University of Ghana http://ugspace.ug.edu.gh RC848. H425 N57 THE BALME LIBRARY bite C.l G371250 3 0 6 9 2 L 0 0 7 3 2 1 9 5 University of Ghana http://ugspace.ug.edu.gh MOLECULAR DIAGNOSIS OF HEPATITIS C VIRUS IN GHANAIAN BLOOD DONORS By NICHOLAS ISRAEL NII-TREBI: 10074739 BSc (Ghana), 1998 September, 2002 University of Ghana http://ugspace.ug.edu.gh MOLECULAR DIAGNOSIS OF HEPATITIS C VIRUS IN GHANAIAN BLOOD DONORS By NICHOLAS ISRAEL NII-TREBI: 10074739 BSc (Ghana), 1998 This thesis is submitted to the University of Ghana, Legon in partial fulfillment of the requirement for the award of M.Phil degree in Biochemistry September, 2002 University of Ghana http://ugspace.ug.edu.gh DECLARATION I certify that the work described in this report was carried out by me at the Virology Unit, Noguchi Memorial Institute for Medical Research and the Biochemistry Department of the University of Ghana, Legon under the supervision of Prof. Alexander K. Nyarko, Dr. Yaa D. Osei and Dr. William K. Ampofo. SKF&'t 2d'- 3-0 - o r - 03, Nicholas Israel Nii-Trebi ................. D ate................................... Student Alexander K. Nyarko K. Ampofo Dr. Yaa D. Osei Supervisor Supervisor Supervisor University of Ghana http://ugspace.ug.edu.gh DEDICATION To my parents, Mr. & Mrs. Ebenezer Trebi. To my siblings, Caro, Ruth, Pat, Enock, Esther and to all members of the Great Family. University of Ghana http://ugspace.ug.edu.gh ACKNOWLEDGEMENTS I am sincerely grateful to the Lord God Almighty for His protection, provision and guidance for me throughout my graduate program. I acknowledge my indebtedness to my supervisors, Prof. Alexander K. Nyarko, Dr. William K. Ampofo, both of Noguchi Memorial Institute for Medical Research (N. M. I. M. R), and Dr. Yaa D. Osei of the Department of Biochemistry, University of Ghana, Legon, whose keen interest, selfless devotion, priceless contributions, very helpful criticisms and suggestions helped me to complete this thesis. My heartfelt appreciation goes to Dr. Koichi Ishikawa, Dr. Fukasawa, Dr. Kenzo Tokunaga, and Dr. Soturo Takeo, Japanese visiting scientists for the technical expertise and material support they placed at my disposal that made this work possible. I wish to thank all the lecturers of the Biochemistry Department, especially Dr. W. S. K. Gbewonyo, and the technical staff for their special assistance. I say a big thank you to my only colleague, Evelyn Y. Ugly-Kwame for her encouragement and support especially during the tough times. My warmest appreciation goes to Messrs Harry Asmah, Charles Brown, David Mensah, Victor Nuvor, Arthur Quarm, Mrs. Regina Apiah-Oppong, Mrs Anita Ghansa, all of the N. M. I. M. R, Mr. Emmanuel Lamptey of Oceanography Department of the University of Ghana, Legon and Mrs. Nancy Commodore for the co­ operation, love and essential contributions they offered during the period. Special thanks go to the Administration of the N. M. I. M. R for the permission granted me for the use of their facilities. To the Head of the Virology Unit of the N. M. I. M. R, Dr. Mubarak Osei- Kwasi, and all the members of staff of the Unit, I am very much grateful for their invaluable suggestions and contributions. Special appreciation is also due to the Head and staff of the National Blood Transfusion Service (N. B. T. S), Korle Bu Teaching Hospital especially Mr. Emmanuel Tetteh and Ms. Margaret Kumaka for their support during sample collection. To my friends, and those unnamed but who all helped in diverse ways to make the completion of this work possible, I say thank you and may God reward all your efforts. Finally, my warmest appreciation goes to all my dear family members who, due to concentration on this work, were denied my attention and services. May the Good Lord richly bless you all for your love, understanding and care. iv University of Ghana http://ugspace.ug.edu.gh TABLE OF CONTENTS DECLARATION ii DEDICATION iii ACKNOWLEDGEMENTS iv TABLE OF CONTENTS v LIST OF TABLES vii LIST OF FIGURES viii LIST OF ABBREVIATIONS ix ABSTRACT x CHAPTER ONE: INTRODUCTION AND LITERATURE REVIEW 1 1.1 INTRODUCTION 1 1.2 LITERATURE REVIEW 6 Genome Organization o f HCV 8 Replication Cycle o fH CV 10 Classification o fH CV 15 Genetic Variation in HCV 15 Geographical Distribution o fH CV Genotypes 16 Pathogenesis o fH CV 19 Clinical Significance ofHCV Infection 21 Stability and Detection o f HCV in Clinical Specimens 22 Diagnosis o fH CV 23 Role o f Genomic Heterogeneity in HCV Persistence and Vaccine Development 27 Clinical Significance o f HCV Genotypes 28 Genotyping o f HCV 29 Sequencing 32 CHAPTER TWO: MATERIALS AND METHODS 34 2.1 MATERIALS AND REAGENTS 34 2.2 METHODS 35 Sample Collection 35 Assays for Antibody to HCV 36 Particle Agglutination Assay 36 Enzyme Linked Immunosorbent Assay 37 HCV RNA Extraction from Plasma 38 Detection of HCV 39 V University of Ghana http://ugspace.ug.edu.gh Reverse Transcription-Polymerase Chain Reaction to Generate cDNA 39 Genotyping of HCV 41 PCR for Genotyping o f HCV 42 HCV cDNA Cloning and Sequencing 45 cDNA Extraction from Agarose Gel 45 Competent Cell Preparation 46 Ligation and Transformation 46 Miniprep Plasmid DNA Isolation and Purification 47 Largeprep Plasmid DNA Isolation and Purification 48 Restriction Enzyme Digestion 49 PCR for HCV cDNA Sequencing 49 Purification o f PCR Products 50 Sequencing Electrophoresis 50 CHAPTER THREE: RESULTS 52 Sample collection, serological testing and confirmation 52 Detection of HCV by PCR 53 Genotyping of HCV by PCR Using Type-specific Primers 55 Cloning 58 cDNA Nucleotide Sequences and Analyses 60 CHAPTER FOUR: DISCUSSION AND CONCLUSION 66 4.1 DISCUSSION 66 4.2 CONCLUSION 70 REFERENCES 72 APPENDICES 94 APPENDIX I: Restriction map of pCR 2.1 TOPO Vector 94 APPENDIX II: Complementary DNA sequence graph of Ghanaian HCV extract 95 VI University of Ghana http://ugspace.ug.edu.gh LIST OF TABLES Table 1: Primers used for HCV detection 41 Table 2: Oligonucleotide primers used for PCR, sequencing and genotyping 43 Table 3: HCV genotyopes and expected sizes in agarose gel electrophoresis 44 Table 4: Sources of sequence data for core region used for comparison with those obtained in this study 51 Table 5: Reactivity profiles for thirteen subjects positive for anti-HCV by the SERODIA particle agglutination (PA) assay, ELISA and by PCR 52 Table 6: Sequence identity matrix of four HCV cDNA clones from HCV positive specimens 60 v ii University of Ghana http://ugspace.ug.edu.gh 1 1ST OF FIGURES Fig. 1. Worldwide prevalence of anti-HCV among volunteer blood donors 7 Fig. 2: Organization of the hepatitis C virus genome and polyprotein cleavage products 9 Fig. 3: Hypothetical model of the HCV replication cycle 12 Fig. 4: Geographic distribution of HCV variants 17 Fig. 5: Electrophoretic mobility of HCV cDNA identified in donated blood specimens 53 Fig. 6: Electrophoresis patterns of PCR products from different genotyping systems 55 Fig. 7 : Semi-nested PCR products obtained from HCV infected samples for cloning 56 Fig. 8: Agarose gel electrophoresis of recombinant DNA (rDNA) purified from cultured bacterial colonies 58 Fig. 9: Eco RI digestion of DNA clones purified from cultured colonies of transformed E. coli 59 Fig. 10. Core nucleotide sequences of HCV cDNA 61 Fig. 11. Phylogenetic tree of HCV core cDNA sequences 65 v iii University of Ghana http://ugspace.ug.edu.gh LIST OF ABBREVIATIONS AMV Avian myeloblastosis virus E as in El, E2 denotes envelope glycoprotein HAV Hepatitis A virus HBV Hepatitis B virus HCV Hepatitis C virus a-IFN Alpha interferon IRES Internal ribosomal entry site M-MuLV Moloney murine leukemia virus NS as in NS3, NS4, etc denotes Non-structural protein PBMC Peripheral blood mononuclear cells RdRp RNA-dependent RNA polymerase RIBA-3 Third generation recombinant immunoblot assay RT-PCR Reverse-transcriptase polymerase chain reaction 5'UTR / 5'NCR 5'-Untranslated region / 5'-Noncoding region ix University of Ghana http://ugspace.ug.edu.gh ABSTRACT The geographical distribution of different types and subtypes and the prevalence of hepatitis C virus (HCV) vary significantly. Identification of HCV genotypes has become increasingly important for the clinical management and prognosis of HCV infections. Available evidence shows that HCV is endemic in West Africa, but there is little data on HCV genotypes present in Ghana. This study therefore set out to identify circulating HCV genotypes in healthy Ghanaians and determine the relationship to genotypes from other geographical regions. Plasma were obtained from 200 blood donors in the year 2002 and tested for antibodies against HCV. RNA was extracted from anti-HCV-positive sera and reverse-transcribed into cDNA. The cDNA preparations were subjected to nested and semi-nested PCR to amplify 5’-untranslated region (5’UTR) and the core sequences, respectively. Nested PCR was then used to identify HCV genotypes using type-specific primers. Semi-nested PCR amplified core sequences were cloned into a TOPO vector (Appendix I). The clones were transformed into E. coli cells and cultured; DNA was purified from the cells and sequenced. HCV cDNA sequences were analysed and compared for intra- and inter­ donor differences and with reported sequences for similarity with those from other regions. HCV RNA was detected in only 2 of 13 (15.4%) HCV seropositive donors. Genotype 2 was the only genotype found and subtypes 2a and 2b were detected in one subject while the other had 2a only. University of Ghana http://ugspace.ug.edu.gh Comparison of nucleotide sequences from position 329 to 658 of the HCV genome showed the following characteristics: (i) the nucleotide sequence similarity was 95 to 96%; (ii) intra- / inter-donor difference in nucleotide sequences observed was 30% and an intra- / inter-donor similarity was at least 94%. The phylogenetic analyses of the core region indicated that collectively, the Ghanaian HCV RNA extracts formed a diverse single phylogenetic group. The existence of rapid genotype variation within a single individual was observed. This study also shows that HCV genotype 2a is prevalent in Ghana. XI University of Ghana http://ugspace.ug.edu.gh CHAPTER ONE INTRODUCTION AND LITERATURE REVIEW 1.1 INTRODUCTION Viral hepatitis is a systemic disease primarily involving the liver. It presents a major health problem throughout the world (Prince et a l, 1993; Alter et al., 1992). Most cases o f acute viral hepatitis in children and adults are caused by hepatitis A virus (HAV) and hepatitis B virus (HBV). Hepatitis C virus is the most important agent o f chronic or acute parentally transmitted viral hepatitis not attributable to HAV or HBV and is known as non-A, non-B or NANB hepatitis (Dana et al., 1994; Choo et al., 1990; 1989). Hepatitis C virus causes persistent infections in more than 90% of infected people. An estimated 70 to 90% of infections become chronic with progression to cirrhosis in at least 20 % o f infected individuals after 10 to 20 years (Barera et al., 1995; Thomas et al., 1995 Alter et al., 1992). It is also associated with hepatocellular carcinoma (Alter, 1995). Persons with HCV infection may have no symptoms for several years and many infected people do not know they have the virus. No vaccine for HCV is available, and antiviral treatments, generally alpha interferon (a-EFN), are marginally effective (NIH, 1997). Studies have demonstrated that the subtype of the infecting HCV strain seems to influence the clinical course o f the infection as well as the outcome of therapy with alpha interferon (Prati et al., 1996; Takada et al., 1996; Lau et al., 1995). HCV has a single-stranded RNA genome o f positive (protein-coding) polarity. It has a genetic organization similar to that of the Flaviviridae family, which includes the pesti- 1 University of Ghana http://ugspace.ug.edu.gh and the flaviviruses to which the yellow fever virus belongs (Alter, 1995; Choo et al, 1991; Miller et al., 1990). Around 96% of the genome codes for 9 viral proteins, of which 3 are structural and 6 non-structural, with non-coding regions at both the 5' and 3' ends (Choo et al., 1991). These structural and non-structural proteins form the basis of diagnostic tests to detect the presence of anti-HCV antibodies and the viral genome. HCV has a high rate of genetic mutation (Ogata et al., 1991), and as a result, extensive genetic heterogeneity of HCV occurs in infected individuals. HCV isolates are found as either a group of isolates with very closely related genomes, referred to as quasispecies, or genetically distinct groups called ‘genotypes’ (Bukh et al., 1995). Since the original classification of HCV into 6 major genotypes, sequence comparisons of HCV derived from a much wider range of geographic locations have provided evidence for the existence of a large number of variants (Simmonds et al., 1994). Presently at least 50 subtypes of HCV have been described on the basis of phylogenetic analysis (Smith et al., 1997; Simmonds et al., 1995; Stuyver et al., 1994). HCV typing has been established by methods mainly based on polymerase chain reaction (PCR) and / or serology (Cerino et al., 1996). All HCV genotyping assays operate on the crucial assumption that the region analysed - the 5' untranslated region (5' UTR), core, NS4 or NS5b (see Fig. 1) is representative of the whole genome. This assumption would break down if recombination between HCV genotypes occurred during virus replication. Comparisons of genotyping assays based on sequence analysis of different regions of the genome, and between PCR-based and serological typing assays have given remarkably 2 University of Ghana http://ugspace.ug.edu.gh consistent results (Fields et al., 1996). This suggests that genotyping is a valid procedure despite the theoretical possibility of recombination (Bhattacherjee et al., 1995; Lau et al., 1995; Tanaka et al., 1994). The availability of the nucleotide sequence of HCV makes use of reverse transcriptase (RT) PCR, which targets the highly conserved 5' noncoding regions (5' NCR) as a direct and reliable assay. Many of the current methods for genotyping rely on the following (i) PCR amplification of virus sequences in clinical specimens, using type-specific primers that selectively amplify different genotypes (Okamoto et al., 1993) (ii) Analysis of the PCR product by hybridization with genotype-specific probes (Stuyver et al., 1994), (iii) Restriction fragment length polymorphisms (RFLP) (Gish et al., 1999; Davidson et al., 1995; McOmish et al., 1993) (iv) Reverse dot blot (Stuyver et al., 1996), and (iv) Heteroduplex mobility analysis (White et al., 2000). First, second and third generation HCV assays target antigens to the core region (c22c) and one or more non-structural regions - NS3 (c33), NS4 (cl00-3) or NS5. These assays proved sensitive and specific for screening blood donations to eliminate post-transfusion HCV infections (Aach et al., 1991). However, low incidence, sequence diversity or impairment of immune response has rendered such HCV assays, especially the first and second-generation assays, prone to non-specific cross-reactivity. Besides, non-specific reactions occasionally originate from the bacterial fragment of the fusion protein, during expression of HCV recombinant proteins in bacterial cells for anti-HCV tests. 3 University of Ghana http://ugspace.ug.edu.gh In West Africa, although HCV is recognized as endemic (Jeannel et a l, 1998), information on HCV infection in the Ghanaian population is limited. Recent information on HCV seroprevalence was generated by investigations on seroprevalence of blood- borne infectious diseases in Ghana. Initial screening using a particle agglutination assay showed that 8.4% of the healthy donors were HCV positive. However, supplementary analysis using third-generation recombinant immunoblot assay (RIBA 3) and PCR confirmed HCV seroprevalence as only 0.9% (Ampofo et al., 2002). The demonstration of HCV seroprevalence in Ghana illustrated the need for HCV screening for would-be blood donors (Ampofo et al., 2002; Acquaye et al., 2000; Wansborough-Jones et al., 1998). Currently, anti-HCV screening among blood donors is under implementation in the country. Although present HCV screening assays may be useful at preventing transmission of HCV infection, employing molecular technology to confirm HCV positivity may prove useful especially in reducing significant loss of blood donations caused by lack o f specificity of most screening assays (Courouce et al., 1998). In addition to ensuring the maximum possible safety of transfused blood and components, the proper management of HCV infection is very important. It has been documented that certain genotypes of HCV are associated with rapid disease progression (Hotta et al., 1997). Besides, antigenic differences between genotypes have implications for development of vaccines for HCV and for the optimal design of serological screening and confirmatory assays for HCV. Molecular diagnosis of HCV is therefore very essential for the clinical management and public health control of HCV infection. 4 University of Ghana http://ugspace.ug.edu.gh AIMS AND OBJECTIVES Genotypic differentiation of HCV has served as an important epidemiological tool for the study of the geographic distribution of HCV genotypes, their routes of transmission, and their association with certain risk factors. Heterogeneity in sequence seen among HCV genotypes may be associated with various antigenic and biological properties (Zein et al., 1995). Besides, outcome of liver disease and rates of response to interferon therapy may vary according to HCV genotype (Yoshioka et al., 1992). Therefore, identification of HCV genotypes may provide for prognosis and therapy. In Ghana, although currently blood for transfusion is routinely screened for HCV in addition to human immunodeficiency virus (HIV) and hepatitis B virus (HBV), there is little detail on occurrences of HCV subtypes in the country. This study was therefore conducted to identify HCV genotypes in healthy Ghanaians. This would generate data on HCV genotype distribution, to inform policy making on the management of HCV infections in the country. The study was conducted to specifically: 1) Screen blood donors in Accra for hepatitis C virus infection, 2) Extract and genotype hepatitis C virus from infected blood specimens and 3) Determine intra- and inter-donor HCV subtype differences by sequence analyses. 5 University of Ghana http://ugspace.ug.edu.gh 1.2 LITERATURE REVIEW Hepatitis C virus infection is an important public health problem, affecting the well being of an estimated 75-150 million people worldwide. Prevalence of HCV infection in blood donors worldwide is summarised in Fig 1. Prevalences generally vary between 0.04% and 3.5% in most parts of the world (Shakil et al., 1995; Dow et al., 1993, Tretskaia et al., 1993, Galban et al., 1992). Relatively higher prevalences (4 -14%) have been recorded in Africa (Iliako et al., 1995; Ndume and Skalsky, 1993). The highest prevalence (26%) thus far reported was found in Cairo, Egypt (Bassily et al., 1995). The precise mode of acquisition HCV is often uncertain. However, HCV is known to be transmitted by parenteral, or inapparent parenteral routes such as blood transfusion, exposure to blood or blood components, intravenous drug abuse, sex (though inefficient and infrequent means) and maternal-infant transmission (relatively uncommon). Hepatitis C virus infection may remain clinically silent or progress to cirrhosis. The illness caused by HCV infection has a complex natural history, and the ultimate, long­ term prognosis for patients with chronic hepatitis is difficult to predict. However, the rate of disease progression and the morbidity associated with HCV are known to be affected by many interactive factors. They include age of acquisition, concomitant alcohol abuse, gender, coexisting viral disease, host immune response, level of viraemia, HCV genotype and degree of viral diversity (Zein, 2000; Dusheiko et al., 1993; Gordon et al., 1993; Pozzato etal., 1991). 6 University of Ghana http://ugspace.ug.edu.gh Fig. 1. W orldwide prevalence o f anti-HCV among volunteer blood donors (Decker and Troonen, 2001). 7 University of Ghana http://ugspace.ug.edu.gh The structure and assembly of HCV as well as the function of various HCV genome- coded proteins play a significant role in production of genetic variants. This variation results in differences in infectivity, severity or spectrum of disease and response to treatment (Dusheikko et al., 1994). Genome Organization of HCV The genome organization of HCV (Fig. 2) is similar to that o f the flaviviruses and pestiviruses (Miller et al., 1990; Bradley, 1985). It is an enveloped particle harbouring a plus-strand RNA that has a length of about 9600 nucleotides (Fig 2). The genome carries a single long open reading frame (ORF) that occupies around 96% of the entire genome. The ORF encodes a single large polyprotein precursor of approximately 3,010 amino acids, that is cleaved co- and posttranslationally by host and viral proteases to yield nine individual structural and nonstructural viral proteins: core, envelope 1(E1), E2; non- structural (NS) 2, NS3, NS4a, NS4b, NS5a and NS5b. The polyprotein gene is flanked by non-coding regions at both the 5' and 3' ends (Choo et al., 1991). The structural proteins are located in the amino terminal one-third region and the nonstructural replicative proteins in the remaining region of the genome (Reed et al., 1998). The first 40 nucleotides of the RNA genome are not required for translation but are involved most likely in replication (Boyer and Haenni, 1994). Translation of the HCV open reading frame (ORF) is directed through a 341-nucleotide long 5' NTR functioning as internal ribosome entry site (Tsukiyama-Kohara et al., 1992). The 3' non­ translated region (NTR) has a tripartite structure composed of a variable sequence 8 University of Ghana http://ugspace.ug.edu.gh Cleavage Host ?Host NS2(+NS3) signal signal metallo- Enzyme peptidase peptidase protease NS3 protease (+NS4a) Cleavage Site (aa No.) ” 5 n CO I CO Size (kDa) Putative function RNA- Envelope Zn2+ Ser Protease/ RNA-dependent binding glyco- metallo- Hellcase RNA polymerase Nucleo- proteins proteinase Required capsld (+NS3) byNS3 protease Fig. 2. Organization o f the hepatitis C virus genome and polyprotein cleavage products. A schematic representation o f the HCV genome indicating the positions o f the structural and non-structural proteins within the polyprotein as well as the 5 ’ and 3 ’ NTRs. The polyprotein cleavage products, cleavage sites for host cell signalises, the NS2-3 proteinase, the NS3 proteinase and an unknown cellular proteinase (denoted by ?) are indicated, (nt - nucleotides; aa -am ino acids, UTR - untranslated or non-coding region, kDa - kilodalton) (Houghton, 1996). 9 University of Ghana http://ugspace.ug.edu.gh following the stop codon o f the ORF, a poly (U) tract o f heterogeneous length and a highly conserved 98 nucleotide sequence essential for replication in vivo (Kolykhalov et al., 2000; Yanagi et al., 1999; Tanaka et al., 1996). The first cleavage product o f the polyprotein is the highly basic core protein, forming the major constituent o f the nucleocapsid (Yasui et al., 1998). Envelope proteins (El and E2) are highly glycosylated type 1 transmembrane proteins, forming disulfide-linked and non-covalently-linked heterodimers, respectively (Deleersnyder et al., 1997). Most of the non-structural proteins 2-5B are required for the replication o f the viral RNA (Lohmann et al., 1999 b). NS2 and the amino-terminal domain o f NS3 constitute the NS2-3 proteinase, catalysing cleavage at the NS3/NS4 site (Hirowatari et al., 1993). NS3 is a bifunctional molecule carrying (1) a serine-type proteinase responsible for cleavage at the NS3/NS4a, NS4a/b, NS4b/5a and NS5a/b sites and (2) NTPase/helicase activities essential for translation and replication of the HCV genome (Bartenschlager et al., 1993). NS4a is an essential cofactor of the NS3 proteinase and is required for efficient polyprotein processing (Tanji et al., 1995a; Bartenschlager et al., 1994). The functions of the hydrophobic NS4b and the highly phosphorylated NS5a in replication are so far unknown. NS5a appears to be involved in resistance of the infected cell to the antiviral effect of IFN. NS5b has been identified as the RNA-dependent RNA polymerase (RdRp) (Al et al., 1998; Yuan et al., 1997). Replication cycle of HCV The dynamics of HCV replication can be deduced from the rapid rates of virus production and emergence of mutants (Zeuzem et al., 1998). There is lack of a 10 University of Ghana http://ugspace.ug.edu.gh convenient animal model and an efficient cell culture system for the study of HCV. As such, current understanding of the molecular mechanisms of HCV replication is based primarily on analogies to the closely related flavi- and pestiviruses. Characterization of recombinant proteins has also provided some information on HCV replication. Using these systems, the HCV replication cycle comprises the following: (1) penetration of the host cell and liberation o f the genomic RNA from the virus particle into the cytoplasm; (2) translation of the input RNA, processing o f the polyprotein and formation o f a replicase complex associated with intracellular membranes; (3) utilization of the input plus-strand for synthesis o f a minus-strand RNA intermediate; (4) production of new plus-strand RNA molecules which in turn can be used for the synthesis o f new minus strands, for polyprotein expression or packaging into progeny virions; (5) release of virus from infected cell (Bartenschlager et al., 2000). Fig. 3 illustrates the model. Attachment and entry The first step in the life cycle of HCV is the attachment o f the infectious particle to the host cell. This requires a specific interaction between a receptor on the cell surface and a viral attachment protein on the surface of the particle. CD81 (CD denotes cluster o f differentiation, a family of molecular structures on a cell surface) was identified as a putative receptor based on its strong interaction with E2 as well as with virus particles in vitro (Pileri et al., 1998). HCV also enters cells by binding to low-density lipoprotein (LDL) receptors (Thomssen et al., 1992). While the nature of the HCV receptor is not known currently, the major envelope glycoprotein E2 is thought to be used for initiating 11 University of Ghana http://ugspace.ug.edu.gh Endoplasmic Reticulum V Fig. 3. Hypothetical model o f the HCV replication cycle. Upon infection o f the host cell (large rectangle) the plus-strand RNA genome (+RNA) is liberated into the cytoplasm and translated. The polyprotein is processed and viral proteins remain tightly associated with membranes o f the ER. Minus-strand RNA ( - RNA) is synthesized by the replicase composed o f N S3-5B and serves as template for production o f excess amounts o f plus strand. Via interaction with the structural proteins plus-strand RNA is encapsidated. Particles are enveloped by budding into the lumen o f the ER and virus particles are exported via transit through the Golgi complex (Bartenschlager et al., 2000). University of Ghana http://ugspace.ug.edu.gh virus attachment to the host cells (Zibert et al., 1995). The role of E l is less clear but its presence suggests that it is involved in membrane fusion (Flint et al., 1999). Polyprotein translation and processing Once inside the cytoplasm, the genomic RNA is translated. Translation is mediated by the internal ribosomal entry site (IRES) (Wang et al., 1993; Tsukiyama-Kohara et al., 1992). Experimental evidence suggests that sequences of the core coding region, but not the core protein itself, are required for full IRES activity (Honda et al., 1996; Reynolds et al., 1995). It has been reported that the HCV IRES binds specifically to the 40S ribosome subunit and does not require any additional translation factors (Pestova et al., 1998). Under the direction of IRES, the polyprotein is translated at the endoplasmic reticullum (ER) and cleaved co- and post-translationally by host cell signalases and viral proteinases (Bartenschlager, 1999; Reed and Rice, 1998). Processing of the polyprotein proceeds through intermediates, notably an E2-p7-NS2 protein. The C-NS2 region is processed by host signal peptidases cleaving at the C/El, E1/E2, E2/p7, p7.NS2 junctions (Fig. 2). Processing of the NS3-5 region is mediated by the NS3 proteinase with the following preferred order of cleavages: NS3/4a-NS5a/b-NS4a/b-NS4b/5a (Grakoui et al., 1993). Proteolytic activity of NS3 is greatly stimulated by NS4a, although it is enzymatically active on its own (Bartenschlager et al., 1994; Tanji et al., 1994). In addition to serving as a proteinase cofactor, NS4a further functions to contribute to efficient polyprotein 13 University of Ghana http://ugspace.ug.edu.gh cleavage and replication. First, it increases the metabolic stability of NS3. For example, in the absence of NS4, NS3 is degraded very rapidly. Secondly, NS4 anchors NS3 to intracellular membranes where most of the HCV proteins are located, thereby increasing the local enzyme:substrate concentration and facilitating the formation of a membrane- associated replicase complex (Wolk et al., 2000; Tanji et al., 1995). RNA replication The individual steps underlying RNA replication are largely unknown. Several coprecipitation studies have shown that most or all of the HCV polyprotein cleavage products, in particular NS3-5B, form a replicase complex associated with intracellular membranes. This allows the production of viral proteins and RNA in a distinct compartment (Bolten et al., 1998). In common with other positive-strand viruses, HCV is presumed to replicate its RNA genome through the production of a minus-strand replication intermediate. The virus-encoded NS5B RdRp is the key enzyme that catalyzes the synthesis of minus- and plus-strands either in a primer-dependent initiation manner or a ‘copy-back’ mechanism in in vitro studies (Al et al., 1998; Yamashita et al., 1998). Primer dependent synthesis proceeds by elongation of a primer hybridized to an RNA homopolymer. ‘Copy-back’ mechanism occurs when using heteropolymeric templates. Steps in the assembly and release of HCV from the cell are unknown, although it is likely that the mature virus particle is formed by budding of the assembled nucleocapsid 14 University of Ghana http://ugspace.ug.edu.gh through the lipid membrane o f the cell into which the E l and E2 glycoproteins are inserted (Bartenschlager et al., 2000). Classification of HCV A current proposal for the nomenclature of HCV genotypes is to divide HCV into ‘types’, corresponding to the main branches in the phylogenetic tree, and "subtypes’ corresponding to the more closely related sequences within the major groups (Simmonds et al., 1994, 1993a; Enomoto et al., 1990). Earlier classification described a total o f six major types o f HCV, numbered 1 to 6 in order o f discovery. The subtypes are denoted by the letters a, b and c, that differ from each other by around 20% (Simmonds et al., 1993a; Stuyver et al., 1993; Chan et al., 1992). Pairwise similarity applied to either partial or total genome sequences led to the classifiction of HCV into 11 distinct genotypes (Tokita et al., 1998,1995). However, phylogenetic analysis has grouped HCV-lOa with HCV-3, and indicated that HCV-7, -8, -9 and 11a shared a common ancestor with HCV-6 (de Lamballerie et al., 1997; Simmonds et al., 1996). Results from phylogenetic inference methods thus support the existence of six HCV genotypes (Robertson et al., 1998). Genetic Variation in HCV A feature of HCV replication is the rapid generation of virus variants. Sequence comparisons of HCV obtained from a wide range o f geographic locations have provided evidence for the existence o f an extremely large number o f variants (Hotta et al., 1997; 15 University of Ghana http://ugspace.ug.edu.gh Mellor et al., 1995). Even within an individual HCV does not exist as a single entity but rather as a swarm of microvariants of a predominant ‘master sequence’, a phenomenon referred to as quasispecies (Holland et al., 1992). The production of such a large number of variants is primarily due to the high error rate of the viral RNA-dependent RNA polymerase (RdRp) that is expected to be in the range of 10-4. The high variation observed with HCV replication may account for the fact that a significant fraction of virus genomes appear to be defective (Martell et al., 1992). Phylogenetic analysis of nucleotide sequences of either structural genes, such as the envelope glycoprotein, E l (Bukh et al., 1993), non-structural genes such as NS5B, the RNA polymerase (Simmonds et al., 1993), or the complete genome (Chamberlain et al., 1997) has provided evidence that the six major genotypes of HCV are approximately equally divergent from each other. This was based on analyses o f a worldwide collection of samples from HCV-infected blood donors and patients with hepatitis. Regions that encode the putative envelope proteins (El, E2/NS1) are the most variable (Hijikata et al., 1991) and the 5’ untranslated region is the most conserved (Han et al., 1991). The hypervariable region 1 found within the envelope E2 protein gene is a major site for the genetic evolution of HCV (Kato; 2000). Geographical Dstribution of HCV Genotypes It has been observed that the genotypes of HCV have particular geographical distribution. Some genotypes are distributed worldwide while others are found predominantly in specific regions (Fig. 4). Genotypes 1, 2 and 3 are found throughout the world whereas 16 University of Ghana http://ugspace.ug.edu.gh Fig. 4. Geographic distribution o f HCV variants (Decker and Troonen, 2001). 17 University of Ghana http://ugspace.ug.edu.gh genotypes 4, 5, and 6 appear to be more restricted in their distribution. A striking geographical change in genotype distribution is apparent between Europe and the Middle East, West Africa, and parts of North and Central Africa (Bukh et al., 1993; Stuyver et al., 1993). Genotypes 1, 2 and 3 constitute the major genotypes in Japan, Western and Eastern Europe, and North America. Genotype 4 has been found mostly in Central and Northern Africa and in the Middle East but not in Western countries. Type 5 has been reported from South Africa and type 6 has been identified in Southeast Asia and Hong Kong (Simmonds, 1999; Nousbaum, 1998; Mori et al., 1992). Hepatitis C virus infection has been reported in West Africa (Develoux et al., 1995; Mellor et al., 1995), although data on its distribution is scarce. Evidence has been found for high genetic diversity and long-term endemicity of HCV genotypes 1 and 2 in West Africa. Available data suggest that the distribution of HCV genotypes in West Africa is different from what occurs in other parts of Africa. A new subtype 2d of genotype 2 has been isolated from a Nigerian patient treated in the Netherlands (Stuyver et al., 1994). Similarly, a new subtype of genotype 1 has been characterized in the serum sample from another Nigeria patient. Genotype 2 has been identified in two samples from The Gambia (Mellor et al., 1995). Recently, genotypes 1 and 2 were identified in Guinea, Burkina Faso and Benin. The genotypes showed high genomic diversity, with 18 different subtypes including 2c, 2d and 16 new subtypes (Dominique et al., 1998). 18 University of Ghana http://ugspace.ug.edu.gh In Ghana, little data on the prevalence and genotypes of HCV infection is available despite the known high incidence of liver disease, much of which is likely to be caused by hepatitis viruses. A survey of HCV antibody seroprevalence revealed a rate of 5.4% in some school children aged between 6 to 18 years (Martinson et al., 1996). HCV infection has also been observed in both HIV-seropositive and seronegative individuals (Brandful et al., 1999). In another study, a seroprevalence of 2.8% and an occurrence of genotype 2 were observed in blood donors and antenatal clinic attenders in Kumasi in the middle part of the country. HCV genotype 2 was therefore suggested as indigenous to Ghana (Wansbrough-Jones et al., 1998). Pathogenesis of HCV Infection The hallmark of HCV is its ability to cause perstistent infection that evolves into chronic disease associated with liver damage, characterized by sustained viremia and anti-HCV antibody. Numerous studies involving posttransfusion hepatitis, intravenous drug user- associated hepatitis, and community-acquired hepatitis have shown that viremia may occur in approximately 70 to 90% of HCV-infected persons (Alter et al., 1995, Thomas et al., 1995). Although the majority of HCV- infected individuals experience persistent infection, the disease may be active or quiescent. It has been proposed that differences in the host cellular (Missale et al., 1996) or humoral (Zein et al., 1999) immune responses to HCV are important in spontaneous clearance. HCV infection usually fails to resolve spontaneously in about 80% of individuals who become chronically infected after initial exposure to HCV (Alter et al., 1992). Studies have suggested that disease progression, morbidity and mortality depend on various viral or host factors such as viral load, alcohol 19 University of Ghana http://ugspace.ug.edu.gh intake, other infecting agents such as HBV and HIV and the length of time of HCV acquisition (Zein, 2000; Dusheiko et al, 1993; Gordon et a l, 1993;). The role of HCV genotypes in persistence of HCV following an acute expoure to HCV has been investigated. Data provided evidence that the genotype of HCV may potentially play an important role in the development of chronic infection. The rate of evolution to chronicity in patients exposed to HCV genotype lb infection was 92%, while in patients exposed to other genotypes the rate was 33% to 50% (Amoroso et al., 1998). Chronic HCV infection with genotype lb is also reportedly associated with a more severe liver disease and a more aggressive course than infection with other HCV genotypes (Pozzato et al., 1991). HCV genotype lb has been found to be prevalent among patients with liver cirrhosis and HCV-associated hepatocellular carcinoma (Abe et al., 1998; Zein et al., 1996; Silini et al., 1995). The role of genotypes in the progression of liver disease cannot be separated from the roles o f the cofactors mentioned above (Fong et al., 1991; Mendenhall et al., 1991). There appears to be significant biologic variation in HCV disease expression in the host over the length o f the infection. In a study on the natural history of HCV infection, the mean times from exposure to HCV to the diagnosis of chronic active hepatitis, to compensated liver cirrhosis, to decompensated cirrhosis, and to hepatocellular carcinoma were 11, 18, 23 and 29 years respectively (Zein et al., 2000 ). Severe complications such as cirrhosis and hepatocellular carcinoma could occur over a short period in some people 20 University of Ghana http://ugspace.ug.edu.gh whereas others have no complication despite a much longer period o f infection (Zein et al., 1996). Clinical Significance of HCV Infection Hepatitis C infection causes an indolent and slowly progressive liver disease that is asymptomatic until the development of decompensated liver disease and, often, liver cancer. Chronic liver disease occurs in at least 50% of patients with acute HCV infection and progressive liver injury, fibrosis and cirrhosis develop in one-third of these patients over a period of 20-30 years, while 15% develop hepatocellular carcinoma (Di Bisceglie etal., 1991). Acute hepatitis C infections are usually associated with subclinical disease. Approximately only one quarter of acute cases result in jaundice (Di Bisceglie et al., 1991). Most of the serious liver disease associated with HCV is a consequence of the chronic, persistent nature of the infections. It has been suggested that posttransfusion cases proceed more aggressively than does infection associated with intravenous drug use, which may be related to the larger viral inoculums received in posttransfusion infections (Di Bisceglie et al., 1991). Clinically, hepatitis caused by HCV is indistinguishable from that caused by other hepatitis viruses. When acute disease occurs, general symptoms of hepatitis are apparent. The usual signs of the disease are malaise, anorexia, nausea, and occasionally pain in the right upper abdomen. When symptoms occur, fatigue is the most common complaint, but 21 University of Ghana http://ugspace.ug.edu.gh weakness, wasting, edema, and ascitis also can occur (Dusheiko et al., 1993). Extrahepatic manifestations o f the disease include the deposition of immune complexes comprising HCV, viral antibodies and rheumatoid factor within the kidney glomeruli. The deposition o f such complexes has been postulated to be the cause of membranoproliferative glomerulonephritis, which typically causes weakness, peripheral edema, hypertension and hepatomegaly (Johnson et al., 1993). Stability and Detection of HCV in Clinical Specimens Previous experiments have revealed certain collection procedures as well as handling, transport and storage conditions of samples necessary for the optimal detection of HCV RNA (Halfon et al., 1996). Conventional methods exist for RNA extraction from samples of serum, plasma, peripheral blood mononuclear cells (PBMCs) and whole blood (Schmidt et al., 1995). However, various processing and storage conditions influence the stability and alter the RNA concentration and hence limit the ease of detection of HCV RNA in clinical samples (Halfon et al., 1996). The type of blood collection tube has been shown to influence the titre of HCV RNA in samples. Recent studies showed that whole blood anticoagulated with EDTA may be stored at up to 25°C for up to five days without any significant loss in plasma HCV RNA level (Grant et al., 2000). Comparative studies showed that whole blood contains significantly more HCV RNA than plasma, which contains more HCV RNA than serum, which also contains more HCV RNA than PBMC, neutrophils, or RBC/ platelets (Schmidt et al., 1997; Wang et al., 1999). However, whole blood extraction methods are 22 University of Ghana http://ugspace.ug.edu.gh costly and more time-consuming. Besides, Cook et al (2000) demonstrated that the use of whole blood specimens for routine detection or quantitation of HCV RNA in the blood does not provide any greater sensitivity than the use of serum or plasma specimens. This makes the use of serum / plasma for HCV diagnosis a valid and reliable procedure. Diagnosis of HCV HCV diagnosis is particularly important for the safety of supply of blood and blood products. Serodiagnosis is dependent on the detection of circulating anti-HCV antibodies to specific HCV antigens using commercially available kits. Anti- HCV antibody positivity has been shown to be strongly corrrelated with persistent viraemia. However, antibodies may not be present in patients with very low viremia. Besides, the titre of circulating virus is generally low, hence currently, serodiagnosis is confirmed by the detection of viral RNA in blood or blood fractions. This is achieved through PCR amplfication of reverse-transcribed complementary DNA (cDNA) of HCV (Choo et al., 1994). Thus the methods o f choice for the screening of blood samples for HCV should be those that are sensitive, specific and reproducible, ensuring consistency in laboratory assays. Recombinant DNA techniques have been used to develop structural and non-structural proteins derived from HCV RNA with utility for antibody screening. Anti-HCV assays have evolved from first-generation products incorporating NS4 proteins only, through to third-generation assays by incorporating core (c22-3, structural), NS3 protease / helicase (c33c, non-structural), NS4 (5-1-1 and cl 00-3, non-structural) and NS5 replicase (non- 23 University of Ghana http://ugspace.ug.edu.gh structural) proteins. The first-generation assays are affected by the level of circulating globulins in serum, and therefore give a high level of false positivity. It has been suggested that the interpretation of second-generation assays is affected by the HCV genotype (Zein et al., 1997). Third-generation assays for anti-HCV have been shown to have much higher sensitivities and specificities than the second-generation assays and useful for earlier detection o f seroconversion. They detect up to 95% of HCV-infected persons (Hosein et a l, 1991; McHutchinson et a l, 1992). They are much less strongly influenced by the infecting genotype (Courouce, 1998; Kao et al., 1996; Maggi et al., 1995). Various diagnostic test kits for the detection of antibodies to HCV have been used recently in Ghana. These include the HCV-SPOT assay (Genelabs Diagnostics Ltd., Singapore), the SERODIA passive-particle agglutination assay kits (FUJIREBIO Inc., Tokyo, Japan), enzyme-linked immunoassay (IMUCHECK-HCV C50Ab; International Reagents Corporation, Kobe, Japan) and the third-generation recombinant immunoblot assay (RIBA 3; Ortho Diagnostic Systems, Roissy, France). The SERODIA-HCV PA (particle agglutination) assay was developed using gelatin particle carriers, sensitized with recombinant antigens c22-3 and c200. The test is based on the principle that sensitized particles are agglutinated by the presence of antibodies to HCV in serum/plasma specimens. The Murex anti-HCV (Version 4.0) enzyme-linked immunosorbent assay (ELISA) utilizes antigens from core, NS3, NS4 and NS5 regions of 24 University of Ghana http://ugspace.ug.edu.gh the virus genome. It operates on the principle that anti-HCV antibodies in a sample bind to immobilized antigens and are detected subsequently following an enzyme action. A positive anti-HCV test provides evidence of exposure to HCV. However, seroconversion is generally not detected until 7 to 31 weeks after infection. Therefore, specific antibodies may not be detectable in early acute disease. Moreover, antibody detection does not distinguish between acute, chronic or past HCV infection. Additional information can only be obtained by testing for viral RNA in serum or plasma by PCR or direct hybridization (‘branched DNA’ test). Besides, individuals vary in their immune response to various HCV proteins (Zein et al., 1996). These have made the detection of HCV RNA by reverse transcriptase (RT)-PCR become essential for the diagnosis of HCV infection. Usually, the amount of blood HCV, opposed to other viruses, is very small. Besides, HCV RNA level changes with the dynamics o f the disease. Thus, the method to extract HCV-RNA from the samples requires good procedures that are effective, simple and quick. Recent technological advances have led to the availability o f products such as the SepaGene-RV-R (Sanko Junyaku Co. Ltd., Tokyo, Japan) which extracts target RNA simply and quickly with high collection ratio by utilizing the agglutination partition (AP) method. The AP method uses a non-phenol reagent and a protein agglutinant that form agglutinated partitions according to differences in specific gravity. Target RNA is thus extracted into the aqueous phase while impurities such as proteins are trapped in the agglutinated layer. As a result, the RNA is available in the aqueous phase ready for use in a nested RT-PCR assay for detection (Miyachi et al., 2000; Naito et al, 1999). 25 University of Ghana http://ugspace.ug.edu.gh The PCR is a sensitive technique that detects as few as tens of viral RNA; besides, viraemia is detected within a few days after acute infection (Choo et al., 1994). RT-PCR amplification targets the 5’ leader sequence of the viral genome, which has been shown to be highly conserved among different viral isolates (Bukh et al., 1992; Chan et al., 1992; Okamoto et al., 1990). A positive HCV RNA test suggests viral replication in the liver and validates a diagnosis of either acute or chronic hepatitis C. However, the sensitivity of PCR for HCV RNA detection has been shown to be affected by the choice of primers, handling and storage of preextraction samples (Grant et al., 2000; Bukh et al., 1992; Busch et al., 1992). Critical parameters affect the performance of PCR assay. Low yield or no amplification product may result from a number of factors including missing reaction component, use of degraded template, presence of an inhibitor (removable by ethanol precipitation), suboptimal reaction conditions, uneven distribution of temperature or template in some positions of thermal cycler and genuine absence of target sequence in target DNA. Multiple, nonspecific amplification products may also result from suboptimal reaction conditions, poor primer design, too high primer concentration or contamination by another target RNA/DNA. Also, degradation of RNA, thermal inactivation of Avian Myeloblastosis Virus (AMV) or Moloney Murine Leukemia Virus (M-MuLV) Reverse Transcriptase, lack of primer specificity or primer annealing and problem with the RNA purification may also lead to low yield or no first strand (RT-PCR) product. Appropriate measures exist for overcoming these problems. 26 University of Ghana http://ugspace.ug.edu.gh One useful reagent newly developed for PCR technique is the use of ‘Ready-To-Go RT- PCR beads (Amersham Pharmacia Biotech Inc., N. J, USA). Ready-To-Go RT-PCR beads provide the reagents for RT-PCR reactions. The components are namely buffer, MgCl2, nucleotides, M-MuLV reverse transcriptase, RNAguard and Taq DNA polymerase, in a convenient ambient-temperature-stable bead. The Ready-To-Go bead format significantly reduces the number of pipetting steps, thereby increasing the reproducibility o f the RT-PCR technique and minimizing the risk o f contamination and yielding products sufficient for easy detection on agarose gel electrophoresis. Role of Genomic Heterogeneity in HCV Persistence and Vaccine Development The mechanisms of HCV persistence are generally unknown. However, several arms of the immune system including humoral and cellular immunity interact to limit viral replication and prevent persistence (Zein, 2000). Neutralizing antibodies are often specific for a particular serologic type of virus (Koziel, 1996). The role of cytotoxic T lymphocytes (CTL), which mediate the cellular immune responses, in protecting against viral persistence is unknown (Koziel et al., 1993). HCV heterogeneity may be important in escaping CTL-induced immunity. Responses to HCV antibody are usually directed against the viral envelope proteins, most likely, the hypervariable region 1 which is located in the E2 region (Farci et al., 1994). Cellular immune responses appear to play a role in protecting against HCV infection. Possible targets for HCV-specific CTL recognition within the conserved core protein and 27 University of Ghana http://ugspace.ug.edu.gh additonal epitopes in the more highly variable region E2 protein have been identified (Koziel et al., 1993, 1992). It has been shown that single amino acid changes in CTL epitopes result in failure of recognition by HCV-specific CTL, although direct evidence for the presence of CTL mutants in human HCV infection is lacking (Koziel, 1996). Irrespective of the specific type of immune response (humoral or cellular) that is associated with protection and clearance of HCV after an acute exposure, the response appears to be type-specific (Lai et al., 1994). The genetic heterogeneity o f HCV is likely to make the development of HCV vaccine difficult. However, a vaccine consisting of recommbinant E l and E2 proteins of HCV-1 (genotype la) has been shown to elicit protective immunity. This poses a challenge for the development of a broadly effective vaccine for the prevention o f HCV. Clinical Significance of HCV Genotypes HCV genotypes have relationship with the epidemiology, pathogenicity and response to interferon therapy. Genotypic characterization of HCV has become an important part of clinical management and public health control of HCV infection (Martinot-Peignoux et al., 1999). Strain differences influence transmission patterns among susceptible hosts as well as the clinical outcome after infection although at varying frequencies in populations throughout the world (Zein, 2000; Amorso et al., 1998; Simmonds et al., 1996). Studies have suggested that genotypes 2 and lb may play an important role in hepatocarcinogenesis in Japan, Spain and the United States (Abe et al., 1998). Both 28 University of Ghana http://ugspace.ug.edu.gh blood donors and patients with chronic hepatitis from countries in Western Europe and the USA all show frequent infection with genotypes la, lb , 2a, 2b and 3a (McOmish et al., 1994). In France, HCV lb is associated with patients who had received a previous blood transfusion (Nousbaum et al., 1995), whereas HCV 3a is predominantly associated with intravenous drug use (Pawlotsky et al., 1996). In northern Asia, HCV type 6 variants were commonly found among blood donors and blood addicts; while in blood donors, HCV types la, lb and Id were more strongly associated with elevation o f serum aminotransferase levels (Hotta et al., 1997). HCV genotypes la and lb have been shown to be associated with a more severe liver disease and lower rates o f response to interferon therapy than HCV genotype 2a, 2b or 3 (Martinot-Peignoux et al., 1999; Nizar et al., 1996). A low response rate to anti-HCV therapy also occurs in patients infected with HCV type 4 (Remy et al., 1998; el-Zayadi et al., 1996). The association of HCV genotypes with clinical outcome after infection and the level of response to therapy make genotyping of HCV important in the management of HCV-associated hepatitis. Genotyping of HCV Reliable methods for determining the HCV genotype are crucial for epidemiological and clinical analyses (Zein, 2000). Data indicate that HCV subtypes can be distinguished by serological and molecular methods (Mathias et al., 1999; Bukh et al., 1992; Okamoto et al., 1992). The reference standard and most definitive method for HCV genotyping is sequencing of a specific PCR-amplified portion of the HCV genome obtained from a 29 University of Ghana http://ugspace.ug.edu.gh suitable specimen, followed by phylogenetic analysis. However, direct sequencing is impractical on a large scale because of the complexity o f the procedure. Besides, sequencing o f amplified DNA from a particular region of the genome does not usually identify mixed infections with two different HCV genotypes (Zein, 2000). The choice of the genomic region to be analysed is crucial. The region must contain type- and subtype-specific motifs, which reliably represent the diversity of the entire genome. Sufficient conservation within the subtype is essential for the development and use of sensitive and specific primers or probes, but sufficient variability is needed to allow discrimination between subtypes. Furthermore, variability of the region to be analysed should be sufficiently low to allow PCR amplification of all HCV genotypes. As such, various regions of the HCV genome, namely, the 5’ non-coding region (Chayama et al., 1993; Bukh et al., 1992; Chan et al., 1992), the core region (Chayama et al., 1993; Chan et al., 1992), the envelope region (Simmonds et al., 1994; Stuyver et al., 1993), the NS4 region (Tanaka et al., 1994; Simmonds et al., 1993) and the NS5 region (Sakamoto et al., 1994; Simmonds et al., 1993), have been utilized for grouping o f HCV into different types by nucleotide sequencing. However, the low variability of some regions including the 5-NCR does not allow complete discrimination o f HCV genotypes, but the core and NS5B regions, though intermediately conserved, offer greater possibilities for discrimination between different subtypes. Serologic genotyping is based on specific antibodies directed to epitopes encoded by specific regions o f the genome for specific HCV genotype (Machida et al., 1992). 30 University of Ghana http://ugspace.ug.edu.gh Recently, a recombinant immunoblot assay based on recombinant HCV proteins from the NS4 region has been developed for the differentiation o f HCV subtypes la, lb , 2a, 2b, 3a and 4a (Mathias et al., 1999). The serologic genotyping assays have the advantages of simplicity and low risk for contamination. However, serologic typing seems to lack specificity and sensitivity, which limits its usefulness (Zein, 2000). Investigators of HCV genotyping therefore rely on molecular genotyping systems. A number of HCV molecular genotyping systems have been developed that depend mainly on the amplification of HCV RNA extracted from clinical specimens. Initial HCV RNA amplification is followed by either reamplification with type-specific primers (Chayama et al., 1993, Okamoto et al., 1992) or by digestion o f PCR products with restriction endonucleases that recognize genotype-specific cleavage sites (McOmish et al., 1993; Nakao et al., 1991). Without modification, none o f the reported methods, with exception of direct nucleotide sequencing, is able to discriminate among the HCV genotype in all six major types and the common subtypes on the basis o f the core region of HCV genome. Moreover, all these PCR-based methods have the shortcomings and advantages of PCR. They are expensive and time-consuming and require specialized facilities to prevent contamination and ensure accurate results. However, if performed accurately, they are reliable. Recently, a convenient genotyping system based on PCR o f the core region with genotype-specific primers, which allows for the determination of HCV genotypes la, lb, 2a, 2b, 3a, 3b, 4, 5a and 6a has been reported (Ohno et al., 1997). The phylogenetic 31 University of Ghana http://ugspace.ug.edu.gh lineage can be investigated following the sequencing of an informative region of the HCV genome to confirm observed HCV genotypes. Sequencing The DNA sequence can be elucidated using chemical (Maxam and Gilbert, 1977) or enzymatic (Sanger et al., 1977) methods. The enzymatic method of sequencing is based on the ability of a DNA polymerase to extend a primer, hybridized to the template that is to be sequenced, until a chain-terminating nucleotide is incorporated. Each sequence determination is carried out as a set of four separate reactions, each of which contains all four deoxyribonucleotide triphosphates (dNTPs) supplemented with a limiting amount of a different dideoxyribonucleotide triphosphate (ddNTP). Because ddNTPs lack the 3-OH group necessary for chain elongation, the growing oligonucleotide is selectively terminated at G, A, T or C, depending on the respective dideoxy analog in the reaction. The resulting fragments, each with a common origin but ending in a different nucleotide, and also differing from one another by the length of one nucleotide, are separated according to size by high resolution denaturing polyacrylamide gel electrophoresis. The final nucleotide on each strand is read by an automated sequencer using fluorometric methods that depend upon the labelling of either the primer or the terminators. Thermal cycle sequencing offers several advantages over conventional, non-cycled sequencing strategies (Saluz and Jost, 1989). First, the protocol yields a linear amplification of the template DNA, reducing the amount of template required to yield a detectable ladder. Second, the high temperature employed during each denaturation, 32 University of Ghana http://ugspace.ug.edu.gh helps to circumvent problems associated with rapid reannealing of linear double stranded DNA (dsDNA) templates such as PCR products. Third, high annealing temperatures increase the stringency of primer hybridization. Several critical factors affect the sequencing results. Template denaturation, as well as primer annealing temperatures; purity, amount and the quality of the template DNA; the quality of the gel; and the sequencing temperature among others, do affect the results of sequencing. Poor performance of any of the steps mentioned normally results in lack of clear peaks, instead o f a kind of picture seen in Appendix III, and hence sequence is unreadable. Band compressions are most often associated with GC-rich sequences that form secondary structures that are not completely denatured during gel electrophoresis (Mills and Krammer, 1979). These secondary structures result in the anomalous migration of DNA fragments, which in turn can complicate the interpretation of sequencing results. 33 University of Ghana http://ugspace.ug.edu.gh CHAPTER TWO MATERIALS AND METHODS 2.1 MATERIALS AND REAGENTS Insulated box, Ice packs, were from Polar Tech Industries, Inc., Genoa IL60135. Autoclave, freezer, were from Sanyo Electric Biomedical Co., Ltd., Japan. Microtitre plate was from Greiner Labortechnik,.. Tray mixer (Mini-orbital shaker) was from Bellco Glass. Inc., Vineland, N. J, USA. Multichanel pipette (Finnpipette Digital Multichanel) was by Labsystems Inc., Finland and single chanel pipette (Pipetman) was from Gilson Co., Ltd., France. Incubator was from Yamato Scientific Co., Ltd., Tokyo, Japan. Automatic strip washer (Immunowash), Microplate reader, were from BIO-RAD Laboratories, 20090 Segrate, Italy. Centrifuge was from Kokusan Corporation, Tokyo, Japan. Perkin-Elmer GeneAmp PCR System 2400 was from Norwalk CT 06859, USA. Vacuum chamber (CentriVap Concentrator) was from LABCONCO Corporation, Kansas City, Missouri 64132, USA. Water bath was from Julabo Labortechnik GMBH, D-77960 Seelbach, Germany. SERODIA HCV kit was obtained from FUJIREBIO INC., Tokyo, Japan. Murex anti- HCV (Version 4.0) was obtained from ABBOTT Diagnostics UK. SepaGene RV-R RNA extraction kit was obtained from Sanko Junyaku Co. Ltd., Tokyo, Japan. DNA purification kit was from QIAGEN GmbH, Germany. Ready-To-Go RT-PCR and To­ Go PCR kits, Thermo Sequence Cy™ 5.5 Terminator Cycle Sequencing Kit, RapidGel Cartridge, and the SEQ4x4 Sequencer were obtained from Amersham Pharmacia Biotech Inc., N. J, USA. QIAquick Plasmid DNA Purification Kit was obtained from QIAGEN, 34 University of Ghana http://ugspace.ug.edu.gh Germany. Restriction enzyme, buffer and ligase were obtained from Roche Diagnostics GmbH., Mannheim, Germany. DNA size markers were obtained from Promega Corporation, Madison, USA. Absolute ethanol was from Riedel-deHaen (ph. Eur). Ethylenediaminetetraacetic acid (EDTA) sample collection tubes were obtained from Vacutainer Systems, Frankh Lakes, N. J., USA. Diethyl pyrocarbonate (DEPC), isopropyl alcohol, glacial acetic acid, tris base (Tris[hydroxymethyl]aminomethane), EDTA, calcium chloride, ethidium bromide were obtained from SIGMA Chemical Co., Steinheim, Germany. Boric acid was obtained from Kanto Chemical Co. Inc., Tokyo, Japan. Agarose, LB Agar, LB Broth Base and pCR 2.1 TOPO vector were obtained from Invitrogen, Life Technologies, Paisley, Scotland. MicroCell™ 300 Cassette was from Visible Genetics Inc., Canada. 2.2 METHODS Samples Collection Random samples from blood donors were collected at the Korle-Bu Teaching Hospital. Blood was collected in four milliliters EDTA tubes. The samples were transported to the study laboratory in a cold box (an insulated box containing frozen ice packs to keep samples cold). Within 2 hours of drawing the blood, the samples were centrifuged at 2,500g for 15 minutes at room temperature. After centrifugation, aliquots of plasma were made in duplicates into freezing vials and immediately frozen at -70°C until needed for serological testing and virus extraction. 35 University of Ghana http://ugspace.ug.edu.gh Assays for Antibody to HCV Particle Agglutination Assay The SEROD1A-HCV particle agglutination (PA) assay was performed on the plasma samples to detect the presence of antibodies to HCV. The test was performed according to the manufacturer’s instructions. Plasma samples were declared as containing anti- HCV antibodies by visual observation of agglutination between reconstituted HCV- sensitized particles and HCV antibodies present in a sample as described below. Using a micropipette, 75(il of sample diluent were placed in the first well o f a ‘U ’ shaped microplate and 25|il into each of wells two to four. To the diluent in the first well, 25jj.1 of specimen were added and mixed. Two-fold serial dilutions were made in wells two and three, starting with 25(il o f dilution in the first well and discarding 25ju.l of solution remaining in the pipette after mixing in the fourth well. Twenty-five microlitres each of reconstituted control and sensitized particles were placed in wells two and four to give final dilutions of 1:16 and 1: 64 respectively. The contents of the wells were well mixed on a tray mixer for roughly 2 min. The plate was then covered with a plate sealer and placed on a level, vibration-free surface, allowed to stand at room temperature for two hours after which the result was read. A sample was considered reactive if either a large ring / multiform agglutination occurred, or firmly agglutinated particles that spread out covering bottom of wells uniformly occurred. Samples that showed reactivity at 1:64 dilutions were further tested at a higher final dilution of 1:512 as a way of reducing non­ specific reactivity. Both reactive and non-reactive samples were screened by ELISA to aid selection of possible HCV positive samples for virus extraction. 36 University of Ghana http://ugspace.ug.edu.gh Enzyme Linked Immunosorbent Assay (ELISA) A third-generation Enzyme-linked Immunosorbent Assay (ELISA) using the Murex anti- HCV (version 4.0) kit was used to evaluate all sera both reactive and non-reactive by PA. The assay was performed strictly according to the manufacturer’s instructions. Plates with antigen coated wells and reagents were brought to room temperature before the assay. Substrate and conjugate were reconstituted and the wash solution was diluted to working strength (IX) 20 min before they were used. A multichannel pipette was used to add 180 |al of sample diluent to each well. Twenty microliters of samples and controls were added to the diluent and mixed. The wells were covered with a plate sealer and incubated 1 hr at 37°C to enable any anti-HCV antibodies in the sample bind to the immobilized antigens in the wells. The plates were washed at the end of the incubation period to remove unbound materials. Five wash cycles were performed with an automatic strip washer. Immediately after washing, 100(il of conjugate solution containing peroxidase-conjugated monnoclonal anti-human IgG was added to each well. The plates were then covered and incubated at 37°C for 30 min to allow binding between any captured anti-HCV antibody and the conjugate. The wells were washed as before to remove excess conjugate. After washing the plates, bound enzyme was detected by the addition of 100(il of substrate solution containing 3,3’,5,5’- tetramethylbenzidine (TMB) and hydrogen peroxide to each well. The wells were covered and incubated at 37°C for 30 min. At the end of the incubation period 50 ul of stop solution (0.5 N sulphuric acid) were added to each well. Within 15 min, the absorbance was read at 450 nm against a reference of 630 nm. The assay was declared 37 University of Ghana http://ugspace.ug.edu.gh valid when the mean absorbance of negative controls (N) at 450 nm (A 450) was less than 0.25 (that is N < 0.25) and the positive control A450 (P) was more than 0.8 above the negative control (that is P > N + 0.8). A sample was declared reactive if its absorbance value at 450 nm was greater than the cut-off value (CV) calculated by adding 0.6 to N (that is CV = N + 0.6). Sera that were reactive by both PA (high dilution) and Murex anti-HCV ELISA were selected for HCV extraction, amplification and genotyping. HCV RNA Extraction The nucleic acid was extracted from 100|j.l of plasma by using the SepaGene RNA extraction kit as follows: Three hundred microliters of reagent 1 containing guanidine thiocyanate for dissolving HCV membrane and protein denaturation, were pipetted into 1.5ml sterile eppendorf tubes. To the reagent in the microtube, 100(il of plasma sample were added and mixed. This was followed by the addition of 300jul of reagent 2 and 600|il of reagent 3 to the tube and mixed well by shaking vigorously vertically. Reagent 2 contains sodium acetate for salting out protein while reagent 3 contains chloroform protein agglutinant for removing protein or polysaccharide. The mixture obtained was left at -20°C for 10 mins after which it was centrifuged for 15 mins at 12,000g in a refrigerated centrifuge (4°C). The upper phase was transferred into another microtube by pipetting. An equal volume of isopropyl alcohol were added and mixed gently by inverting the tube, and then left for 45 mins at -20°C. The mixture was then centrifuged as before. The supemate was removed by aspiration. One millilitre of 70% ethanol was 38 University of Ghana http://ugspace.ug.edu.gh added gently to the blue pellet in the tube and centrifuged at 4°C for 10 mins at 12,000g. The supemate was aspirated; the pellets were dried in a vacuum chamber and resuspended in 40|il of ribonuclease-free water. This extract was used for HCV detection. Detection of HCV In order to optimize the nested PCR, the best condition for the reaction was established. Reverse transcription-PCR was performed by the one-step method combined with the cDNA synthesis reaction followed by the PCR as described below. Reverse Transcription-Polymerase Chain Reaction to Generate cDNA The first PCR was combined with the reverse-transcriptase (RT) step in the same Ready- To-Go RT-PCR tube containing bead optimized for first strand cDNA synthesis and PCR. Each bead contained 10 units of RNAguard, 100 units of M-MuLV reverse transcriptase, 200 each of deoxynucleotides, 2 units of AmpliTa# Gold DNA polymerase and 1.5 mM MgCb- The bead was dissolved in 43.7 (il o f RNase-free water on ice; 0.65|il of 10 p.M of each HCV-specific outer primer and 5 f_il of RNA template were added to make a final reaction volume of 50 (il. The sequences of primers used for the RT-PCR were designed from 5’-untranslated region of HCV genome (HC-J1 isolate: GeneBank accession number D 10749). The sequence of the HCV-specific primers (sense, number 19 and antisense, number 20) were respectively 5’- GCG ACACT CC ACC AT AGAT-3 ’ and 5 ’-GCTCATGGTGCACGGTCT A-3 ’ for the outer primer pairs (that gave a product size of 329 base pairs). 39 University of Ghana http://ugspace.ug.edu.gh The thermocycler (2400 Perkin-Elmer Thermal Cycler) was programmed first to incubate the samples for 30 mins at 42°C for the initial RT step and then preheat them at 95°C for 5 mins to activate AmpliTag Gold DNA polymerase. The first round amplification was achieved in a reaction of 40 cycles consisting of 94°C for 30 secs, 50°C for 45 secs, and 72°C for 1 min in a Perkin-Elmer GeneAmp PCR System 2,400 (Norwalk CT, USA). The complementary DNA (cDNA) product obtained in the first reaction was used in a second round of amplification. In the second PCR, 2 (j.1 of the cDNA product generated in the first PCR were amplified for 40 cycles using a Ready-To-Go PCR tube in a Perkin-Elmer 2,400 thermal cycler. The Ready-To-Go PCR tube contained bead which was dissolved in 22.3(J RNase-free water and 0.35|il each of the pair of HCV PCR inner primers was added. The formulation of the bead was such that when dissolved and brought to a final volume of 25(il, it contained 1.5 units o f Taq DNA Polymerase, 10 mM Tris-HCl (pH 9.0 at room temperature), 50mM KC1, 1.5mM MgCk, 200(iM of each dNTP and stabilizers including bovine serum albumin (BSA). The reaction mixture was prepared on ice. The sequences of primers used for the nested PCR are listed in Table 1 below along with the nucleotide position and PCR product size expected by the primer combinations. Sample amplification was performed under the following conditions: Preheating at 94°C for 2 mins to activate Taq DNA Polymerase, a preliminary 20 cycles of amplification at 94°C for 30 secs (denaturation), 53°C for 45 secs (annealing), and extension at 72°C for 1 40 University of Ghana http://ugspace.ug.edu.gh min. Additional amplification was performed as follows: 20 cycles at 94°C for 30 secs, 55°C for 45 secs and 72°C for 1 min. The PCR products were detected by electrophoresis on 2% agarose gel in IX Tris-Acetic Ethylenediaminetetraacetic acid (IX TAE). The gel was stained with ethidium bromide and evaluated under UV light. The sizes of the PCR products were estimated according to the migrating pattern of a 100-bp DNA ladder. The PCR assays were done under strict precautions to prevent cross-contamination that would produce false positive results. TABLE 1: Primers used for HCV detection Region Primer code Sequence (5’-3’) Tm(°C) Product length 5’UTR HCV 19 outer/f GCGACACTCCACCATAGAT 60.1 HCV20 outer/r GCTCATGGTGCACGGTCTA 65.0 329 bp HCV21 inner/f CTGTGAGGAACTACTGTCT 51.1 HCV22 inner/r ACTCGCAAGCACCCTATC 63.4 268 bp F =forward (sense) primer, r = reverse (antisense) primer (Konomi et al., 2000) Genotyping of HCV HCV PCR positive samples were genotyped by the method of Ohno et al (1997). Table 2 shows the sequences and nucleotide positions of the primers used. The concentrations of primers used were adjusted to 2.5|jM. RNA was reverse-transcribed to generate cDNA, amplified and typed by PCR using type-specific primers and Ready-To-Go RT-PCR Beads. Two rounds of amplification were carried out as described below. 41 University of Ghana http://ugspace.ug.edu.gh RNA was first reverse-transcribed into cDNA with M-MuLV reverse transcriptase contained in the Ready-To-Go RT-PCR bead and with the random hexamer pd(N)6. The bead was dissolved in 40.5(0.1 of RNase-firee water on ice, followed by the addition of 2.5(j.l of 1 fj.g/ul pd(N)6 and 5(0.1 RNA template. For the initial RT step, the samples were first incubated at 42°C for 25 mins, preheated at 95°C for 5 mins in a Thermal Cycler (Perkin-Elmer 2,400) and then put on ice while the first round PCR reaction mix was prepared. The first round PCR utilized the primers Sc2 and Ac2, and Taq DNA Polymerase contained in the reaction tube. One microliter of each primer was added to the reaction tubes on ice. Amplification conditions included preincubation at 94°C for 1 min followed by 40 cycles with the following parameters: a preliminary 20 cycles of amplification at 94°C for 1 min denaturation, annealing at 45°C for 1 min, and extension at 72°C for 1 min; followed by an additional 20 cycles of 94°C for 1 min, annealing at 60°C for 1 min, and extension at 72°C for 1 min. The product obtained in the above reaction was further amplified in a second round of HCV genotyping PCR. PCR for Genotyping o f HCV Two different second-round PCRs were performed for each sample using Ready-To-Go PCR Bead. Two different primer mixtures (Table 2), one containing the S7, S2a, Gib, G2a, G2b and G3b primers (mix 1) and another containing the S7, GI a, G3a, G4, G5a and G6a primers (mix 2), were prepared and used for the two different reactions. 42 University of Ghana http://ugspace.ug.edu.gh TABLE 2. Oligonucleotide primers used for PCR, sequencing and genotyping Primer PCR round Sequence (5’-3’) Nucleotide position Sc2 1 GGGAGGTCTCGTAGACCGTGCACCAT - 2 4 - 3 Ac2 1 GAG(AC)GG(GT)TACCCCATGAG(AG)TCGGC 417-391 S7 2s AGACCGTGCACCATGAGCAC -12 + 8 Ac2 2s GAG(AC)GG(GT)TACCCCATGAG(AG)TCGGC 417-391 Mix 1 S7 2g AGACCGTGCACCATGAGCAC 12 +8 S2a 2g AACACTAACCGTCGCCCACAA 40-60 Gib 2g CCTGCCCTCGGGTTGGCT A(AG) 222-203 G2a 2g CACGTGGCTGGGAATCGCTCC 178-159 G2b 2g GGCCCCAATTAGGACGAGAC 325-306 G3b 2g CGCTCGGAAGTCTTACGTAC 164-145 Mix 2 S7 2g AGACCGTGCACCATGAGCAC - 12-8 Gla 2g GGATAGGCTGACGTCTACCT 196-177 G3a 2g GCCCAGGACCGGCCTTCGCT 220-201 G4 2g CCCGGGAACTTAACGTCCAT 87-58 G5a 2g GAACCTCGGGGGGAGAGCAA 308-289 G6a 2g GGTCATTGGGGCCCCAATGT 334-315 The primers used are denoted as follows: S = sense, A or G = antisense, and c = core region; 2s denotes second-round PCR for sequencing, 2g denotes second-round PCR for genotyping; the notations la to 6a are in accordance with HCV genotype nomenclature proposed by Simmonds et al (1994). Pairs o f nucleotides inside parentheses being degenerate nucleotides (Ohno et al., 1997). 43 University of Ghana http://ugspace.ug.edu.gh The total reaction volume was 25|j.l and made up of 1 8 .5|lx1 RNase-free water, 6\i\ of 2.5|aM PCR primer Mix. 1 or Mix. 2 and 0.5 ul template DNA. Amplification was performed with preheating at 94°C, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 62°C for 45 secs, and extension at 72°C for 1 min. Ten microliters of the second-round PCR product was electrophoresed on a 2% agarose gel in IX TAE, stained with ethidium bromide, and evaluated under UV light. The HCV genotype was determined by identifying the genotype-specific cDNA bands in the gel with their expected sizes as shown in Table 3. TABLE 3: HCV Genotypes and Expected sizes in Agarose gel Electrophoresis______ Pimer Genotype Expected band size (bp) Mix 1 lb 234 2a 190, 139 2b 337 3b 176 Mix 2 la 208 3a 232 4 99 5a 320 6a 336 44 University of Ghana http://ugspace.ug.edu.gh HCV cDNA Cloning and Sequencing To confirm HCV genotype and to determine inter- and intra-patient subtype differences, the nucleotide sequences of HCV from the PCR positive samples were determined. A semi-nested PCR was performed with Sc2 and Ac2 as first-round primers and S7 and Ac2 as second-round primers. The PCR product was excised from the gel after the electrophoresis, purified and cloned into a TA cloning vector; and sequenced. cDNA Extraction from Agarose Gel DNA extraction from gel was performed using QIAquick Gel purification protocol, designed to extract and purify DNA of 70 bp to 10 kb from low-melting agarose gels in TAE or TBE. With a scalpel the DNA fragment, approximately 429 bp long, was excised from the agarose gel and weighed in a 1.5 ml eppendorf tube. Three volumes (300|il) of gel solubilization buffer were added to each 100 mg of gel and incubated in a water bath at 50°C until gel slice completely dissolved in approximately 10 min. One gel volume of isopropanol (100^1 for each lOOmg gel slice) was then added to the sample and mixed. The solution was transferred onto a QIAquick column and span down for the DNA to bind to the column. The column was washed with 750(xl of wash buffer. The column was transferred into a clean 1,5ml microcentrifuge tube; 40|il of autoclaved Milli Q water were added to the column and span to elute DNA into the tube. Eluted DNA was stored at - 20°C. 45 University of Ghana http://ugspace.ug.edu.gh Competent Cell Preparation Competent cells were prepared by modifying the method described by Sambrook and Russell (2001). Fifty microliters of stock bacterial (E. coli) cells were added to 20ml of Luria Bertani (LB) medium in a 100ml flask. The cells were grown at 37°C overnight with vigorous shaking (150rpm). Five millilitres of the subculture were poured into 250ml LB in a one-liter flask and incubated for 3hr. The culture was then put on ice for 30min after which it was dispensed into 50ml centrifuge tubes and centrifuged at 3,000g for 15min in a refrigerated (4°C) centrifuge. The pellets were resuspended in half volume of ice cold 0.1 M CaC^ and again left on ice for 30min. The cells were pelleted and resuspended in a total volume of 8ml 0.1M CaC^ and left on ice overnight. Two milliliters (1/5 volume) of sterile glycerol was added and mixed by pipetting gently. The competent cells prepared were dispensed in 200|il aliquots into sterile eppendorf tubes and immediately put in dry ice and absolute ethanol mixture before storage at -70°C. Ligation and Transformation Nested RT-PCR products purified from agarose gel were inserted into a 2.1 pCR plasmid vector (Appendix I) to which a topoisomerase was covalently attached and which had a ligase activity. The ligation reaction mix was made up of 1(̂ 1 each of salt solution (1.2 M NaCl and 60 mM MgC^), vector and 1 |ig/|J.l insert DNA; and 3(il water (total reaction volume was 6 (j.1). The reaction proceeded at 23°C in a refrigerated water bath for 30min. Two microliters of the recombinant plasmid DNA reaction were used to transform bacterial cells as follows: Ninety-eight microliters of competent E. coli cells that had been thawed on ice were added to 2|il of ligated DNA in sterile reaction tubes and 46 University of Ghana http://ugspace.ug.edu.gh immediately put on ice for 20 mins. The cells were heat-shocked at 42°C for 45 secs in a water-bath and then put on ice again for 10 mins. The transformed bacteria were spread on an agar plate containing ampicillin as selective agent by using glass beads. The plates were incubated at 37°C overnight. Miniprep Plasmid DNA Isolation and Purificaction A single colony of about 2 mm diameter was picked from a plate freshly grown overnight at 37°C and transferred into 2 ml of LB medium in a 10 ml culture tube. The culture was incubated overnight at 37°C with vigorous shaking in a water-bath with shaker. Plasmid DNA was purified by using QIAGEN Plasmid Purificatin kit. One milliliter of the culture was taken into a sterile eppendorf tube and span at l,000g for 1 min. The supernatant was completely discarded. Resuspension buffer, 150pl, were added and vortexed to completely resuspend the cells. To the suspension, 150^1 of lysis buffer were added and mixed by gently inverting the tube 15 times. That was followed by the addition of 150p.l of neutralization buffer and mixing by slowly inverting the tube 10 times. The lysate was spun at 13,000g for 3 min. The supernatant was carefully taken into a fresh tube containing 200fj.l of phenol chloroform isoamyl alcohol, vortexed and span as before. The upper layer was carefully taken into fresh tube, two volumes (approximately 900pl) of absolute ethanol were added, shaken, and the pellet spun down at l,300g as before. The supemate was aspirated. The pellets were washed with 250f.il of absolute ethanol, dried in a vacuum chamber and resuspended in 40|il of DNAse-free water. The purity and the concentration were measured and the concentration was adjusted to 1 (j.g / jal. 47 University of Ghana http://ugspace.ug.edu.gh Two micrograms of the above miniprep were digested with restriction with Eco R1 and the electrophoresis run to determine positive clones. The remaining 1ml of the mini culture of the positive clones was used for a largeprep plasmid DNA culture. Largeprep Plasmid DNA Isolation and Purification One hundred milliliters of LB medium were transferred into a 250 ml culture flask and inoculated with 1 ml mini prep culture and incubated at 37°C overnight with vigorous shaking. Plasmid DNA was purified using QIAGEN Plasmid Purification kit in almost the same procedure as for mini prep. The cells were aseptically transferred to sterile 50-ml polypropylene tubes. The cultures were cooled to 0°C by storing the tubes on ice for 10 mins. The cells were recovered by centrifugation at 5,000g for 15 mins at 4°C in a refrigerated centrifuge. Cell resuspension, lysis and neutralization were done as for mini prep using 10ml each of the cell resuspension, lysis and chilled neutralisation buffers. A QIAGEN-tip 500 column was equilibrated 10 ml equilibration buffer and the column allowed emptying by gravity flow. After centrifugation, the supemate was filtered through the resin of the column and washed two times with 30 ml wash buffer. DNA was eluted with 15 ml elution buffer into a fresh tube and precipitated by adding 10.5 (0.7 volume) room-temperature isopropanol to the eluted DNA, mixing and centrifuging as before. The DNA was washed with 5ml 70% ethanol, dried and resuspended in lOOpl DNAse-free water. The purity was measured and the concentration adjusted to l|ag /pi. The purified DNA was digested with Eco RI to check for the presence of insert DNA before sequencing. 48 University of Ghana http://ugspace.ug.edu.gh Restriction Enzyme Digestion The restriction enzyme digestion reaction mix was made up of the following: 16.5(j.l Milli Q water, 2|il of 10 X digestion reaction buffer, 0.5jj1 of enzyme (Eco RI) and l|al plasmid DNA (l|ig/|al) in a 1.5 ml eppendorf tube. The reaction components were mixed by tapping the reaction tube gently. The reaction was proceeded with incubation at 37°C for 2 hours in a water bath. Digestion products were run on 1% agarose in IX TAE. PCR for HCV cDNA Sequencing Sequencing PCR reactions were performed using Cy5.5™ dye-labelled dideoxynucleotide triphosphate (ddNTP) terminators. Four tubes were labelled A, C, G, and T for the respective termination reactions. For each template that was sequenced, a master mix of DNA template (2jig DNA obtained in 4pl of 0.5|ag/|al DNA concentration), reaction buffer (3.5|al), 1 pM sense or antisense primer (2.0jil), ThermoSequence DNA polymerase (10 U/pl, 2pl) and distilled water up to total reaction volume of 31.5 pi was prepared. Into the appropriately labelled tube, lp.1 of the corresponding Cy5.5 ddNTP termination mix was dispensed. After thorough mixing, 7^1 of the master mix were aliquoted into the reaction tubes, thoroughly mixed again and cycled in a thermocycler with the following parameters: one-minute pre-incubation at 95°C, 30 cycles consisting of 30 secs denaturation at 95°C, 30 secs annealing at 55°C and a 2-min extension at 72°C. The PCR products were purified for sequencing as described below. 49 University of Ghana http://ugspace.ug.edu.gh Purification o f PCR Products Unincorporated dye terminators were removed by ethanol precipitation method. The PCR products were transferred to a 1.5 ml eppendorf tubes. To each tube, 2 \ j l I of 7.5 M ammonium acetate was added and 30|il (approximately 3 times the reaction volume) of chilled 100% ethanol. The tubes with their contents were centrifuged in a refrigerated microcentrifuge at 12,000g for 30 mins at 0°C. The supernatant was carefully removed and the pellets washed with 200|il of chilled 70% ethanol through 5 mins centrifugation at 0°C. The pellets were vacuum-dried for lOmins in a vacuum centrifuge. Each pellet was completely resuspended by adding 6|il formamide loading dye and vortexing gently for 10 secs. Sequencing Electrophoresis DNA was sequenced in an acrylamide gel electrophoresis. A SureFill Gel Cartridge and a MicroCell Cassette were used for the electrophoresis. The SureFill Gel Cartridge contained an aqueous solution of unpolymerized acrylamide and a number of components to aid electrophoresis. The MicroCell Cassette was designed to be easily filled with acrylamide solution containing a photoinitiator. A comb was inserted into the MicroCell Cassette and was properly placed into a fill fixture. By using an injector, the cassette was filled with gel from the cartridge. The cassette was then loaded into a gel toaster and polymerised ready for use. Two microlitres of each sample were loaded into separate lanes of prepared sequencing gel and sequenced in SEQ 4 x 4 Sequencer with IX TBE (Appendix I) as running buffer. Nucleotide sequences obtained were aligned and compared with previously reported 50 University of Ghana http://ugspace.ug.edu.gh Purification o f PCR Products Unincorporated dye terminators were removed by ethanol precipitation method. The PCR products were transferred to a 1.5 ml eppendorf tubes. To each tube, 2|il of 7.5 M ammonium acetate was added and 30|al (approximately 3 times the reaction volume) of chilled 100% ethanol. The tubes with their contents were centrifuged in a refrigerated microcentrifuge at 12,000g for 30 mins at 0°C. The supernatant was carefully removed and the pellets washed with 200|al of chilled 70% ethanol through 5 mins centrifugation at 0°C. The pellets were vacuum-dried for lOmins in a vacuum centrifuge. Each pellet was completely resuspended by adding 6|il formamide loading dye and vortexing gently for 10 secs. Sequencing Electrophoresis DNA was sequenced in an acrylamide gel electrophoresis. A SureFill Gel Cartridge and a MicroCell Cassette were used for the electrophoresis. The SureFill Gel Cartridge contained an aqueous solution of unpolymerized acrylamide and a number of components to aid electrophoresis. The MicroCell Cassette was designed to be easily filled with acrylamide solution containing a photoinitiator. A comb was inserted into the MicroCell Cassette and was properly placed into a fill fixture. By using an injector, the cassette was filled with gel from the cartridge. The cassette was then loaded into a gel toaster and polymerised ready for use. Two microlitres of each sample were loaded into separate lanes of prepared sequencing gel and sequenced in SEQ 4 x 4 Sequencer with 1X TBE (Appendix I) as running buffer. Nucleotide sequences obtained were aligned and compared with previously reported 50 University of Ghana http://ugspace.ug.edu.gh sequences. The inner sense primer (2s AGACCGTGCACCATGAGCAC) used for HCV sequencing was used to blast the Internet to retrieve HCV sequences from the gene bank. The sources of sequence data used for comparison with those obtained in this study were as shown in Table 4. TABLE 4: Sources of sequence data for core region used for comparison with those obtained in this study. Genotype Isolate Accession no. lb HCJ 2 D10074 HCV-S1 AF356827 HCV-A AJ000009 HCV-N AF139594 MD33 AF207774 2a HCJ 6 D00944 NDM59 AF1690005 2b MA AB030907 5a INDIA AY051292 EUH1480 Y13184 Outgroup SynCon 51 University of Ghana http://ugspace.ug.edu.gh CHAPTER THREE RESULTS Sample Collection, Serological Testing and Confirmation A total of 200 blood samples were collected from donors at the National Blood Transfusion Service , Korle-Bu Teaching Hospital, Accra for the studies. The samples were screened for the identification of seropositive samples for virus extraction as described in materials and methods. Out of the 200 samples screened, 54 (27%) were found positive by low dilution (1 in 64) PA assay, 12 (6%) were positive by high (1 in 512) dilution PA assay. Only 1 of the 12 samples also reacted on ELISA, 1 sample reacted on ELISA alone but was found negative by PCR. HCV RNA was detected by PCR in 2 samples - HCV 152 and HCV 173 as seen in Fig. 5. HCV 152 was both PA and ELISA reactive while HCV 173 was reactive by PA only. The reactivity pattern is summarized in Table 5 below. Table 5: Reactivity profiles for thirteen subjects positive for anti-HCV by the SERODIA particle agglutination (PA) assay, ELISA and confirmation by PCR (n = 200) PA 1:512* ELISA PA 1: 512* 10 (2)p 1 ELISA l( l )p 2 Total Positives 13 2 p- indicates number of tested samples confirmed positive by PCR *PA 1:512 indicates the dilution of plasma sample in the SERODIA assay 52 University of Ghana http://ugspace.ug.edu.gh HCV 152 HCV 173 1 2 3 4 5 6 7 * 8 9 1 0 ^ bp 1,000 700 500 ► 300 268 -fr- Fig. 5. HCV detection in plasma samples. Electrophoretic mobility of HCV cDNA product in 2% agarose gel. Lane 1 - 100 bp molecular weight markers. Lane 2 - cDNA of globin mRNA as HCV positive control. Lanes 3, 4, 5, 6, 7 and 9 - RT-PCR amplified products showing no bands suggestive of HCV. Lanes 8 and 10 RT-PCR amplified products of plasma HCV RNA extracts showing product bands of size 268 bp indicating presence of HCV. 53 University of Ghana http://ugspace.ug.edu.gh The electrophoretic patterns of PCR products from different genotyping PCR reactions are shown in Fig. 6. Each sample was analysed twice by PCR with primer ‘Mix 1’ and ‘Mix 2’, electrophoresed on a 2% agarose gel and stained with ethidium bromide. Primer ‘mix 1’ amplification allows for the specific detection of PCR products for HCV genotypes lb, 2a, 2b and 3b while primer ‘mix 2’ allows for the specific detection of HCV genotypes la, 3a, 4, 5a and 6a. The sizes of the HCV genotype-specific products are given in Table 3. Lane 1 shows a lOObp DNA molecular weight marker. Lanes 2 and 3 contain the samples HCV 152 and HCV 173 respectively, amplified with primer ’mix 1’. Lanes 4 and 5 contain the same samples amplified with primer 'mix 2’. In ‘mix 1’ (left half). Two specific bands of sizes 190 and 337 corresponding to genotypes 2a and 2b respectively, were detected in lane 2, while a 190 bp band corresponding to genotype 2a was detected in lane 3. However, no such bands were detected in the corresponding lanes of ‘mix 2’ (lanes 4 and 5). Figure 7 shows the electrophoretic pattern of a semi-nested PCR amplification products obtained from the HCV infected samples for cloning. A sequence in the core region of the HCV genome was RT-PCR-amplified with Sc2 and Ac2 as first-round PCR primers and S7 (nucleotide position -12) and Ac2 (nucleotide position 417) as second-round PCR primers. The products (429 bp) were electrophoresed on a 2% agarose gel and stained with ethidium bromide 54 University of Ghana http://ugspace.ug.edu.gh Fig. 6. Electrophoretic patterns of PCR products from different genotyoing primer mix systems. Migration positions of PCR products of two different HCV types are shown in bold. Lane 1- lOObp DNA molecular weight markers Lanes 2 and 3 Two PCR reactive samples HCV 152 and HCV 173 respectively amplified with ‘primer mix 1 ’ system. Lanes 6 and 7 - Same PCR reactive samples HCV 152 and HCV 173, respectively, amplified with primer ‘mix 2’ system. 55 University of Ghana http://ugspace.ug.edu.gh M 2 3 4 5 6 7 8 bp 1,500 1,000 500 429bp 400 Fig. 7. Semi-nested PCR amplification products obtained from HCV infected samples to be purified for cloning. Lane 1 contains 100 bp DNA size markers. Lanes 3 and 5 products of HCV 152 and 173 respectively with size of 429 bp corresponding to the amplified HCV core region. 56 University of Ghana http://ugspace.ug.edu.gh Figure 8 shows the electrophoretic pattern of the rDNA (4.35 kb) obtained from cloning HCV cDNA (429 bp) purified from semi-nested PCR electrophoretic gel into pCR 2.1 TOPO vector (3.921 kb). The rDNA obtained was used to transform competent E. coli cells. DNA was purified from overnight cultures of E. coli colonies. In the figure, DNA bands of about 4.35kb (corresponding to the size of the expected rDNA) appeared in all the sample lanes. The sizes of the purified products (lanes 2 to 6) were estimated according to the migration pattern of a 1 kb molecular size marker. The numbers in parentheses are the clone numbers. In Fig. 9, the Eco RI digestion products of the five clones HCV 173 (1), 173 (2), HCV 152 (4), 152 (5) and HCV 152 (8) are shown in 2% agarose gel electrophoresis. DNA cleavage was achieved due to the presence of Eco Rl recognition sequence about eight base pairs before and after the PCR product insert site of the pCR 2.1-TOPO vector (Appendix II). Positive clones showed two bands of digestion products: the bigger band is that of the vector DNA (~ 3.9 kb) and the smaller band shows the insert DNA (~ 429 bp). 57 University of Ghana http://ugspace.ug.edu.gh 1 2 3 4 5 6 bp 12,000 5.000 4.000 4.3 kbp 1,000 500 Fig. 8. Agarose gel (2%) electrophoresis of recombinant DNA (rDNA) purified from cultured bacterial colonies. Lane 1 - migration positions of a 1 kb molecular size markers. Lanes 2, 3, 4, 5 and 6 - rDNA bands of about 4.35kb corresponding to the clones HCV 173 (1), 173 (2), HCV 152 (4), 152 (5) and HCV 152 (8). 58 University of Ghana http://ugspace.ug.edu.gh 1 2 3 4 5 6 bp 12,000 -> 4,000 3.9 kb-> 1,650 1,000 500 ► 429bp 400 ► Fig. 9. Eco RI digestion of DNA clones purified from cultured colonies of transformed E. coli. Lane 1 - lkb molecular weight markers Lanes 2 to 6 - Eco RI digestion products of HCV 173 (1), 173 (2), HCV 152 (4), 152 (5) and HCV 152 (8) respectively. Two product bands of sizes ~ 3.9 kb (bigger band) and ~ 429 bp (smaller band) corresponding to vector and insert DNA, respectively, were observed in each lane. 59 University of Ghana http://ugspace.ug.edu.gh cDNA Nucleotide Sequences and Analyses In all five clones were obtained and the core regions of four, comprising two from each of the two PCR positive HCV extracts, were successfully sequenced. Consensus sequences of the 4 clones were obtained and aligned together with references available for the core region. Table 6 shows the sequence identity matrix performed to compare the sequences obtained. There was poor homology (69.9%) between one pair of clones from HCV extract that showed dual genotype, 2a and 2b. The homology between the other pair that showed a single genotype, 2b was greater than 95%. The intertype homology varied from 70% to 95% depending on the clones compared. Table 6. Sequence identity matrix of four HCV clones from two HCV positive specimens Seq-> HCV 152 (4) HCV 152 (8) HCV 173 (1) HCV 172 (2) HCV 152(4)* 1.000 0.699 0.704 0.704 HCV 152 (8)f — 1.000 0.940 0.945 HCV 173 (l)f — ... 1.000 0.962 HCV 173 (2)f --- --- --- 1.000 t All HCV 173 clones and one clone o f HCV 152 (clone 8) show high similarity (> 92 %) to one another but different from one other clone o f HCV 152 (clone 4) *. The core HCV cDNA sequence of nucleotides of Ghanaian HCV extracts are shown in Fig. 10 together with some other isolates of HCV whose core sequences are available. The first twenty nucleotides at the 5’ end show the inner forward primer sequence used for the PCR amplification prior to cloning and sequencing. The same sequence was used to obtain available sequences from the Gene bank for comparison. Homologous nucleotides are highlighted on a black background. 60 University of Ghana http://ugspace.ug.edu.gh 2 0 4 0 5 0 Ee 3 *n h c v 152 HCV 152 HCV 173 HCV 173 EUH14B0 HCV-A HCV-H HCV-SI IHDIA MD33 HDM5 9 H C J 2 H C J 6 MA SynCOH HCV 152 (4 HCV 152 (8 HCV 17 3 (1 HCV 17 3 (2 EUH140O Fig. 10. Core nucleotide sequences of HCV cDNA. 61 University of Ghana http://ugspace.ug.edu.gh HCV-A HCV N HCV-SI IHDIA MD33 HDM5 9 HCJ 2 HCJ~6 MA S y n C O H HCV 15 2 (4 HCV 15 2 (8 HCV 173 (1 HCV 173 (2 EUH1480 HCV-A HCV-H HCV-SI IHDIA MD33 HDM5 9 HCJ 2 HCJ 6 MA SynCOH HCV 152 (4 HCV 152 (8 HCV 173 (1 HCV 17 3 (2 EUH1480 HCV-A HCV-H HCV-SI IHDIA MD33 HDM5 9 H C J 2 HCJ_6 MA S y n C O H .3 7; 0 380 390 . . . . s 400 410 . . . . s. . . . 4 2i0 HCV 15 2 (4 HCV 15 2 (8 HCV 17 3 (1 HCV 17 3 (2 EUH14B0 H C V A HCV-H HCV-S1 IHDIA MD33 HDM5 9 HCJ 2 62 University of Ghana http://ugspace.ug.edu.gh M A S y n C O H i n n a i l HCV 152 HCV 152 HCV 17 3 HCV 17 3 EUH1480 HCV-A HCV-H HCV-S1 I N D I A MD33 HDM59 HCJ 2 HCJ_6 M A S y n C O H 63 University of Ghana http://ugspace.ug.edu.gh 63 University of Ghana http://ugspace.ug.edu.gh Phylogenetic tree (neighbour joining) of HCV core sequences of four Ghanaian HCV cDNA clones (HCV 152 -4, HCV 152 -8, HCV 173 -1 and HCV 1 7 3 -2 ) and available reference sequences from the Gene bank using a synthetic construct (Syn CON) as an outgroup is shown in Fig. 11. The tree was constructed by the neighbour-joining method. The Ghanaian extracts are highlighted on a faint black background. The percentage of bootstrap replications (within branches at relevant nodes) supporting the branches leading to each clade is indicated. Bootstrap values are reported when greater than 55%. The branch leading to the group of Ghanaian extracts is 99% supported. Also the branch leading to the group of Ghanaian extracts and the group to which the HCJ 6 of genotype 2a belongs is 100% supported. 64 University of Ghana http://ugspace.ug.edu.gh Fig. 11. Phylogenetic tree of HCV core cDNA sequences of Ghanaian extracts (highlighted) and other available isolates. 65 University of Ghana http://ugspace.ug.edu.gh CHAPTER FOUR DISCUSSION AND CONCLUSION 4.1 DISCUSSION Hepatitis C virus infection has been associated with repeated exposure to blood and blood products in the absence of serological screening. Non-specific reactivity of anti-HCV in Ghanaians has been reported in a previous study, in which false positivity was resolved by a high dilution particle agglutination (PA) and third generation recombinant immunoblot assay (Ampofo et al., 2002). In this current investigation, out of 200 blood samples screened for anti-HCV, 2 (1%) were confirmed positive by PCR. The overall seroprevalence of 1% recorded in this study was in agreement with findings of the previous study in which HCV prevalence of 0.9% was observed among blood donors (Ampofo et al., 2002). Such prevalence is moderate compared to what occurs in other African countries (2 - 14%) as seen in Fig. 1, but high if compared with the prevalence levels in the United Kingdom and some parts of Japan (0.04 - 0.09%); North America, Western Europe and Israel (0.15 - 0.5%). HCV antibody screening might help to practically eliminate any transfusion-associated hepatitis. Positive anti-HCV test provides evidence of exposure to HCV. Blood donors are clearly not representative of the entire population, but scrutiny of HCV positive donors provides some insights into the epidemiology of this infection (Alter, 1995; Mansel and Locamini, 1995). The low specificity of the PA screening assay (Table 5) in this study could be attributed to non-specific reactivity with antibodies to the closely related viruses of the 66 University of Ghana http://ugspace.ug.edu.gh Flaviviridae family. The RT-PCR results shown in Fig. 5 confirmed the presence of HCV. Based on the first and second PCR primer pairs used, the second amplification product was expected to give a distinct band of 268 bp regardless of the genotype, when run on agarose electrophoretic gel. The products observed in Fig. 5 were in agreement with this. The very high band intensity of one of the PCR reactive samples (HCV 152) could be due to high viral load since the same amount of DNA extract was used for all the samples. Such information concerning the extent, or especially the apparent quantification of viraemia, is necessary to assist with the identification and monitoring of patients prior to or during an anti-viral therapy. It is also relevant for health care workers implicated in “injury-prone” activities such as surgery, other invasive diagnostic or therapeutic interventions, dental procedures and for chronically infected women planning pregnancy. The results from the determination of HCV genotypes using type-specific primers in RT- PCR techniques (Fig. 6) showed evidence that HCV type 2 is present in Ghana. This observation supports previous findings in a study conducted in Kumasi in which HCV type 2 was observed in pregnant women and blood donors (Wansbrough-Jones et al, 1998). It had been suggested that HCV genotypes 1 and 2 might be endemic in West Africa (Stuyver et al., 1994). The diagnosis of type 2 HCV, especially genotype 2a among blood donors in this study complements the proposal by Wansbrough-Jones et al (1998) that type 2 HCV might be indigenous to Ghana. 67 University of Ghana http://ugspace.ug.edu.gh Reports have shown that co-infection with more than one HCV subtype is common among intravenous drug abusers (De Socio et al., 1996). There is also some evidence that infection with different virus genotypes is associated with differences in the clinical course of disease, and the likelihood of developing hepatocellular carcinoma (Abe et al., 1998). Repeated exposure to blood and blood products, in the absence of serological screening and / or intravenous drug abuse might account for HCV infections observed since they are largely associated with a high risk of HCV exposure and infection (Alter et al., 1998, Thomas et al., 1995). HCV genotypes have been shown to be associated with specific geographical areas, specific routes of transmission and specific clinical implications (Zein, 2000; Amorso et al., 1998; Simmonds et al., 1996; Bukh et al., 1993). Genotypes 2 and 3 are predictive of a better response to interferon-a therapy than type 1, which is suggested to be associated with more severe liver disease than other genotypes (Feray et al., 1995; Martinot- Peignoux et al., 1995). Subtyping will be required not only for the initiation and monitoring of therapy, but also for the choice of vaccine and further follow up of vaccinees. Besides, genotyping is required for the correct interpretation of HCV antibody diagnosis. HCV genotypes 2a and 2b are most frequently found in Taiwan, East Asia, parts of China, (Decker and Troonen, 2001) and Japan (Okamoto et al., 1992). Overwhelming lines of epidemiological evidence have indicated direct involvement of hepatitis C virus infection, particularly genotype 2, in hepatocellular carcinoma (Koike et al., 2002; Abe et 68 University of Ghana http://ugspace.ug.edu.gh al., 1998). Perhaps a similar situation may exist in Ghana since HCV is rarely screened for in clinical practice and it may be necessary to do routine screening particularly for patients having liver and related problems to determine the contribution of HCV infection in such cases. Considering the geographical distribution of HCV genotypes, and the demonstrated presence of HCV type 2 in Ghana, there is the possibility that this genotype originated from countries in East Asia and USA, which are associated with genotypes 2a and 2b. Another possibility may be that these genotypes have been introduced across neighbouring West African countries namely Nigeria, Guinea, Burkina Faso, Gambia, and Benin due to the high rate of migration in the sub-region. A comparative analysis of nucleotide sequences of multiple clones of an RT-PCR fragment obtained from the core region indicated phylogenetic relatedness of HCV in Ghanaian extracts. The detection of the primer sequences (first twenty nucleotides) in the core HCV sequences compared as shown in Fig. 10 confirmed the validity of the procedure followed and the reliability of such primers used in this region for the detection HCV RNA. The pattern of Ghanaian HCV nucleotide sequences obtained in this study appeared to belong to a common phylogenetic group as seen (with shaded background) in Fig. 11; although they were also similar to sequences of some of the available isolates they were compared with. This was demonstrated by an inter-donor nucleotide similarity of at least 94%. There was 30% difference in cDNA nucleotide sequences of the sequences of the Ghanaian HCV extracts representing HCV genotypes 2a and 2b. The 69 University of Ghana http://ugspace.ug.edu.gh high genetic distance observed in one of the Ghanaian HCV extracts, HCV 152 (4), in the phylogenetic tree shown in Fig. 11 may indicate a more rapid process of diversification than other subtypes and perhaps, the possible existence of strains of unusual genotypes in asymptomatic Ghanaians (Mellor et a l, 1995). The need for routine screening of all blood donations for all transfusion-relevant viruses, with priority going to HCV, HBV and HIV, cannot be overemphasized. Also, the distribution of HCV genotypes needs to be periodically monitored since they may result in serious modifications of patterns of disease and responses to therapy in the future. 4.2 CONCLUSION This study has demonstrated that: (i) The current seroprevalence of HCV among healthy Ghanaians in Accra is 1%. (i) HCV genotype 2 is probably the prevalent HCV type common among blood donors in Accra. (ii) Intra- and intertype differences exist in Ghanaian HCV strains. However, these HCV strains appear to belong to a common phylogenetic group and seem to vary significantly from strains from other geographical regions. Overall, the endemicity of type 2 HCV in Ghana is evident. This local nucleotide sequencing procedure is one of the first attempts at molecular diagnosis of HCV infection in Ghana and also reports a novel genotype 2a/2b dual infection (Fig. 6) in Ghana. It presents the possibility of interferon-a treatment for HCV 70 University of Ghana http://ugspace.ug.edu.gh infections in Ghana. The results also support the previous suggestion by Wansbrough- Jones et al (1998) that HCV genotype 2 is indigenous to Ghana. Recommendations This study illustrates primarily the current transfusion-transmissible risk of HCV in Ghana. It is recommended that: 1. Effective routine HCV diagnosis is required not only for the safety of blood supply prior to transfusion but also for identifying carriers for initiation of treatment 2. Developing appropriate methods for HCV diagnosis will require evaluation of cost- effectiveness. 3. Results of this study stress the need to continue surveillance of circulating HCV genotypes to provide data for vaccine application in the country. 4. Complete subtype differentiation of the prevailing genotypes will be particularly useful in determining the route of infection and also reflect the past epidemiology of HCV transmission. 5. Further, there is the need to investigate the association of HCV types with clinical disease in an extended series of patients and symptom-free carriers, and in various populations. 6. Finally, isolation and determination of full-length HCV genomic sequences in Ghana may be helpful in designing vaccine and for serological investigations of possible group- and type-specific antibodies. 71 University of Ghana http://ugspace.ug.edu.gh REFERENCES Aach RD, Stevens CE, Hollinger FB, Mosley JW, Peterson DA, Taylor PE, Johnson RG, Barbosa LH, Nemo GJ (1991). Hepatitis C virus infection in post-transfusion hepatitis. An analysis with first- and second-generation assays. N Engl J Med\ 325: 1325-1329. Abe K, Edamoto Y, Park YN, Nomura AMY, Taltavull TC, Tani M, Thung SN. (1998). In situ detection of hepatitis B, C and G virus nucleic acids in human hepatocellular carcinoma tissues ftom different geographic regions. Hepatology; 28: 568-572. Acquaye JK, Tettey-Donkor D (2000). Frequency of hepatitis C virus antibodies and elevated serum alanine transaminase levels in Ghanaian blood donors. West Afr J Med; 19: 239-241. Alter HJ (1995). To C or not to C: these are the questions. J Am Soc Hematol; 85: 1681-1695. Alter HJ, Purcell RH, Shih JW, Melpolder JC, Houghton M, Choo QL, Kuo G (1989). Detection of antibody to hepatitis C virus in prospectively followed transfusion recipients with acute and chronic non-A, non-B hepatitis. N Engl J Med\ 321: 1494-1500. Alter MJ, Margolis HS, Krawczynsky K, Judson FN, Mares A, Alexander WJ, Hu PY, Miller JK, Gerber MA, Sampliner RE, Meeks EL, Beech MJ (1992). The natural history of community-acquired hepatitis C in the United States. N Engl J Med; 327: 1899-1905. 72 University of Ghana http://ugspace.ug.edu.gh Amoroso P, Rapicceta M, Tosti ME, Mele A, Spada E, Buonocore S, Lettieri G, Pierri P, Chionne P, Ciccaglione AR, Sagliocca L (1998). Correlation between virus genotype and chronicity rate in acute hepatitis C. J Hepatol', 28: 939-944. Amoroso P, Rapicetta M, Tosti ME, Mele A, Spada , Buonocore S, Lettieri G, Pierri P, Chionne P, Ciccaglione AR, Sagliocca L (1998). Correlation between virus genotype and chronicity rate in acute hepatitis C. J Hepatol, 28: 608-613. Ampofo W, Nii-Trebi N, Ansah J, Abe K, Naito H, Aidoo S, Nuvor V, Brandful J, Yamamoto N, Ofori-Adjei D, Ishikawa K (2002). Prevalence of blood-borne infectious diseases in blood donors in Ghana. J Clin Microbiol-, 40: 3523-3525. Barrera JM, Bruguera M, Ercilla MG, Gil C, Celis R, Gil MP, Del Valle Onorato M, Rodes J, Ordinas A (1995). Persisitent hepatitis C viremia after acute self-limiting posttransfusion hepatitis C. Hepatology; 21: 639-644. Bartenschlager R, Lohmann V (2000). Replication of hepatitis C virus. J Gen V; 81: 1631-1648. Bartensclager R, Ahlbom-Laake L, Mous J, Jacobsen H (1994). Kinetic and structural analyses of hepatitis C virus polyprotein processing. J Virol', 68: 5045­ 5055. Bhattacheijee V, Prescott LE, Pike I, Rodgers B, Bell H, El-Zayadi AR, Kew MC, Conradie J, Lin CK, Marsden H, Saeed AA, Parker D, Yap P-L, Simmonds P (1995). Use of NS-4 peptides to identify type-specific antibody to hepatitis C virus genotypes 1, 2, 3,4, 5, and 6. J Gen Virol; 76: 1737-1748. Bolten R, Egger D, Gosert R, Schaub G, Landmann L, Bienz K (1998). Intracellular localization of poliovirus plus- and minus-strand RNA visualized by strand-specific fluorescent in situ hybridization. J Virol', 72: 8578-8585. 73 University of Ghana http://ugspace.ug.edu.gh Boyer JC, Haenni AL (1994). Infectious transcripts and cDNA clones of RNA viruses. Virology, 198: 415-426. Bradley DW (1985). The agents of non-A, non-B hepatitis. J Virol Methods', 10: 307­ 319. Brandful JAM, Apeagyei FA, Ampofo WK, Adu-Sarkodie Y, Ansah JE, Nuvor S, Aidoo S, Ishikawa K, Sata T, Yamamoto N, Yamazaki S (1999). Relationship between immunoclinical status and prevalence of viral sexually transmitted diseases among human immunodeficiency virus-1 seropositive patients in Ghana. Viral Immunol, 12: 131-137. Bukh J, Purcell RH, Miller RH (1993). At least 12 genotypes of hepatitis C virus predicted by sequence analysis of the putative El gene isolates collected worldwide. Proc Natl Acad Sci, USA; 90: 8234-8238. Bukh J, Purcell RH, Miller RH (1992). Importance of primer selection for the detection of hepatitis C virus RNA with the polymerase chain reaction assay. Proc Natl Acad Sci, USA; 89: 187-191. Busch MP, Wilber JC, Johnson P, Tobler L, Evans CS (1992). Impact of specimen handling and storage on detection of hepatitis C virus RNA. Transfusion', 32: 4942­ 4946. Cerino A, Cividini A, Asti M, Lanza A, Silini E, Mondelli MU (1996). Comparative evaluation of two serologic typing methods for hepatitis C virus. J Clin Microbiol; 34: 714-716. Chamberlain RW, Adams N, Saeed AA, Simmonds P, Elliot RM (1997). Complete nucleotide sequence of a type 4 hepatitis C virus variant, the predominant genotype in the Middle East. J Gen Virol', 78: 1341-1347. 74 University of Ghana http://ugspace.ug.edu.gh Chan S-W, McOmish F, Holmes EC, Dow B, Peutherer JF, Follett E, Yap PL, Simmonds P (1992). Analysis of a new hepatitis C virus type and its phylogenetic relationship to existing variants. J Gen Virol, 73: 1131-1141. Chayama K, Tsubota A, Arase Y, Saitoh S, Koida I, Ikeda K, Matsumoto T, Kobayashi M, Iwasaki S, Koyama S, Morinaga T, Kumada H (1993). Genotypic subtyping of hepatitis C virus. J Gastroenterol Hepatol, 8: 150-156. Choo Q-L, Kuo G, Ralston R, Weiner A, Chien D, Van Nest G, Han J, Berger K, Thudium K, Kuo C, Kansopon J, McFarland J, Tabrizi A, Ching K, Moss B, Cummins LB, Houghton M, Muchmore E (1994). Vaccination of chimpanzees against infection by the hepatitits C virus. Proc Natl Acad Sci, USA; 91: 1294-1298. Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M (1989). Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science; 244: 359-362. Choo QL, Richman KH, Han JH, Gerger K, Lee C, Dong C, Gallegos C, Coit D, Selby-Medina A, Barr PJ, Weiner AJ, Bradley DW, Kuo G, Houghton M (1991). Genetic organization and diversity of the hepatitis C virus. Proc Natl Acad Sci ,USA; 88: 2451-2455. Choo Q-L, Weiner AJ, Overby LR, Kuo G, Houghton M, Bradley D (1990). Hepatitis virus: The major causative agent of viral non-A, non-B hepatitis. Br Med Bull, 46: 423-441. Cook L, Ross AM, Knight GB, Angello V (2000). Use of whole blood specimens for routine clinical quantitation of hepatitis C virus RNA does not increase assay sensititvity. J Clin Microbiol; 38: 4326-4331. University of Ghana http://ugspace.ug.edu.gh Cook L, Ross AM, Knight GB, Angello V (2000). Use of whole blood specimens for routine clinical quantitation of hepatitis C virus RNA does not increase assay sensitivity. J Clin Microbiol, 38 (12): 4326-4331. Courouce AM, Bouchardeau F, Girault A, Le Marrec N (1994). Significance of NS3 and NS5 antigens in screening for HCV antibody. Lancet; 343: 853-854. Courouce AM, Noel L, Barin F, Elghouzzi MH, Lunel F, North ML, Smilovici W (1998). A comparative evaluation of the sensitivity of five anti-hepatitis C virus immunoblot assays. Vox Sang-, 74: 217-224. Dana F, Becherer PR, Bacon BR (1994). Hepatitis C Virus. What recent studies can tell us. Postgrad Med; 95: 125-130. Davidson F, Simmonds P, Ferguson JC, Jarvis M, Dow BC, Follett AC, Seed CRG, Krusius T, Lin C, Medgyesi GA, Kiyokawa H, Olim G, Duraisamy G, Cuypers T, Saeed AA, Teo D, Conradie J, Kew MC, Lin M, Nuchaprayoon C, Ndimbie OK, Yap PL (1995). Survey of major genotypes and subtypes of hepatitis C virus using RFLP of sequences amplified from the 5’ noncoding region. J Gen Virol; 76: 1197-1207. de Lamballerie X, Charrel RN, Attoui H, De Micco P (1997). Classification of hepatitis C virus variants in six major types based on analysis of the envelope 1 and nonstructural 5B genome regions and complete polyprotein sequences. J Gen Virol; 78:45-51. De Socio GV, Francisci D, Mecozzi F, Sensini A, Polidori M, Castronari R, Panluzzi S, Stagni G (1996). Hepatitis C virus genotypes in the liver and serum of patients with chronic hepatitis C. Clin Microbiol Infect; 2: 20-24. Decker R and Troonen H (2001). Hepatitis C 1997: Essays and Expert Opinions on its Natural History, Epidemiology, Diagnosis and Therapy. Abbott Diagnostics Educational Services, Germany. June 2001 ed; p 6. 76 University of Ghana http://ugspace.ug.edu.gh Deleersnyder V, Pillez A, Wychowski C, Blight K, Xu J, Hahn YS, Rice CM, Dubuisson J (1997). Formation of native hepatitis C virus glycoprotein complexes. J Virol, 71: 697-704. Denis F, Aussel L, Ranger S, Martin P, Itoua-N’Gaporo A, Frommel D, Teckle- Haimanot RT, Sangare A, M’Boup S, Millan J, Alqubati Y (1994). Prevalence of antibodies to hepatitis C virus among patients with leprosy in several African countries and the Yemen. J Med Virol, 43: 1-4. Develoux M, Boni G, Agessy-Ahyi B, Gnahoui L, Delaporte E (1995). The prevalence of anti-hepatitis C antibodies in pregnant women and blood donors in Benin. Bulletin de la Societe de Pthologie Exotique; 88: 115-116. Di Bisceglie AM, Goodman ZD, Ishak KG, Hoofiiagle JH, Melpolder JJ, Alter HJ (1991). Long-term clinical and histopathological follow-up of chronic posttransfusion hepatitis. Hepatology, 14: 969-974. Dominique J, Fretz C, Traore Y, Kohdjo N, Bigot Andre, Pe Gamy E, Jourdan G, Kourouma K, Maertens G, Fumoux F, Foumel J-J, Stuyver L (1998). Evidence for high genetic diversity and long-term endemicity of hepatitis C virus genotypes 1 and 2 in West Africa. J Med Virol, 55: 92-97. Dow BC, Coote I, Munro H, McOmish F, Yap PL, Simmonds P, Foller EA (1993). Confirmation of hepatitis C virus antibody in blood donors. J Med Virol, 41: 215­ 220. Dusheiko G, Brown D (1993). HCV diagnosis, p 283-302. In: Zuckerman AJ, Thomas HC (eds). Viral hepatitis. Scientific basis and clinical management. Edinburgh, Scotland: Churchill Livingstone. Dusheiko G, Schmilovitz-Weiss H, Brown D, McOmish F, Yap P-L, Sherlock S, McIntyre N, Simmonds P (1994). Hepatitis C virus genotypes: an investigation of type-specific differences in geographic origin and disease. Hepatology, 19: 13-18. 77 University of Ghana http://ugspace.ug.edu.gh el-Zayadi A, Simmonds P, Dabbous H, Prescott L, Selim O, Ahdy A (1996). Response to interferon alpha of Egyptian patients infected with hepatitis C virus genotype 4. ./ Viral Hep; 3: 261-264. Enomoto N, Takada A, Nakao T, Date T (1990). There are two major types of hepatitis C virus in Japan. Biochem Biophys Res Commun; 170: 1021-1025. Farci P, Alter PH, Wong DC, Miller RH, Govindarajan S, Engle R, Shapiro M, Purcell RH (1994). Prevention of hepatitis C virus infection in chimpanzees after antibody-mediated in vitro neutralization. Proc Natl Acad Sci, USA; 91: 7792-7796. Feray C, Gigou M, Samuel D, Paradis V, Mishiro S, Maertens G, Reynes M, Okamoto H, Bismuth H, Brechot C (1995). Influence of the genotypes of hepatitis C virus on the severity of recurrent liver disease after liver transplantation. Gastroenterology; 108: 1088-1096. Flint M, Thomas J, Maidens C, Shotton C, Levy S, Barclay W, McKeating JA (1999). Functional analysis of cell surface-expressed hepatitis C virus E2 glycoprotein. J Virol; 73: 6782-6790. Fong TL, Di Bisceglie AM, Waggoner JG, Banks SM, Hoofnagle JH (1991). The significance of antibody to hepatitis C virus in patients with chronic hepatitis B. Hepatology; 14: 64-67. Galban GE, Padron G, Arus SE, Gonzalez O, Rodrigez Z, Mora S, Brito M (1992). Antibodies against hepatitis C virus. Study in voluntary blood donors. Cuba 1991. GEN; 46: 10-14. Gish RG, Qian K, Brooks L, Leung J, Xu Y, Pike I, Lau TY (1999). Characterization of anti-hepatitis C virus -positive sera not genotyped by restriction fragment length polymorphism or serology. J Gastroenterol Hepatol; 14: 339-344. 78 University of Ghana http://ugspace.ug.edu.gh Gordon SC, Elloway RS, Long JC, Dmuchowski CF (1993). The pathology of hepatitis C as a function of mode of transmission: blood transfusion vs. intravenouos drug use. Hepatology, 18: 1338-1343. Grakoui A, McCourt DW, Wychowski C, Feinstone SM, Rice CM (1993). Characterization of hepatitis C virus-encoded serine proteinase: determination of proteinase-dependent polyprotein cleavage sites. J Virol', 67: 2832-2843. Grant PR, Kitchen A, Barbara JAJ, Hewitt P, Sims CM, Garson JA, Tedder RS (2000). Effects of handling and storage of blood on the stability of hepatitis C virus RNA: implications for NAT testing in transfusion practice. Vox Sang', 78: 137-1.42. Halfon P, Khiri H, Gerolami V, Bourliere M, Feryn JM, Reynier P, Gauthier A, Cartouzou G (1996). Impact of various handling conditions on quantitative detection of hepatitis C virus RNA. J Hepatol; 25: 307-311. Hijikata M, Mizushima H, Tanji Y, Komoda Y, Hirowatari Y, Akagi T, Kato N, Kimura K, Shimotohno K (1993). Proteolytic processing and membrane association of putative non-structural proteins of Hepatitis C virus. Proc Natl Acad Sci, USA; 90: 10773-10777. Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Shimotohno K (1991). Gene mapping of the putative structural region of the hepatitis C virus genome by in vitro processing analysis. Proc Natl Acad Sci, USA; 88: 5547-5551. Hirowatari Y, Hijikata M, Tanji Y, Nyunoya H, Mizushima H, Kimura K, Tanaka T, Kato N, Shimotohno K (1993). Two proteinase activities in HCV polypeptide expressed in insect cells using baculovirus vector. Arch Virol, 133: 349-356. Holland JJ, De La Torre JC, Steinhauer DA (1992). RNA virus populations as quasispecies. Cur Top Microbiol Immunol, 176: 1-20. 79 University of Ghana http://ugspace.ug.edu.gh Honda M, Ping LH, Rijnbrand RCA, Amphlett E, Clerke B, Rowlands D, Lemon SM. (1996). Structural requirements for initiation of translation by internal ribosome entry within genone-length hepatitis C virus RNA. Virology, 222: 31-42. Hosein B, Fong CT, Popovsky MA, Ye J, Zhang M, Wang CY (1991). Improved serodiagnosis of hepatitis C virus infection with synthetic peptide antigen from capsid protein. Proc Natl Acad Sci; 88: 3647-3651. Hotta H, Kemapunmanus M, Apichartpiyakul C, Soetjipto, Handajanai R, Barzaga NG (1997). Differential distribution of hepatitis C virus subtypes in Asia: comparative study among Thailand, Indonesia, the Philippines and Japan. J Trop Med Public Health, Southeast Asia; 28: 23-31. Houghton M (1996). Hepatitis C virus, p 1035 - 1058. In: Fields BN, Knipe DM and Howley PM (eds). Fields Virology. Lippincott-Raven, Philadelphia. Houghton M, Weiner A, Han J, Kuo G, Choo Q-L (1991). Molecular Virology of the heptitis C viruses: implications for diagnosis, development and control of disease. Hepatology; 14: 381-388. Jeannel D, Fretz C, Traore Y, Kohdjo N, Bigot A, Pe Gamy E, Jordan G, Kourouma K, Maertens G, Fumoux F, Foumel JJ, Stuyver L (1998). Evidence for high genetic diversity and long-term endemicity of hepatitis C virus genotypes 1 and 2 in West Africa. J Med Virol; 55: 92-97. Johnson RJ, Gretch DR, Yamabe H, Hart J, Bacchi CE, Hartwell P, Couser WG, Corey L, Wener MH, Alpers CE, Wilson R (1993). Membranoproliferative glomerulonephritis associated with hepatitis C virus infection. N Engl J Med; 328: 465-470. Kao JH, Lai MY, Hwang YT, Yang PM, Chen PJ, Sheu JC, Wang TH, Hsu HC, Chen DS (1996). Chronic hepatitis C without anti-hepatitis C antibodies by second- 80 University of Ghana http://ugspace.ug.edu.gh generation assay. A clinicopathologic study and demonstration of the usefulness of a third-generation assay. Dig Dis Sci; 41: 161-165. Kato N (2000). Genome of human hepatitis C virus (HCV): gene organization, sequence diversity, and variation. Microb Comp Genomics; 5: 129-151. Kesler HH, Stelzl E, Raggam RB, Haas J, Kirchmeir F, Hegenbarth K, Daghofer E, Santner BI, Marth E, Stauber RE. (2001). Effects of storage and type of blood collection tubes on hepatitis C virus level in whole blood samples. J Clin Microbiol; 39:1788-1790. Koike K (2002). Hepatocarcinogenesis in hepatitis viral infection: lessons from transgenic mouse studies. J Gastroenterol; 37 (Suppl 13): 55-64. Kolykhalov AA, Mihalik K, Feinstone SM, Rice CM (2000). Hepatitis C virus- encoded enzymatic activities and conserved RNA elements in the 3’ nontranslated- region are essential for virus replication in vivo. J Virol; 74: 2046-2051. Konomi N, Miyoshi C, La Fuente Zerain C, Li T-C, Arakawa Y, Abe K (1999). Epidemiology of hepatitis B, C, E and G virus infections and molecular analysis of hepatitis G virus isolates in Bolivia. J Clin Microbiol; 37: 3291-3295. Konomi N, Yamaguchi M, Naito H, Aiba N, Saito T, Arakawa Y, Abe K. (2000). Simultaneous detetion of hepatitis B, C, and G viral genomes by multiplex PCR method. JIfect Dis (Short Communicatio); 53: 70-72. Konomi N, Yamaguchi M, Naito H, Aiba N, Saito T, Arakawa Y, Abe K (2000). Simultaneous detection of hepatitis B, C and G viral genomes by multiplex PCR method. Jpn J Infect Dis; 53: 70-72. Koziel MJ (1996). Immunology of viral hepatitis. Am J Med; 100: 98-109. 81 University of Ghana http://ugspace.ug.edu.gh Koziel MJ, Dudley D, Afdhal N, Choo QL, Houghton M, Ralston K, Walker bU (1993). Hepatitis C virus (HCV)- specific cytotoxic T lymphocytes recognize epitopes in the core and envelope proteins of HCV. J Virol', 67: 7522-7532. Koziel MJ, Dudley D, Wong JT, Dienstag J, Houghton M, Ralston R, Walker BD (1992). Intrahepatic cytotoxic T lymphocytes specific for hepatitis C virus in persons with chronic hepatitis. J Immunol, 149: 3339-3344. Lai ME, Mazzoleni AP, Argiolu F, De Virgilis S, Balestrieri A, Purcell RH, Cao A, Farci P (1994). Hepatitis C virus in multiple episodes of acute hepatitis in polytransfused thalassaemic children. Lancet, 343: 388-390. Lanford RE, Sureau C, Jacob JR, WhiteR, Fuerst TR. (1994). Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand specific RT-PCR. Virology, 202: 606-614. Lau JYN, Mizokami M, Kolberg JA, Davis GL, Prescott LE, Ohno T, Perillo RP, Lindsay KL, Gish RG, Qian K-P, Kohara M, Simmonds, Urdea MS (1995). Application of six hepatitis C virus genotypring systems to sera from chronic hepatitis C patients in the United States. J Infect Dis; 171: 181-189. Lohmann V, Komer F, Koch JO, Herian U, Theilmann L, Bartenschlager R (1999b). Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell lin. Science-, 285: 110-113. Machida A, Ohnuma H, Tsuda F, Munekata E, Tanaka T, Akahane Y, Okamoto H, Mishiro S (1992). Two distinct subtypes of hepatitis C virus defined by antibodies directed to the putative core protein. Hepatology, 16: 886-891. 82 University of Ghana http://ugspace.ug.edu.gh Maggi F, Vatteroni ML, Pistello M, Avio CM, Cecconi N, Panicucci F, Bendinelli M (1995). Serological reactivity and viral genotypes in hepatits C virus infection. J Clin Microbiol', 33: 209-211. Mansell CJ, Locamini SA (1995). Epidemiology of hepatitis C in the East. Semin Liver Dis; 15: 15-32. Martell M, Esteban JI, Quer J, Genesca J, Weiner A, Esteban R, Guardia J, Gomez J (1992). Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution. J Virol; 66: 3225­ 3229. Martinot-Peignoux M, Marcellin P, Pouteau M, Castelnau C, Boyer N, Poliquin M, Degott C, Descombes I, Le Breton V, Molitova V, Benhamou JP, Erlinger S (1995). Pretreatment serum hepatitis C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interferon alfa therapy in chronic hepatitis C. J Infect Dis; 22: 1050-1056. Martinot-Peignoux M, Roudot-Thoraval F, Mendel I, Coste J, Izopet J, Duverlie G, Payan C, Pawlotsky JM, Defer C, Bogard M, Gerolami V, Halfon P, Buisson Y, Fouqueray B, Loiseau P, Lamoril J, Lefrere JJ, Marcellin P (1999). Hepatits C virus genotypes in France: relationship with epidemology, pathogenicity and response and response to interferon therapy. J Viral Hep; 6: 435-443. Martinson FEA, Weigle KA, Mushahwar IK, Weber DJ, Royce R, Lemon SM. (1996). Seroepidemiological survey of hepatitis B and C virus infections in Ghanaian children. J Med Virol; 48: 278-283. Maxam AM, Gilbert W (1977). A new method for sequencing DNA. Proc Natl Acad Sci, USA; 74: 560-564. McHutchinson JG, Person JL, Govindarajan S, Vanlinluck B, Gore T, Lee SR, Nelles M, Polito A, Chien D, DiNello R, Quan S, Kuo G, Redeker AG (1992). Improved 83 University of Ghana http://ugspace.ug.edu.gh detection of hepatitis C virus antibodies in high-risk populations. Hepatology, 15: 19-25. McOmish F, Chan SW, Dow BC, Gillon J, Frame WD, Crawford RJ, Yap PL, Follet EA, Simmonds P (1993). Detection of three types of hepatitis C virus in blood donors: investigation of type-specific differences in serologic reactivity and rate of alanine aminotransferase abnormalities. Transfusion-, 33: 7-13. Mellor J, Holmes EC, Jarvis LM, Yap PL, Simmonds P and the International HCV Collaborative Study Group. (1995). Investigation of the pattern of hepatits C virus sequence diversity in different geographical regions: implications for virus classification. J Gen Virol, 76: 2493-2507. Mendenhall CL, Chedid A, French SW, Ray M, Roselle GA, Grossman CJ, Weesner RE, Gartside PS (1991). Alpha-fetoprotein alterations in alcoholics with liver disease. V. A Cooperative Study Groups. Alcohol Alcohol, 26: 527-534. Miller RH, Purcell RH (1990). Hepatitis C virus shares amino acid sequence similarity with pestiviruses and flaviviruses as well as members of two plant virus supergroups. Proc Natl Acad Sci, USA; 87: 2057-2061. Mills DR, Kramer FR (1979). Structure-independent nucleotide sequence analysis. Proc Natl Acad Set, 76: 2232-2235. Missale G, Bertoni R, Lamonaca V, Valli A, Missari M, Mori C, Rumi MG, Houghton M, Fiaccadori F, Ferraei C (1996). Different clinical behaviours of acute hepatitis C virus infection are associated with different vigour of the anti-viral cell- mediated immune response. J Clin Investig, 98: 706-714. Miyachi H, Masukawa A, Ohshima T, Hirose T, Impraim C, Ando Y (2000). Automated specific capture of hepatitis C virus RNA with probes and paramagnetic particle separation. J Clin Microbiol; 38: 18-21. 84 University of Ghana http://ugspace.ug.edu.gh Mori S, Kato N, Yagyu A, Tanaka T, Ikeda Y, Petchclai B, Chewsilp P, Kurimura T, Shimotohno K (1992). A new type of hepatitis C virus in patients in Thailand. Biochem Biophysis Res Commun; 183: 334-342. Naito H, Win KM, Abe K (1999). Identification of a novel genotype of hepatitis G virus in Southeast Asia. J Clin Microbiol; 37: 1217-1220. Nakao T, Enomoto N, Takada N, Takada A, Date T (1991). Typing of hepatitis C virus genomes by restriction fragment length polymorphism. J Gen Virol\ 72: 2105­ 2112. National Institutes of Health. (1997). National Institutes of Health Consensus development conference panel statement: management of hepatitis C. Hepatology; 26: 2S-10S. Nousbaum JB, Pol S, Nalpas B, Landais P, Berthelot P, Brechot C (1995). Hepatitis C virus type lb (II) infection in France. Collabrative Study Group. Ann Intern Med; 122: 161-168. Nousbaum JB (1998). Genomic subtypes of hepatitis C virus: epidemiology, diagnosis and clinical consequenses. Bull Soc Pathol Exot; 91: 29-33. Ogata N, Alter HJ, Miller RH, Purcell RH (1991). Nucleotide sequence and mutation rate of the H strain of hepatitis C virus. Proc Natl Acad Sci, USA; 88: 3392-3396. Ohno T, Mizokami M, Wu R, Saleh MG, Ohba K, Orito E, Mukaide M, Williams R, Lau JYN (1997). New hepatitis C virus (HCV) genotyping system that allows for identification of HCV genotypes la, lb, 2a, 2b, 3a, 3b, 4, 5a and 6a. J Clin Microbiol; 30: 201-207. 85 University of Ghana http://ugspace.ug.edu.gh Okamoto H, Kurai K, Okada S, Yamamoto K, Lizuka H, Tanaka T, Fukuda S, Tsuda F, Mishiro S (1992). Full-lehgth sequence of hepatits C vimrus having poor homology to reported isolates: comparative study of four distinct genotypes. Virology, 188: 331-341. Okamoto H, Kurai K, Okada S-I, Yamamoto K, Lizuka H, Tanaka T, Fukuda S, Tsuda F, Mishiro S (1992). Full-length sequence of a hepatitis C virus genome having poor homology to reported isolates: comparative studu of four distinct genotypes. Virology; 188: 331-341. Okamoto H, Okada S, Sugiyama Y, Yotsumoto S, Tanaka T, Yoshizawa H, Tsuda F, Miyakawa Y, Muyami M (1990). The 5’-terminal sequence of the hepatitis C virus genome. Jpn J Exp Med; 60: 167-177. Okamoto H, Tokita H, Sakamoto M, Horikita M, Kojima M, lizuka H, Mishiro S (1993). Characterization of the genomic sequence of type V (or 3a) hepatitis C virus isolates and PCR primers for specific detection. J Gen Virol; 74: 2385-21390. Pestova TV, Shatsky IN, Fletcher SP, Jackson RJ, Hellen CU (1998). A prokaryotic- like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNAs. Gene Develop; 12: 67-83. Pileri P, Uematsu Y, Campagnoli S, Galli G, Falugi F, Petracca R, Weiner AJ, Houghton M, Rosa D, Grandi G, Abrignani S (1998). Binding of hepatitis C virus to CD81. Science; 282: 938-941. Prati D, Capelli C, Zanella A, Mozzi F, Bosoni P, Pappalettera M, Zanuso F, Vianello L, Locatelli E, De Fazio C, Ronchi G, Del Ninno E, Colombo M, Sirchia G (1996). Influence of different hepatitis C virus genotypes on the course of asymptomatic hepatitis C virus infection. Gastroenterology; 110: 178-183. 86 University of Ghana http://ugspace.ug.edu.gh Prince AM, Brotmn B, Inchauspe G, Pascaul D, Nasoff M, Hasein B, Wang CY. (1993). Patterns of prevalence of hepatitis C virus infection in posttransfussion non­ A, non-B heptitis. J Infect Dis; 167: 1296-1301. Reed KE, Gorbalenya AE, Rice CM (1998). The NS5A/NS5 proteins of viruses from three genera of the family Flaviviridae are phosphorylated by associated serine/ threonine kinases. J Virol; 72: 6199-6206. Reed KE, Rice CM (1999). Molecular characterization of the hepatitis C virus. In Hepatitis C Virus, 2nd edn, pp 1 - 37. Edited by HW Reesink., Basel, Switzerland: Karger. Remy AJ, Verdier E, Pemey P, Ducos J, Blanc P, Blanc F, Larrey D (1998). Route of infection, liver histology and response to interferon in patients with chronic hepatitis caused by genotype 4 HCV infection in a Western country. J Hep; 29:169. Reynolds JE, Kaminsky A, Kettinen HJ, Grace K, Clerke BE, Carroll AR, Rowlands DJ, Jackson RJ. (1995). Unique features of internal initiation of hepatitis C virus RNA translation. EMBOJ; 14: 6010-6020. Robertson B, Myers G, Howard C, Brettin T, Bukh J, Gaschen B, Gojobori T, Maertens G, Mizokami M, Nainan O, Netesov S, Nishioka K, Shin-i T, Simmonds P, Smith D, Stuyver L, Weiner A (1998). Classification, nomenclature and database development for hepatitis C virus (HCV) and related viruses: proposals for standardization. International Committee on Virus Taxonomy. Arch Virol; 143: 2493-2503. Sakamoto M, Akahane Y, Tsuda F, Tanaka T, Woodfield DG, Okamoto H (1994). Entire nucleotide sequence and characterization of a hepatitis C virus of genotype V/3a. JGen Virol; 75: 1761-1768. 87 University of Ghana http://ugspace.ug.edu.gh Saluz HP, Jost JP (1989). Genomic sequencing and in vivo footprinting. Anal Biochem; 176: 201-208. Sambrook J, Russell DW (2001). Preparation and transformation of competent E coli using calcium chloride. In: Molecular Cloning - A laboratory manual (3rd ed), pp 1.116-1.118. Published by Cold Spring Harbor Laboratoy Press, Cold Spring Harbor, New York. Schmidt WN, Klinzman DM, LaBrecque DR, Macfarlane DE, Stapleton JT (1995). Direct detection of hepatitis C virus (HCV) RNA from whole blood, and comparison with HCV RNA in plasma and peripheral blood mononuclear cells. J Med Virol, 47: 153-160. Shakil AO, Conry-Cantilena C, Alter HJ, Hayashi P, Kleiner DE, Tedeski V, Krawczynski K, Conjeevaram HS, Sallie R, Di Bisceglie AM (1995). Volunteer blood donors with antibody to hepatitis C virus: Clinical, biochemical, virologic and histologic features (1995). Ann Inter Med; 123:330-337. Shakil AO, Conry-Cantilena C, Alter HJ, Hayashi P, Kleiner DE, Tedeski V, Krawczynski K, Conjeevaram HS, Sallie R, Di Bisceglie AM (1995). Volunteer blood donors with antibody to hepatitis C virus: Clinical, biochemical, virologic and histologic features (1995). Ann Inter Med; 123:330-337. Silini E, Bono F, Cividini A, Cerini A, Bruno S, Rossi S, Belloni G, Brugnetti B, Civardi E, Salvaneschi L, Mondelli MU (1995). Differential distribution of hepatitis C virus genotypes in patients with and without liver function abnormalities. Hepatology; 21: 285-290. Simmonds P (1995). Variability of hepatitis C virus. Hepatology; 21: 21S-28S. Simmonds P. (1999). Viral heterogeneity of the hepatitis C virus. J Hepatol; 31 (Suppl): 54-60. 88 University of Ghana http://ugspace.ug.edu.gh Simmonds P, Alberti A, Alter HJ, Bonino F, Bradley DW, Brechot C, Brouwer JT, Chan SW, Chayama K, Chien DS, Choo Q-L, Colombo M, Cuypers HTM, Date T, Dusheiko GM, Esteban JI, Fey O, Hadziyannis SJ, Han J, Hatzakis A, Holmes EC, Hotta H, Houghton M, Irvine B, Kohara M, Kolberg JA, Kuo G, Lau JYN, Lelie PN, Maertens G, McOmish F, Miyamura M, Mizokami M, Nomoto A, Prince AM, Reesink HW, Rice C, Roggendorf M, Schalm SW, Shikata T, Shimotohno K, Stuyver L, Trepo C, Weiner A, Yap PL, Urdea MS (1994). A proposed system for the nomenclature of hepatitis C viral genotypes. Hepatology; 19: 1321-1324. Simmonds P, Holmes EC, Cha TA, Chan S-W, McOmish F, Irvine B, BealL E, Yap PL, Kolberg J, Urdea MS. (1993a). Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogentic analysis of the NS-5 region. J Gen Virol; 74: 2391-2399. Simmonds P, Mellor J, Craxi A, Sanchez-Tapiaz JM, Albeti A, Prieto J, Colombo M, Rumi MG, Lo Jacano 0 , Ampurdances-Mingall S, Foms-Bemhardt X, Chemollo L, Civeira MP, Frost C, Dusheiko G (1996). Epidemiological, clinical and therapeutic associations of hepatitis C types in western Europeans patients. J Hepatol 24: 517­ 524. Smith DB, Pathirana S, Davidson F, Lawlor E, Power J, Yap PL, Simmonds P (1997). The origin of hepatitis C virus genotypes. J Gen Virol; 78: 321-328. Stuyver L, Rossau R, Wyseur A, Duhamel M, Vanderborght B, Van Heuverswyn H, Maertens G. (1993). Typing of hepatitis C virus isolates and characterization of new subtypes using a line probe assay. J Gen Virol; 74: 1093-1102. Stuyver L, van Arnhem W, Wyseur A, Hernandez F, Delaporte E, Maertens G (1994). Classification of hepatitis C virus based on phylogenetic analysis of the envelope 1 and non-structural 5b regions and identification of five additional subtypes. Proc Natl Acad Sci, USA; 91: 10134-10138. 89 University of Ghana http://ugspace.ug.edu.gh Stuyver L, Wyslur A, van Arnhem W, Hernandez F, Maertens G (1996). Second- generation line probe assay for hepatitis C virus genotyping. J Clin Microbiol, 34: 2259-2266. Takada T, Tsutsumi M, Zhang SC, Okanoue T, Matsushima T, Fujiyama S, Komatsu M (1996). Relationship between hepatocellular carcinoma and subtypes of hepatitis C virus: a nationwide analysis. J Gastroenterol Hepatol; 11: 166-169. Tanaka T, Tsukiyama Kohara K, Yamaguchi K, Yagi S, Tanaka S, Hasegawa A, Ohta Y, Hattori N, Kohara M (1994). Significance of specific antibody assay for genotyping of hepatitis C virus. Hepatology, 19: 1347-1353. Tanji Y, Hijikata M, Hirowatari Y, Shimotohno K (1994). Hepatitis C virus polyprotein processing: kinetics and magnetic analysis of serine proteinase-dependent cleavage. J Virol, 68: 8418-8422. Tanji Y, Hijikata M, Satoh S, Kaneko T, Shimotohno K (1995a). Hepatitis C virus- encoded nonstructural protein NS4A has versatile functions in viral protein processing. J Virol, 69: 1575-1581. Thomas DL, Vlahov D, Solomon L, Cohn S, Taylor E, Garfein R, Nelson KE. (1995). Correlates of hepatitis C virus infections among injection drug users. Medicine-, 74: 212-220 . Thomssen R, Bonk S, Propfe C, Heermann KH, Kochel HG, Uy A (1992). Association of hepatitis C virus in human sera with beta-lipoprotein. Med Microbiol Immunol, 181: 293-300. Tokita H, Okamoto H, Lizuka H, Kishimoto J, Tsuda F, Miyakawa Y, Mayumi M (1998). The entire nucleotide sequences of three hepatitis C virus isolates in genetic groups 7-9 and comparison with those in the other eight genetic groups. J Gen Virol; 79: 1847-1857. 90 University of Ghana http://ugspace.ug.edu.gh Tokita H, Okamoto H, Luengrojanakul P, Vareesangthip K, Chainuvati T, Lizuka H, Tsuda F, Miyakawa Y, Mayumi M (1995). Hepatitis C vims variants from Thailand classifiable into five novel genotypes in the sixth (6b), seventh (7c, 7d) and ninth (9b,9c) major genetic groups. J Gen Virol; 76: 2329-2335. Tretskaia TA, Shakhgil’dian IV, Iashina TL, Kravchenko VK, Liubchak VA, Mkhno LA, Grechishkin VS, D’iachenko Al, Favorov MO (1993). The incidence of detecting hepatitis C antibodies in different age groups of the population in northeastern Ukrain. Vopr Virusol; 38: 137-138. Tsukiyama-Kohara K, lizuka N, Kohar M, Nomoto A (1992). Internal ribosome entry site within hepatitis C virus RNA. J Virol, 66: 1476-1483. Tsukiyama-Kohara K, Lizuka N, Kohara M, Nomoto A (1992). Internal ribosome entry site within hepatitis C virus RNA. J Virol; 66: 1476-1483. Wang C, Samow P, Siddiqui A (1993). Translation of human hepatitis C virus RNA in cultured cells is mediated by internal ribosome-binding mechanism. J Virol, 67: 3338-3344. Wansbrough-Jones MH, Frimpong E, Cant B, Harris K, Evans MRW, Teo CG. (1998). Prevalence and genotype of hepatitis C virus infection in pregnant women and blood donors in Ghana. Trans Roy Soc Trop Med and Hyg\ 92: 496-499. White PA, Zhai X, Carter I, Zhao Y, Rawlinson WD (2000). Simplified hepatitis C virus genotyping by heteroduplex mobility analysis. .J Clin Microbiol, 38: 477-482. Wolfgang J (1998). Viral hepatitis: A clinical guide. Abbott Diagnostics Division, Germany. June 1998 ed; p 15-18. Wolk B, Sansono D, Krausslich HG, Dammacco F, Rice CM, Blum HE, Moradpour D (2000). Subcellular localization, stability and trans-cleavage of the hepatitis C 91 University of Ghana http://ugspace.ug.edu.gh virus NS3-NS4A complex expressed in tetracyclin-regulated cell lines. J Virol, 74: 2293-2304. Yamashita T, Kaneko S, Shirota Y, Qin W, Numora T, Kobayashi K, Murakami S (1998). RNA-dependent RNA polymerase activity of the soluble recombinant hepatitis C virus NS5B protein truncated at the C-terminal region. J Biol Chem; 273: 15479-15486. Yanagi M, St Claire M, Emerson SU, Purcell RH, Bukh J (1999). In vivo analysis of the 3’ untranslated region of the hepatitis C virus after in vitro mutagenesis of an infectious cDNA clone. Proc Natl Acad Sci, USA; 96: 2291-2295. Yasui K, Wakita T, Tsukiyama KK, Funahashi SI, Ichikawa M, Kajita T, Moradpour D, Wands JR, Kohara M (1998). The native form and maturation process of hepatitis C virus core protein. J Virol, 72: 6048-6055. Yoshioka K, Kakumu S, Wakita T, Ishikawa T, Itoh Y, Takayanagi M, Higashi Y, Shibata M, Morishita T (1992). Detection of hepatitis C virus by polymerase chain reaction and response to interferon-alpha therapy: relationship to genotypes of hepatitis C virus. Hepatology, 16: 293-299. Yuan ZH, Kumar U, Thomas HC, Wen YM, Monjardino J (1997). Expression, purification and partial characterization of HCV RNA polymerase. Biochem Biophys Res Commun; 232: 231-235. Zein NN, Germer JJ, Wendt NK, Schimek CM, Thorvilson JN, Mitchell PS, Persing DH (1997). Intermediate results of the second-generation hepatitis C virus (HCV) recombinant immunoblot assay: significance of high-level c22-3 reactivity and influence of HCV genotypes. J Clin Microbiol, 35: 311-312. Zein NN, Li H, Persing DH (1999). Humoral immunity in acute and chronic hepatitis C infection. Gastroenterology, 116: 135-143. 92 University of Ghana http://ugspace.ug.edu.gh Zein NN, Poterucha JJ, Gross JB Jr, Wiesner RH, Themeau TM, Gossard AA, Wendt NK, Mitchell PS, Germer JJ, Persing DH (1996). Increased risk of hepatocellular carcinoma in patients infected with hepatitis C genotype lb. Am J Gastroenterol, 91: 2560-2562. Zein NN, Rakela J, Krawitt E L, Reddy KR, Tominaga T, Persing DH (1996). Hepatitis C virus genotypes in the United States: epidemiology, pathogenecity, and response to inteferon therapy. Ann Intern Med; 125: 634-639. Zein NN, Rakela J, Persing DH (1995). Genotype dependent serologic reactivities in patients infected with chronic hepatitis C virus in the United States. Mayo Clin Proc; 70: 449-452. Zein NN (2000). Clinical significance of hepatitis C virus genotypes. Clin Microbiol Rev; 13: 223-235. Zeuzem S, Schmidt JM, Lee JH, von Wagner M, Teuber G, Roth WK (1998). Hepatits C virus dynamics in vivo: effect of ribavirin and interferon alfa on viral turnover. Hepatology; 28: 245-252. Zibert A, Schreier E, Roggendorf M (1995). Antibodies in human sera specific to hypervariable region 1 of hepatitis C virus can block viral attachment. Virology; 208: 653-661. 93 University of Ghana http://ugspace.ug.edu.gh APPENDICES APPENDIX I Restriction map of pCR 2.1 TOPO Vector ATG Htndi Sac I i I I I Spi i>1Ml j ftcr.crM Pfrnor I_____ CAG GAA AGA OCT A T G AC C ATG A TT ACG CCA AGC T T G GI A CCG AGC TOG GAT CCA C TA GTC C T T TGT CGA TAC TG G TAC TAA TOC GGT TC G A AC CAT GGC TC G AGC CTA GGT GAT fls'Xl £mRl I EcaRlI GTA ACG GCC QCC AGT GTG C TG GAA T T C GQC T T J PCR Product f y GCC GAA T T C TGC CAT TGC CGG CGG TC A CAC GAC C T T AAG CCG f l IT T CGG C TT A A G ACG Aval P k « 7 I Neti Xha I Uw i Xhai AGA TA T CCA TCA CAC TGG duG CCG C^TC GAG CAT OCA T^CT AGA GGG CtiC AAT TC G CCC TAT TC T ATA GGT AGT G TG ACC QCC GGC GAG C TC G TA CGT AGA TC T CCC GGG T T A AGC GOG ATA 17 Promoter M13 oiwad ( 2CJ| ^ tn c r AGT GAG TCG TAT TA c AAT TCA C TG GCC GTC GTT TTA C A A C G T OGT GAC TGG GAA AAC \ TC A CTC AQC A TA AT G TTA AGT GAC CGG CAG C M AAT G T T GC A GCA C TG ACC C T T T T G 94 University of Ghana http://ugspace.ug.edu.gh a p p e n d i x II Complementary DNA sequence graph of Ghanaian HCV extract c a G ic iP T » c o a L CCCIX3 a a a e a a a a r c n j u s t ig vc 10 20 30 40 SO SO i i r GOD m3 OXC T G P G rtn m T w m iO O g q c c ^ A J D O T i JOTTiM n M ^ r r r e n a c r e ^ i y r r r r r r a r g r r r T ^ ^ 70 SO 00 100 110 120 130 140 150 1C0 r r r * ^ m r t iiJ t ii± xvu-xj*-cr-BirrTrtrr'j*erriu ifLrr~n i m w w -i^ n p ^ :r r r j< « r ? if «r»rrT ^n«r»«rT T frr> n '70 180 1B0 200 210 220 230 0 2S0 260 I Ta^ jg^'q^j^ CLU^Tqagrgpg o iMfccy c cP' xf i/maro iu ixra«**q3c*wô 270 280 290 300 310 320 330 340 330 q m jG o g a jA T /tto r a i i o u a ^ m ^ •c t t .v-u j c*T (j j m r r c a r r a o r H r r a it rc u a v i ic t t t g o g s t a 300 370 3S0 3B0 400 410 420 430 440 4S0 460 a A . 95