ii PREVALENCE OF AVIAN MALARIA IN SOME PROTECTED AREAS IN GHANA BY CONSTANCE AGBEMELO-TSOMAFO (10363504) THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON, IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE AWARD OF M. PHIL ZOOLOGY DEGREE. JULY, 2013 University of Ghana http://ugspace.ug.edu.gh i DECLARATION I do hereby declare that this thesis is my own work produced from research under the joint supervision of Dr. Erasmus H. Owusu and Dr. Langbong Bimi, all of the Department of Animal Biology and Conservation Sciences, University of Ghana. This work has not been previously submitted partially or wholly for the award of a degree in any University. References to the works of other investigators have been duly acknowledged. SIGNED: ………………………… DATE: …………………. CONSTANCE AGBEMELO-TSOMAFO (STUDENT) SIGNED: ……………………………….. DATE: …………………. DR. ERASMUS H. OWUSU (SUPERVISOR) SIGNED: ……………………………….. DATE: …………………. DR. LAGBONG BIMI (SUPERVISOR) University of Ghana http://ugspace.ug.edu.gh ii DEDICATION To God for his grace, my family and to everyone who has contributed to the success of this work. University of Ghana http://ugspace.ug.edu.gh iii ACKNOWLEDGEMENT My sincere appreciation goes to my supervisors, Dr. Erasmus H. Owusu and Dr. Langbong Bimi for their guidance and supervision. I acknowledge Dr. B. Kayang for allowing me to carry out part of my work in his laboratory, Dr. Ravinder Sehgal of the University of San Franscisco, and Dr. J. H. Kofi Bonney of NMIMR for their professional advice, Dr. Phyllis Addo, Dr. Samuel Adjei, Ms. Juliet Ewool, Mrs. Mona M. Abbas and Mr. Maxwell Quartey for their guidance and contribution to make this study a success. I am grateful to all the staff of Animal Experimentation, Virology and Parasitology departments of Noguchi Memorial Institute for Medical Research for their various technical helps. Many thanks to Believe Ahedor, Ken Agyeman-Badu, Mrs. Shirley Adu- Poku, Innocent Afeke, Kofi Kwofie and Mrs. Priscilla Frimgpong. I am also thankful to Ghana Wildlife Division and the management of Kakum National Park and Shai Hills resource reserve for granting me the permit to collect samples from the sites. Many thanks to Mr. Eric Cudjoe and Mr. Daniel Acquah-Lamptey for helping me in the sample collection. Finally, I wish to acknowledge the kind financial support I received from my husband, Mr. Jonathan Forson. University of Ghana http://ugspace.ug.edu.gh iv TABLE OF CONTENTS DECLARATION................................................................................................................. i DEDICATION.................................................................................................................... ii ACKNOWLEDGEMENT ................................................................................................ iii TABLE OF CONTENTS ................................................................................................. iv LIST OF TABLES ............................................................................................................. x LIST OF FIGURES .......................................................................................................... xi LIST OF ABBREVIATIONS ......................................................................................... xii ABSTRACT ..................................................................................................................... xiii CHAPTER ONE ................................................................................................................ 1 1.0 INTRODUCTION ......................................................................................................... 1 1.1 Background ................................................................................................................ 1 1.2 Justification ................................................................................................................ 3 1.3 Aim ............................................................................................................................. 4 1.4 Specific Objectives ..................................................................................................... 4 CHAPTER TWO ............................................................................................................... 5 2.0 LITERATURE REVIEW .............................................................................................. 5 2.1 Brief history of avian malaria ....................................................................................... 5 2.2 Avian haemosporidian parasites .................................................................................... 6 2.2.1 Vectors of avian malaria ................................................................................ 7 2.2.2 Parasite-host association ............................................................................... 8 University of Ghana http://ugspace.ug.edu.gh v 2.3 Life cycle of avian malaria parasites ............................................................................ 8 2.4 Review of avian malaria studies ................................................................................. 13 2.5 Parasite diversity and global distribution .................................................................... 15 2.6 Effect of parasitism on bird hosts ............................................................................... 16 2.7 Investigation of avian malaria using traditional microscopy ...................................... 17 2.8 PCR-based methods and comparison to traditional microscopy in detecting malaria. 18 2.9 Factors affecting avian malaria prevalence ................................................................. 21 CHAPTER THREE ....................................................................................................... 22 3.0 MATERIALS AND METHODS ................................................................................ 22 3.1 Study design ................................................................................................................ 22 3.2 Study sites and material collected ............................................................................... 22 3.2.1 Kakum National Park ................................................................................... 24 3.2.2 Shai Hills Resource Reserve ........................................................................ 25 3.3 Collection of birds ....................................................................................................... 26 3.3.1 Sample size .................................................................................................. 26 3.3.2 Collection of blood samples and preparation of the material for microscopic examination and DNA studies .......................................................... 26 3.4 Giemsa staining ............................................................................................................ 28 3.5 Microscopic examination of blood films .................................................................... 28 3.6 Extraction of DNA from avian blood ........................................................................ 28 University of Ghana http://ugspace.ug.edu.gh vi 3.7 PCR amplification ....................................................................................................... 29 3.7.1Parasite identification..................................................................................... 30 3.8 Research Permit .......................................................................................................... 30 3.9 Statistical analysis ....................................................................................................... 31 CHAPTER FOUR ........................................................................................................... 32 4.0 RESULTS ................................................................................................................... 32 4.1 Sample size and distribution of birds in the study areas ............................................. 32 4.2 Relative Abundance of Birds in Kakum National Park .............................................. 33 4.3 Relative Abundance of Birds in Shai Hills Resource Reserve ................................... 36 4.4 Microscopic investigation and PCR screening of avian blood samples ..................... 39 4.5 A comparative analysis of Microscopy and PCR for the detection of avian haemosporidians ............................................................................................................... 41 4.6 Parasite lineages and habitats ...................................................................................... 45 CHAPTER FIVE ............................................................................................................ 49 5.0 DISCUSSION ............................................................................................................. 49 5.1 Efficiency of methods used in parasite detection and identification .......................... 49 5.2 Parasite Prevalence in Forest and Savanna Birds ....................................................... 50 5.3 Habitat Effect .............................................................................................................. 52 CHAPTER SIX ............................................................................................................... 54 University of Ghana http://ugspace.ug.edu.gh vii 6.0 CONCLUSION AND RECOMMENDATION .......................................................... 54 6.1 CONCLUSION ........................................................................................................... 54 6.2 RECOMMENDATIONS ............................................................................................ 55 REFERENCES ................................................................................................................ 56 APPENDICES ................................................................................................................. 70 APPENDIX I .................................................................................................................... 70 Sample information (Shai Hills) ....................................................................................... 70 APPENDIX II .................................................................................................................... 71 Sample information (Kakum National Park) .................................................................... 71 APPENDIX III .................................................................................................................. 72 Nucleotide Sequences ....................................................................................................... 72 APPENDIX IV................................................................................................................... 75 Haemoproteus and Plasmodium lineages and their Genbank accession numbers ............ 75 APPENDIX V ................................................................................................................... 76 Sensitivity and specificity of diagnostic tests ................................................................... 76 APPENDIX VI .................................................................................................................. 77 Protocol for DNA Extraction from avian blood ............................................................... 77 University of Ghana http://ugspace.ug.edu.gh viii LIST OF TABLES Table 1: Total number of birds caught in Kakum National Park and relative abundance of each bird species expressed in number of birds × 100/mist-net m × h .............................. 34 Table 2: Relative Abundance of birds trapped in Shai Hills Resource Reserve ............... 37 Table 3: Birds tested and outcome of PCR screening and microscopic examination of blood samples..................................................................................................................... 43 Table 4: Prevalence (P) and lineages of haemosporidian parasites in birds trapped in Kakum National Park (lineage names are according to NCBI database) .......................... 46 Table 5: Prevalence (P) and lineages of haemosporidian parasites in birds trapped in Shai Hills Resource Reserve ...................................................................................................... 48 University of Ghana http://ugspace.ug.edu.gh ix LIST OF FIGURES Figure 1: Diagram showing the life cycle of avian malaria parasite ............................... 12 Figure 2: A schematic presentation of the study sites .................................................... 23 Figure 3: Blood sample collection and preparation of blood films for microscopic examination ....................................................................................................................... 27 Figure 4: Distribution of sampled bird species and families in Kakum National park and Shai hills resource reserve. ............................................................................................... 32 Figure 5: Blood stages of haemosporidian parasites as seen in thin blood films ............ 39 Figure 6: Agarose gel showing PCR results with the primers HaemF and HaemR2 on DNA samples extracted from blood samples of birds ....................................................... 40 University of Ghana http://ugspace.ug.edu.gh x LIST OF ABBREVIATIONS A - Adenine BLAST - Basic Local Alignment Search Tool Bp - Base pair C - Cytosine DNA - Deoxyribonucleic acid G - Guanine H - Haemoproteus IUCN - International Union for the Conservation of Nature MEGA - Molecular Evolutionary Genetics Analysis NCBI - National Centre for Biotechnology Information P - Plasmodium PCR - Polymerase Chain Reaction T - Thymine University of Ghana http://ugspace.ug.edu.gh xi ABSTRACT Differences in habitat types affect host-parasite interactions and can increase the risk of epizootic outbreaks in wild populations. It is thought that parasitism is a necessary factor in conservation biology and is important in understanding ecological parasitology and vertebrate conservation management. The aim of this study was to estimate the prevalence of avian malaria in forest and savanna birds. A total of 132 birds of 39 species belonging to 20 families were trapped in two wildlife protected areas in Ghana (Kakum National Park and Shai Hills Resource Reserve) and screened for the presence of the haemoparasites, Plasmodium and Haemoproteus spp. A combination of microscopy and PCR detected an overall prevalence of 45.4%. Comparatively, prevalence varied between the two sites with a higher prevalence of 69.20% in Kakum National Park compared to 12.90% in Shai Hills Resource Reserve. Sequencing of the positive PCR amplicons identified 20 mitochondrial lineages of 11 Plasmodium and 9 Haemoproteus lineages. Plasmodium and Haemoproteus prevalences varied in both sites with Plasmodium recording the highest prevalence in each site. The results of the study did not only confirm the presence of avian malaria in the Ghanaian wildlife protected areas, but also differences of these in the different habitats. The study also recommended that investigations should be carried out in both dry and wet seasons as well as including more study sites to make better comparison. University of Ghana http://ugspace.ug.edu.gh 1 CHAPTER ONE 1.0 INTRODUCTION 1.1 Background Haemosporidian infections are induced by a group of disease causing protozoan parasites which infect mammals, reptiles, amphibians and birds (Valkiunas, 2005). These organisms cause diseases such as avian malaria, haemoproteosis and leucocytozoonosis in their vertebrate hosts (Martinsen et al., 2008).The diseases are far induced in birds by an unknown number of haematozoan species (Olias et al., 2011) belonging to the order Haemosporida. There are three genera of avian haemosporidians namely Haemoproteus, Plasmodium, and Leucocytozoon(Beadell & Fleischer, 2005). Species of all three genera are closely related genetically but their life-history traits differ; more over they share several characteristics with human malaria parasites, and all three genera, but most often only Plasmodium spp. are referred to as avian malaria parasites (Hellgren et al., 2004).Some of the life-history traits that are used to define these species and genera include the types of host cells that they use for schizogony, the number of daughter cells produced by each mature schizont, and the presence or absence of haemozoin pigment stored within the parasite cell which is the product of the breakdown of haemoglobin, formed by crystallization of the porphyrin (Martinsen et al., 2008).The use of the genera, Plasmodium and Haemoproteus, concurrently to refer to avian malaria raised a controversy among parasitologists, ecologists and evolutionary researchers. However, due to genetic studies about the phylogeny of the group, many researchers include Haemoproteus spp. among malaria parasites (Perez-Tris et al., 2005). In view of that, this study will refer to both genera as avian malaria parasites. University of Ghana http://ugspace.ug.edu.gh 2 Traditionally, the detection of avian malaria infections has been by microscopic examination of blood smears only, but most recently, the development of molecular technology has made screening for these parasites faster and more reliable (Fallon et al., 2003). Recent molecular studies on infection of these parasites by Polymerase Chain Reaction (PCR)-based methods indicated a high diversity of the parasites in wild bird communities (Bensch et al., 2007; Ricklefs et al., 2007; Kim &Tsuda, 2010). Avian malaria parasites have been very useful in many studies. The frequent use of these parasites in the study of evolution and population ecology is based on the relative ease with which infected birds can be distinguished from uninfected ones and the fact that the intensity of infection can be estimated for each host using blood smears (Valkiunas, 1993; Richner et al., 1995; Rintamaki et al., 1998). This implies that the costs of infection can be examined using both quantitative and qualitative methods (Hellgren et al., 2004). Majority of the published works in the field of avian haemosporidian studies focused on species of the genera Haemoproteus and Plasmodium, because they are more easily detected (Atkinson and Van Riper, 1991). However, there are relatively few studies on Leucocytozoon spp. (Atkinson and Van Riper, 1991). The scarcity of investigations on species of the genus Leucocytozoon is not because the infection (Leucocytozoonosis) is itself rare, but because the life stages of the parasites are detectable in peripheral blood for only very short time periods, which makes the infection difficult to detect and accurately identified, especially using traditional ocular methods (Valkiunas, 1997). The broad understanding gained from pioneering studies of avian malaria parasites and their importance in evolutionary modeling studies of host-parasite systems and conservation biology has helped to re-establish this field of study (Braga et al., 2011). These parasites have also been used as model organisms for studies on many aspects of parasite-host University of Ghana http://ugspace.ug.edu.gh 3 interactions (Perkins and Schall, 2002; Ricklefs and Fallon, 2002), host life-history trade- offs and sexual selection (Richner et al., 1995; Nordling et al., 1998). These studies are important in understanding ecological parasitology and vertebrate conservation management (Braga et al., 2011). 1.2 Justification Avian malaria is a potential threat for both domestic and wild birds (Bonneaud et al., 2006). It is estimated that 68% of all birds are susceptible to malaria infections (Sehgal, 2004), and the impact of the disease on bird populations is often overlooked in wildlife ornithology. However parasitism is a necessary factor in conservation biology and should therefore be considered in biodiversity preservation studies (Valkiunas, 2005; Parker et al., 2006). Previous studies have established that environmental conditions can impact the diversity and abundance of parasite species, either by favoring or limiting parasite numbers (Loiseau et al., 2010) due to sensitivity of vectors to climatic conditions (Cosgrove et al., 2008) and as a result, affecting the prevalence of host infection (Loiseau et al., 2010). In Ghana, there are only few studies documented on avian malaria (Wink &Bennett, 1976; Loiseau et al., 2009). Consequently, different features of the parasites, including their prevalence and taxonomy need to be examined so as to provide information essential for future projects aiming at predicting and managing the impact of protozoan blood parasites on birds in Ghana. The results will be useful in providing vital information to resource managers about parasite distribution as well as drawing up a protection plan for protected areas against dipteran-borne diseases. This study is therefore to establish a University of Ghana http://ugspace.ug.edu.gh 4 baseline of malaria parasite infections of the birds and will be relevant in studying how habitat composition could affect parasite prevalence. 1.3 Aim The goal of this study is to estimate the prevalence of avian malaria in Forest and Savanna birds. 1.4 Specific Objectives The specific objectives of the study were:  To detect and identify avian malaria parasites in savannah and forest birds.  To assess the efficiency of microscopy and Polymerase Chain Reaction-based method in estimating the prevalence of the parasites.  To compare prevalence of the disease among savannah and forest birds.  To assess the implication of habitat types on parasite prevalence. University of Ghana http://ugspace.ug.edu.gh 5 CHAPTER TWO 2.0 LITERATURE REVIEW 2.1 Brief history of avian malaria The publication of an article on blood parasites (Danilewsky, 1884) in the Russian Medical Journal marked a qualitatively new stage in the development of protozoology. Danilewsky was the first scientist to investigate avian malaria pathology where he indicated, by dissecting infected birds that the disease is accompanied by an acute anaemia, enlargement of the liver and spleen, as well as the accumulation of pigment and the presence of parasites and infected erythrocytes in the phagocytes of these organs. He associated ecological observations with seasonal dynamics of parasite infections in birds, and concluded that avian malaria parasites prevail in birds in the warm seasons; parasitemia correlates with temperature of the environment and that vectors take part in the spreading of the parasites (Valkiunas, 2005).His postulates and statements about the similarity between human malaria parasites and the parasites of birds in particular were of significant biological importance (Valkiunas, 2005). The research on the fauna and distribution of bird malaria became more active after the founding of the organisation of the International Reference Centre for Avian Malaria Parasites in 1968 in St. John’s, Canada, by M. Laird with the official support of the World Health Organization (Valkiunas, 2005). From the end of the 20th century, most of the researches on avian malaria parasites were mainly based on material collected from naturally infected birds and important data about ecology, molecular biology, distribution, prevalence, diversity and phylogeny have been accumulated (Bensch et al., 2000; Beadell et al., 2006; Hellgren et al., 2007). University of Ghana http://ugspace.ug.edu.gh 6 2.2 Avian haemosporidian parasites The most commonly known haemosporidians are the human malaria parasites from the genus Plasmodium (Barraclough et al., 2008).Plasmodium shares the same order or the same family with closely related parasites of the genera Haemoproteus and Leucocytozoon, depending on the author’s discretion (Perkin and Schall, 2002; Valkiunas, 2005); and the three genera have an evolutionary relationship (Perkin and Schall, 2002). All three genera go through alternating cycles of sexual and asexual reproduction, however only species of Plasmodium go through schizogony in circulating erythrocytes which results in symptoms of malaria (Beadell and Fleischer, 2005). Among bird species haemosporidians vary over time, season, and between locations, in their prevalence and parasitaemia which could also result in different selective pressures on bird populations (Bensch and Akesson, 2003). Comparatively, species of the genera Plasmodium and Leucocytozoon are considered to be more pathogenic than Haemoproteus spp. (Beadell and Fleischer, 2005). However, some Haemoproteus species were reported to cause disease in birds (Cardona et al., 2002) and to affect their ecological fitness (Marzal et al., 2005; Valkiunas, 2005). In many cases, infection is subclinical, (Merino et al., 2000; Waldenstrom et al., 2002) and in more severe cases, hypertension and cardiomegaly, cerebral and splenic infection, anemia, debilitation, and death can occur (Atkinson and van Riper, 1991). The pathogenicity of avian malaria parasites in birds has been argumentative for decades (Schrenzel et al., 2003). In general, Plasmodium spp. are considered more virulent than Haemoproteus spp., but infection with either appears to exert a cost to the host in every case (Merino et al., 2000). In passerines, costs can range from marked debilitation and University of Ghana http://ugspace.ug.edu.gh 7 life threatening anemia to subclinical drains on physiological processes and behaviors, such as immune responsiveness, quality of parenting, and ability to cope with stress (Jarvi et al., 2002; Waldenstrom et al., 2002). In avian malaria, as in human malaria (Hill et al., 1991), it is the first exposure to the infection that may cause the severest fitness consequences, that is acute infection (Atkinson & van Riper 1991). On the other hand, chronic stages of malaria infections are characterized by having none or only mild fitness effects (Atkinson & van Riper 1991; Hill et al., 1991). Once an individual bird has been infected with malaria, the infection may persist for years or even a lifetime (Atkinson & van Riper, 1991). The study of avian haemosporidian parasites has added to understanding emerging infectious diseases in different hosts (Kilpatrick et al., 2006; Jourdain et al., 2007). The ability of several migratory birds to travel vasts distances, makes it possible for them to transmit parasites between distant geographical locations, even between continents (Fallon et al., 2006; Svensson et al., 2007; Hellgren et al., 2007). In addition, many avian haemosporidian parasites are able to infect species from different bird families (Ricklefs et al., 2004; Krizanauskiene et al., 2006). 2.2.1 Vectors of avian malaria The avian malaria parasites are transmitted exclusively by blood-sucking dipteran insects (Valkiunas, 2005). Culex mosquitoes are generally considered to be vectors of Plasmodium spp., while biting midges and black flies are vectors of Haemoproteus spp. (Beadell & Fleischer, 2005). In some cases, species belonging to other mosquito genera such as Aedes, Culiseta, Anopheles, Mansonia and Aedeomyia have also been implicated in the transmission of different species of avian Plasmodium (Njagbo et al., 2009; University of Ghana http://ugspace.ug.edu.gh 8 Bonneaud et al., 2009). Additionally, wild mosquitoes of the genus Coquillettidia have been shown to be vectors of Plasmodium spp. in the lowland forest of Cameroon (Njagbo et al., 2011). 2.2.2 Parasite-host association Host-parasite associations seemingly reflect the physiological and immunological restrictions that are imposed by hosts, as well as ecological factors including distribution and abundance of hosts, parasites and vectors; which limit the chances for parasite transmissions between different hosts (Bensch et al., 2000; Beadell et al., 2008). Though host specialization has the tendency to limit resource availability and increase the risk of extinction, it could also increase contact among individuals of a parasite species restricted to a narrow host range (Beadell et al., 2008). Generalist parasites (with wide host distributions) are usually thought to have low fitness in any of their hosts. However, they may have higher abundance and face reduced extinction risk relative to specialist parasites (Beadell et al., 2008). Avian haemosporidians offer an important system for studying host-parasite strategies of closely related parasites since they have a high diversity as well as a diverse host fauna that is potentially available to each parasite in any particular geographical location (Beadell et al., 2008). 2.3 Life cycle of avian malaria parasites Avian malaria parasites of the genera Plasmodium and Haemoproteus are obligatory sexual organisms and require two hosts, a haematophagous dipteran vector and a vertebrate host to complete their life cycles (Barraclough et al., 2008). They must undergo a round of sexual reproduction in their vectors in order to produce stages that can be transmitted to vertebrate hosts (Barraclough et al., 2008). These genera have similar University of Ghana http://ugspace.ug.edu.gh 9 life cycles, with schizogony and gametocytogenesis within their vertebrate host leading to gametogenesis, zygote formation and sporogony within their insect vectors (Barraclough et al., 2008). The only difference between their life cycles is the type of vector (mosquitoes for Plasmodium, midges and black flies for Haemoproteus) because both genera parasitize the erythrocytes (Barraclough et al., 2008). Fertilization is however similar among the two groups. After a period of asexual proliferation in a vertebrate host, transmission to the vector occurs through the uptake of dioecious haploid pre-sexual stages (the gametocytes) in a blood meal (Barraclough et al., 2008). Gametocytes are activated inside the vector in the form of exflagellation of male gametes, with several gametes arising from one male gametocyte, and the production of a single female gamete from each female gametocyte (Barraclough et al., 2008). Fertilisation results in a zygote in the lumen of the insect vector’s midgut. This zygote undergoes multiple divisions (sporogony) to form and release haploid sporozoites that migrate into the vector’s salivary glands. Infection of a bird host occurs when sporozoites are injected with saliva as the vector takes a blood meal (Barraclough et al., 2008).The general characteristics of the life cycle of avian malaria parasites is described below (Fig.1) in the example of Plasmodium relictum which is distributed worldwide in a broad range of vertebrate hosts and has been well studied (Valkiunas, 2005). The development of the parasite in bird host can be divided into exo-erythrocytic merogony, erythrocytic merogony, and formation of gametocytes (Valkiunas, 2005). The exo-erythrocytic merogony is made up of primary (pre-erythrocytic) and secondary(post- erythrocytic) merogonies (Valkiunas, 2005). Primary exo-erythrocytic merogony consists of two generations of meronts, which are cryptozoites and metacryptozoites respectively, University of Ghana http://ugspace.ug.edu.gh 10 while secondary exoerythrocytic merogony includes several generations of meronts called phanerozoites (Valkiunas, 2005). Vectors inject sporozoites into birds and this gives rise to cryptozoites (Fig. 1.a). They develop predominantly in the reticular cells of many organs and tissues, including skin (Valkiunas, 2005). The second generation of primary exo-erythrocytic merogony is induced by cryptozoites which develop in macrophages in many organs and tissues (Fig. 1.b). Merozoites, develop in metacryptozoites, and infect the cells of the erythrocytic series (Fig.1.c) or induce the next generation of metacryptozoites and phanerozoites (Fig.1.d) (Valkiunas, 2005). The time from inoculation of sporozoites into birds until the maturation of the first generation of metacryptozoites is called a prepatent period of development (Valkiunas, 2005). After merozoites penetrate into young and mature erythrocytes, they become roundish and give rise to the growing non-fissionable parasites, which are called trophozoites (Valkiunas, 2005). After the first nucleus division, the parasite develops into a stage called erythrocytic meront (Valkiunas, 2005). Due to presence of merogony in erythrocytes, the infection of vertebrate hosts can be easily achieved by sub-inoculation of infected blood (Valkiunas, 2005). Asexual division produces uninuclear merozoites in erythrocytic meronts. The cycle of erythrocytic merogony in the majority of parasite species terminates after 24 to 36 h (Valkiunas, 2005). A part of merozoites formed in the erythrocytic meronts induces the next cycles of erythrocytic merogony and gives rise to gametocytes, while the other part penetrates the endothelial cells of the capillaries of many organs including the brain, initiating secondary exo-erythrocytic merogony (Valkiunas, 2005). Several minutes after feeding on infected birds, mature gametocytes in the midgut of mosquitoes round up and escape from the erythrocytes. Gametes are formed and University of Ghana http://ugspace.ug.edu.gh 11 fertilization occurs, and then motile ookinete develops (Valkiunas, 2005). Ookinetes move toward the epithelial cells of the midgut, reach the basal lamina, become round and transform into the oocysts surrounded by a capsule like wall (Valkiunas, 2005). After several germinative centers are formed many hundreds of sporozoites develop during the sporogony (Valkiunas, 2005). When mature oocysts rupture, the sporozoites get into the haemocoele and penetrate into the salivary glands (Valkiunas, 2005). The sporogony of P. relictum at the optimal temperature 24°C is completed in seven days after ingestion of mature gametocytes (Valkiunas, 2005). Infection of new hosts occurs by means of injection during a blood meal of infected vectors (Valkiunas, 2005). University of Ghana http://ugspace.ug.edu.gh 12 Figure 1: Diagram showing the life cycle of avian malaria parasite (Valkiunas, 2005). Legend: Upper part (18-24), in vector; lower part, in bird: a, b - primary exo-erythrocytic merogony; c -erythrocytic merogony; d - secondary exoerythrocytic merogony; 1 - sporozoite in reticuloendothelial cell; 2, 3 - cryptozoites; 4 - merozoite in macrophage; 5, 6 - metacryptozoites; 7 - merozoites in erythrocytes; 8 - gametocytes; 9 - merozoite in erythrocyte; 10, 11 - erythrocytic meronts; 12 - merozoite in endothelial cell of capillaries; 13, 14 -phanerozoites; 15 - merozoites in erythrocytes; 16 - gametocytes; 17 - macrogamete; 18 - exflagellation of microgametes; 19 - fertilization of macrogamete; 20 - ookinete penetrating the peritrophic membrane; 21 - young oocyst; 22, 23 - sporogony; 24 - sporozoites in the salivary glands of vector (Valkiunas, 2005). University of Ghana http://ugspace.ug.edu.gh 13 2.4 Review of avian malaria studies Many experimental studies have been designed to be helpful in understanding the impact of malaria and other haemosporidian parasites in wildlife (Marzal et al., 2005; Zehtindjiev et al., 2008; Knowles et al., 2010). A study by Chasar et al., (2009) indicated that host-parasite systems can be affected by habitat changes, since these systems are complex, with many biotic and abiotic variables. The study showed clearly that the dipteran insect vectors’ response to environmental changes can be a major factor regulating malaria parasite distribution and prevalence. Besides habitat changes, many diseases and pathogens are known to be sensitive to climatic conditions. For instance, meteorological factors such as temperature, rainfall and humidity have been linked with the dynamics of malaria vector populations, thus the spread of the disease (Chasar et al., 2009). A research in Kenya associated microclimatic changes caused by deforestation to the increased survival and fecundity of the mosquito Anopheles gambiae and concluded that infectious disease prevalence may differ with habitat change and associated altered microclimates (Chasar et al., 2009). Many researchers have addressed the relationship between avian haemosporidian parasites and various ecological factors (Valkiunas, 2005). For example, there have been extensive studies to determine the prevalence and diversity of these parasites in rainforest birds in West-Central Africa (Waldenstrom et al., 2002; Sehgal et al., 2005; Beadell et al., 2009). However, few studies focused on the relationship between the distribution of avian malaria infections and habitat changes (Chasar et al., 2009). A study which examined prevalence of infections in pristine and disturbed forests from a limited sampling over a broad geographic range in Cameroon found a higher prevalence of University of Ghana http://ugspace.ug.edu.gh 14 Plasmodium lineages in pristine as compared to disturbed sites (Bonneaud et al., 2009). However, other researchers examining prevalence of the parasites in Africa did not show clear differences in prevalence between seasons or years (Sehgal et al., 2005). Researchers examined how diversity and prevalence of haemosporidian parasites differ between disturbed and undisturbed habitat types and found different bird species possessing varying assemblages of parasite communities (Ricklefs et al.,2005; Arriero &Moller, 2008), but there is little empirical data on blood parasite diversity for individual bird species over a large scale in Africa (Chasar et al., 2009). Field studies using a combination of microscopy and molecular diagnostic methods revealed mixed infections of Plasmodium spp. and other related haemosporidians in over 40% of infected birds (Valkiunas et al., 2006), and over 80% in some European bird populations (Valkiunas et al., 2003). Some studies reported that avian malaria parasites of the genus Plasmodium caused serious clinical conditions and induced fatal results to captive birds in USA, Brazil, New Zealand, and Asia (Murata, 2002; Grim et al., 2004; Alley et al., 2008; Belo et al., 2009).Severe illness and overwhelming occurrence of Plasmodium elongatum - malaria have been recorded among penguins in zoos in North America and Eurasia (Cranfield et al,. 1990), so this infections are of practical significance (Valkiunas, 2008). Prevalence and diversity of haemosporidian parasites have also been studied though insufficiently, in rainforest birds in some parts of Africa (Chasar et al., 2009). For example, a study in Uganda showed that 76.5% of pigeons (Columba livia) were infected with Haemoproteus species and in South Africa, new species of Haemoproteusparasites were identified (Sehgal, 2005). However, birds in the semi-arid regions of South Africa University of Ghana http://ugspace.ug.edu.gh 15 lack haemosporidian parasites and this is seemingly due to the scarcity of the breeding habitats of the insect vectors (Sehgal, 2005). A study in Cameroon reported avian malaria parasite prevalence in 220 individuals belonging to three different species of African rain-forest birds. The number of individual birds infected was 20 with thirteen verified mitochondrial lineages found (Bonneaud et al., 2009). A study on the effects of deforestation on the distribution of haemosporidians was conducted on large numbers of rainforest birds collected in Ghana and Cameroon during 2005-2007 (Valkiunas et al., 2009).In this study, three new species of Plasmodium were described using data on the morphology of their blood stages and sequences of the mitochondrial cytochrome b gene. 2.5 Parasite diversity and global distribution Avian malaria parasites are distributed worldwide with a high diversity, and have been detected on every continent except Antarctica (Donovan et al., 2008). Apart from a few host taxa restricted to extreme arctic environments (Bennett et al., 1992) and several remote island taxa (Beadell et al., 2007), the majority of bird species are hosts to avian malaria parasites. Over 45% of bird species of the world’s fauna has currently been investigated with respect to infection with haemosporidians out of which Haemoproteus spp. was recorded in approximately 50%, and Plasmodium and Leucocytozoon spp. in approximately 30% of the investigated bird species (Valkiunas, 2005). The number of species of the order Haemosporida exceeds 400 species in all vertebrates, with more than 50% of them occurring in avian hosts (Valkiunas, 2005). Application of sensitive molecular techniques to the detection of haemosporidians have revealed an extremely broad diversity of parasite lineages (Durrant et al., 2006; Ishtiaq et al., 2007), University of Ghana http://ugspace.ug.edu.gh 16 thereby questioning previous morphological species limits (Beadell et al., 2006; Hellgren et al., 2007) and raising the possibility that haemosporidian species diversity is on the order of avian species diversity (Bensch et al., 2004) or even higher. Supporting this hypothesis, single host species have been shown to harbor between five and 34 distinct parasite mitochondrial lineages (Ishtiaq et al., 2006; Bensch et al., 2007). Avian malaria parasites include approximately 40 morphologically distinct species of the genus Plasmodium, and 130 species of the genus Haemoproteus (Bensch et al., 2009). Understanding the diversity of these parasites is being increased by the application of molecular genetic screening techniques of blood samples collected from wild hosts (Bensch et al., 2004). For example, estimates of global species diversity of the order of 200 species based on microscopy, have been suggested to need revision to somewhere in the order of 10 000 species based on comparisons of nuclear and mitochondrial gene trees (Bensch et al., 2004). 2.6 Effect of parasitism on bird hosts Parasites are powerful selective agents that influence almost all aspects of their hosts’ life (Dronamraju, 2004). The Red Queen hypothesis proposed that hosts and parasites are involved in a constant co evolutionary arms race, in which host resistance and parasite infectivity are under strong mutual selection (Jaenike, 1978). Parasites can have a substantial influence on the demography of their host populations and thus drive ecological and evolutionary processes (Mouritsen and Poulin, 2005; Miura et al., 2006; Ostfeld et al., 2008). University of Ghana http://ugspace.ug.edu.gh 17 In host life history evolution, it is suggested that parasites play a significant role as mediators of fitness costs sustained as a result of reproductive effort or exaggeration of sexual ornaments (Gustafsson et al., 1994; Sheldon and Verhulst, 1996). Experimental researches of the importance of parasites in life history evolution have often used blood parasites of the genera Haemoproteus, Plasmodium and Leucocytozoon and their avian hosts as ideal systems (Desser and Bennett, 1993). In wild animal populations, fitness of individuals can be affected by pathogens in a number of ways, such as increasing predation risk, reducing survival and reducing reproductive output (Moller and Nielsen, 2007; Johnson et al., 2008). These effects can be observed at higher organizational levels, with pathogens playing a critical role in host population dynamics and range distributions (Ricklefs, 2010), thereby driving genetic variation and sexual selection (Ortego et al., 2007; Spugin and Richardson, 2010).In wild birds, malarial infection was shown to have implications for host mate choice, parental investment, reproductive success, immune gene variability and population or species persistence (Westerdahl et al., 2005; Bonneaud et al., 2006). 2.7 Investigation of avian malaria using traditional microscopy For several years, avian malaria parasites have been mainly studied by microscopic examination of Giemsa-stained blood films (Palinauskas, 2008). The existing information on the basic life history, geographical distribution, vertebrate hosts and vector specificity, seasonal changes of infection, and other aspects of ecology of these parasites have been gathered mainly by microscopy (Forrester and Spalding, 2003). However, researchers using traditional microscopy faced many challenges. For example, the identification of avian Plasmodium species from the blood smears is often impossible (Palinauskas, 2008). University of Ghana http://ugspace.ug.edu.gh 18 Even when recorded, most chronic infections of Plasmodium spp. remain unidentified to the species level, even by experts, owing to low intensities and common mixed infections (Valkiunas, 2005). 2.8 PCR-based methods and comparison to traditional microscopy in detecting avian malaria The first PCR protocol developed for avian haemosporidian studies was designed to amplify Plasmodium parasites from birds in Hawaii using primers for 18SrRNA (Feldman et al., 1995). This not widely used because it was efficient only for a small group of Plasmodium species. As a means of improving upon this protocol, Bensch et al., (2000) published the first general PCR protocol for both avian Plasmodium and Haemoproteus parasites, where a portion of the mitochondrial cytochrome b gene was the target molecule. This protocol together with slightly modified protocols (Hellgren et al., 2004; Waldenstrom et al., 2004) is still among the most widely used protocols (Bensch et al., 2009). The PCR technique has become a valuable tool for the detection of haemosporidian parasites, and the use of sequencing revealed a wealth of genetic diversity (Bensch et al., 2000; Ricklefs and Fallon, 2002; Schrenzel et al., 2003). Compared to traditional microscopy of blood smears, PCR offers increased sensitivity (Richard et al., 2002). However, Haemoproteus spp. and Plasmodium spp. typically are amplified generally, and identification to genus level requires sequencing (Beadell and Fleischer, 2005). A comparison of several PCR methods to microscopy for detection of avian haemosporidians revealed that PCR is faster, cheaper, and more reliable than microscopic blood smear examination for large-scale screening (Palinauskas, 2009) and that some problems associated with traditional typing of parasites can be resolved with PCR (Richard et al., 2002). University of Ghana http://ugspace.ug.edu.gh 19 Furthermore, polymerase chain reaction methods can provide sequence information that allows for the identification of the specific parasite lineage (Bensch and Akesson, 2003), which is not possible using parasite morphology alone (Hellgren et al., 2004).Moreover, lineage-specific data may be useful when monitoring an epidemic or measuring migratory connectivity (Webster et al., 2002), but ecologists, wildlife managers, and zookeepers often may benefit from genus-level knowledge of parasites in an avian community (Beadell and Fleischer, 2005). Molecular diagnostic techniques are very sensitive in detecting blood parasites, even when there is low parasitaemia (Ricklefs et al., 2004; Sehgal et al., 2006; Hellgren et al., 2007). Pérez-Tris and Bensch, (2005) also described a molecular method for detecting mixed infections of haemosporidians; they stated that the detection efficiency might vary depending on the combination of parasite lineages and the intensity of infections. However, PCR assays alone underestimate the occurrence of simultaneous infections of haemosporidian parasites in naturally infected birds (Valkiunas et al., 2006). In such research, the sequences obtained are presumed to represent the parasite seen under the microscope, but there may be light infections of other species that will be amplified preferentially (Valkiunas et al., 2007). For example, one study used a sequence obtained from a dove infected with Haemoproteus columbae (Escalante et al., 1998), but the sequence was later shown to represent a Plasmodium sp. lineage (Bensch et al., 2000). Because GenBank data have been used increasingly in investigations of phylogenetic relationships of parasites, incorrect identifications of sequence identity might be misleading, so it is important to link DNA sequences and morphospecies precisely (Sehgal et al., 2005). However, it is not an easy task because the great majority of natural infections of avian haemosporidian parasites are light with a few or even single parasites University of Ghana http://ugspace.ug.edu.gh 20 present in blood films and it is usually impossible to identify species of Plasmodium in such light infections (Sehgal et al., 2005; Valkiunas et al., 2005). To determine the true species composition of the haemosporidians in each naturally infected individual host, a combination of both microscopy and PCR-based methods has been recommended (Valkiunas et al., 2006; Valkiunas et al., 2009). Microscopy is unlikely to result in false positives, which is a major concern in large-scale PCR studies (Valkiunas et al., 2008). It is important that blood films, which are used for microscopic examination, should be of good quality; they should be examined properly by skilled investigators (Valkiunas et al., 2008). In spite of the substantial time investments associated with microscopy, such examination provides opportunities for simultaneous determination and verification of taxonomically different parasites (Valkiunas et al., 2008). Studies revealed that, even though PCR methods are extremely sensitive, they also have shortcomings (Pérez-Tris & Bensch, 2005). The main problem is that the PCR methods are often selective during simultaneous infections with species of Plasmodium and Haemoproteus or both (Pérez-Tris & Bensch, 2005; Valkiunas et al., 2006). So, alone they are insufficient when diagnosing mixed infections of haemosporidian parasites, which are common in wildlife (Ricklefs & Fallon, 2002; Perkins & Schall, 2002). It is important to link knowledge of traditional parasitology and molecular biology because the former provides information about basic life history strategies of these organisms and the latter provides new information about their phylogenetic relationships (Bensch et al., 2000; Ricklefs & Fallon, 2002; Perkins &Schall, 2002; Valkiunas, 2005). University of Ghana http://ugspace.ug.edu.gh 21 2.9 Factors affecting avian malaria prevalence Host factors such as age, sex and host population density may also influence host parasite infection (Wood et al., 2007). Prevalence may increase with age as new infections accumulate, then decrease as susceptible individuals die or tolerant individuals become immune (Wilson et al., 2001). Male birds tend to have a higher prevalence of infection than females (McCurdy et al., 1998). Population density may also influence the risk of infection, depending on how parasite transmission relates to host population density and Spatiotemporal variation in parasite infection has often been supposed to contribute to the maintenance of genetic variation in host resistance to parasites, but only rarely has it been studied in wild populations (Lively & Dybdahl, 2000; Bensch & Akesson, 2003). University of Ghana http://ugspace.ug.edu.gh 22 CHAPTER THREE 3.0 MATERIALS AND METHODS 3.1 Study design This study was designed to involve both field and laboratory based research. Birds were sampled from two wildlife protected areas located in Greater Accra region and Central region of Ghana. All the laboratory investigations to detect malaria parasites from avian blood samples were done in the department of animal experimentation, Noguchi Memorial Institute for Medical Research (NMIMR), and in the department of animal science, college of agricultural sciences, both in the University of Ghana. 3.2 Study site and material collected The sample collection took place between July and December, 2012, in Shai Hills Resource Reserve and Kakum National Park located in Greater Accra and central regions of Ghana respectively. University of Ghana http://ugspace.ug.edu.gh 23 Figure 2: A schematic presentation of the study sites (not to scale) University of Ghana http://ugspace.ug.edu.gh 24 3.2.1 Kakum National Park The Kakum National Park was demarcated as forest reserve between 1925 and 1926 and the reserve was established in 1931 as a source of timber and protection of the watersheds of Kakum River and other rivers which supply the water needs of Cape Coast and other surrounding areas. The park, together with the neighbouring Assin Attandanso Resource Reserve, protects 357km2 of diverse and dense vegetation and is home to varied wildlife (IUCN, 2010). The vegetation of Kakum National Park falls into the transition forest type and this classification was based only on the dominant emergent trees. One hundred and five species of vascular plants have so far been identified in the Kakum area (IUCN, 2010). The main features of the vegetation found in Kakum are the moist forest, swamp forest, periodic swamp forest, riverine forest and boval vegetation. The mammals recorded in the park include potto, Demidoff's galago, grasscutter, brush- tailed porcupine, species of primates (including black and white colobus and Diana monkey), honeybadger, bongo, elephant, duikers (including the yellow-backed duiker), water chevrotain, two hogs, pangolins and squirrels and the reptiles include monitor lizard, dwarf crocodile, Home'shinged tortoise and serrated tortoise (IUCN, 2010). A total of 266 bird species have been reported, including rare species such as the white- breasted guinea fowl (Agelastes meleagrides) and the threatened yellow-throated olive greenbul (Criniger olivaceus). There is a great number and diversity of butterflies (at least 405 species) recorded in the park. The few carnivores that occur in Kakum are low in density. They include African civet, forest genet, leopard and palm civet (IUCN, 2010). University of Ghana http://ugspace.ug.edu.gh 25 3.2.2 Shai Hills Resource Reserve Shai Hills Resource Reserve with an area of 52km2is one of Ghana's smallest wildlife protected areas and is located in Doryumu, Dangme west district of the Greater Accra Region. The reserve is situated in Accra Plains which forms the western end of the Dahomey Gap, an area of low rainfall where the West African coastal rainforest belt is interrupted and replaced by low grass and savannah (IUCN, 2010). The Shai Hills are a series of inselbergs (mountains that have been largely worn away). The highest peak rises to 290 m. The hills are covered by a mixture of forest, thickets and grassland with unique low stature dry forest being mainly found in the intervening canyons. The hills are surrounded by savannah-covered plains, at about 60 m elevation. The reserve's vegetation is dominated by short-grass savannah with trees and shrubs on the plains, and by dry evergreen forest and thickets on the hills (IUCN, 2010). To date, 397 plant species have been identified in the reserve, including two endemic species. The large mammals that are commonly seen in Shai Hills include olive baboons (Papio Anubis), kob (Kobus kob), green monkey (Cercopithecus aethiops), spot-nose monkey (C. petaurista) and bushbuck (Tragelaphus scriptus) (IUCN, 2010).There are records of Tree Hyrax Dendrohyrax dorsalis which are much more likely to be the Rock Hyrax (Procavia johnstoni). Other species are grasscutter, crested porcupine, hedgehog, Togo hares, oribi, and slender tailed mongoose (IUCN, 2010). Predators in the reserve include hyenas, leopards, civets, genets, servals and side-striped jackals. About 173 species of birds have been recorded in the reserve (IUCN, 2010). University of Ghana http://ugspace.ug.edu.gh 26 3.3 Collection of birds Birds were caught using mist nets. Six mist nets comprising four 12m length and two 18m lengths were set in Kakum National park while four nets comprising two 18m nets and two 12m nets were set in Shai Hills Resource Reserve. The mist nets were opened between the hours of 05:30am and 05:00pm. Nets were checked frequently for catches. The trapped birds were carefully removed from the nets and kept in holding bags prior to processing. Processed birds were marked with a permanent marker before released so that sample was not taken from any recaptured bird. The birds were identified by using “Birds of Ghana” field guide (Borrow and Demey, 2010). 3.3.1 Sample size Sample size depended on the relative abundance of the birds sampled from the study sites. A total of 132 birds were sampled. Out of this 78 were sampled from Kakum National Park and 54 from Shai Hills Resource Reserve. 3.3.2 Collection of blood samples and preparation of the material for microscopic examination and DNA studies Blood samples were taken by puncturing the brachial vein of birds. Each bird was removed from the holding bag and the area around the brachial vein was sterilized by swabbing with 70% alcohol. This also moistened the surrounding feathers of the brachial vein making it more accessible. Using a sterile 26 gauge needle, the area was pricked and squeezed gently to obtain a large drop of blood (Fig. 3A). The blood was collected using a 200µl pipette tip fixed to a micropipette aid (Fig. 3B). Approximately 100 µl of whole blood was drawn from each bird, and kept for molecular analysis. The blood samples University of Ghana http://ugspace.ug.edu.gh 27 were kept in 300 µl EDTA micro-containers and mixed gently but thoroughly to prevent coagulation. They were held at ambient temperature in the field and later at -20 °C in the laboratory. A blood drop of approximately 2 µl taken directly from the bird’s body was used to prepare each blood film (Fig. 3C). Three thin blood films were prepared from each bird on ready-to-use glass slides; the thin film was spread using a smooth edge slide spreader. Using a grease pencil, the slides were labeled with numbers for identification. The blood films were made on slides that have frosted ends for easy labeling (Chesebrough, 2000). The smears were air-dried within 5-10 sec after their preparation, with the slides in a horizontal position after which they were placed in a separate box covered with a lid to protect them from insects and dust (Chesebrough, 2000). The slides were fixed in absolute methanol in the field for 1 min on the day of their preparation. Fixed slides were packed into slide boxes, so that they did not touch each other. All smears packed into slide boxes were brought in for processing at the department of Animal Experimentation, Noguchi Memorial Institute for Medical Research, University of Ghana. A B C Figure 3: Blood sample collection and preparation of blood films for microscopic examination. A – Puncturing the brachial vein; B – taking blood sample; C – making blood smears University of Ghana http://ugspace.ug.edu.gh 28 3.4 Giemsa staining Fixed smears were stained in the laboratory with 5% working solution of a commercially purchased stock solution of Giemsa’s stain, pH 7.0-7.2, at 20-25°C. The methanol fixed slides were immersed in a coplin jar. The 5% Giemsa solution was poured on the slides in the jar and allowed to stand for 30 min. The stain from the jar and slides were then washed with clean water to avoid the films being covered with fine deposit stain. The back of each slide was cleaned and placed on a draining rack to air dry. 3.5 Microscopic examination of blood films An Olympus CH30 light compound microscope was used to examine the blood slides. On each slide, a drop of oil immersion was put to the lower third of the film and examined to check the staining, morphology and distribution of the cells and to detect malaria schizonts, gametocytes and trophozoites (Chesebrough, 2000). Approximately 100 -150 fields were examined for 10-15 min at low magnification (×400), and then at least 100 fields were studied at high magnification (×1000). Pictures of the parasites were taken using a wraycam G500 (wraymer microscope ×0.5) using the software wrayview. The examination of each sample took approximately 40-50 min. 3.6 Extraction of DNA from avian blood Deoxyribonucleic acid (DNA) was extracted from whole blood following a DNeasy kit protocol (Qiagen, Valencia, CA, and USA). Ten microlitres (10µl) of whole blood was added into a labeled 1.5mL micro centrifuge tube. 200µl of Avian Phosphate Buffered Solution (PBS) was added to each sample. Twenty microlitres (20µl) Proteinase K was added to each sample and mixed by vortexing for 5-15 seconds. Two hundred microlitres (200µl) of Buffer AL was added and mixed by vortexing for 5-15 seconds and the samples were incubated at 50˚C for 10 University of Ghana http://ugspace.ug.edu.gh 29 minutes. Two hundred microlitres (200µl) of cold 100% ethanol was added to each sample and mixed by vortexing for 5-15 seconds. The mixture was transferred into labeled spin columns and centrifuged at 8000 x gravity for 1 minute. The tubes containing the flow through were discarded. Five hundred microlitres (500µl) of Buffer AW1 was added to each spin column and centrifuged at 8000 x gravity for 1 minute and the tube containing the supernatant discarded. Five hundred microlitres (500µl) of Buffer AW2 was added to each spin column and centrifuged at 14,000 x gravity for 3 minutes and the tube containing the flow through discarded. Each spin column was placed in a labeled micro centrifuge tube and the tube containing the filtrate discarded. Two hundred microlitres (200µl) of Buffer AE was then added to the spin column and incubated at room temperature for 1 - 5 minutes. The sample was centrifuged at 8000 x gravity for 1 minute and the spin columns discarded. The extracted DNA samples were frozen at -20˚C for future use. 3.7 PCR amplification For confirmation of the presence of Plasmodium and Haemoproteus spp., single polymerase chain reaction (PCR) method that amplifies a fragment of the mitochondrial cytochrome b gene was used. Positive and multiple negative controls were included to check. The positive controls were taken from infected birds, as was determined by microscopic examination of blood films, and sterile nuclease free water was used as negative controls in place of DNA template (Valkiunas et al., 2009). The negative controls were used to control for false amplification due to the high sensitivity of the PCR. The primers HaemF (5’ATGGTGCTTTCGATATATGCATG3’) and HaemR2 (5’GCATTATCTGGATGTGATAATGGT3’), designed by Bensch et al., (2000) and University of Ghana http://ugspace.ug.edu.gh 30 derived from a relatively conserved region of several avian Plasmodium and Haemoproteus spp. previously registered in GenBank were used. Each solution for PCR reaction contained 15 μl of 2 × Gotaq green master mix (Promega), 0.04µmol of each primer, 10.2μl of nuclease free water and 3μlof the DNA in a final volume of 30μl. DNA amplification was done using an Applied Biosystems 2720 thermal cycler. A total of 35 cycles was carried out, consisting of denaturing at 95°C for 1minute, annealing at 55°C for 1minute, and extension at 72°C for 1minute, with an initial pre-incubation at 95°C for 5 minutes and elongation at 72°C for 10 minutes. The amplified DNA (5µl) was then submitted to electrophoresis in 2% agarose gel and detected by ethidium bromide staining and UV trans-illumination. The expected target size was 478-bp and the band size was measured using a 50bp DNA ladder (Biolabs). 3.7.1 Parasite identification All amplicons with band sizes between 400bp and 600bp were sent to Macrogen gene sequencing company for analysis (Macrogen, Europe). They were purified and subjected to an automatic dye-terminator cycle sequencer with Big Dye Terminator, to confirm genomic sequences. The resulting sequences were submitted to the National Center for Biotechnology Information (NCBI) BLAST nucleotide database for comparison with known sequences. 3.8 Research Permit This work received permit from the Ghana Wildlife Division of the Forestry Commission and was done with the consent of the park managers in the two study sites University of Ghana http://ugspace.ug.edu.gh 31 3.9 Statistical analysis Results were analysed using the statistical packages, SPSS (version 16), Practistat and Excel to address the objectives of the study. Kappa measurement of agreement was used to test for sensitivity and specificity of PCR and microscopy diagnostic methods in detecting avian malaria parasites. Mann-Whitney U-test was used to compare prevalences estimated in both study areas and Kruskal-wallis H-test was used to compare prevalences estimated by microscopy, PCR and a combination of the both methods in the two study areas. These tests were used because; normality test showed that the data used was not normally distributed. Sequencing results was opened using the software Bioedit. The sequences were edited and aligned using the software MEGA (version 5.2). The sequence results were analysed using the Basic Local Alignment Search Tool (BLAST) on the National Center for Biotechnology Information (NCBI) nucleotide database. University of Ghana http://ugspace.ug.edu.gh 32 CHAPTER FOUR 4.0 RESULTS 4.1 Sample size and distribution of birds in the study areas A total of 132 individual birds comprising 20 families and 39 species were trapped. Of this number, (54%) representing 21 species were recorded exclusively in Kakum National park, (41%) representing 16 species were recorded exclusively in Shai Hills resource reserve and (5%) representing 2 species, viz. Ceyx pictus and Merops albicollis were found in both sites (Figure 3). The representation of families of birds in each reserve has been shown in figure 3. Eight families occurred in only Shai Hills, seven families occurred in only Kakum and five were common to both sites and these were the families: alcedinidae, meropidae, pycnonotidae, columbidae and muscicapidae. Figure 4: Distribution of sampled bird species and families in Kakum National park and Shai hills resource reserve. 21 16 2 7 8 5 0 5 10 15 20 25 Kakum only Shai Hills only Kakum and Shai Hills N u m b er o f sp ec ie s/ fa m il ie s study sites Distribution of sampled bird species and families species families University of Ghana http://ugspace.ug.edu.gh 33 4.2 Relative Abundance of Birds in Kakum National Park In Kakum National Park, a total of 78 individual birds of 23 species belonging to 12 families were sampled. Two species, Ploceus nigerrimus (0.93%) and Andropadus virens (0.45%) were the most abundant. The relative abundance of other species trapped is shown in Table 1. University of Ghana http://ugspace.ug.edu.gh 34 Table 1: Total number of birds caught in Kakum National Park and relative abundance of each bird species expressed in number of birds × 100/mist-net m × h Common Name/ Host family Scientific Name Number of birds caught Relative Abundance Nectariniidae Olive sunbird Cyanomitra olivacea 5 0.19 Olive-bellied sunbird Cinnyris chloropygius 1 0.04 Collard sunbird Hedydipna collaris 1 0.04 Blue-throated brown sunbird Cyanomitra cyanolaema 1 0.04 Sylviidae Green crombec Sylvietta virens 1 0.04 Muscicapidae Dusky-blue flycatcher Muscicapa comitata 1 0.04 Monarchidae Red-bellied paradise flycatcher Terpsiphone viridis 1 0.04 Cisticolidae Grey-backed camaroptera Camaroptera brachyura 2 0.07 Red-faced cisticola Cisticola erythrops 1 0.04 Pycnonotidae Yellow whiskered greenbul Andropadus latirostris 1 0.04 Red-tailed greenbul Criniger calurus 1 0.04 Little greenbul Andropadus virens 12 0.45 Western blue-bill Spermophaga haematina 5 0.19 Estrildidae Chestnut-breasted negrofinch Nigrita bicolor 1 0.04 Ploceidae Blue-billed malimbe Malimbus nitens 4 0.15 Crested malimbe Malimbus malimbicus 2 0.07 Vieillot’s black weaver Ploceus nigerrimus 25 0.93 Village weaver Ploceus cucullatus 4 0.15 Black-necked weaver Ploceus nigricollis 1 0.04 University of Ghana http://ugspace.ug.edu.gh 35 Columbidae Tambourine dove Turtur tympanistria 3 0.11 Meropidae White-throated bee-eater Merops albicollis 3 0.11 Alcedinidae African pygmy kingfisher Ceyx pictus 1 0.04 Zosteropidae Yellow white-eye Zosterops senegalensis 1 0.04 Family: 12 Species:23 Individuals:78 University of Ghana http://ugspace.ug.edu.gh 36 4.3 Relative abundance of birds in Shai Hills Resource Reserve A total of 54 birds of 18 species belonging to 13 families were trapped. Two species, Turtur afer (0.57%) and Cossypha nivieicapilla (0.48%) were the most abundant. The relative abundance of all other species trapped is shown in Table 2. The common and scientific names of all birds trapped are shown in APPENDIX I and II. University of Ghana http://ugspace.ug.edu.gh 37 Table 2: Relative Abundance of birds trapped in Shai Hills Resource Reserve Common Name/ Host Family Scientific Name Number of birds caught Relative Abundance Alcedinidae African pygmy kingfisher Ceyx pictus 2 0.09 Capitonidae Veillot's barbet Lybius vieilloti 4 0.17 Columbidae Blue-spotted wood dove Turtur afer 13 0.57 Dicruridae Forked-tail drongo Dicrurus adsimilis 1 0.04 Lybiidae Yellow-fronted tinkerbird Pogoniulus chrysoconus 1 0.04 Meropidae White-throated bee-eater Merops albicollis 1 0.04 Muscicapidae Pied flycatcher Ficedula hupoleuca 1 0.04 Pale flycatcher Bradornis pallidus 1 0.04 Phasianidae Stone patridge Ptilopachus petrosus 1 0.04 Picidae Buff-spotted wood pecker Campethera nivosa 4 0.17 Platysteiridae Common wattle eye Platysteira cyanea 5 0.22 Pycnonotidae Grey-headed bristle bill Bleda canicapillus 3 0.13 Simple leaflove Chlorocichla simplex 2 0.09 Yellow-throated leaflove Chlorocichla flavicollis 1 0.04 Common bulbul Pycnonotus barbatus 1 0.04 Sturnidae Violet-backed starling Cynnyricinclus leucogaster 1 0.04 Turdidae Snowy crowned robin chat Cossypha niveicapilla 11 0.48 African thrush Turdus pelios 1 0.04 Family: 13 Species: 18 54 University of Ghana http://ugspace.ug.edu.gh 38 4.4 Microscopic investigation and PCR screening of avian blood samples Microscopic examination of blood films revealed infections with either Plamodium or Haemoproteus in 30 birds. Some infected erythrocytes are shown in figure 5.However, PCR screening of the blood samples showed that 58 birds were infected with malaria parasites. Gel electrophoresis picture showing results for some positive samples is shown in figure 6. a b c d e f g h i j k l Figure 5: Blood stages of haemosporidian parasites as seen in thin blood films. a, b, c: gametocytes of Haemoproteus spp. in the blood of Nigrita bicolor; d-j: gametocytes of Haemoproteus spp. in the blood of Ploceus nigerrimus; k, l: gametocytes of Plasmodium spp. in the blood of Ploceus nigerrimus. University of Ghana http://ugspace.ug.edu.gh 39 m n o p q r s s1 t u v w x y z Figure 5: Blood stages of haemosporidian parasites as seen in thin blood films. m-o: gametocytes of Plasmodium spp. in the blood of Ploceus nigerrimus; p-r: gametocytes of Haemoproteus spp. in the blood of Bradornis pallidus; s, s1, t: gametocytes of Plasmodium spp. in the blood of Merops albicollis; u-w: gametocytes of Haemoproteus spp. in the blood of Zosterops senegalensis; x-z: gametocytes of Haemoproteus spp. in the blood of Ficedula hupoleuca. University of Ghana http://ugspace.ug.edu.gh 40 Lane: Figure 6: Agarose gel showing PCR results with the primers HaemF and HaemR2 on DNA samples extracted from blood samples of birds. Lane M- 50bp DNA ladder (Biolabs); lane 1-6, 8-16, 18-23: DNA samples extracted from avian blood; lane 23 – positive control; lanes7, 17, 24 – negative controls. 500bp M 1 2 3 4 5 .6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 University of Ghana http://ugspace.ug.edu.gh 41 4.5 A comparative analysis of Microscopy and PCR for the detection of avian haemosporidians A combination of microscopy and PCR in diagnosing avian malaria revealed Plasmodium and Haemoproteus prevalence of 45.4% (Table 3). Microscopy alone detected 23% prevalence while PCR alone detected 44% prevalence. The difference in prevalence detected by the two methods was statistically significant (p<0.05). However, there was no significant difference (p>0.05) between prevalence detected by PCR alone and the combination of the two methods (Table 3). Considering the microscopy results as the reference point, a total of 58 PCR positive samples and 30 microscopy positive samples yielded a sensitivity of 48.3%; 74 PCR negative and 102 microscopy negative samples yielded a specificity of 97.3% (APPENDIXV). Some samples showed positive by PCR (51.7%) and undetected by microscopy. Only 2.79% of detections were positive by both microscopy and PCR. Thus kappa measurement of agreement estimated a weak agreement (k=0.48) between PCR screening and microscopic examination as diagnostic tests for the detection of avian blood parasites. The combination of both PCR and microscopy revealed infections of Haemoproteus spp. and Plasmodium spp. among 11 families and 18 species of avian hosts (Table 3).The species with the highest prevalence of infection were Ploceus cucullatus (n=4, 100%), Camaroptera brachyura (n=2, 100%) and P. nigerrimus (n=25, 92%). The prevalence of parasites in other species sampled is shown in Table 3. University of Ghana http://ugspace.ug.edu.gh 42 Comparatively, parasite infections varied between the two sites with a higher prevalence (69.20%) in Kakum National Park compared to (12.90%) in Shai Hills Resource Reserve. However, the difference was not statistically significant (p>0.05). University of Ghana http://ugspace.ug.edu.gh 43 Table 3: Birds tested and outcome of PCR screening and microscopic examination of blood samples Microscopy PCR Both methods Prevalence (%) Taxa No. screened H/P H/P H/P Nectariniidae Cyanomitra olivacea 5 1 2 2 40 Cinnyris chloropygius 1 0 1 1 - Hedydipna collaris 1 0 0 0 0 Cyanomitra cyanolaema 1 1 1 1 - Sylviidae Sylvietta virens 1 1 1 1 - Muscicapidae Ficedula hupoleuca 1 1 1 1 - Bradornis pallidus 1 1 1 1 - Muscicapa comitata 1 0 1 1 - Monarchidae Terpsiphone viridis 1 0 0 0 0 Cisticolidae Camaroptera brachyuran 2 0 2 2 100 Cisticola erythrops 1 0 0 0 0 Pycnonotidae Bleda canicapillus 3 0 0 0 0 Andropadus latirostris 1 0 0 0 0 Criniger calurus 1 0 1 1 - Andropadus virens 12 0 5 5 41.7 Spermophaga haematina 5 0 2 2 40 Estrildidae Nigrita bicolor 1 1 1 1 - Ploceidae Malimbus nitens 4 0 3 3 75 Malimbus malimbicus 2 0 1 1 50 Ploceus nigerrimus 25 19 22 23 92 University of Ghana http://ugspace.ug.edu.gh 44 H: Haemoproteus P: Plasmodium Ploceus cucullatus 4 3 4 4 100 Ploceus nigricollis 1 0 0 0 0 Columbidae Turtur afer 13 0 1 1 7.7 Turtur tympanistria 3 0 0 0 0 Meropidae Merops albicollis 4 1 2 3 75 Alcedinidae Ceyx pictus 3 0 1 1 33.3 Zosteropidae Zosterops senegalensis 1 1 1 1 - Capitonidae Lybius vieilloti 4 0 0 0 0 Dicruridae Dicrurus adsimilis 1 0 0 0 0 Lybiidae Pogoniulus chrysoconus 1 0 1 1 - Phasianidae Ptilopachus petrosus 1 0 0 0 0 Picidae Campethera nivosa 4 0 0 0 0 Platysteiridae Platysteira cyanea 5 0 0 0 0 Chlorocichla simplex 2 0 0 0 0 Chlorocichla flavicollis 1 0 0 0 0 Pycnonotus barbatus 1 0 1 1 - Sturnidae Cynnyricinclus leucogaster 1 0 0 0 0 Turdidae Cossypha niveicapilla 11 0 1 1 9.1 Turdus pelios 1 0 1 1 - University of Ghana http://ugspace.ug.edu.gh 45 4.6 Parasite lineages and habitats Sequencing of the mitochondrial cytochrome b gene revealed a total of 11 Plasmodium lineages and 9 Haemoproteus lineages from both Kakum National park and Shai Hills Resource reserve (Table 4, 5). However, sequences for twelve individuals were not determined due to faint bands shown on gel electrophoresis. Out of 11 Plasmodium lineages, three, viz. WA22, PV1L and PLASCOQ12 were common to both sites. One lineage, WA45 was recovered from Shai Hills only while seven lineages, viz. WA6, OZ45_MEX19, LIN3A, P31, PV11, COLL7 and WA16 were recovered from Kakum National Park only (Table 4, 5). Two out of the nine Haemoproteus lineages, L-PFC1 and SYBOR1.SPAIN were recovered from Shai Hills while the rest NA15BRCO, WAH36, VILWE1, WAH34, LIN8A, HV42 and LIN18A were recovered from Kakum National Park (Table 4, 5). Plasmodium and Haemoproteus prevalences varied in both sites with Plasmodium recording the highest prevalence in each site, viz. 33.3% in Kakum and 7.4% in Shai Hills compared to the lower prevalences of Haemoproteus, ie. 17.9% in Kakum and 3.7% in Shai Hills (Table 4, 5). However, there was no significant difference (p>0.05) between Plasmodium and Haemoproteus prevalences in each site (Table 4, 5). University of Ghana http://ugspace.ug.edu.gh 46 Table 4: Prevalence (P) and lineages of haemosporidian parasites in birds trapped from Kakum National Park (lineage names are according to NCBI database) Plasmodium Haemoproteus Genus unknown Taxa N P (%) Lineage P (%) Lineage Percentage Cyanomitra Olivacea 5 1(20) WA6 0 Cinnyris chloropygius 1 0 0 Hedydipna Collaris 1 0 0 Cyanomitra cyanolaema 1 1(100) WA6 0 Sylvietta virens 1 0 1(100) NA15BRCO Muscicapa Comitata 1 1(100) PLASCOQ12 0 Terpsiphone Viridis 1 0 0 Camaroptera Brachyuran 2 0 0 1(50) Cisticola erythrops 1 0 0 Andropadus virens 12 5(41.7) PV1L(5) 0 Andropadus Latirostris 1 0 0 Criniger calurus 1 1(100) PV1L 0 Spermophaga Haematina 5 3(60) OZ45_MEX 19(2) PV1L(1) 0 1(20) Nigrita bicolor 1 0 1(100) WAH36 University of Ghana http://ugspace.ug.edu.gh 47 Ploceus nigerrimus 25 10(40) LIN3A(1), WA22(2) P31(1), PV11(5) COLL7(1) 10(40) VILWE1(2) WAH34(7) LIN8A(1) 1(4) Ploceus cucullatus 4 2(50) PV11(1), WA22(1) 0 2(50) Ploceus nigricollis 1 0 0 Malimbus nitens 4 2(50) PV1L(1), WA16(1) 1(25) HV42 1(25) Malimbus Malimbicus 2 0 0 1(50) Turtur tympanistria 3 0 0 Merops albicollis 3 0 0 Ceyx pictus 1 0 0 Zosterops senegalensis 1 0 1(100) LIN18A 26 (33.3) 14 (17.9) University of Ghana http://ugspace.ug.edu.gh 48 Table 5: Prevalence (P) and lineages of haemosporidian parasites in bird species sampled in Shai Hills Resource Reserve Plasmodium Haemoproteus unknown Taxa N P (%) Lineage P (%) Lineage % Ceyx pictus 2 0 0 Lybius vieilloti 4 1(25) WA22 0 Turtur afer 13 0 0 1(7.7) Dicrurus adsimilis 1 0 0 Pogoniulus chrysoconus 1 1(100) PV1L 0 Merops albicollis 1 0 0 Ficedula Hupoleuca 1 0 1(100) L-PFC1 Bradornis pallidus 1 0 1(100) SYBOR1 SPAIN Ptilopachus Petrosus 1 0 0 Campethera nivosa 4 0 0 Platysteira cyanea 5 0 0 Bleda canicapillus 3 0 0 Chlorocichla Simplex 2 0 0 Chlorocichla flavicollis 1 0 0 Pycnonotus barbatus 1 1(100) WA45 0 Cynnyricinclus leucogaster 1 0 0 Cossypha niveicapilla 11 1(9.1) PLAS COQ12 0 Turdus pelios 1 0 0 4(7.4) 2(3.7) University of Ghana http://ugspace.ug.edu.gh 49 CHAPTER FIVE 5.0 DISCUSSION 5.1 Efficiency of methods used in parasite detection and identification Two diagnostic methods, Microscopy and Polymerase Chain Reaction (PCR) were used in the detection and identification of avian malaria parasites of the genera Plasmodium and Haemoproteus. The result of this study conforms to other results and conclusions regarding lower sensitivity of microscopy in comparison to the PCR-based methods in determining the prevalence of avian malaria infections (Jarvi et al., 2002; Richards et al., 2002; and Durrant et al., 2006). Factors that could contribute to these discrepancies include low parasitaemia and differences, the use of poor quality blood films and too few microscopic fields examined (Jarvi et al., 2002). Few slides from the present study contained haemolyzed blood cells, which indicate insufficient desiccation, or fixation of blood films, or both, in the field. The results also correlates with the study by Valkiunas et al. (2008) that microscopic examination of poor quality blood films is an unreliable method of diagnosis. In conclusion, the present study agrees with previous studies, that concluded that the reliability of PCR does not only expose the insensitivity of microscopy, but also shows that blood films prepared for microscopic examination should be of good quality. The overall prevalence of haemosporidian blood parasites, as determined by microscopy was (23%). The difference in prevalence determined by PCR diagnostics (44%) and the combination of both methods (45.4%) was not significant. In few samples, microscopy was slightly more sensitive than PCR, and, in most samples, the opposite was true. The main shortcoming of microscopic examination of blood films is the low sensitivity in determining exceptionally light infections (1 parasite cell per 1000 microscopic fields) University of Ghana http://ugspace.ug.edu.gh 50 when just a few parasites are present in blood films (Valkiunas et al., 2008). Such light parasitaemia would be easily overlooked even with increased observation time (Valkiunas et al., 2008). The present study reported low levels of parasitaemia detected by microscopic examination ranging from 1-5 parasites per 1000 microscopic fields. This shortcoming coupled with the fact that, all blood stages of the parasites, important for morphospecies identification, were not available in the blood films, make it difficult to have clear identification of specific lineages. PCR-based methods are particularly attractive because they provide sequence information for phylogenetic and epidemiologic studies of parasites and for the diagnosis of parasitic disease (Jarvi et al., 2002; Perkins and Schall, 2002; Bensch et al., 2004). A problem with PCR, but unlikely with microscopy, is the risk of false positives. The present study tried to minimize this by running multiple negative controls however, some false positives can still go undetected. Microscopy also has an advantage in providing an opportunity to determine or verify the identity and intensity of infections. The combination of both methods revealed higher prevalence of the parasites. This agrees with the studies by Krone et al. (2008), which reported that the combination of diagnostic methods reveals higher prevalence of parasites in avian hosts. There is therefore the need to combine both microscopy and PCR in order to obtain proper estimates of prevalence. University of Ghana http://ugspace.ug.edu.gh 51 5.2 Parasite Prevalence in Forest and Savanna Birds The prevalence of avian malaria in some protected areas in Ghana has been confirmed in this study. The overall prevalence of 45.3% of the individuals infected with the blood parasites is closer to the overall prevalence of 48.2% recorded in Balmoral, Zambia (Pierce, 1984) and relatively higher than 22.2% reported for Ghana (Wink & Bennett, 1976) and 28.2% reported for Uganda. It is also higher than the reported prevalence of 28.2% for Uganda and 28.6% in some West African rainforests (Sehgal et al., 2005). A study by Wink and Bennett (1976) revealed that prevalence of blood parasites in birds from the tropical rainforest in the Bunso area in Ghana was similar to prevalence recorded in birds sampled in the savanna-urban area around Accra. However, the present study disagrees with the above results, thus reporting higher prevalence of blood parasites in the Kakum tropical rainforest than Shai Hills savanna area. The family ploceidae was the most heavily parasitized family that occurred in Kakum forest with an overall prevalence of 23.5%. This follows the trend that has been observed in many parts of Africa including Ghana (Wink & Bennett, 1976) and can be explained by their behavioural ecology. For example, P. nigerrimus and P. cucullatus, found to have high parasite prevalence are colonial breeders and cavity nesters. Previous study showed that colonial breeders are more susceptible to parasite infection than non-colonial breeders (Tella, 2002; Merino et al., 1999). The most occuring lineage recorded in this study was Plasmodium lineage PV1L. The fact that some lineages are more abundant than others may be due to the differential ability of the vectors to transmit some lineages better than others. Some vectors have the University of Ghana http://ugspace.ug.edu.gh 52 ability to transmit more than one parasite lineage, but they transmit some lineages more effectively than others (Alavi et al., 2003). Generally, the variation in blood parasite prevalences observed between host species and geographic locations could be explained by differences in their exposure to the insect vectors (Valkiunas, 2005). The present study reported that bird species from the Kakum National Park had high blood parasite prevalence. This is also because they share many qualities that would increase vector exposure such as cavity nesting and habitation of forested areas (Durrant et al., 2006) and bright plumage coloration (Scheuerlein et al., 2004). For example, P. niggerrimus and Zosterops senegalensis, found to have 11-100 parasites in 100 microscopic fields are forest birds with bright plumage coloration and also cavity nesters. Other factors that could affect parasite prevalence could include proximity to vector breeding sites, relative levels of host resistance, local temperature differences in the study sites and age of the hosts. Heavily infected individuals may also be under-sampled as observed by (Sehgal, 2005). 5.3 Habitat Effect The effect of habitat in the ecology of haemosporidian parasites cannot be ignored in the study of host-parasite relationship. There was a higher prevalence of infection with Plasmodium and Haemoproteus spp. in birds collected from Kakum National Park forest than in Shai Hills savanna resource reserve. Several factors may be responsible for this occurrence. Such factors include differences in vegetation cover, differences in rainfall, soil moisture and species composition of the avian hosts and their insect vectors. Vegetation density and structure could influence interactions between avian hosts and University of Ghana http://ugspace.ug.edu.gh 53 their insect vectors, thereby playing a role in the transmission and maintenance of parasite infections (Bonneaud et al., 2009). The sampling site in the Kakum National Park is forest vegetation at the edge of the conservation area and shares boundary with the Kakum National Park. This site is situated within residential and agricultural areas where human impacts may enhance the abundance of the dipteran insect vectors and dispersal into forest bird habitat. Some of the human activities provide micro-habitats that serve as larval habitat to the insect vectors. Forest disturbance such as deforestation and encroaching agriculture potentially increase vector abundance, thus, increasing disease transmission (Bonneaud et al., 2009). Moreover, the forested areas harbor a wide variety of vectors which implies high prevalence of the parasite (Durrant et al., 2006). On the contrary, Prevalence of Plasmodium spp. and Haemoproteus spp. in Shai Hills resource reserve was relatively low. One of the factors contributing to this is the low density vegetation of the savanna. This vegetation type reduces the breeding sites for dipteran insect vectors thereby reducing the level of parasite transmission to avian hosts. University of Ghana http://ugspace.ug.edu.gh 54 CHAPTER SIX 6.0 CONCLUSIONS AND RECOMMENDATIONS 6.1 CONCLUSIONS The prevalence of avian malaria parasites of the genera Plasmodium and Haemoproteus was assessed in Kakum National Park and Shai Hills resource reserve using traditional microscopy and a PCR-based method. The two diagnostic methods showed some discrepancies, however the combination of both methods gave a more credible estimate of parasite prevalence in the two wildlife protected areas. Parasite prevalence was higher (69.2%) in forest birds sampled in Kakum National Park compared to (12.9%) in savanna birds sampled in Shai Hills resource reserve. Due to light infections and absence of important blood stages observed in blood films, the parasites could not be identified morphologically. However, sequencing of 478bp of the mitochondrial cytochrome b gene revealed 11 Plasmodium lineages and 9 Haemoproteus lineages throughout the study. Generally, the study has shown a higher prevalence of Plasmodium spp. than Haemoproteus spp. in both forest and savanna birds. University of Ghana http://ugspace.ug.edu.gh 55 6.2 RECOMMENDATIONS The study of avian diseases is very limited in Ghana and this study can be considered as one of the baselines assessment of malaria in birds in Ghanaian protected areas. To consolidate the knowledge in this area to inform policy, the following recommendations are being made: 1. Future works on avian malaria and other haemosporidians should include a broader sampling of individual birds so as to have each species well represented as this will help in making realistic estimation of prevalence. 2. There is the need to increase the scope of the study to make conclusions more credible. 3. Seasonality should be factored into data collection so that parasite prevalence will be assessed both during the rainy and dry seasons. 4. Future works should expand the study to include intensity of parasite infection, host-specificity and genetic diversity of the lineages recovered. 5. There is also the need to carry out similar works in well-equipped laboratories for better microscopic and molecular analyses. REFERENCES University of Ghana http://ugspace.ug.edu.gh 56 Alavi, Y., Arai, M. & Mendoza, J. (2003). The dynamics of interactions between Plasmodium and the mosquito: a study of the infectivity of Plasmodium berghei and Plasmodium gallinaceum, and their transmission by Anopheles stephensi, Anopheles gambiae and Aedes aegypti. International Journal of Parasitology, 33, 933–943. Alley, M. R., Fairley, R. A., Martin, D.G., Howe, L. & Atkinson, T. (2008). An outbreak of avian malaria in captive yellow heads mohua (Mohoua ochrocephala). New Zealand Veterinary56, 247-251. Arriero, E., & Moller, A. P. (2008). Host ecology and life-history traits associated with blood parasite species richness in birds. Journal of Evolutionary Biology, 11, 1505– 1513. Atkinson, C. T. & Van Riper, C. III. (1991). Pathogenicity and epizootiology of avian haematozoa: Plasmodium, Leucocytozoon, and Haemoproteus. In: Bird-parasite interaction. Loye J. T. & Zuk M. (eds.). Oxford University Press, Oxford, U.K. 19- 48. Atkinson, C. T., Van Riper, C. III. Pathogenicity and epizootiology of avian haematozoa: Plasmodium, Leucocytozoon, and Haemoproteus. Barraclough, K. R., Duval, L., Talman, M. A., Ariey, I. & Robert, V. (2008). Attraction between sexes: male-female gametocyte behavior within a Leucocytozoon toddy (Haemosporida). Parasitology Research, 102, 1321-1327. Beadell S. J., Covas R., Gebhand C., Ishtiaq F., Melo M., Schmidt K. B., Perkins L. S., Graves R. G. & Fleischer C. R. (2008). Host association and evolutionary relationships of avian blood parasites. West Africa International Journal of parasitology University of Ghana http://ugspace.ug.edu.gh 57 Beadell, J. & Fleischer, R. (2005). A restriction enzyme-based assay to distinguish between avian haemosporidians. Journal of Parasitology 91, 683-685. Beadell, J. S., Gering, E., Austin, J., Dumbacher, J. P., Peirce, M., Pratt, T. K., Atkinson, C. T. and Fleischer, R. C. (2004). Prevalence and differential host-specificity of two avian blood parasite genera in the Australo-Papuan region. Molecular Ecology, 13, 3829-3844. Beadell, J. S., Ishtiaq, F., Covas, R., Melo, M., Warren, B. H., Atkinson, C. T., Bensch, S., Graves, G. R., Jhala, Y. V., Peirce, M. A., Rahmani, A. R., Fonseca, D. M. & Fleischer, R. C. (2006). Global phylogeographic limits of Hawaii’s avian malaria. Proceedings. Biological sciences / The Royal Society, 273, 2935-2944. Belo, N. O., Passos, L. F., Junior, L. M. C., Goulart, C. E., Sherlock, T. M & Braga, E. M. (2009). Avian malaria in captive psittacine birds: Detection by microscopy and 18S rRNA gene amplification. Journal of Veterinary Medicine, 88, 220-224. Bensch S., Perez-Tris, J., Waldenstrom, J. & Hellgren, O. (2004). Linkage between nuclear and mitochondrial DNA sequences in avian malaria parasites: Multiple cases of cryptic speciation? Evolution, 58, 1617-1621. Bensch, S., Stjernman, M., Hasselquist, D., Ostman, O., Hansson, B., Westerdahl, H. & Pinheiro, R. T. (2000). Host specificity in avian blood parasites: A study of Plasmodium and Haemoproteus mitochondrial DNA amplified from birds. Proceedings. Biological sciences / The Royal Society, 267, 1583-1589. University of Ghana http://ugspace.ug.edu.gh 58 Bensch, S., Waldenstrom, J., Jonzen, N., Westerdahl, H., Hansson, B., Sejberg, D. & Hasselquist, D. (2007).Temporal dynamics and diversity of avian malaria parasites in a single host species. Journal Animal Ecology, 76, 112-122. Bensch, Staffan, & Åkesson, S. (2003). Temporal and spatial variation of hematozoans in Scandinavian willow warblers. Journal of Parasitology, 89(2), 388–391. Retrieved fromhttp://www.journalofparasitology.org/perlserv/?requestgetabstract&doi=1 0.1645/0022-3395(2003)089[0388:TASVOH]2.0.CO;2 Bensch, Staffan, Hellgren, O., & Pérez-Tris, J. (2009). MalAvi: a public database of malaria parasites and related haemosporidians in avian hosts based on mitochondrial cytochrome b lineages. Molecular ecology resources, 9(5), 1353–1358. doi:10.1111/j.1755-0998.2009.02692.x Bishop, M. A. & Bennett, G. F. (1992). Host-parasite catalogue of the avian haematozoa: supplement 1; Bibliography of the avian blood inhabiting haematozoa: supplement 2. Mem Univ Newfoundl and Occas Pap Biology, 15, 1-244. Bonneaud, C., Perez-Tris, J., Federici, P., Chastel, O. & Sorci, G. (2006). Major histo compatibility alleles associated with local resistance to malaria in a passerine. Evolution 60(2), 383-389. Bonneaud, C., Sepil, S., Milà, B., Buermann, W., Pollinger, J., Seghal, R. N. M., Valkiunas, G., Lezhova, A. T., Saatchi, S. & Smith, T. B. (2009). The prevalence of avian Plasmodium is higher in undisturbed tropical forest of Cameroon. Journal of Tropical Ecology 25,439-447. Cambridge University press, UK. University of Ghana http://ugspace.ug.edu.gh 59 Borrow, N. and Demey, R. (2005). Birds of Western Africa. Princeton University Press, Princeton. Braga, M. E., Silveira, P., Belo, O. N. and Valkiunas, G. (2011). Recent advances in the study of avian malaria: an overview with an emphasis on the distribution of Plasmodium spp. in Brazil. Mem Inst Oswaldo Cruz, Rio de Janeiro, 106(1), 3-11. Cardona, C. J., Ihejirika, A. & Mcclellan, L. (2002).Haemoproteus lophortyx infection in bobwhite quail. Avian Diseases, 46,249-255. Chasar, A., Loiseau, C., Valkiunas, G., Iezhova, T., Smith, B. T. and Seghal, N. M. R. (2009). Prevalence and diversity patterns of avian blood parasites in degraded African rainforest habitats. Molecular ecology, 18, 4121- 4133. Cheesbrough, M. (2000). Protozoology. District laboratory practice in tropical countries. Low-price edition, UK. 1, 134-140. Cosgrove, C. L., Wood, M. J., Day, K. P. & Sheldon, B. C. (2008). Seasonal Variation in Plasmodium prevalence in a population of blue tits Cyanistes caeruleus. Journal of Animal Ecology, 77, 540-548. Dronamraju, K. R. ed. (2004). Infectious Disease and Host-pathogen Evolution. Cambridge University Press, Cambridge. Durran, K. L., Beadell, J S., Ishtiaq, F., Graves, G.R. & Olson, S.L. (2006). Avian hematozoa in South America: a comparison of temperate and tropical zones. Journal of Ornithology, 60, 98–111. University of Ghana http://ugspace.ug.edu.gh 60 Escalante, A. A., Freeland, D. E., Collins, W. E. & Lal, A. A. (1998). The evolution of primate malaria parasites based on the gene encoding cytochrome b from the linear mitochondrial genome. Proceedings. National Academy of Science, 95, 8124-8129. Fallon, S. M., Bermingham, E. & Ricklefs, R. E. (2005). Host specialization and geographic localization of avian malaria parasites: A regional analysis in the Lesser Antilles. American Naturalist, 165, 466-480. Fallon, S. M., Ricklefs, R. E., Swanson, B. L. & Bermingham, E. (2003).Detecting avian malaria: an improved Polymerase Chain Reaction diagnosis. Journal of Parasitology, 89(5), 1044-1047. Feldman, R. A., Freed, L. A. & Cann, R. L. (1995). A PCR test for avian malaria in Hawaiian birds. Molecular Ecology, 4,663–673. Feldman, R. A., Freed, L. A. and Cann, R. L. (1995). A PCR test for avian malaria in Hawaiian birds. Journal of Molecular Ecology, 4, 663-673. Forrester, D. J. & Spalding, M. G. (2003). Parasites & diseases of wild birds in Florida. University Press of Florida, Gainesville, Florida, 1133. Grim, K. C., McCutchan, T., Li, J., Sullivan, M., Graczyk, T. K., McConkey, G. & Cranfield, M. (2004). Preliminary results of an anti-circumsporozoite DNA vaccine trial for protection against avian malaria in captive African black-footed penguins (Spheniscus demersus). Journal of Zoological Wildlife Medicine, 35, 154-161. Gustafsson, L., Nordling, D., Andersson, M. S., Sheldon, B. C. & Qvarnstrom, A. (1994). Infectious diseases, reproductive effort and the cost of reproduction in birds. Proceedings. Biological sciences / The Royal Society, 346, 323-331. University of Ghana http://ugspace.ug.edu.gh 61 Hellgren, O., Krizanauskiene, A., Valkiunas, G. & Bensch, S. (2007). Diversity and phylogeny of mitochondrial cytochrome b lineages from six morphospecies of avian Haemoproteus (Haemosporida, Haemoproteidae). Journal of Parasitology, 93, 889- 896. Hellgren, O., Waldenstrom, J. & Bensch, S. (2004). A New PCR Assay for Simultaneous Studies of Leucocytozoon, Plasmodium, and Haemoproteus from avian blood. Journal of Parasitology, 90(4), 797-802. Hudson, P. J., Dobson, A. P. & Newborn, D. (1998). Prevention of population cycles by parasite removal. Science, 282, 256-258. Jaenike, J. (1978). A hypothesis to account for the maintenance of sex within populations. Evolutionary Theory, 3, 191-194. Jourdain, E., Gauthier-Clerc, M., Bicout, D. J., & Sabatier, P. (2007). Bird migration routes and risk for pathogen dispersion into western Mediterranean wetlands. Emerging Infectious Diseases, 13, 365-372. Kilpatrick, A. M., Kramer, L. D., Jones, M. J., Marra, P. P. & Daszak, P. (2006). West Nile virus epidemics in North America are driven by shifts in mosquito feeding preferences. PLoS Biol. 4, e82. doi:10.1371/journal.pbio.0040082. Kim, K. S. & Tsuda, Y. (2010). Seasonal changes in feeding pattern of Culex pipiens pallens govern transmission dynamics of multiple lineages of avian malaria parasite in Japanese wild bird community. Journal of Molecular Ecology, 19, 5545-5554. Knowles, S. C. L., Palinauskas, V. & Sheldon, B. C. (2010). Chronic malaria infections increase family inequalities and reduce parental fitness: experimental evidence from a wild bird population. Journal of Evolutionary Biology, 23, 557-569. University of Ghana http://ugspace.ug.edu.gh 62 Knowles, S. C. L., Wood, M. J. & Sheldon, B. C. (2010). Contest dependent effects of parental effort on malaria infection in a wild bird population, and their role in reproductive trade-offs. Oecologia, 164, 87–97. Krizanauskiene, A., Hellgren, O., Kosarev, V., Sokolov, L., Bensch, S. & Valkiunas, G. (2006). Variation in host specificity between species of avian haemosporidian parasites: Evidence from parasite morphology and cytochrome b gene sequences. Journal of Parasitology, 92, 1319-1324. Lively, C. M. & Dybdahl, M. F. (2000). Parasite adaptation to locally common host genotypes. Nature, 405, 679-681. Martinsen, E. S., Perkins, S. L. & Schall, J. J. (2008). A three-genome phylogeny of malaria parasites (Plasmodium and closely related genera): Evolution of life-history traits and host switches. Molecular Phylogenetics and Evolution 47, 261-273. Marzal, A., de Lope, P., Navarro, C. & Moller, A. P. (2005). Malarial parasites decrease reproductive success: an experimental study in a passerine bird. Oecologia, 142, 541-545. McCurdy, D. G., Shutler, D., Mullie, A. & Forbes, M. R. (1998). Sex-biased parasitism of avian hosts: relations to blood parasite taxon and mating system. Oikos, 82, 303- 312. Mccurdy, D. G., Shulter, D., Mullie, A. & Forbes, M. R. (1998). Sex biased parasitism of avian hosts: Relations to blood parasite taxon and mating system. Oikos, 82, 303– 312. University of Ghana http://ugspace.ug.edu.gh 63 Merino, S., Moreno, J., Sanz, J. J. & Arreiro, E. (2000). Are avian blood parasites pathogenic in the wild? A medication experiment in blue tits (Parus caeruleus). Proceedings of the Royal Society B: Biological Sciences, 267, 2507-2510. Miura, O., Kuris, A. M., Torchin, M. E., Hechinger, R. F. & Chiba, S. (2006). Parasites alter host phenotype and may create a new ecological niche for snail hosts. Proceedings of the Royal Society B: Biological Sciences, 273, 1323-1328. Moller, A. P. & Nielsen, J. T. (2007). Malaria and risk of predation: a comparative study of birds. Journal of Ecology, 88, 871-881. Møller, A. P. & Nielsen, J. T. (2007). Malaria and risk of predation: a comparative study of birds. Ecology, 88,871–881. Mouritsen, K. N. & Poulin, R. (2005). Parasites boost biodiversity and changes animal community structure by trait-mediated indirect effects. Oikos, 108, 344-350. Murata, K. (2002). Prevalence of blood parasites in Japanese wild birds. Journal of Veterinary Medicine, 64,785-790. Njagbo, Y. K., Cornel, J. A., Seghal, N. M. R., Loiseau, C., Buermann, W., Harrigan, J. R., Pollinger J., Valkiunas, G. & Smith, B. T. (2009). Coquilletidia (Culicidae, Diptera) mosquitoes are natural vectors of avian malaria in Africa. Malaria Journal, 8, 193. Nordling, D., Anderson, M., Zohari, S. & Gustafsson, L. (1998). Reproductive effort reduces specific immune response and parasite resistance. Proceedings of the Royal Society B: Biological Sciences, 265, 1291-1298. University of Ghana http://ugspace.ug.edu.gh 64 Olias, P., Wogelin, M., Zenkor, W., Freter, S., Gruber, A.D. & Klopfleich, R. (2011). Avian Malaria deaths in parrots, Europe. Journal of Emerging Infectious diseases, 17(5):950-952. Ortego, J. I. N., Aparicio, J. M., Calabuig, G. & Cordero, P. J. (2007). Risk of ectoparasitism and genetic diversity in a wild lesser kestrel population. Journal of Molecular Ecology, 16, 3712-3720. Ostfeld, R. S., Keesing, F. & Eviner, V. T. (2008). Infectious Disease Ecology - Effects of Ecosystems on Disease and of Disease on Ecosystems. Princeton University Press, Princeton, NJ, USA. Palinauskas, V., Valkiunas, G., Bolshakov, C. V. & Bensch, S. (2008). Plasmodium relictum (lineage P-SGS1): effects on experimentally infected passerine birds. Experimental Parasitology, 120, 372-380. Palinauskas, V., Valkiunas, G., Krizanauskiene, A., Bensch, S. & Bolshakov, C. V. (2009). Plasmodium relictum (lineage P-SGS1): further observation of effects on experimentally infected passeriform birds, with remarks on treatment with Malarone™. Experimental Parasitology, 123, 134-139. Parker, P. G., Whiteman, N. K. & Miller, E. (2006) Conservation medicine on Galápagos Islands: partnership among behavioral, population, and veterinary scientists. Auk, 123, 625-638. Peirce, M. A. (1984). Hematozoa of Zambian birds. Journal of Natural History, 18, 105– 122. Pérez-Tris, J. & Bensch, S. (2005). Diagnosing genetically diverse avian malaria infections using mixed-sequence analysis and TA cloning. Journal of Parasitology, 131, 1-9. University of Ghana http://ugspace.ug.edu.gh 65 Perez-Tris, J., Hasselquist, D., Hellgren, O., Krizanauskiene, A., Waldenstrom, J. and Bensch, S. (2005). What are malaria parasites? Trends Parasitology, 21, 209-211. Richner, H., Christe, P. & Oppliger, A. (1995). Paternal investment affects prevalence of malaria. Proceedings of the National Academy of Sciences of the United States of America, 92, 1192-1194. Richner, H., Christe, P. & Oppliger, A. (1995). Paternal investment affects prevalence of malaria. Proceedings of the National Academy of Sciences, USA, 92, 1192–1194. Ricklefs, R. E. & Fallon, S. M. (2002). Diversification and host switching in avian malaria parasites. Proceedings of the Royal Society B: Biological Sciences, 269, 885-892. Ricklefs, R. E. (1992). Embryonic development period and the prevalence of avian blood parasites. Proceedings of Royal Society of London B Biological Sciences, 89, 4722– 4725. Ricklefs, R. E. (2008). Community relationships of avian malaria parasites in southern Missouri. EcolMonogr, 75, 543-559. Ricklefs, R. E. (2010). Evolutionary diversification, coevolution between populations and their antagonists, and the filling of niche space. Proceeding of the National Academy of Sciences, USA, 107, 1265-1272. Ricklefs, R. E., Fallon, S. M. & Bermingham, E. (2004). Evolutionary relationships, cospeciation, and host switching in avian malaria parasites. Systematic Biology, 53, 111-119. Ricklefs, R. E., Fallon, S. M., Latta, S. C., Swanson, B. L. & Bermingham, E. (2005). Migrants and their parasites: a bridge between two worlds. In: Greenberg, R. & University of Ghana http://ugspace.ug.edu.gh 66 Marra, P. P. (Eds.), Birds of Two Worlds: The Ecology and Evolution of Migrants. The Johns Hopkins University Press, Baltimore, 210-221. Ricklefs, R. E., Swanson, B. L., Fallon, S. M., Martinez-Abrain, A., Scheuerlein, A., Gray, J. & Latta, S. C. (2007). Community relationships of avian malaria parasites in southern Missouri. Ecol. Monogr, .75, 543-559. Rintamäki, P. T., Ojanen, W., Pakkala, H., & Tynjälä, M. (1998). Blood parasites of migrating willow warblers (Phylloscopus trochilus) at a stopover site. Canadian Journal of Zoology, 76, 984–988. Scheuerlein, A. & Ricklefs, R. E. (2004). Prevalence of blood parasites in European passerine birds. Proceedings of the Royal Society B: Biological Sciences, 271, 1363- 1370. Schrenzel, M. D., Maalouf, G. A., Keener, L. L. & Gaffney, P M. (2003). Molecular characterization of malarial parasites in captive passerine birds. Journal of Parasitology, 89, 1025-1033. Seghal, R. N. M., Jones, H. I. & Smith, T. B. (2005). Blood Parasites of some West African Rainforest Birds. Journal of Veterinary Science, 67(3), 295-301. Sehgal, R .N. M., Hull, A. C., Anderson, N. L., Valkiunas, G., Markovets, M. J., Kawamura, S. and Tell, L. A. (2006). Evidence for cryptic speciation of Leucocytozoon spp. (Haemosporida, Leucocytozoidae) in diurnal raptors. Journal Parasitology, 92, 375-379. Sheldon, B. C. & Verhulst, S. (1996). Ecological immunology: costly parasite defenses and trade-offs in evolutionary ecology trends. Ecological Evolution, 11, 317-321. University of Ghana http://ugspace.ug.edu.gh 67 Sheldon, B. C., &. Verhulst, S. (1996). Ecological immunology: Costly parasite defenses and trade-offs in evolutionary ecology. Trends in Ecology and Evolution, 11, 317– 321. Spurgin, L. G. & Richardson, D. S. (2010). How pathogens drive genetic diversity: MHC, mechanisms and misunderstandings. Proceedings of Royal Society of London B Biological Sciences, 277, 979-988. UICN/PACO, (2010).Parks and reserves of Ghana: Management effectiveness assessment of protected areas. Ouagadougou, BF: UICN/PACO. Valkiunas, G. (1993). Phatogenic influence of haemosporidians and trypanosomes on wild birds in the field conditions: Facts and hypothesis. Ecologia, 1, 47-60. Valkiunas, G. (2005). Avian malaria parasites and other haemosporidia. CRC Press, Boca Raton, Florida, USA. Valkiunas, G., & Iezhova, T.A. (2001). A comparison of the blood parasites in three subspecies of the Yellow wagtail Motacilla flava. Journal of Parasitology, 87, 930- 934. Valkiunas, G., Anwar, A. M. & Atkinson, C. T. (2005). What distinguishes malaria parasites from other pigmented haemosporidians? Trends in Parasitology, 21, 357- 358. Valkiunas, G., Iezhova, T. A. & Shapoval, A. P. (2003). High prevalence of blood parasites in hawfinch Coccothraustes coccothraustes. Journal of Natural History, 37, 2647-2652. University of Ghana http://ugspace.ug.edu.gh 68 Valkiunas, G., Iezhova, T. A., Krizanauskiene, A., Palinauskas, V., Sehgal, R. N. M. & Bensch, S. (2008). A comparative analysis of microscopy and PCR-based detection methods for blood parasites. Journal of Parasitology, 94, 1395-1401. Valkiunas, G., Iezhova, T. A., Loiseau, C., & Ravinder, .N.M.S., (2009). Sporozoites of Hemosporidian Parasites in Peripheral Blood of Naturally Infected Birds. Journal of Parasitology, 95(6): 1512-1515. Valkiunas, G., Iezhova, T. A., Loiseau, C., Chasar, A., Smith, T. B. & Sehgal, R. N. M. (2008). New species of haemosporidian parasites (Haemosporida) from African rainforest birds, with remarks on their classification. Research Parasitology, 103, 1213-1228. Valkiunas, G., Krizanauskiene, A., Iezhova, T. A., Hellgren, O. & Bensch, S. (2007). Molecular Phylogenetic Analysis of Circumnuclear Hemoproteids (Haemosporida: Haemoproteidae) of Sylviid Birds, With A Description of Haemoproteus Parabelopolskyi Sp. Nov. Journal of. Parasitology. 93(3):680-687. Valkiunas, G., Sehgal, R. N. M., Iezhova, T. A. & Smith, T. B. (2005). Further observations on the blood parasites of birds in Uganda. Journal of Wildlife Disease, 41, 580-587. Valkiunas, G., Zehtindjiev, P., Hellgren, O., Ilieva, M., Iezhova, T. A. & Bensch, S. (2007). Linkage between mitochondrial cytochrome b lineages and morphospecies of two avian malaria parasites, with a description of Plasmodium (Novyella) ashfordi sp. Parasitology Research. University of Ghana http://ugspace.ug.edu.gh 69 Waldenstrom, J., Bensch, S., Hasselquist, D. & Ostman, O. (2004). A new nested polymerase chain reaction method very efficient in detecting Plasmodium and Haemoproteus infections from avian blood. Journal of Parasitology, 90, 191-194. Waldenstrom, J., Bensch, S., Kiboi, S., Hasselquist, D. & Ottosson, U. (2002). Cross- species infection of blood parasites between resident and migratory songbirds in Africa. Journal of Molecular Ecology, 11, 1545-1554. Westerdahl, H., Waldenstrom, J., Hansson, B., Hasselquist, D., Von Schantz, T. & Bensch, S. (2005). Associations between malaria and MHC genes in a migratory songbird. Proceedings. Biological sciences / The Royal Society, 272, 1511-1518. Wilson, K., Bjornstad, O. N., & Dobson, A. P. (2001). Heterogeneities in macroparasite infections: patterns and processes. In: The Ecology of Wildlife Diseases. Hudson, P. J., Rizzoli, A., Grenfell, B. T., Heesterbeek, H. & Dobson, A. P. (eds). Oxford University Press, Oxford, UK. Wink, M. & Bennett, G. F. (1976). Blood parasites of some birds from Ghana. Journal of Wildlife Diseases, 12, 587–590. Wood, M. J., Cosgrove, C. L., Wilkin, T. A., Knowles, S. C. L., Day, K.P., & Sheldon, B.C. (2007). Within-population variation in prevalence and lineage distribution of avian malaria in blue tits, Cyanistes caeruleus . Molecular Ecology, 16, 3263-3273. University of Ghana http://ugspace.ug.edu.gh 70 APPENDICES APPENDIX I Sample information (Shai Hills) Common name Scientific name Infection African pygmy kingfisher Ceyx pictus - Veillot's barbet Lybius vieilloti + Blue-spotted wood dove Turtur afer + Forked-tail drongo Dicrurus adsimilis - Yellow-fronted tinkerbird Pogoniulus chrysoconus + White-throated bee-eater Merops albicollis - Pied flycatcher Ficedula hupoleuca + Pale flycatcher Bradornis pallidus + Stone patridge Ptilopachus petrosus - Buff-spotted wood pecker Campethera nivosa + Common wattle eye Platysteira cyanea - Grey-headed bristle bill Bleda canicapillus - Simple leaflove Chlorocichla simplex - Yellow-throated leaflove Chlorocichla flavicollis - Common bulbul Pycnonotus barbatus - Violet-backed starling Cynnyricinclus leucogaster - Snowy crowned robin chat Cossypha niveicapilla + African thrush Turdus pelios - University of Ghana http://ugspace.ug.edu.gh 71 APPENDIX II Sample information (Kakum National Park) Common name Scientific name Infection Olive sunbird Cyanomitra olivacea + Olive-bellied sunbird Cinnyris chloropygius + Collard sunbird Hedydipna collaris - Blue-throated brown sunbird Cyanomitra cyanolaema + Green crombec Sylvietta virens + Dusky-blue flycatcher Muscicapa comitata + Red-bellied paradise flycatcher Terpsiphone viridis - Grey-backed camaroptera Camaroptera brachyura + Red-faced cisticola Cisticola erythrops - Little greenbul Andropadus virens + Yellow whiskered greenbul Andropadus latirostris - Red-tailed greenbul Criniger calurus - Western blue-bill Spermophaga haematina + Chestnut-breasted negrofinch Nigrita bicolor + Vieillot’s black weaver Ploceus nigerrimus + Village weaver Ploceus cucullatus + Black-necked weaver Ploceus nigricollis - Blue-billed malimbe Malimbus nitens + Crested malimbe Malimbus malimbicus + Tambourine dove Turtur tympanistria - White-throated bee-eater Merops albicollis + African pygmy kingfisher Ceyx pictus + Yellow white-eye Zosterops senegalensis + University of Ghana http://ugspace.ug.edu.gh 72 APPENDIX III Nucleotide Sequences Plasmodium sp. WA6 CAACTGGTGCTTCATTTGTATTTATTTTAACTTACTTACATATATTAAGAGGAT TAAATTATTCATATTCATACTTACCTTTATCATGGACATCTGGATTAATTATAT TTTTAATATCTATAGTAACAGCTTTTATGGGTTACGTATTACCTTGGGGTCAA ATGAGTTTTTGGGGTGCTACTGTAATTACTAATTTATTATATTTTATACCTGGA CTTGTTTCATGGATATGTGGTGGATATCTTGTAAGTGACCCAACCTTAAAAAG ATTCTTTGTATTACATTTTACATTTCCATTTATAGCTTTATGTATTGTATTTATA CATATATTCTTTTTACATTTACAAGGTAGCACAAATCCTTTAGGGTATGATAC AGCTTTAAAAATACCCTTCTATCCAAATCTTTTAAGTCTTGATATCAAAGGAT TCAATAATGTATTAGTATTATTTTTAGCACAAAGTTTATTTGGAATATT Haemoproteus sp. – WAH36 CTACAGGTGCAACCTTTGTATTTATTTTAACTTATTTACATATATTAAGAGGAT TAAACTATTCATATTTCTTATTTACCTTTATCATGGATAACTTGGATTAGTAAT ATTTCTTAATATCTATTTGTTACCGCTTTTATTGGGTTATGTATTACCTTGGGG TCAAATGAGTTTCTGGGGTGCAACTGTTATTACTAATTTATTATACTTTATACC TGGACTTGTTTCATGGATTTGTGGTGGATATACTATTAGCGATCCAACTTTAA AAAGATTTTTTGTATTACATTTTATATTTCCTTTTGTAGCTTTATGTATTGTATT TATACATATATTCTTCTTACACTTACAAGGTAGCTCTAATCCTTTAGGATATGA TACAGCTTTAAAAATACCTTTCTATCCGAAGTCTATTATGTCTAGATATCAGA AGGATTTAATAACGTATTAGTCATATTTCTAGCACAAAGTTTATTTGGAATTC TACCTTATCCTCCAGAAATATTGAAACNGGAANN University of Ghana http://ugspace.ug.edu.gh 73 Plasmodium sp. OZ45_MEX19 CAACAGGTGCTTCATTTGTTTTCATTTTAACCTATTTACATATTTTAAGAGGAT TAAATTACTCATATTCATATTTACCTTTATCATGGATTTCAGGATTATTAATAT TTTTAATATCCATAGTTACTGCCTTTTATGGGTTATGTATTACCATTGGGGTCA AATGAGTTTCTGGGGTGCTACAGCTTATAACTAACTTATTATATTTTATACCA GGACTTGTCTCATGGATTTGTGGTGGATATCTTGTAAGTGACCCAACCTTAAA AAGATTTTTTGTATTACATTTTACATTCCCATTTATAGCTTTATGTATTGTATTC ATACATATATTCTTCTTACATTTACAAGGTAGCACAAATCCTTTAGGGTATGA TACAGCTTTAAAGATACCCTTCTATCCAAATTTATTAAGTCAGAGATAATAAA GGATTTAATAATGTATTAGTTTTATTCTTATCTCAAAGTTTATTTGGAATTTTA CCATTATCACATCAGCATAATGCACTN Plasmodium sp. PV1L AGAAGGAGATAACGGGATGATATATGTACTTACCTATTTACATATTTTACCAC GAGTAAATTACTCATATTCGTATTTACCTTTATCATGGATATCAAGATTAATA ATATTTTTAATATCAATAGTAACTGCTTTTATGGGATATGTAGTACCTTGGGG TCAAATGAGTTTTTGGGGTGCAACCGTTATTACTAACTTATTATACTTTATACC TGCTCTTGTTTCATGGATTTGTGGTGGATATCTTGTTAGTGACCCAACATTAAA AAGATTTTTTGTATTACCTTTCATATTTCCACTGATTGCTACGTATATTGAATT TATACATGAATGTTGGCTACATAGCCAAAACCGGGAGGATCGTTCAAGTGAT GATACGCCTGCATCCAAAGCACAAGTTCCCTGAACAAGCCTGAATTCCATAG ATGTCGGGGAGGGGGCAGGGGGGGAATATTATTACCATGACGTTTAGTTTGA AGGAAGCTGTTACCTACAGGAGACACATAAGGCAACTACTGCCCTCAGATTC CCAAAGAGCATTTCCTTTATCAGATACAAGGAGTACTCTCAAAATTC University of Ghana http://ugspace.ug.edu.gh 74 Plasmodiumsp.Plascoq12 AAATGTGAATAACGGCAGATAAATGTACTTCACTATTTACATATTTTAACGAA GATTAAATTACTCATATTCATATATTACCTCTTATCACGAGATATCACAGTATT AATAATATTTTTAATATCACTAGTAACTGCGTTTATGAGATATGTATTACCTTG TGGTCACATGAGTTTTTGGGGTGCGCCCCTGATTACTAACTTATTATACTTTAT ACCCGGGCATGTGTCATCATGGTATGTGGGGGAGATCTCGTGAAAGAGACCC CACTTTAAAAAGATTTTGTAGTACTACATTTTACATTCCCATATCAGATCTTTA AGTATTAGTATTTATACATATATTCTTTCTACATTTACAAGGCAGCACTAATCC TTTAGGGGATGATACAGCTCTAAAAACACCCTTCTATCCAAATCTTTTAAGTC TCGATATTAAAGGATTTAATAATGTATTAGTATTATTCTTATCACAAAGTTTAT TTGGAATATT Haemoproteus sp. VILWE1 CTACTGGTGCTACATTTGTATTTATTCTAACTTATCTACATATTTTAAGAGGAT TAAACTATTCATATTCTTATTTACCTCTATCATGGATATCTAGGATTATTAATA TTCTTAATTTCTATTGTTACCGCTTTTATGGGTTATGTATTACCTTGGGGTCAA ATGAGTTTCTGGGGTGCAACCGTTATAACTAATTTATTATATTTTATACCTGG ACTTGTTTCATGGATTTGTGGAGGATATACTATTAGTGATCCAACTTTAAAAA GATTTTTTGTATTACATTTTATATTTCCATTTATAGCTTTATGTATTGTATTTAT TCATATATTCTTCTTACACTTACAAGGTAGCTCTAATCCTTTAGGATATGATAC AGCTTTAAAAATACCTTTCTATCCAAGTCTATTATGTCTAGATATTAAAGGAT TTAATAATGTATTAGTCCTATTTCTAGCGCATAGTTAATTTGGAATTCT University of Ghana http://ugspace.ug.edu.gh 75 APPENDIX IV Haemoproteus and Plasmodium lineages and their Genbank accession numbers Parasite Lineage GenBank number Haemoproteus sp. WAH36 EU810737 Haemoproteus sp. VILWE1 DQ847181 Haemoproteus sp. WAH34 EU810732 Haemoproteus sp. NA15BRCO GQ395665 Haemoproteus sp. LIN18A JN661945 Haemoproteus sp. LIN8A JN661931 Haemoproteus sp. HV42 HQ386241 Haemoproteus sp. L-PFC1 DQ630004 Haemoproteus sp. SYBOR1.SPAIN KC682871 Plasmodium sp. WA6 EU810661 Plasmodium sp. OZ45_MEX19 HM222481 Plasmodium sp. PV1L FJ404709 Plasmodium sp. Plascoq12 HM179155 Plasmodium sp. LIN3A EF380115 Plasmodium sp. WA22 EU810646 Plasmodium sp. P31 DQ839061 Plasmodium sp. WA16 EU810620 Plasmodium sp. PV11 GQ150193 Plasmodium sp. COLL7 DQ368376 Plasmodium sp. WA45 EU810630 University of Ghana http://ugspace.ug.edu.gh 76 APPENDIXV Sensitivity and specificity of diagnostic tests PCR screening * microscopic examination Cross tabulation microscopic examination Total negative positive PCR screening negative Count 72 2 74 % within PCR screening 97.3% 2.7% 100.0% % within microscopic examination 70.6% 6.7% 56.1% positive Count 30 28 58 % within PCR screening 51.7% 48.3% 100.0% % within microscopic examination 29.4% 93.3% 43.9% Total Count 102 30 132 % within PCR screening 77.3% 22.7% 100.0% % within microscopic examination 100.0% 100.0% 100.0% University of Ghana http://ugspace.ug.edu.gh 77 APPENDIX VI Protocol for DNA Extraction from avian blood (1) Add 10µl of whole blood into a labeled 1.5mL microcentrifuge tube. (2) Add 200µl of Avian Phosphate Buffered Solution (PBS) to each sample (see below for avian PBS recipe). (3) Add 20µl Proteinase K to each sample and mix by vortexing for 5-15 seconds. (4) Add 200µl of Buffer AL and mix by vortexing for 5-15 seconds. Incubate the samples at 50˚C for 10 minutes. (5) Add 200µl of cold 100% ethanol to each sample and mix by vortexing for 5-15 seconds. (6) Transfer the mixture from Step 5 into the labeled spin columns and centrifuge at 8000 x gravity for 1 minute. Discard the tubes containing the flow through. (7) Add 500µl of Buffer AW1 to each spin column and centrifuge at 8000 x gravity for 1 minute. Discard the tube containing the flow through. (8) Add 500µl of Buffer AW2 to each spin column and centrifuge at 14,000 x gravity for 3 minutes. Discard the tube containing the flow through. (9) Put each spin column in a labeled microcentrifuge tube and discard the tube containing the filtrate. Add 200µl of Buffer AE to the spin column and incubate at room temperature for 1 - 5 minutes. Centrifuge at 8000 x gravity for 1 minute and discard the spin columns. Freeze the extracted DNA samples at -20˚C for future use. Avian blood University of Ghana http://ugspace.ug.edu.gh 78 produces the best quality DNA and only 1-3µL of DNA is required per 15µL PCR reaction. University of Ghana http://ugspace.ug.edu.gh