enforcement. In other words, these tools are prime candidates for putting a check on illegal logging – an industry which has devastating consequences for biodiversity, ecosystems and national economies alike. According to Nielsen & Kjær (2008), DNA obtained from dried wood samples can be amplified and thus with available DNA data of timber species, dried wood can be traced from the source even to the consumer. This is a positive prospect to deal with the continually challenging problem of illegal logging facing the forestry industry. Lowe & Cross (2011), states that DNA barcoding offer tremendous promise for use in timber tracking at all levels; regional scale, concession and for tracking individual logs or wood products and can also be easily automated offering quick, cheap and high-volume processing. According to Ratnasingham & Hebert (2007) and Ross et al. (2003), DNA sequence database using a standardized gene fragment has the ability to identify wildlife products, whether as processed meat, skins or whole animals hence making it a potential tool for tracing illegal trade in wildlife and wildlife products. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 18 Existing legislation and treaties governing the trade in wildlife, such as the Convention on the International Trade of Endangered Species (CITES) and the United States Endangered Species Act (ESA), are based on the recognition of distinct population or taxonomic units (Eaton et al., 2010). Accurate identification is often impaired due to the types of products involved, which are typically processed and difficult to identify using morphological techniques (Eaton et al., 2010). Baker (2008) argues that to improve our ability to detect; monitor and control the trade in wildlife and wildlife products, so that lawbreakers can be impeached, more accurate and efficient methods of species identification are required such as DNA barcoding. The application of DNA barcoding in many forensic cases involves plant evidence that may be useful to link a suspect, a victim, a weapon, a vehicle to crime scenes (Yoon, 1993; Coyle et al., 2001). According to Coyle et al. (2001), DNA barcoding has the potential to identify a plant species from minute leaf fragments and pollen grains and these have increased its acceptance and use by forensic botanists because often botanical trace evidence does not contain the necessary morphological features that would allow one to identify a plant at the genus or species level. Volpato et al. (2009), applied forensic DNA barcoding to a case where unknown plant material, declared as “almond leaves”, was being imported into Canada from Haiti Border Service. Officers seized the unknown plant material suspecting that it might be tobacco. DNA barcoding was able to reveal that the plant material was from the genus of Terminalia. This genus of large trees includes species like Terminalia catappa, which is used in traditional Haitian medicine. Chemical analysis also suggested that the plant material in question was not tobacco further University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 19 supporting barcoding results. This clearly demonstrates the practical utility of DNA barcoding for these kinds of samples. 2.8 Challenges of DNA Barcoding The success of DNA barcoding is based on the assumption that the short DNA sequence chosen has relatively lower ‘within-taxon’ variation than that ‘between-taxa’ and thus can discriminate among species (www.barcodinglife.org). According to Chase et al. (2005), the efforts to produce DNA barcodes have been very successful for animals and fungi using the cytochrome oxidase 1 gene (COX 1). Unlike animals, ‘land plants have had the reputation of being problematic for DNA barcoding for two general reasons: the standard DNA regions used in algae, animals and fungi have exceedingly low levels of variability and the typically used land plant plastid phylogenetic markers (e.g. rbcL, trnL-F, etc.) appear to have too little variation’ (Chase et al., 2005). The mitochondrial locus being used for many animal groups and algae is not suitable for use in land plants, and an appropriate alternative is needed. Progress has been made in the selection of two alternative regions for plant DNA barcoding (Cowan & Fay, 2012). There are however many challenges in finding a solution that fulfills all the requirements of a successful, universally applicable barcode, and in the short term a pragmatic solution that achieves as much as possible and has payoffs in most areas has been chosen. Research continues in areas ranging from the technicalities of sequencing the regions to data analysis and the potential improvements that may result from the developing technology and data analysis systems (Cowan & Fay, 2012). University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh http://www.barcodinglife.org/ 20 In conclusion, the application of DNA barcoding is an efficient tool that can reduce the difficulties in identification and finding of new species using only morphological characters. It will be important for our country to develop skills and infrastructure to apply the principle of the DNA barcoding technique in essential areas of the country that deals with research on biodiversity to enforcement of food laws, quarantine and phyto-sanitary laws, illegal logging and protection of wildlife. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 21 CHAPTER THREE 3.0 MATERIALS AND METHODS According to the Forestry Commission Ghana, fifty timber tree species are in commercial trade, (Table 1). However, only 31 of the timber species could be identified and sampled in three biodiversity hotspots in the country. The biodiversity hotspots are Ankasa Resource Reserve, Kakum National Park and Bia Biosphere Reserve. DNA barcode database was developed from the 31 tree species sampled from the three study sites in Ghana for future identification of such tree species. To verify the authenticity of the data in the molecular identification of such timber trees, DNA barcodes were produced for six trees already in the reference database for comparison which were randomly selected. Detailed descriptions of the sites are presented below. 3.1 Study Area Three forested areas in southern Ghana were selected for the study. These were the Bia Biosphere Reserve, Ankasa Production Reserve and Kakum National Park. They were selected because they form the most significant and high biodiversity hot spots in the country. Also they have timber species of commercial importance and are better protected. 3.1.1 Bia Biosphere Reserve Bia Biosphere Reserve is in the Western Region of Ghana and lies in Southwest Ghana on the border with La Côte d’Ivoire, within the administrative jurisdiction of Juabeso District Assembly and traditionally under the Paramount stool of the Sefwi Wiawso Traditional Council at Sefwi Wiawso. It lies between latitudes 6° 20’ to 6° 38’ N and longitude 2°58’ to 3° 58’W, (Forestry University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 22 Commission, 2010). The Bia Biosphere Reserve lies in the transition zone between two of Ghana’s vegetation categories; the northern part lies within the Moist Evergreen Forest Vegetation Zone whiles the southern part is within the Moist Semi-deciduous Vegetation Zone (Hall and Swaine, 1981). Bia Biosphere Reserve lies in the south-west corner of the Southern Ashanti Uplands (Diame, 2010). Topography is undulating, and the geology mixed, with Lower Birrimian (middle Pre- Cambrian) to the east, granites to the west, and Upper Birrimian forming a north-south strip through the middle (Diame, 2010). According to Hall & Swaine (1981), the soils derived from the mixture are acrisols, locally classified as forest Ochrosols. It is a moderately acidic soil with pH of 6-7 and generally red or reddish brown appearance. The Biosphere reserve protects the headwaters of River Panabo and River Sukusuku which flow into La Côte d’Ivoire and river Tawya which is a tributary of River Bia (Diame, 2010). The climate is humid tropical, with a distinct dry season from December to March (Forestry Commission, 2010). Temperatures are estimated to vary from a minimum of 20-22°C (July/August) to a maximum of 29-34°C (February/March). Rainfall peaks are in June and October and the mean annual total is between 1500-1700mm (Forestry Commission, 2010). Fig. 1 presents the map of Bia Biosphere Reserve and the settlements within and around it. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 23 Figure 1: Map showing the location of Bia Biosphere Reserve University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 24 3.1.2 Ankasa Resource Reserve The Ankasa Resource Reserve (APR) is located in southwestern Ghana on the border with La Côte d’Ivoire. It lies between 5° 09’ and 5° 25’ North, and between 2° 29’ and 2° 45’ West. It covers an area of 509 km2 and is composed of Nini-Suhien National Park and Ankasa Resource Reserve. Ankasa Resource Reserve lies within the wet evergreen zone. It is situated south of the Nini and Tano Rivers and north of the Axim–Elubo Road. The climate of the Ankasa Resource Reserve has a distinctive bi-modal rainfall pattern occurring from April to July and September to November with an average annual rainfall of 1,700 to 2,000 mm. Mean monthly temperatures are typical of tropical lowland forest and range from 24oC to 28oC (Forestry Commission, 2010). Relative humidity is high throughout the year, at about 90% during the night falling to 75% in early afternoon. Ankasa Resource Reserve has rugged, deeply divided terrain in the north and west with flatter swampy ground associated with the Suhien watershed in the East. The northern part of Ankasa Resource Reserve is an area of rolling granite topography with frequent, steep sided, small round hills rising 60 to 150 m with no flat uplands and no broad valleys. South of the granites is the Pre-Cambrian Lower Birrimian series, sediment of clay. At the south side are late tertiary sands that are relatively recent deposits (FAO & UNESCO, 1988). Fig. 2 presents the map Ankasa Resource Reserve and the settlements within and around it. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 25 Figure 2: Map showing the location of Ankasa Resource Reserve University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 26 3.1.3 Kakum National Park The Kakum National Park is located in the Twifo Heman Lower Denkyera (referred to as Twifo Heman) and Assin Districts of the Central Region of Ghana. Kakum National Park lies within the moist evergreen zone. The reserve lies between longitudes 1°51' and 1°30’ W and latitudes 5°20' and 5°40'N (Forestry Commission, 1996). It overlies the Proterozoic Middle Precambrian Cape Coast granitoid complex, which outcrops in some areas like Aboabo, Ahomaho etc (Forestry Commission, 1996). The Kakum National Park is generally flat with only a few undulating highlands ranging between 150-250 m above sea level (Forestry Commission, 1996). Most of the hills occur in the south-western portion rising up to 250 m. The soils of Kakum National Park are mainly Forest Ochrosols and Forest Gleisols along rivers and streams (Brammer 1962). The corresponding classification by FAO is Rhodic Ferralsols or Haplic Ferralsols and Dystric Gleysols along rivers and streams (FAO UNESCO, 1988). The mean annual rainfall is between 1,500 mm and 1,750 mm. The prevailing winds are south- westerly and are generally light. The average relative humidity is about 85% with temperatures fluctuating between 10.2°C and 31.6°C (Forestry Commission, 1996). Fig. 3 presents the map of Kakum National Park and the settlements within and around it. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 27 Figure 3: Map showing the location of Kakum National Park. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 28 3.2 Taxon Sampling Green healthy leaf samples of 31 trees species (Appendix A) were collected with a pole pruner from the three biodiversity hot spots (Bia Biosphere Reserve, Ankasa Resource Reserve and Kakum National Park). Leaf samples of each species were collected in duplicate from the same or different forest reserve. In cases where the samples were collected from the same forest the distance between two plants, was at least 1km interval. Leaf samples of all the six trees for verification of the reference were collected from semi deciduous degraded forests around the city of Aburi in the eastern region of Ghana. The spotting of all the tree species in the field was done with the aid of a taxonomist from the Ghana Herbarium, University of Ghana. Specimens that were not immediately confirmed in the field were sent to the Ghana Herbarium for confirmation. Relevant literature such as Hawthorne, (1990), Hawthorne & Jongkind, (2006) and Hawthorne and Gyakari (2006) were used to confirm some of the identifications in the field. Global Positioning System (GPS) coordinates of each tree species from which samples were taken was recorded with a Garmine Trex handheld GPS. Leaf samples taken were then prepared for DNA extraction and herbarium voucher specimens. 3.3 Preparing samples for DNA Extraction Green healthy leaf samples of each tree species were cut into smaller pieces with a pair of scissors and put into a Ziploc bag containing silica gel (Chase & Hills, 1991). A small voucher with the following information; name of collector(s), place of collection, GPS location, species name of plant, date of collection and voucher number were prepared and inserted into the Ziploc bag with the voucher number written outside of the bag with a permanent marker. The bag was then sealed with caution to eliminate air. The silica gel in each Ziploc bag is changed after University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 29 turning near white colour, an indication of absorbing moisture. Total dryness of each sample was achieved within 24 hours and stored in a refrigerator awaiting DNA extraction. 3.4 Preparing Sample for herbarium voucher A herbarium voucher is a collection of dried plants or specimen of plants that are systematically arranged for reference. According to Bridson and Forman (1992), the importance of collecting good herbarium specimens is that a small number of really well preserved and annotated specimens are far more valuable than a large number of poor specimens. In collecting herbarium specimen, the collected sample must show as wide a range of variations as possible, hence some important features of the plant such as flowers, fruits, seeds, leaf/leaflet arrangements etc. are collected. The supporting branch of the part that can best be a representation of the population was cut with a pair of secateurs or sickle to retain all important features such as petioles, axillary buds, stipules, flowers; and fruits if any. It was then trimmed with both a pair of scissors or secateurs and a tag with collection number written in pencil tied to the specimen. Photographs of the whole plant, the prepared specimen, the fruits, seeds and flowers were taken with a digital camera. Important features such as the colour of the flowers, fruits; ripped and unripe, shape and venations of leaves, colour of stem, approximate height of tree, colour of exudates if any, etc, and a brief description of the plant were recorded. The prepared herbarium specimen was then placed in an old newspaper with the voucher number written with a permanent pen on it. The University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 30 newspaper is then placed in between two paper folders and then pressed in between aluminum foils to straighten and flatten the leaves before they dry. The specimens were then dried over a wire mesh on a gas burner. Large fruits and seeds were dried separately with the same collection number as that of the sample written in permanent ink on it. After thorough drying, the samples were glued onto a herbarium sheet with special herbarium glue. Fruits and seeds were kept at a different place with a reference to the voucher specimen 3.5 DNA Extraction Laboratory analyses were done at the Vincent Savolainen Laboratory, Imperial College, London United Kingdom (UK). Total genomic DNA was extracted from each of the thirty one silica- dried leaves samples using a modified cetyl trimethylammonium bromide (CTAB) technique (Doyle & Doyle, 1990). 3.6 Extraction Process About 0.3 g of each silica-dried leaf samples were ground with a laboratory mortar and pestle to break up the thick cell wall covering the cells of the plant in order to release the DNA of the leaf sample. To each ground leaf sample, one ml extraction buffer was added and incubated for 1 hr. at 60°C with occasional swirling after which samples were cooled at room temperature. 600 μL Chloroform isoanyl alcohol (CIA) was added to each sample and mixed gently for 5 minutes followed by a 15 minute centrifuge. The supernatants were then transferred to new tubes and equal volume of isopropanol added and mixed gently. The samples were then incubated at -20°C University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 31 overnight and centrifuged for 15 minutes. The pellets were then washed with 70% ethanol followed by another 10 minutes centrifuge. The wash was then repeated for two more times. The DNA was then dried and the pellets dissolved in 50 μL TERNase solution and incubated for 1 hr at 37°C after which the DNA is ready for amplification. All chemicals were used according to manufacturers recommended concentrations and quantities. 3.7 DNA Amplification The extracted DNA sample was made to undergo a 30- 40 cycles of 3 steps; Denaturation at 94oC which is the separation of a double strand into two single strands, which occurs when the hydrogen bonds between the strands are broken. Annealing at 50oC which in genetics means for complementary sequences of single-stranded DNA or RNA to pair by hydrogen bonds to form a double-stranded polynucleotide. The term is often used to describe the binding of a DNA probe or the binding of a primer to a DNA strand during a polymerised chain reaction (PCR). The term is also often used to describe the reformation (renaturation) of complementary strands that were separated by heat (thermally denatured) and finally Extension at 72oC in which the DNA polymerase synthesizes a complementary strand. The enzyme reads the opposing strand sequence and extends the primers by adding nucleotides in the order in which they can pair. The whole process was repeated over and over after which the DNA sample was ready to be sequenced. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 32 3.8 DNA Sequencing And Editing The amplified DNA sample was then placed into a Polymerized Chain Reaction (PCR) machine and the cycle sequencing program started. The Consortium for the Barcode of Life (CBOL) plant working group recommended the 2-locus combination of ribulose-1, 5-bisphosphate carboxylase oxygenase large subunit (rbcL) and maturase K (matK) as the standard plant barcode based on assessments of recoverability, sequence quality and levels of species discrimination (CBOL Plant Working Group, 2009). In this work the rbcLa gene region was sequenced and is composed of 119 sequences, with sequences having a minimum of 431 base pairs (bp) and a maximum of 579 bp. Previous studies (Bafeel et al., 2011; Fazekas et al., 2008) have proven that the rbcLa gene region shows a high amplification success rate when used in the identification of plant species than the matK. The rbcLa primer (ATGTCACCACAAACAGAGACTAAAGC) was used due to its reported high success sequence yielding rate (Kress & Erickson, 2007; Norris et al., 2009). In the PCR machine, a 26 cycle of three steps; 10 seconds of denaturation at 96oC, 5 seconds annealing at 50oC and finally 4 minutes extension at 60oC take place. After these processes the sequenced DNA samples were ready to be edited. DNA strands were edited and assembled using Sequencher 3.1. (Gene Code, ANN arbor, Michigan, USA) and the rbcLa sequences were aligned manually in Phylogenetic Analysis Using Parsimony software program (PAUP*) v.4.0b.10 (Swofford, 2002). Finally, a DNA sequence of each timber tree species generated was combined to form single-locus DNA matrices. These matrices represent a DNA cladogram database for the timber trees that are in commercial trade in Ghana. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 33 3.9 Social Survey The social survey carried out during this study deals with two kinds of data: primary data obtained from questionnaires and a face to face interview of a targeted population which consisted of some managers in the Forestry Commission and traders in timber industry. Secondary data obtained from relevant documents on illegal logging activities and the timber industry from journals and the Forestry Commission of Ghana. 3.9.1 Secondary Data A thorough and extensive literature review of relevant documents on illegal logging activities and the timber industry was done using secondary data from journals to increase reliability and validity of the data collected (Babbie, 2002; Kumar, 2002 cited by Phiri, 2009). The review provided valuable issues surrounding the research core objectives. Documents related to timber species lost through illegal activities were sought for clarifications with the staff of the Forest Services Division of the Forestry Commission of Ghana. 3.9.2 Primary Data A purposive sampling method which targeted a group made up of wood traders, furniture producers and selected key managers of the Forest Services Division whose roles involve forest management, planning and the verification of legal timber was used in the survey. Questionnaires and interview guides (Appendix B) were used to elicit information on the timber species they use in their industry, method of identification of timber species they use, timber resource situation and the level of awareness, the source of awareness and the importance of University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 34 forest conservation were also found from the respondents. Also the existing methods used in tracking illegal timber species and their challenges were also found. 3.9.3 Data analysis A statistical tool, SPSS 17 and Microsoft windows excel were used to analyze the samples. Percentages, means, frequencies, tables and chats were used in the analyses of the data. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 35 CHAPTER FOUR 4.0 RESULTS 4.1 Timber species commonly logged and are in commercial trade in Ghana In Table 1 is presented the list of 50 species that are commonly logged and are in commercial trade in Ghana according to the Forestry Commission of Ghana and their conservation status. Of these 31 trees were identified and sampled during the study. 32% of the species are vulnerable whiles 52% of the species have not been assessed by the International Union for Conservation of Nature. Table 1: Commonly logged timber species in commercial trade and their conservation status Scientific Name Local names Conservation status Afzelia africana Papao Vulnerable Albizia ferruginea Awiemfuosemena Vulnerable Albizia zygia Okoro Not assessed Alstonia boonei Sinuro/ Nyamedua Not assessed Amphimas pterocarpoides Yaya Not assessed Anopyxis klaineana kokote Vulnerable Antiaris toxicaria Kyenkyen Vulnerable Antrocaryon micraster Aprokuma Vulnerable Bombax bunopozense Akata/Akondie Not assessed Cedrela odorata Cedrela Vulnerable Ceiba pentandra Onyina Not assessed Celtis mildbraedii Esa Not assessed University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 36 Scientific Name Local names Conservation status Celtis philippensis Esafufuo Not assessed Celtis zenkeri Esa Kokoo Not assessed Chrysophyllum albidum Akasaa Not assessed Chrysophllum perpulchrum Atabene Not assessed Cola gigantean Watapuo Not assessed Cylicodiscus gabunensis Denya Not assessed Cynometra ananta Ananta Not assessed Daniellia ogea Hyedua Not assessed Distemonanthus benthamianus Bonsamdua Not assessed Entandrophragma angolense Edinam Vulnerable Entandrophragma cylindricum Sapele/Penkwa Vulnerable Entandrophragma utile Utile Vulnerable Gmelina arborea Gmelina Not assessed Guarea cedrata Kwabohoro Vulnerable Heritiera utilis Nyankom Vulnerable Holoptelea grandis Nakwa Not assessed Khaya Ivorensis Mahogany Vulnerable Lannea welwitschii Kumanini Not assessed Lophira alata Kaku Vulnerable Lovoa trichilioides Dubinibiri/Walnut Vulnerable Mansonia altissima Oprono Not assessed Melicia excelsa Odum Not assessed Nauclea diderrichi Kusia Not assessed Nesogordonia papverifera Danta Not assessed Panda oleosa Kokroboba Not assessed Petersianthus macrophylla Esia Not assessed Pouteria aningeri Asamfena-Nini Not assessed Piptadenistrum africanum Dahoma Not assessed Pterygota macrocarpa Kyere Vulnerable University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 37 Scientific Name Local names Conservation status Pycnanthus angolensis Otie Not assessed Sterculia oblonga Ohaa Not assessed Sterculia rhinoptela Wawabima Not assessed Tectonia grandis Teak Not assessed Terminalia ivorensis Emire Vulnerable Terminalia superba Ofram Not assessed Tieghemella heckelli Baku/Makore Not assessed Triplochiton scleroxylon Wawa Least concern Turraeanthus africanus Apapaye/ Avodire Vulnerable Zanthoxylum leprieurii Oyaa Not assessed 4.2 Characteristics of DNA Barcodes of tree species in commercial trade in Ghana Characteristics of the 31 timber species covering 14 different families and 28 genera used in generating the cladogram and their sequences at the rbcLa gene region are presented below. 4.1.1.0 Species: Amphimas pterocarpoides Harms. Family: Leguminosae Specimen: GH 0227 Location: Bia Biosphere Reserve 195m 6°34.522'N 3°07.437'W Description: Amphimas pterocarpoides is deciduous, crown dense and dark with leaves clustered at twig tips. Leaves are pinnate and almost alternate. Flowers are yellowish petals, 2.5cm long and deeply notched. Fruits are flat papery wind-dispersed pods up to 20 x 5 cm with raised veins, with single kidney shaped seed 2 cm long (Hawthorne & Gyakari, 2006). University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 38 Plate 1: Amphimas pterocarpoides Harms. DNA barcode; rbcLa CAAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGA CTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTG AAGAAGCAGGTGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGG CTTACCAGTCTTGATCGTTACAAAGGACGATGCTACTACATCGAGCCCGTTGCTGGAGAAGAAAATCA ATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCC ATTGTAGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACT TCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTA TGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAG CAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTGAATTCCCAACCAT TTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGT GAAATCAAAGGGCATTACTTGAATGCACTG 4.1.1.1 Species: Amphimas pterocarpoides Harms. Family: Leguminosae Specimen: GH 0225 Location: Kakum National Park 176m 5°51.160'N 2°44.184'W DNA barcode; rbcLa CAAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGA CTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTG AAGAAGCAGGTGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGG CTTACCAGTCTTGATCGTTACAAAGGACGATGCTACTACATCGAGCCCGTTGCTGGAGAAGAAAATCA ATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCC ATTGTAGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACT TCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTA TGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAG CAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTGAATTCCCAACCAT TTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGT GAAATCAAAGGGCATTACTTGAATGCACTG University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 39 4.1.2.0 Species: Antiaris toxicaria (Rumph.ex Pers.)Leschen Family: Moraceae Specimen: GH0230 Location: Bia Biosphere Reserve 179m 6°22.121'N 2°59.168'W Description: It is a common canopy or emergent tree across Ghana, especially in secondary forests, old farms etc. Leaves are simple, alternate, and sometimes rough like sandpaper. Its seedlings are usually abundant in the vicinity of the parent plant. Flowers are inconspicuous, in leaf axils whiles fruits are usually reddish velvety on the outside (Orwa et al., 2009). Plate 2 Antiaris toxicaria (Rumph.ex Pers.) Leschen DNA barcode; rbcLa CAGAAACTAAAGCTTTTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTG AATATGAAGTCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCTCCTG AAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACGGG CTTACCAGTCTTGATCGCTACAAAGGTCGATGCTACAACATCGAGCCCGTTGCTGGAGAAGAAAATCA ATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCC ATTGTGGGTAATGTATTTGGGTTCAAAGCTCTGCGGGCGTTACGTCTGGAAGATTTGCGAATCCCTCCT TCTTATTCTAAAACTTTCCAAGGACCACCCCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTA TGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAG CAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCCT TTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAAGCTGAAACAGGT GAAATCAAAGGACATTACTTGAATGCAACTG 4.1.2.1 Species: Antiaris toxicaria (Rumph.ex Pers.)Leschen Family: Moraceae Specimen: GH0228 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 40 Location: Kakum National Park 176m 5°51.160'N 2°44.184'W DNA barcode; rbcLa CAGAAACTAAAGCTTTTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTG AATATGAAGTCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCTCCTG AAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACGGG CTTACCAGTCTTGATCGCTACAAAGGTCGATGCTACAACATCGAGCCCGTTGCTGGAGAAGAAAATCA ATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCC ATTGTGGGTAATGTATTTGGGTTCAAAGCTCTGCGGGCGTTACGTCTGGAAGATTTGCGAATCCCTCCT TCTTATTCTAAAACTTTCCAAGGACCACCCCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTA TGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAG CAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCCT TTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAAGCTGAAACAGGT GAAATCAAAGGACATTACTTGAATGCAACTG 4.1.3.0 Species: Ceiba pentandra (Linn) Gaertn. Family: Malvaceae Specimen: GH0235 Location: Bia Biosphere Reserve 195m 6°34.522'N 3°07.437'W Description: It a very common pioneer tree which is widespread in the tropics. Leaves are usually alternate with 5-9 leaflets, petiole up to 15 cm. Flowers are 2.5 cm long, in clusters; 5 white petals with densely silky hairs and the fruits are usually dark, ellipsoid pendulous capsule with 5 values, 10-30 cm long; inside with dense flossy dirty white ‘kapo’ with many seeds (Orwa et al., 2009). Plate 3: Ceiba pentandra (Linn) Gaert University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 41 DNA barcode; rbcLa CAGAAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCT GAATATGAAGTCAAAGATACTGATATCTTGGCAGCCTTCCGAGTAACTCCTCAACCCGGAGTTCCGCC TGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACCGTGTGGACCGATG GGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAAT CAATATATATGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTT CCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTGCGAATCCCTA CTTCTTATACTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAGGTTGAAAGAGATAAATTGAACAAG TACGGTCGCCCCCTATTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAG AGCAGTTTATGAATGTCTACGTGGCGGACTTGATTTTACTAAAGATGATGAGAATGTGAACTCCCAAC CATTTATGCGCTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACA GGTGAAATCAAAAGGGCATTACTTGAATG 4.1.3.1 Species: Ceiba pentandra (Linn) Gaertn. Family: Malvaceae Specimen: GH0233 Location: Kakum National Park 176m 5° 51.160N' 0°10.488'W DNA barcode; rbcLa CAGAAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCT GAATATGAAGTCAAAGATACTGATATCTTGGCAGCCTTCCGAGTAACTCCTCAACCCGGAGTTCCGCC TGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACCGTGTGGACCGATG GGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAAT CAATATATATGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTT CCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTGCGAATCCCTA CTTCTTATACTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAGGTTGAAAGAGATAAATTGAACAAG TACGGTCGCCCCCTATTAGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAG AGCAGTTTATGAATGTCTACGTGGCGGACTTGATTTTACTAAAGATGATGAGAATGTGAACTCCCAAC CATTTATGCGCTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACA GGTGAAATCAAAAGGGCATTACTTGAATG 4.1.4.0 Species: Celtis mildbraedii Engl. Family: Ulmaceae Specimen: GH0238 Location: Bia Biosphere Reserve 195m 6°34.522'N 3°07.437'W University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 42 Description: It is extremely abundant in semi-deciduous forests across tropical Africa. Leaves are simple, alternate, and serrated. Flowers clusters in leaf axils, greenish, without petals, 2 styles each splitting into 2 stigmas (Hawthorne & Gyakari, 2006). Plate 4 Celtis mildbraedii Engl. DNA barcode; rbcLa CAGAAACTAAAGCTTTTTGTTGGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTACACTCC TGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCCC CTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGAC GGGCTTACCAGCCTTGATCGCTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAA TCAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACT TCCATTGTGGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGAGAATCCCT CCTGCTTATACTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAA GTATGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTA GAGCTGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAA CCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACA GGTGAAATCAAAAGGACATTACTTGAATGCAACTC 4.1.4.1 Species: Celtis mildbraedii Engl. Family: Ulmaceae Specimen: GH0236 Location: Kakum National Park 130m 5° 10.416'N 0°22.984'W DNA barcode; rbcLa CAGAAACTAAAGCTTTTTGTTGGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTACACTCC TGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCCC CTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGAC GGGCTTACCAGCCTTGATCGCTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAA TCAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACT University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 43 TCCATTGTGGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGAGAATCCCT CCTGCTTATACTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAA GTATGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTA GAGCTGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAA CCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACA GGTGAAATCAAAAGGACATTACTTGAATGCAACTC 4.1.5.0 Species: Celtis philippensis Blanco Family: Ulmaceae Specimen: GH0369 Location: Kakum National Park 176m 5°51.160'N 0°10.488'W Description: It is a completely hairless leaves with basal nerves reaching higher and generally larger teeth; its slash is pure white (Hawthorne & Gyakari, 2006). Plate 5: Celtis philippens Blanco DNA barcode; rbcLa CAGAAACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTACACTCCT GAATATGAAACCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCCCC TGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACG GGCTTACCAGCCTTGATCGCTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAAT CAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTT CCATTGTGGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGAGAATCCCTC CTGCTTATACTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAG TATGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAG AGCTGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACC ATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGCTGAAACAGGT GAAATCAAAGGACATTACTTGAATGCAACTG University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 44 4.1.5.1 Species: Celtis philippensis Blanco Family: Ulmaceae Specimen: GH0239 Location: Kakum National Park 170m 4°41.150'N 0°9.388'W DNA barcode; rbcLa CAGAAACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTACACTCCT GAATATGAAACCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCCCC TGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACG GGCTTACCAGCCTTGATCGCTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAAT CAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTT CCATTGTGGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGAGAATCCCTC CTGCTTATACTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAG TATGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAG AGCTGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACC ATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGCTGAAACAGGT GAAATCAAAGGACATTACTTGAATGCAACTG 4.1.6.0 Species: Celtis zenkeri Engl. Family: Ulmaceae Specimen: GH0242 Location: Ankasa Resource Reserve 110m 5°13.040'N 2°39.089'W Description: It is commonly found in semi-deciduous forests, especially the drier ones, across tropical Africa. Leaves are usually simple, alternate and asymmetric at base with 3-5 other pair’s of laterals. The fruit is red, rounded and 6mm long (Hawthorne & Gyakari 2006). Plate 6: Celtis zenkeri Engl. University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 45 DNA barcode; rbcLa CAGAAACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTACACTCCT GAATATGAAACCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCCCC TGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACG GGCTTACCAGCCTTGATCGCTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAAT CAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTT CCATTGTGGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGAGAATCCCTA CTTCTTATACTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAG TATGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAG AGCTGTTTATGAAGTTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACC ATTTATGCGTTGGAGAGACCGTTTCTGCTTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAG GTGAAATCAAAGGACATTACTTGAATGCAACTG 4.1.6.1 Species: Celtis zenkeri Engl. Family: Ulmaceae Specimen: GH0240 Location: Ankasa Resource Reserve 100m 2° 16.789'N 2°44.184W DNA barcode; rbcLa CAGAAACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTACACTCCT GAATATGAAACCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCCCC TGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACG GGCTTACCAGCCTTGATCGCTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAAT CAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTT CCATTGTGGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGAGAATCCCTA CTTCTTATACTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAG TATGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAG AGCTGTTTATGAAGTTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACC ATTTATGCGTTGGAGAGACCGTTTCTGCTTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAG GTGAAATCAAAGGACATTACTTGAATGCAACTG 4.1.7.0 Species: Cedrela odorata Linn. Family: Meliaceae Specimen: GH0245 Location: Bia Biosphere Reserve 179m 6°22.121'N 2°59.168' W University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 46 Description: It is commonly found in forest zone areas. It has pinnate leaves clustered at twig tips and panicles of small flowers. Fruits are splitting capsule with 5 valves and 25 mm flat seeds (Orwa et al., 2009). Plate 7 Cedrela odorata Linn. DNA barcode; rbcLa GAAACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGA CTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCCG AGGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGG GCTTACTAGCCTTGATCGTTACAAAGGACGATGCTACAACATTGAGCCAGTTGCTGGAGAAGAAAATC AATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACGTC CATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCC CGCGTATTCTAAAACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGT ATGGTCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGA GCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACC ATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCGGAAGCAATCTATAAAGCGCAAGCTGAAACAA GGTGAAATCAAAGGTCATTACTTGAAATGCAACTG 4.1.7.1 Species: Cedrela odorata Linn. Family: Meliaceae Specimen: GH0243 Location: Ankasa Resource Reserve 140m 5°13.040N' 2°39.089'W DNA barcode; rbcLa GAAACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGA CTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCCG AGGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGG GCTTACTAGCCTTGATCGTTACAAAGGACGATGCTACAACATTGAGCCAGTTGCTGGAGAAGAAAATC AATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACGTC CATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCC University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 47 CGCGTATTCTAAAACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGT ATGGTCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGA GCAGTTTATGAATGTCTACGCGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACC ATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCGGAAGCAATCTATAAAGCGCAAGCTGAAACAA GGTGAAATCAAAGGTCATTACTTGAAATGCAACTG 4.1.8.0 Species: Chrysophyllum albidum G. Don. Family: Sapotaceae Specimen: GH0250 Location: Ankasa Resource Reserve 130m 2°16.789'N 0°22.984'W Description: C.albidum is cultivated in villages for its fruit, which have pointed tips. It is sometimes found in dry forest patches, but not in moist forests. Leaves are generally white-ish (Houessou et al., 2012). Plate 8 C.albidum G. Don. DNA barcode; rbcLa CGAACTAAAGCAAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGA CTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTG AAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGG ACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATC AATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTC CATTGTGGGGAATGTATTTGGGTTCAAAGCCCTGCGCGCTTTACGTCTGGAAGATCTGCGAATCCCTCC TGCGTATTCTAAAACTTTCCAAGGACCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGT ACGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGA GCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACC ATTTATGCGTTGGAGAGATCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAG GTGAAATCAAAGGGCATTACTTGAATGCACTG University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 48 4.1.8.1 Species: Chrysophyllum albidum G. Don. Family: Sapotaceae Specimen: GH0248 Location: Kakum National Park 130m 5°10.416'N 0°22.984'W DNA barcode; rbcLa CGAACTAAAGCAAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGA CTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTG AAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGG ACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATC AATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTC CATTGTGGGGAATGTATTTGGGTTCAAAGCCCTGCGCGCTTTACGTCTGGAAGATCTGCGAATCCCTCC TGCGTATTCTAAAACTTTCCAAGGACCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGT ACGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGA GCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACC ATTTATGCGTTGGAGAGATCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAG GTGAAATCAAAGGGCATTACTTGAATGCACTG 4.1.9.0 Species: Distemonanthus benthamianus Baill. Family: Leguminosae Specimen: GH0253 Location: Bia Biosphere Reserve 179m 6°22.121'N 2°59.168'W Description: It is a plant that is commonly found in disturbed forests. Leaves are pinnate with 7- 11 alternate leaflets with closely parallel lateral nerves. Flowers are in lax pink panicles with 5 reddish sepals, 3 white petals and 2 stamens. Fruits are usually flat, 9 x 3.5 cm pale brown pod, hairless when ripe, with fine transverse lines and 1-4 seeds (Orwa et al., 2009). University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 49 Plate 9 Distemonanthus benthamianus Baill. DNA barcode; rbcLa CGAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGA CTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTG AAGAAGCAGGTGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGG CTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCA ATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCC ATTGTGGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGCCTGGAGGATTTGCGAATCCCTCCC GCTTATACGAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTA TGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAG CAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCA TTTATGCGTTGGAGAGACCGTTTCTGTTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACGGG CGAAATCAAAGGGCATTACTTGAATGCACT 4.1.9.1 Species: Distemonanthus benthamianus Baill. Family: Leguminosae Specimen: GH0251 Location: Ankasa Resource Reserve 150m 5°13.040'N 2°39.089'W DNA barcode; rbcLa CGAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGA CTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTG AAGAAGCAGGTGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGG CTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCA ATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCC ATTGTGGGTAATGTATTTGGGTTCAAGGCCCTGCGCGCTCTACGCCTGGAGGATTTGCGAATCCCTCCC GCTTATACGAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTA TGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAG CAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCA TTTATGCGTTGGAGAGACCGTTTCTGTTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACGGG CGAAATCAAAGGGCATTACTTGAATGCACT University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 50 4.1.10.0 Species: Daniellia Ogea Harms Family: Leguminosae Specimen: GH0370 Location: Kakum National Park 176m 5°51.160'N 0°10.488'W Description: It is normally found in semi-deciduous forests. Leaves are pinnate, with 4-9 pairs of hairless leaflets. It is characterized by the combination of flowers with four imbricate sepals, five petals, ten stamens and fruits that are ‘hemi-legumes (Hawthorne & Gyakari, 2006). Plate 10 Daniella ogea Harms DNA barcode; rbcLa AAAACTAAAGCACGTGTTGGATTCAAAGCAGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGA CTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTATCTCCTCAACCTGGAGTTCCGCCCG AAGAAGCAGGTGCCGCAGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGACGGG CTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAATCA ATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCC ATTGTGGGTAATGTCTTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACT GCTTATATTAAAACTTTCCAGGGTCCGCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTA TGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAG CGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCA TTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACGGGT GAAATTAAAGGGCATTACTTGAATGCAACTG 4.1.10.1 Species: Daniellia Ogea Harms Family: Leguminosae Specimen: GH0254 University of Ghana http://ugspace.ug.edu.ghUniversity of Ghana http://ugspace.ug.edu.gh 51 Location: Kakum National Park 176m 5°51.160'N 0°10.488'W DNA barcode; rbcLa AAAACTAAAGCACGTGTTGGATTCAAAGCAGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGA CTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTATCTCCTCAACCTGGAGTTCCGCCCG AAGAAGCAGGTGCCGCAGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGACGGG CTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAATCA ATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCC ATTGTGGGTAATGTCTTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACT GCTTATATTAAAACTTTCCAGGGTCCGCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTA TGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGAG CGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCA TTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGA