University of Ghana http://ugspace.ug.edu.gh STUDIES ON THE DISTRIBUTION OF THE ALLOTYPIC VARIANTS OF THE IgG RECEPTORS (FcyRIIa AND FcyRIHb) AND THEIR ASSOCIATION WITH SEVERE CLINICAL MALARIA AMONG GHANAIAN CHILDREN A THESIS SUBMITTED BY BRIDGETTE-MARIAN OGOE (10031528) B. Sc. (University of Science and Technology), 1993. TO THE DEPARTMENT OF BIOCHEMISTRY, FACULTY OF SCIENCE, UNIVERSITY OF GHANA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE AWARD OF THE MASTER OF PHILOSOPHY DEGREE IN BIOCHEMISTRY SEPTEMBER 2001 University of Ghana http://ugspace.ug.edu.gh £368*59 Qfc\U-ZQ1 \&\^C cA University of Ghana http://ugspace.ug.edu.gh I hereby declare that, with the exception of references to other peoples work which I have duly acknowledged, all the experimental work described in this thesis was carried out by me, and this thesis, either in whole or in part has not been presented elsewhere for another degree. DECLARATION MRS BRIDGETTE-MARIAN OGOE (STUDENT) DR. YAA DIFIE OSEI (SUPERVISOR) (SUPERVISOR) University of Ghana http://ugspace.ug.edu.gh DEDICATION To my children; Kimmy, Kobby and Joojo University of Ghana http://ugspace.ug.edu.gh ACKNOWLEDGEMENTS I would like to thank my supervisors Dr Y.D. Osei and Dr M.D. Wilson for their guidance, advice and support throughout this project. I am also grateful to Dr D. Adu and Dr W. Tse of the Queen Elizabeth Hospital, Birmingham, UK for their immense contribution in donating primers and giving valuable advice. The field work done at Dodowa was made possible with the generous help and assistance of Dr K.A. Koram and the staff (Mr Fenteng, Mr Osei, Mr Attiogbe, Mr Boafo and Miss Celestina Opoku-Ampomah) of the Epidemiology Unit of the Noguchi Memorial Institute for Medical Research. The work done at the Department of Child Health, Korle-Bu Teaching Hospital could not have been done without the support of Dr P.O. Rodrigues, the then acting head of the Department, Dr B. Goka, physician in charge of the Malaria-2000 project and her team of physicians, and Dr B.D. Akanmori and staff of the Immunology Unit of the Noguchi Memorial Institute for Medical Research. I am especially grateful to Mr Addai of the Haematology Unit of the Noguchi Memorial Institute for Medical Research and Mr Ankrah of the Clinical Pathology department of the Korle-Bu Teaching Hospital for helping in the laboratory analysis of the blood samples. I would also like to acknowledge the tremendous help and goodwill received from the workers and students of Parasitology Unit of the Institute. I am particularly grateful to Dr Daniel Boakye, Mr C.A. Brown, Mrs Anita Ghansah, Ms Nancy Duah, Ms Rita Osei, Ms Helena Baidoo, and Ms Naikki Pupulampu for their immense encouragement and support. University of Ghana http://ugspace.ug.edu.gh I would very much like to e xpress m y g ratitude t o t he s taff o f t he D epartment o f Biochemistry, University of Ghana, Legon without whom this work would not have been possible. My utmost gratitude goes to my dear husband for providing the necessary fluids for this project work, my mum, my siblings and my pastor Bishop Dag Heward Mills and his family for all their support. Above all, this would not have been possible without the Lord Almighty, and I give him all the glory. v University of Ghana http://ugspace.ug.edu.gh TABLE OF CONTENTS DECLARATION.........................................................................................................11 DEDICATION............................................................................................................ jii ACKNOWLEDGEMENTS........................................................................................ iv TABLE OF CONTENTS............................................................................................vi LIST OF ILLUSTRATIONS...................................................................................... viii LIST OF TABLES.......................................................................................................ix LIST OF APPENDICES.............................................................................................. x LIST OF ABBREVIATIONS......................................................................................xi ABSTRACT................................................................................................................ xii CHAPTER 1...............................................................................................................1 INTRODUCTION AND LITERATURE REVIEW..................................................1 1.1 INTRODUCTION.............................................................................................1 1.1.1 Rationale.................................................................................................. 7 1.1.2 Objectives................................................................................................ 8 1.2 LITERATURE REVIEW.............................................................................. 10 1.2.1 Immunoglobulins........................................................................................ 10 1.2.1.1 ImmunoglobulinG................................................................................. 11 1.2.2.Fc receptors..................................................................................................12 1.2.2.1 Fey receptors for Ig G................................................................... 12 1.2.2.2 General characteristics of human FcyR............................................. 13 1.2.2.3 Polymorphisms of FcyR..................................................................... 16 1.2.2.4 Ethnic variation in frequency of allelic polymorphism of human FcyR........................................................................................ 20 1.2.2.5 Clinical relevance of FcyR polymorphism........................................22 1.2.3 Malaria-The disease..................................................................................26 1.2.3.1 Cerebral malaria..................................................................................29 1.2.3.2 Anaemia................................................................................................ 31 1.2.4 Immune Response.....................................................................................32 1.2.5 Methods for FcyR genotyping and phenotyping......................................34 1.2.5.1 Immunological methods........................................................................34 1.2.5.2 Molecular methods................................................................................38 CHAPTER 2...............................................................................................................39 MATERIALS AND METHODS................. , ..............................................................39 2.1Chemicals and reagents......................................................................................39 2.1.1 Preparation of buffers and solutions.........................................................39 2.2 Blood sample collection..................................................................................39 2.2.1 The study areas..........................................................................................39 2.2.1.1 Field sample collection..........................................................................41 2.2.1.2 Hospital sample collection.....................................................................41 2.3 Blood analysis..................................................................................................... University of Ghana http://ugspace.ug.edu.gh University of Ghana http://ugspace.ug.edu.gh 2.3.1 Parasitaemia................. 4:5 2.3.2 Hb estimation.............................................................................................. 43 2.3.3 Glucose estimation...................................................................................... 43 2.3.4 Sickling status............................................................................................. 43 2.4 Urinalysis...........................................................................................................43 2.5Extraction of human DNA from filter paper blood blot................................. 44 2.6. Determination of FcyRUa allotypes using allele-specific PCR.....................44 2.7 Determination of FcyRIDb genotypes using PCR...........................................46 2.8 Analysis of PCR products for identification and phenotyping.......................46 2.9 Statistical analysis............................................................................................. 47 CHAPTER 3................................................................................................................. 48 RESULTS...................................................................................................................... 48 3.1 Study population............................................................................................... 48 3.1.1 Control group.............................................................................................. 48 3.1.2 Patient group................................................................................................50 3.2 FcyRUa genotype distribution..........................................................................54 3.2.1 FcyRUa genotype distribution in control group. ................................... 58 3.2.2 FcyRUa genotype distribution in patient group.........................................58 3.2.3 Overall relationship between FcyRUa genotypes and ethnicity................58 3.2.4 Comparison of FcyRIIa genotype distribution of the control and patient groups.................................................................................... 59 3.3 Relationship between FcyRIIa genotype and malaria ........................... 62 3.4 FcyRIHb genotype distribution.........................................................................64 3.4.1 FcyRBIb genotype distribution in the control group................................ 66 3.4.2 FcyRHIb genotype distribution in the patient group................................. 66 3.4.3 Overall relationship between FcyREHb genotype and ethnicity................68 3.4.4 Comparison of FcyRfflb distribution of the control and patient group............................................................................................ 68 3.5 Relationship between FcyREb genotype and malaria....................................70 CHAPTER 4................................................................................................................73 4.1 Discussion.........................................................................................................73 4.2 Conclusion.........................................................................................................79 REFERENCES............................................................................................................82 APPENDICES............................................................................................................102 University of Ghana http://ugspace.ug.edu.gh LIST OF FIGURES Figure 3.1 Age distribution of the control group Figure 3.2 Age distribution of malaria patients recruited at the Korle Bu Teaching Hospital Figure 3.3 The distribution of the different malaria presentations diagnosed among the 254 patients Figure 3.4 The haemoglobin profile of the patient group Figure 3.5 An example of electrophoregram of PCR amplification of the human FcyRIIa gene using P52 and P63 Figure 3.6 An example of electrophoregram of PCR products using primers R2A and R2H Figure 3.7 An example of electrophoregram of PCR products using primers R2A andR2R Figure 3.8 Frequency distribution of the FcyRIIa genotypes within the control and patient groups Figure 3.9 Relationship between FcyRIIa and disease status Figure 3.10 An example of electrophoregram of PCR products using primer sets for NA1 andNA2 Figure 3.11 Frequency distribution of the FcyRIIIb genotype of the malaria patients and the controls Figure 3.12 Frequency distribution of the FcyRIIIb genotype within the different disease categories Figure 3.13 Prevalence of the null genotype within the different malaria patient groups University of Ghana http://ugspace.ug.edu.gh LIST OF TABLES Table 1.2 Table 2.1 Table 2.2 Table 3.1 Table 3.2 Table 3.3 Table 1.1 Phenotypic distribution of FcyRIIa and FcyRIIIb allotypes in different ethnic populations Blantyre coma scale for assessment of consciousness in young children Inclusion and exclusion criteria used for the grouping of patients into different clinical categories DNA sequences of oligonucleotides used in genotyping Overall distribution of the FcyRIIa genotypes within the different ethnic groups FcyRIIa genotype distribution among the different ethnic groups studied within the control and patient groups FcyRIIIb genotype distribution amomg the different ethnic groups within the control and patient groups University of Ghana http://ugspace.ug.edu.gh LIST OF ABBREVIATIONS ADCC Antibody dependent cellular cytotoxicity ANCA Anti-neutrophil cytoplasmic antibodies ARDS Adult respiratory distress syndrome BSM Bispecific molecules Fab Fragment antigen binding Fc Fragment crystallisable GPI Glycosylphosphatidylinositol h Human HR High responders IC Immune complexes Ig Immunoglobulin LR Low responders m Murine mAB Murine antibody MHC Major histocompatibility complex NA Neutrophil antigen NK Natural killer cells PMN Polymorphonuclear cells RBC Red blood cells RIA Radioimmunoassay SDS Sodium dodecyl sulphate SLE Systemic lupus erythematosus TNF Tumour necrosis factor University of Ghana http://ugspace.ug.edu.gh LIST OF APPENDICES Appendix I: Preparation of solutions Appendix II: Severe malaria study questionnaire Appendix III: Cohort demographics and PCR results University of Ghana http://ugspace.ug.edu.gh ABSTRACT The immunoglobulin G (IgG) receptors FcyRIIa and FcyRIIIb vary among different ethnic groups, and more importantly, are also known to be associated with either susceptibility to or protection from certain diseases. These variations are manifest as differences in the antigen-binding capabilities of the receptors. The genes encoding for these receptors are polymorphic and these also vary among populations. These variations can be investigated using molecular methods such as PCR. The aim of the present study was to determine if there were any significant differences in the distribution of these genotypes among some of the ethnic groups in Ghana and also if there was any association between the genotypes and the incidence of severe malaria. A total number of 329 children, belonging to four different tribes were recruited for the study, of which 75 healthy individuals formed the control group. The 254 patients who were recruited were diagnosed as having uncomplicated, severe anaemia or cerebral malaria. Human DNA was isolated from filter paper blood blots for PCR analysis using allele-specific primers for FcyRIIa to detect H/H131, H/R131, R/R131, and FcyRIIIb to detect NA1/NA1 and NA2/NA2 genotypes. The results obtained revealed that there was no association between ethnicity and the FcyRIIa genotype, (P=0.78) and FcyRIIIb genotypes (P=0.23). W ith regard to the incidence of malaria and the FcyRIIa genotypes, the following associations were found (P<0.002 in all cases); firstly, there were significantly more of the homozygous FcyRIIa-R/R131 genotypes among patients with severe anaemia and cerebral malaria. Secondly, there were significantly less of the homozygous H/H131 University of Ghana http://ugspace.ug.edu.gh in all the three forms of malaria and thirdly, the heterozygous FcyRHa-H/R131 was associated with only severe anaemia. These observations suggest that the homozygosity of the R allele is a heritable risk factor for severe malaria, while the H allele confers some degree of protection against the disease both in the homozygous and heterozygous state. Similarly, no association was found between the FcyRIIIb and ethnicity (P>0.05. The homozygous NA1/NA1 was found to be significantly dominant among the patient group (P=0.003). The NA2/NA2 genotype on the other hand was significantly reduced in the patient group (P=0.000), and also in all the three forms of the diseases (P< 0.04). The heterozygous NA1/NA2 was found to be intermediate between the two, but was significantly underepresented in the cerebral and severe anaemia patients (P< 0.001). The null genotype was found to be overepresented within the patient group (P=0.02). These findings suggest that the NA2 offers protection against all forms of malaria and this effect is even observed in the heterozygotes NA1/NA2 among the severe anaemia and cerebral malaria groups. NA1, on the other hand is a heritable predisposing factor to symptomatic malaria. University of Ghana http://ugspace.ug.edu.gh CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW 1.1 INTRODUCTION Human immunoglobulin G receptors (FcyR) provide an important link between the humoral and cellular branches of the immune response. FcyR engagement may result in a plethora of biological responses including phagocytosis, endocytosis, antibody-dependent cellular cytotoxicity (ADCC), release of inflammatory mediators, facilitation of antigen presentation and clearance of immune complexes (Van de Winkel & Capel, 1996). FcyR belongs to the Immunoglobulin (Ig) super gene family and three classes of leukocyte FcyR encoding 12 receptor isoforms have so far been identified (Van de Winkel and Anderson, 1991). These expressed molecules differ in their molecular weights, affinity and specificity for Immunoglobulin G (IgG) isotypes, cell distribution patterns and capacity to trigger intracellular signals (Kimberly et al., 1995). Fey receptors participate in a much broader range of functions other than disposal of immune complexes. For the phagocyte, activation of Fey receptors can trigger a spectrum of integrated cell programs including an oxidative burst, secretion of intracellular granule contents, cellular cytotoxicity, gene activation with new protein synthesis and elaboration of various cytokines (Kimberly et al., 1995). Fey receptors on B lymphocytes can provide negative regulatory signals, and in the context of autoimmunity, modulation of B cell hyperactivity stands out as a potential 1 University of Ghana http://ugspace.ug.edu.gh therapeutic target. Fey receptors on natural killer (NK) cells mediate antibody- dependent cellular cytotoxicity. Fey receptors, expressed on a broad range of blood cells, play an important role in the binding and phagocytosis of IgG -opsonized particles (Van de Winkel & Anderson, 1991). The most abundant phagocyte, the polymorphonuclear leukocyte (PMN), expresses constitutively two of the three FcyR subclasses, FcyRIIa (CD32) and FcyRIIIb (CD 16). FcyRI (CD64) expressed on activated PMN, binds monomeric IgG with high activity. FcyRIIa and mb are low affinity receptors interacting with complexed or aggregated IgG. Both FcyRIIa and mb exhibit a polymorphism, which is genetically determined. FcyRIIa may occur as either FcyRIIa-H131 or FcyRHa-R131 allotype. The substitution of just one amino acid, histidine or arginine at position 131 of the protein molecule accounts for this, and has been found to be critical for IgG binding (Salmon et al., 1992). FcyRIIIb polymorphism can occur either as neutrophil antigenl (NA1) or neutrophil antigen2 (NA2), and these differ in the number of glycosylation sites at position 65 and 82 (Salmon et al., 1992). IgG subclass antibodies also have different properties with respect to binding to the IgG receptors bound on the surface of leukocytes (Burton & Woof, 1992). Human IgGi and IgG3 subclasses interact with all FcyR classes. FcyRIIa has been shown to be the sole FcyR class capable of binding human IgG2, with the H allele having a much higher affinity for IgG2 than the R allele (Salmon et al, 1992). With respect to the FcyRIIIb poymorphism, it has been shown that there is a functional difference in 2 University of Ghana http://ugspace.ug.edu.gh the activity of PMNs expressing the EQb-NAl or IHb-NA2 allotypic forms (Salmon etal, 1992). Results from some studies seem to suggest that the Fey receptor polymorphisms may be relevant in health and diseases, especially in situations where human IgG2 is the predominant antibody subclass produced, such as those involving anti-carbohydrate immune responses (Insel & Anderson, 1988). Abnormal Fey receptor-mediated clearance of IgG-opsonized erythrocytes, a model for circulating immune complexes, has been demonstrated in systemic lupus erythematosus (SLE) and other immune complex diseases (Frank et al., 1979). These polymorphisms have also been implicated in the susceptibility of humans to heparin-induced thrombocytopenia (Cines et al., 1980; Chong et al., 1982). This is a disorder associated with anti­ platelet heparin- dependent antibodies that cluster and trigger the platelet FcyRII (Kelton et al., 1988; Chong et al., 1989). Furthermore, the frequency of individuals homozygous for H131 appears underrepresented in a group of patients with recurrent bacterial infections (Sanders et al, 1994), and in a group susceptible to meningococcal disease (Fijien et al., 1993). Also, the level of circulating human IgG2 is significantly lower in H/H131 individuals as compared to those with the R/R131 genotype (Parren et al., 1992). The frequency of this allotypic polymorphism may vary among ethnic groups. It is possible that ethnic variation in the FcyRIIa allotype frequency may have consequences for the susceptibility, within certain populations, to specific diseases, especially those associated with an human IgG2 humoral response. Reports of high affinity binding of human IgG2 by H I31 transfectants (Warmerdam et al., 1991) as well as greater phagocytosis of particles opsonized with human IgG2 by H/H131 3 University of Ghana http://ugspace.ug.edu.gh PMNs (Salmon et al., 1992) suggest that the H/H131 genotype may have advantages in this respect. Eastern Asians (Japanese, Chinese, Indians) are more frequently of the murine IgGl low responder phenotype compared to Caucasians. Such variation may in part explain racial differences in the susceptibility to certain diseases such as those caused by Haemophilus influenzae and Neisseria (Nagata et al., 1989; Musser et al., 1990; Figueroa & Densen, 1991). In addition to the above, epidemiologic reports also suggest the possibility of such correlations. For example the incidence of meningococcal disease among Japanese is very low compared to non-Japanese inhabitants of the Midwestern United States (Sclech et al., 1985; Densen et al., 1990; Wenger et al., 1990). It has also been reported that H influenzae infections are very rare in Japan. In healthy Caucasian donors, the Rmb-NA2/NA2 phenotype is expressed more often whereas the Rmb-NAl/NAl phenotype predominates in Japanese individuals (Ohto & Matsuo, 1989; Sanders et al., 1994). In Ghana, malaria is a major cause of infant morbidity and mortality. The human disease is a protozoan infection of the red blood cells transmitted by the bite of a blood feeding female anopheles mosquito. There are four generally recognized species of malaria parasites in humans: Plasmodium falciparum, P. malariae, P. vivax and P.ovale (Gamham, 1966). Malaria can be complicated (severe) or uncomplicated. The clinical features of uncomplicated malaria are common to all four species of Plasmodium. The first symptoms are non-specific and resemble influenza. The duration of illness is proportional to the level of immunity and differs between the parasite species. Death University of Ghana http://ugspace.ug.edu.gh from P. vivax, P. ovale or P.malariae infections is very rare. On the contrary, falciparum malaria is a potentially lethal infection. The progression to severe disease can be rapid. The major complications of P falciparum infections in children are cerebral malaria, severe anaemia, respiratory distress and hypoglycaemia (WHO, 1990). Cerebral malaria is defined as unrousable coma (Blantyre coma scale score< 2), asexual parasitaemia, and exclusion of other causes of coma. Severe anaemia is defined as haemoglobin level less than 5g/dl and asexual parasitaemia (WHO, 1991). It usually presents as an acute fall in haemoglobin level. Severe anaemia has a peak incidence in children of a ge a round 1 - 2 y ears a nd i s c ommon i n a reas w ith h igh seasonal transmission than in those with low seasonal transmission (Snow et al., 1994). Two types of immunity offer resistance to malaria; innate and acquired immunity (Marsh, 1993). Innate or natural resistance to malaria is associated with haemoglobinopathies, major histocompatibility complex (MHC), Duffy blood groups and other RBC variants (Marsh et al., 1995). Acquired immunity to malaria reflects a shift from a relatively non-specific cell mediated response to a highly specific antibody mediated and cytotoxic T cell responses. Different immune responses come into play depending on the stage in the parasite’s life cycle. While there is antibody opsonization of the sporozoites for phagocytosis, the immune response to the liver stages of the parasite involves the killing of intracellular parasites by nitric oxide and cytotoxic T cell destruction of infected liver cells (Hill et al., 1991). 5 University of Ghana http://ugspace.ug.edu.gh Acute malaria is characterized by non-specific polyclonal B-cell activation. There is reduction in circulating T cells with an increase in the y/5 T- cell subset (Ho et al., 1990), but other T cell proportions are usually normal (Ho and Webster, 1990). Although residents of hyperendemic or holoendemic malarious areas have hypergammaglobulinaemia, most of this antibody is not directed against malaria antigens (White, 1996). In non-immune individuals, the acute antibody response to infection often comprises mostly Immunoglobulin M (IgM) and Immunoglobulin G2 (IgG2) isotypes, which are unable to arm cytotoxic cells and thus kill asexual malaria parasites (Bouharoun-Tayoun and Druilhe, 1992). Although in adults, IgG2 is often the predominant antibody isotype in the response against polysaccharide antigens, young children exhibit a slow maturation of this isotype. In neonates, there is always a certain level of maternal IgG2 found in the sera, which is given transplacentally, but this disappears about 5 months after birth (Roitt, 1988). It has long been established that the host response to Plasmodium infection includes the production of enlarged populations of both peripheral blood monocytes and mature macrophages. In rodent malaria, experiments have shown that both the spleen and the liver remove parasitized erythrocytes more rapidly from the circulation than they remove unaffected cells (Quinn &Wyler, 1979; Dockrell et al., 1980). Furthermore, macrophages from infected animals are more phagocytic for parasitized cells than are normal macrophages; this enhanced phagocytic activity depends on the presence of either opsonins or cytophilic antibodies and also on the degree of macrophage activation (Criswell et al., 1971; Shear et al., 1979). 6 University of Ghana http://ugspace.ug.edu.gh Protective antibodies inhibit parasite expansion through co-operation with the monocyte-macrophage series by binding to parasitized erythrocytes and activating their Fc receptors (Bouharoun-Tayoun et al., 1990). Although little is known about the nature of this macrophage activation, it seems reasonable to suppose that it includes increased expression of specific surface receptors for the Fc portion of immunoglobulin G (Fey receptors), since this would clearly facilitate the phagocytosis of antibody-coated targets (Lee et al., 1989; Ho et al., 1990). There are presently three methods that can be used to investigate FcyRIIa polymorphism; these are, (i) functional assays, (ii) immunofluorescence assays using both a pan-CD32 mAb and mAb 41 HI 6 that binds specifically to the FcyRHa-R131 allotype (Gosselin et al, 1990) and (iii) PCR-based methods. There are also methods that can be used to type FcyRIIIb polymorphism and these are (i) biochemical methods, (ii) immunofluorescence assays and (iii) sensitive PCR-based methods. 1.1.1 Rationale There has been considerable increase in interest in assessing the role of Fey receptors because of their importance in providing a bridge between the humoral and cellular arms of the human immune response (van de Winkel and Capel, 1993). Appreciable differences in the distribution of FcyRIIa and FcyRIIIb allotypes have been reported among different ethnic groups. This poses interesting questions about the selective pressure that maintains the polymorphisms in these genes in human populations, and about the impact of this polymorphism in the outcome of infection and clinical manifestations. 7 University of Ghana http://ugspace.ug.edu.gh Several hospital-based studies have shown an association between FcyRIIa-H/H131 allotype and protection against encapsulated bacterial infections whereas the poorly IgG2-binding allotype, FcyRIIa-R/R131 is associated with increased susceptibility to these pathogens. No association has so far been reported between any protective immune response and FcyRIIIb allotypes (Van Schie and Wilson, 1997). Because of the high rate of mortality associated with falciparum malaria especially among children under 5 years of age, it expected that any genetic trait that provides some protection would be selected for. We set out therefore to investigate whether there is any association between the protective immune response against falciparum infections and FcyRIIa and FcyRIIIb allotypes. 1.1.2 Objectives The aims of the present study are to find out if (i) there are any differences in the distribution of Fey receptors among Ghanaians and (ii) to determine if there is any association between the FcyRIIa and FcyRIIIb and protective immune response against falciparum malaria. These will be achieved by conducting a case study on a number of children diagnosed as having uncomplicated malaria, cerebral malaria or severe anaemia. The specific objectives were as follows (i).To recruit and obtain demographic data on age, sex and ethnicity of a cohort of children. (ii). To categorize the children according to their disease status. (iii). To determine their respective FcyRIIa and FcyRIIIb genotypes by PCR. University of Ghana http://ugspace.ug.edu.gh When the data on the above were obtained, they were then analysed further to: (i) determine the distribution of the FcyRIIa and FcyRIHb genotypes within the different ethnic groups, (ii) determine if there is any association between the FcyRIIa and FcyRIDb genotypes and ethnic origin, (iii) find out if there is any association between FcyRIIa and FcyRIHb and the disease status of the patients, (iv) compare the genotype frequencies of the patients with those of the controls. 9 University of Ghana http://ugspace.ug.edu.gh 1.2 LITERATURE REVIEW 1.2.1 Immnoglobulins Immunoglobulins (Ig), also called antibodies are a group of serum molecules produced by B lymphocytes. Immunoglobulin proteins are the critical ingredients at every stage of a humoral immune response. When expressed on the surface of resting B-lymphocytes, they serve as receptors that can detect and distinguish among the vast array of potential antigens present in the environment (Benjamini, 1996). The two hallmarks of immunoglobulins as antigen binding proteins are the specificity of each for a particular antigenic structure and their diversity as a group. In addition to antigen binding, immunoglobulins possess secondary biologic activities that are critical for host defence (Goodman and Parslow, 1994). Based upon the structure of their heavy chain constant region, there are five classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM with their heavy chains designated as a , 8, s, y and fj, respectively. All antibodies have basically the same structure, but they are diverse in the region that binds to the antigen. They also differ in amino acid composition, making them different in size and charge (Roitt, 1988). In addition to d ifferences b etween c lasses, t he i mmunoglobulins w ithin e ach c lass are also very heterogeneous. For example, there are four subclasses of human IgG (namely IgGl, IgG2, IgG3 and IgG4). There are also known to be subclasses of human IgA (IgAl and IgA2), but none have been described for IgD, IgM and IgE (Silverton etal., 1977). Each immunoglobulin is bifunctional (Parslow, 1994). One region of the molecule is concerned with binding to antigen while a different region mediates so-called 10 University of Ghana http://ugspace.ug.edu.gh effector functions. These include binding of the immunoglobulin to host tissues, including various cells of the immune system, some phagocytic cells, and the first component (Clq) of the classical complement system (Kuby, 1992). All immunoglobulins are glycoproteins with the carbohydrate content ranging from 2-3% to 12-14% (Roitt, 1988). The antibody molecule is made up of two identical heavy and light polypeptide chains held together by disulphide bonds. These chains can be separated by reduction of the S-S bonds and acidification. The exposed hinge region is extended in structure due to the high proline content and is therefore susceptible to proteolytic attack; thus the molecule can be digested by papain to yield two identical fragments, each with a single combining site for antigen (Fab; fragment antigen binding), and a third fragment which lacks the ability to bind antigen and is termed the Fc (fragment crystallisable). Pepsin acts at a different point to cleave the Fc portion from the divalent F (ab)2 (Valentine & Green, 1967). Of all the antibodies, IgG is the major immunoglobulin in normal human serum, accounting for 70-75% of the total immunoglobulin pool (Roitt, 1988). 1.2.1.1 Immunoglobulin G IgG is the predominant isotype present in blood and extracellular fluid and is primarily responsible for providing systemic immune protection. It consists of a single immunoglobulin molecule with a sedimentation coefficient of 7S and a molecular weight of 146 kDa (Burton & Woof, 1992). The IgG class that is distributed evenly between the intravascular and extravascular pools is the major antibody of secondary immune responses and the exclusive antitoxin class. Through its ability to cross the placenta, IgG provides a maj or line of defence against infection for the first few weeks of a baby’s life which may be further reinforced by the 11 University of Ghana http://ugspace.ug.edu.gh transfer of colostral IgG across the gut mucosa in the neonate through breast-feeding (Silverton, 1977). 1.2.2 Fc Receptors Many cell types that cannot synthesize immunoglobulins are able to adsorb circulating antibodies by way of the Fc receptors (Alazari et al., 1988). These receptors, found on the surface of leucocytes, are so called because they interact with the Fc portion of the heavy chain of immunoglobulins (Davis and Metzger, 1983). The physiologic functions of Fc receptors differ among cell types. Fc receptors facilitate phagocytosis of antibody-coated particles through the phenomenon of opsonization, and are important for triggering chemotaxis and degranulation in neutrophils and other phagocytes. Binding of IgG molecules onto these Fc receptors on macrophages or natural killer cells serves to arm these cells to carry out Antibody dependent cellular cytitoxicity (ADCC) (Goodman and Parslow, 1994). 1.2.2.1 Receptors for Immunoglobulin G (IgG) Receptors for IgG (FcyR), a subgroup within the larger group of FcR, were shown to belong to the Ig supergene family (Van de Winkel & Anderson, 1991). Three major classes of leukocyte FcyR are currently recognized, all of which contain several members. Within an individual, Fey receptor diversity may be related to differences in primary amino acid structure, variation between specific cell types or the association of different molecules during receptor assembly (Kimberly et al, 1995). In humans there are eight distinct Fey receptor genes, with multiple exons, with the result that 12 University of Ghana http://ugspace.ug.edu.gh alternative splicing can generate distinct protein products. All three Fey receptor families share similar though non-identical extracellular (EC) domains, comprising a common structural motif of two or three immunoglobulin-like disulphide linked domains, dictating their ligand- binding characteristics (Ravetch & Anderson, 1990). 1.2.2.2 General characteristics of human FcyR Most FcyR exist as hetero-oligomeric complexes and as such, belong to the family of multichain immune recognition receptors. The ligand binding-a-chains can associate with a number of signalling components. The three FcR signalling chains and the a- chain of FcyRIIa bear a unique 26-amino acid immuno-receptor tyrosine-based activation motif in their cytoplasmic domain (Rascu et al., 1997). FcyRI (CD64) is a 72-kDa glycoprotein with high affinity receptor for IgG. The receptor is heavily glycosylated and has a core protein, revealed after removal of N- linked carbohydrates with a MW of 55kDa (Peltz et al., 1988). This group of receptors are constitutively expressed on monocytes, macrophages, myeloid progenitor cells, dendritic cells, and are also inducible on neutrophils by interferon-y (IFN-y) or granulocyte colony-stimulating factor (Guyre et al., 1983; Repp et al., 1991). Three homologous genes, FcyRIA, FcyRIB and FcyRIC, encode members of the Class-I FcyR and are localized on chromosome 1. FcyRIa and FcyRIb2 are transmembrane molecules with their extracellular regions composed of three (FcyRIa) or two (FcyRIb2) Ig-like domains, respectively. The human (h)FcyRI gene is composed of six exons, two exons encoding the signal peptide, one exon for each 13 University of Ghana http://ugspace.ug.edu.gh of the Ig-like domains, and a single transmembrane /cytoplasmic region exon (Van de Winkel et al., 1990). Human (h) FcyRI is the only receptor class that binds monomeric Ig with high affinity. It shows specificity for three subclasses, hlgGl, hIgG3 and WgG4 in order of decreasing affinity, and interacts with mouse (m) IgG2a and mIgG3, as well as rat IgG2b antibodies (Anderson & Abraham, 1980). A family of 40-kDa FcyRII (CD32) molecules represent the most broadly distributed Fey receptor class. FcyRII members are expressed on most types of blood leukocytes, Langerhans’ cells, different population of endothelial cells, dendritic cells, macrophages and platelets. Three genes, FcyRUA, FcyRUB, and FcyRIIC, located on chromosome 1 encode six isoforms (FcyRHal, Ha2, Ilbl, IIb2, Db3 and He), which differ profoundly in their cytoplasmic tails (Qiu et al., 1990). The hFcyRUA and B gene products differ in both their signal peptides and cytoplasmic domains. The hFcyRHC gene contains a cytoplasmic region similar to hFcyRUA, and a signal peptide that is closely related to that of the hFcyRIIB gene (Brooks et al., 1989). Analysis of the amino acid sequences from cDNAs of the multiple isolated receptor isoforms indicates that the proteins of this receptor class have a similar extracellular region of about 180 amino acids that contain two Ig-like domains, a 27 to 29 amino acid transmembrane domain and a cytoplasmic domain that varies in length from 44 to 76 amino acids (; Hibbs et al., 1988; Brooks et al., 1989 and Seki, 1989). FcyRII is a low affinity receptor, interacting only with complexed or aggregated IgG and is the sole FcyR class that can bind hIgG2 (Kimberly, 1995). 14 University of Ghana http://ugspace.ug.edu.gh FcyRIH (CD16) is a glycoprotein with a molecular weight ranging from 50 to 80 kDa. Two different genes have been identified, FcyRIHA and B, located on chromosome 1 within 200 kb from the FcyRII genes (Van de Winkel & Anderson, 1991). The products of both genes encode proteins with an extracellular region of 190 amino acids containing Ig-like domains. The most remarkable difference between the two subclasses is that hFcyRHIa is a transmembrane receptor (with a 25 amino acid cytoplasmic region) and hFcyRIHb is coupled to the outer leaflet of the plasma membrane via a glycosylphosphatidylinositol (GPI) moiety (Huizinga et al., 1988; Selvaraj et al., 1989). The two genes are highly homologous and differ most critically at amino acid position 203, where a serine in hFcyRIHb determines the GPI-linked molecule, whereas a phenylalanine in hFcyRHlb specifies preservation of the transmembrane and cytoplasmic domains to generate an integral membrane glycoprotein (Kurosaki & Ravtech, 1989; Lanier et al., 1989). FcyRHIa is present on (NK) cells, macrophages, subpopulations of T cells and freshly isolated blood monocytes, immature thymocytes, and placental trophoblasts and binds IgG with medium affinity. FcyRIIIb is selectively expressed on neutrophils a nd i s a 1 ow a ffinity r eceptor f or I gG. Both isoforms effectively bind hlgGl and hIgG3 and interact with mouse IgG (Rascu et al., 1997). Besides membrane bound forms of FcyR, much evidence also suggests the existence of soluble receptors. H uizinga et a I. (1990), have shown that normal human sera contain a high amount of soluble hFcyRm receptor, most likely from neutrophils. This receptor seems to be released from PMN by a proteolytic mechanism. Another 15 University of Ghana http://ugspace.ug.edu.gh way of generating these soluble receptors might be through alternative splicing. Warmerdam et al. (1990), have described a hFcyRII form that lacks the transmembrane region and presumably encodes a soluble molecule. 1.2.2.3 Polymorphisms of FcyR Another form of variation in the structure of immunoglobulins is allotypy. It is based on genetic differences between individuals and depends on the existence of allelic forms (allotypes) of the same protein as a result of the presence of a different amino acid of the same gene at a given locus. As a result of allotypy, a particular constituent of any immunoglobulin can be present in some members of a species and absent in others (Alazari et al., 1988). This situation contrasts with that of immunoglobulin classes which are present in all members of a species. Allotypic differences at known loci usually involve changes in only one or two amino acids in the constant region of a chain. With a few exceptions, the presence of allotypic differences in two identical immunoglobulin molecules does not generally affect binding with antigen but it serves as an important marker for analysis of Mendelian inheritance (Goodman and Parslow, 1994). FcyRIa is not polymorphic, although a single family has been identified in Belgium, lacking phagocyte expression of FcyRIa (Ceuppens et al., 1988). This absence was recently linked to a single nucleotide difference between the wild type FcyRIa and the Belgium family members lacking this receptor. Interestingly, in spite of the absence of FcyRIa, the four members of this family were apparently healthy, lacking evidence for any autoimmune, infectious, or inflammatory disease. 16 University of Ghana http://ugspace.ug.edu.gh A well-studied polymorphism represents allelic variation within the myeloid FcyRIIa (CD32). A point mutation, G into A, results in an arginine (R131) or histidine (HI31) at amino acid position 131 in the second Ig-like domain of FcyRIIa (Warmerdam et al., 1990). This variation has been shown to be critical for the binding of hIgG2 and hIgG3, as well as mlgGl and rat IgG2b (Warmerdam et al., 1991; Parren et al., 1992). An independent polymorphic amino acid is located at position 27 (either glutamine or tryptophan) which is not known to be relevant to the ligand binding of FcyR (Warmerdam, 1990). This genetically determined polymorphism of hFcyRII was originally discovered in studies on the interaction between human monocytes and mlgGl antibodies stemming from analysis of anti-CD3-induced T-cell proliferation. Monocytes from 70% of Caucasian individuals (high responders, HR) supported the T-cell mitogenesis induced by mlgGl anti-CD3 mAb, whereas 30% did not (low responders, LR) (Tax et al., 1983). These findings were confirmed in other functional assays such as EA-rosetting, phagocytosis and ADCC of mlgGl- opsonized targets, binding of mlgGl aggregates, mlgGl-induced release of tumour necrosis factor-a (TNF-a), and adherence of PMN to mlgGl-coated endothelial cells (Van de Winkel & Anderson, 1991). The relative predominance of hFcyRIIa transcripts in three cell types, monocytes, macrophages, and neutrophils, that express this polymorphism suggests that, of the three FcyRII genes, only hFcyRUA bears the allotypic polymorphism. The observation that B cells from all donors uniformly bind mAb 41H16 and express 17 University of Ghana http://ugspace.ug.edu.gh only hFcyRIIb supports this hypothesis (Gosselin et al., 1990). Information about the in vivo relevance of this polymorphism is scant. The FcyRIIb subclass has also been shown to exhibit genetic heterogeneity based on a single amino acid difference at position 11 in the cytoplasmic region, where a tyrosine is substituted by an aspartic acid (Warmerdam et al., 1993). A second type of heterogeneity of FcyRH has been described on human platelets. A stable variation in expression of numbers of hFcyRII on platelets from different individuals was found, which correlated with intensity of the platelet release reaction and platelet aggregation in response to model immune complexes. These workers speculate that this variation in quantitative expression may be associated with susceptibility to certain immune complex disease (Rosenfeld et al., 1987). The FcyRIIa-H131 allotype has been shown to effectively bind hIgG2 dimers, hIgG2 anti-CD3 antibodies and hIgG2-opsonized bacteria, in contrast to the FcyRHa-R131- expressing cells (Salmon et al., 1992). Similarly, rat IgG2b-opsonized red blood cells and rat IgG2b anti-CD3 mAb were much more effectively bound by FcyRUa- H131-expressing cells. The third FcyR class bears a structural polymorphism known as the NA system. Represented only on hFcyRmb expressed by neutrophils, it is involved in autoimmune diseases and transfusion reactions. This polymorphism is reflected in different molecular weights of the deglycosylated FcyR on SDS-PAGE. Human (h) FcyRIHb from NA1/NA1 donors has a MW of 29kDa; that of NA2/NA2 donors has an MW of 33kDa, and heterozygous donors express both. The sequences of the 18 University of Ghana http://ugspace.ug.edu.gh cDNA of these allotypic forms reveal minor amino acids differences between the NA1 and NA2 forms of hFcyRHIb (Ory et al., 1989; Ravtech & Perassia, 1989). Changes in amino acids at positions 63 and 82 lead to two extra glycosylation sites (six instead of four) in the NA2 form resulting in different electrophoretic mobilities of the two allotypes (Huizinga et al., 1990; Ory et al., 1989). PMN from FcyRHIb- NA2 individuals were consistently found to exhibit lower levels of phagocytosis of erythrocytes either sensitised with hlgGl and IgG3 anti-Rhesus D mAb or treated with concanavalin A compared to FcyRIHb-NAl-PMN (Salmon et al., 1990; Bredius et a I., 1994). F urthermore, phagocytosis o f hlgGl-opsonized bacteria by FcyRIHb- NA2-PMN was also reduced in comparison to FcyRIHb-NAl-PMN, whereas no difference was found using hIgG2-opsonized bacteria (Bredius et al., 1994). Recently a triallelic polymorphism of FcyRHIa has been identified, based on a single nucleotide difference (position 230), leading to a leucine, histidine, or arginine at position 48 in the first IgG—binding characteristics between the three FcyRIIIa allotypes (De Haas et al., 1996). Another polymorphism of FcyRIH was described by Ravtech and P erussia (1989), where a nucleotide substitution at position 559 of FcyRIIIa predicts either a valine or a phenylalanine at amino acid position 158 of protein product. The third type o f interindividual variation in FcyRIIIa represents an expression difference reported by Vance et al. (1993). Individuals were identified with either a high or low level of CD 16 expression on NK cells, supportive of a polymorphism. Functional differences were furthermore noted in NK-cell ADCC activity and binding of 19 University of Ghana http://ugspace.ug.edu.gh monomeric hlgG. However a genetic basis for this heterogeneity remains to be established. Two groups have independently identified individuals who lacked expression of hFcyRHIb. Clark et al .(1990), identified a patient with systemic lupus erythematosus (SLE) with no FcyRHI on her PMN. Huizinga et al. (1990), studied two healthy individuals both of whom lacked hFcyRIHb. In both studies the defect seemed attributable to either a grossly disorganized, or a completely absent gene. In the latter study the two deficient individuals were healthy and had no signs of circulating immune complexes or increased susceptibility to infections. These observations raise questions about the in vivo relevance of this receptor class and support the notion that the Fey receptor class are structurally redundant. 1.2.2.4 Ethnic Variation in Frequency of Allelic Polymorphism of Human FcyR The frequency of these allotypic polymorphisms varies among ethnic groups. The percentage of individuals with cells responsive to mlgGl in the T cell mitogenic assay differs greatly among genetically diverse populations (Abo et al., 1984). East Asians (Japanese, Chinese, Indians) are more frequently of the mlgGl low responder phenotype as compared to a caucasian group. Such variation may, in part, explain racial differences in the susceptibility to certain diseases such as those caused by Haemophilus influenzae and Neisseria (Nagata et al., 1989; Musser et al., 1990; Figueroa & Densen, 1991). Osborne et al. (1994), showed that the frequency in these ethnic groups of the high and low responder mlgGl phenotype correlates directly with the R/H131 polymorphism and therefore with the capacity of FcyRII to bind hIgG2 with high 20 University of Ghana http://ugspace.ug.edu.gh affinity. In healthy C aucasians, t he R H[b-NA2/NA2 p henotype i s e xpressed m ore often (Lalezari, 1984; Sanders et al., 1994), whereas the RUIb-NAl/NAl predominates in Japanese individuals (Ohto & Matsuo, 1989) (Table 1.1). The NA- null gene was assessed to be 0.03 in a French population. Table 1.1 Phenotypic Distribution of FcyRIIa and FcyRHIb Allotypes in Different Ethnic Populations Ethnic Groups FcyRHaf0/^ FcyRIHb References N R/R R/H H/H N NA1/NA1 NA1/NA2 NA2/NA2 Caucasian Dutch 123 23 48 German 187 27 45 American 35 23 54 French Asians Japanese 27 6 33 Chinese 18 6 Indian 16 31 44 56 African- American 100 23 50 29 28 23 61 50 13 67 15 3377 12 303 42 45 43 39 40 45 27 Sanders et al, 1994 Osborne et al, 1994 & Wainstein et al, 1995 Fromont et al, 1992 Osborne et c/.,1994 & Ohto & Matsuo, 1989 Osborne et al, 1994 Salmon et al, 1996 N = Number of individuals assessed 21 University of Ghana http://ugspace.ug.edu.gh 1.2.2.5.Clinical Relevance of FcyR Polymorphism FcyRs are of critical importance in directing the uptake and destruction of viruses, bacteria and a variety of infectious parasites, and are involved in antibody-dependent killing of infected cells expressing viral antigens (Wallace et al., 1995; Van de Winkel and Capel, 1996). FcyRHa-expressing NK cells isolated from human immunodeficiency virus (HlV)-seropositive individuals have been shown to be coated with anti-HIV antibodies and readily mediate lysis of HIV-infected cells in vitro. Furthermore, this ADCC activity correlates inversely with disease progression. The importance of appropriate detection of IgG-opsonized microorganisms by FcyRs on phagocytes is further emphasized by susceptibility for individuals expressing the FcyRIIa-R131 allotype to infections by encapsulated bacteria (Tse et al., 1999). TheFcyRIIa-H131 allotype (as opposed to FcyRIIa-R131) is identified as the only FcyR capable of binding human IgG2, an important isotype in immune defence against encapsulated bacteria (Parren et al., 1992; Bredius et al., 1993). Neutrophils from individuals expressing the FcyRHa-R131 allotype inefficiently phagocytose human IgG2-coated bacteria, rendering these individuals more susceptible to infection. Allotypic forms of FcyRIIIb (NA1 versus NA2) have also demonstrated differences in the binding and phagocytosis of IgGi- and IgG3-coated particles, which may have clinical relevance with regard to susceptibility to infectious disease. (Salmon et al., 1992). FcyRs are also important for immune defense to intracellular pathogens such as Toxoplasma gondii (Deo et al., 1997). Antibodies specific for T. gondii focus the organism to the effector cell by binding to FcyRs, thereby leading to destruction of 22 University of Ghana http://ugspace.ug.edu.gh the pathogen. B ispecific molecules (BSMs) that focus T. gondii to the surface of myeloid effectors (monocytes and neutrophils) mediate destruction of the pathogen regardless of the surface antigen on the effector cell to which they are directed (Erbe et al., 1991). In contrast to phagocytes, NK cells destroy T. gondii only upon targeting to FcyRIH, and not other cell-surface markers, identifying FcyRIH on NK cells as primary trigger molecule for T. gondii destruction (Erbe et al., 1991). BSMs are now being developed for a variety of microorganisms, including fungi and antibiotic-resistant bacterial strains, to target these pathogens specifically to FcyR- expressing cytotoxic effector cells (Deo et al., 1997). Porges et al. (1994), demonstrated murine IgG anti-neutrophil cytoplasmic antibodies (ANCA), which are associated with Wegener’s granulomatosis and systemic vasculitis, to engage and activate human neutrophils via FcyRIIa. The production of reactive oxygen intermediates after incubation with mlgGl ANCA was significantly increased in individuals expressing the IIa-R/R131 phenotype. These data are in accordance with those of Mulder et al., (1994) who concluded that ANCA -induced activation of neutrophils was FcyRIIa-dependent, and correlated with hIgG3 ANCA titres in patients with Wegener’s granulomatosis. However, this increased neutrophil activation in FcyRIIa-R/R131 donors almost certainly reflects the greater avidity of these receptors for murine IgGi (Clark et al., 1991; Tate et al., 1992; Porges et al., 1994). The situation with human IgG was unclear. FcyRIIa receptor allotypes may represent risk factors in ANCA-associated systemic vasculitis, and influence susceptibility or disease manifestations if IgG2 and / or IgG3 are the predominant isotype. Since the FcyRIIa-H/H131 receptor binds human 23 University of Ghana http://ugspace.ug.edu.gh IgG3 with greater avidity and also binds IgG2, receptor engagement and antigen recognition by ANCA could lead to an enhanced neutrophil activation and tissue injury, compared to the FcyRIIa-R/R.131 receptor. Thus allelic variants of neutrophil FcyR may contribute to disease susceptibility and organ involvement through differential activation by ANCA isotypes (Tse et al., 1999). Tse et al. (1999) however found that there was no significant increase of the FcyRIIa-H/H131 allotype amongst patients with ANCA-positive systemic vasculitis, irrespective of ANCA specificity, and also that there was no association between this FcyRIIa allotype and nephritis. Depending on the ANCA IgG subclass specificity, FcyRIIa alleles may thus represent heritable disease risk factors in ANCA-triggered inflammation in patients with Wegener’s granulomatosis and systemic vasculitis. Heparin-induced thrombocytopenia (HIT) is characterized by FcyR-mediated platelet activation in the presence of patient serum and heparin and is diagnosed by evaluating the effect of patient plasma on the aggregation of normal donor platelets. Brandt et al. (1995), showed that platelets from donors bearing the RIIa-H/H131 phenotype were largely unresponsive to plasma from patients with HIT or to murine IgGl anti-platelet mAb. The frequency of the RIIa-H/H131 allotype was significantly increased in patients with HIT (34.4%) compared to nonthrombocytopenic patients (19%), suggesting a pathophysiologic role of the FcyRUa polymorphism in HIT (Brandt et al., 1995). FcyRs have been shown to play a significant role in autoimmune disorders, either by meditating destruction of normal cells opsonized with autoantibodies or conversely, 24 University of Ghana http://ugspace.ug.edu.gh by failing to clear immune complexes (ICs) adequately. For example, inability of FcyR-bearing cells to remove soluble ICs has been proposed to enhance autoimmune conditions such as systemic lupus erythematosus (SLE), where IC deposition in tissues triggers inflammation and tissue destruction, a characteristic type IH hypersensitivity reaction (Deo et al., 1997). On the other hand, engagement of functional FcRs on effector cells of the mononuclear phagocyte system triggers the destruction of autologous erythrocytes or platelets in the presence of autoantibodies directed to these cells. This results in autoimmune haemolytic anaemia or idiopathic thrombocytopenia purpura, both of which are autoimmune disorders characteristic of type II hypersensitivity class of inflammation (Deo et al., 1997). Two SLE patients were identified lacking FcyRIIIb expression, based on either a transport defect of one of the receptor alleles (Enenkel et al., 1991) or an absent / abnormal gene (Clark et al., 1990). It was tempting to speculate that the FcyR polymorphism may underlie the FcyR- mediated phagocytosis described in SLE patients. Indeed, Blasini et al. (1993), described an increased proportion (82%) of T cell responders to Leu4 (mlgGl anti-CD3 mAb), expressing the RIIa-R/R131 or RIIa-R/H131 allotypes, in Venezuelan SLE patients, compared to patients with other autoimmune diseases. Duits et al. (1995) found a significant association between the RHa-R/R131 allotype and lupus nephritis (38% for RIIa-R/R131, 48% for RHa- R/H131, and 14% for RHa-H/H131) as compared to either SLE without nephritis (18% RHa-R/R131, 58% RIIa-R/H131 and 24% RDa-H/H) or healthy Caucasian donors. No differences were found for FcyRIIIb polymorphism between SLE patients with or without nephritis. 25 University of Ghana http://ugspace.ug.edu.gh In 1 ine w ith s ome s tudies m ade b y D uits et al. ( 1995), S almon e t al. (1996), also reported a skewed distribution of the RIIa-H/H131 genotype (9%) in African American SLE patients compared to normal donors (30%). These differences were even more striking in a large collection of 214 SLE patients, where 37% expressed the RHa-R/R131 allotype compared to 23% RIIa-R/R131 homozygotes in normal donors. T he h ighest frequency o f t he R Ila-R/Rl 31a llotype w as o bserved i n SLE patients with nephritis (42% RIIa-R/R131 and 12% RIIa-H/H131). Due to the similarities in the pathogenesis of SLE and malaria, it may be possible that FcyR polymorphisms are likely to play a major role in an individual’s susceptibility to malaria. 1.2.3 Malaria: The Disease Malaria is an infectious disease caused by protozoa of the genus Plasmodium which, in sub-Saharan Africa is transmitted by Anopheles gambiae mosquitoes. Malaria is a major global health problem posing a threat to up to 40% of the world’s population (WHO, 1996). The WHO reports that malaria in sub-Saharan Africa has an intense stable transmission causing 270-480 million clinical cases each year and affecting mainly young children. There are over 120 species of Plasmodia, but only four are responsible for malaria in humans with each species causing characteristic symptoms. The four species are Plasmodium falciparum, P. malariae, P. ovale and P. vivax and each of these is biologically and morphologically distinct. 26 University of Ghana http://ugspace.ug.edu.gh In Africa, P. falciparum predominates, as it does also in Papua New Guinea and Haiti, and it is responsible for all lethal forms of malaria, whereas P. vivax is more common in Central and parts of South America, North Africa, the Middle East and the Indian subcontinent. The prevalence of both species is approximately equal in other parts of South America, East Asia and Oceania. Plasmodium vivax is rare in sub-Saharan Africa, whereas P ovale is rare outside West Africa . Plasmodium, malariae is found in most areas , but is relatively uncommon outside Africa (White, 1996). The endemicity of malaria is defined traditionally in terms of the spleen or parasite rates in children aged between 2 and 9 years (Gamham, 1966). In areas which are holoendemic or hyperendemic for P . falciparum, such as much o f tropical Africa, people are repeatedly infected throughout their lives (Cattani et al., 1986). There is considerable morbidity and mortality during childhood. In the Gambia, where people are infected once each year on average, malaria has been estimated to cause 25% of deaths between 1 and 4 years of age, but eventually if the child survives, a state of premunition is achieved where infections cause little or no problems to the host (White, 1996). Non-immune adults entering an area of intense transmission acquire premunition more rapidly than children. Babies develop severe malaria relatively infrequently (although if they do, mortality is high). The factors responsible for this include passive transfer of maternal immunity (McGregor, 1984), and the high haemoglobin F content of the infants’ erythrocytes which retards parasite growth (Pasvol et al., 1977). In holoendemic areas, the baby is inoculated repeatedly with sporozoites during the first year of life, but the blood stage infection is seldom severe. 27 University of Ghana http://ugspace.ug.edu.gh The pathophysiology of malaria results from destruction of erythrocytes, the liberation of parasite and erythrocyte material into the circulation, and the host’s reaction to these events. Plasmodium falciparum malaria-infected erythrocytes also sequester in the microcirculation of vital organs, interfering with microcirculatory flow and host tissue metabolism (Ponnudurai et al., 1991). Malaria can be uncomplicated or severe. Uncomplicated malaria is defined as malaria in the absence of the features of severe malaria (WHO, 1990). It is the most common presentation of malaria. Clinical features in children include fever, headache, anaemia, vomiting and watery diarrhoea, tachypnoea, cough and febrile convulsions. Uncomplicated malaria is not immediately life threatening, but must be treated promptly because it can rapidly lead to severe anaemia. Severe malaria is defined as asexual with one or more of the following complications; coma (cerebral malaria), respiratory distress, hypoglycaemia and severe anaemia. These are the most common causes of death due to malaria in children. There can also be repeated generalized convulsions, metabolic acidosis and shock. Other features of severe malaria in children are impaired consciousness other than coma, prostration or extreme weakness, hyperparasitaemia, jaundice and a rectal temperature above 40°C (White, 1996). In adults, additional defining features of severe malaria are acute renal failure, pulmonary oedema including adult respiratory distress syndrome (ARDS), spontaneous bleeding and haemoglobinuria (black water fever). These features are less common in children (WHO, 1990). 28 University of Ghana http://ugspace.ug.edu.gh 1.2.3.1 Cerebral Malaria This may be defined as unrousable coma, i.e. there is a non-purposeful or no response to a painful stimulus in falciparum malaria (Molyneux et al., 1989). Although cerebral malaria is the most predominant feature of severe falciparum malaria, some patients with .‘ultimately lethal infections never lose consciousness until they die. The onset of coma may be sudden, often following a generalized seizure, or gradual, with initial drowsiness, confusion, disorientation, delirium or agitation, followed by unconsciousness. The length of the prodromal history is usually several days in adults, but in children can be as short as 6-12 hours. The depth of coma is classified by a modification of the Blantyre coma scale (Table 1.2) (WHO, 1990). 29 University of Ghana http://ugspace.ug.edu.gh Table 1.2. Blantyre coma scale for assessment of consciousness in young children Best Motor Response Score Localizes painful stimulus 2 Withdraws limb from painful stimulus 1 No response 0 Best Verbal Response Cries or speaks appropriately with painful stimulus 2 Moan or abnormal cry with painful stimulus 1 No vocal response to painful stimulus 0 Eye Movement Watches or follows 1 Fails to watch or follow 0 Total Score 0-5 Untreated cerebral malaria is probably uniformly fatal. The overall mortality of treated cerebral malaria obviously depends on the referral practices and medical facilities available, but in reported studies averages 15% in children and 20% in adults, but up to 50% in pregnancy (White & Ho, 1992). The occurrence of cerebral malaria appears to have a direct relationship to parasite levels in blood, with better nourished children more severely affected (Hendrickse et al., 1971). Cerebral malaria is not uncommon in Accra, Ghana. Mortality associated with cerebral malaria has been claimed to be as high as 10-20% even with the best of care (Nkrumah, 1977; Commey et al., 1980). Over the past decade, workers in 30 University of Ghana http://ugspace.ug.edu.gh Accra, G hana h ave n oted a nd r eported a c onsiderable i ncrease i n t he incidence of cerebral malaria, especially among older children (Commey et al., 1980). Presumably the metabolic milieu created adjacent to the sequestered and highly metabolically active parasites interferes with neurotransmission but how this occurs is not known. Cytokines increase production of nitric oxide, a potent inhibitor of neurotransmission, by leucocytes, smooth muscle cells, microglia and vascular endothelium through induction of the enzyme nitric oxide synthase. Local synthesis of nitric oxide could well be relevant to the impairment of consciousness. Coma in malaria is not caused by raised intracranial pressure (White, 1996). 1.2.3.2 Anaemia in malaria The degree of anaemia and the rate at which it develops vary enormously. The haemoglobin concentration may fall by up to 2 g/dl each day (Mabey et al., 1987). Some patients appear to tolerate severe malarial anaemia relatively well. These patients usually have an underlying chronic anaemia, and have adapted to increased oxygen carriage. Thus it is both the absolute haemoglobin concentration and the magnitude of the fall that determine the clinical consequences (Lee et al., 1989). The pathogenesis of anaemia is multifactorial (Zuckerman, 1966; Perrin et al., 1982). There is obligatory destruction of red cells containing parasites at merogony. There is also accelerated destruction of non-parasitized cells that parallels disease severity (Davis et al, 1990; Looareesuwan et al., 1991). In severe malaria, anaemia develops rapidly; as there is also the rapid haemolysis of unparasitized red cells contributing to the decline in haematocrit (Looareesuwan et al, 1987). 31 University of Ghana http://ugspace.ug.edu.gh The role of antibody in anaemia is unresolved (Facer et al., 1979; Abdallah et al., 1980; Merry et al., 1986). The majority of studies to date do not show increased red cell immunoglobulin binding in malaria, but in the presence of a lowered recognition threshold for splenic clearance, this might be difficult to detect. Red cell survival is shortened in malaria and this is affected by corticosteroids (Charoenlarp et al., 1979). 1.2.4 Immune Response The precise mechanisms controlling malaria infections are still incompletely understood. It was apparent from the era of malaria therapy, that a strain-specific immunity developed to protect against re-challenge with the same strain, did not protect from infection with a different strain (Jeffery, 1966). Immunity, as distinct from premunition, may be reached when there has been exposure to all local strains of malaria parasites. In controlling acute infection, non­ specific host defence mechanisms and the development of more specific cell- mediated and humoral responses are both important. Acute malaria infections are associated with malaria antigen-specific unresponsiveness. This selective paresis is one of the factors contributing to the slow development of an effective and specific immune response to malaria. In non- immune individuals, the acute immune response to infection often comprises mostly IgM and IgG2 isotypes which are unable to harm cytotoxic cells and thus kill asexual malaria parasites (Bouharoun-Tayoun & Druilhe, 1992). These observations have led to the suggestion that malaria induces an immunological ‘smokescreen’ with broad-spectrum and non-specific activation that interferes with the orderly development of a specific cellular immune response (Ho & Webster, 1990). 32 University of Ghana http://ugspace.ug.edu.gh Following an infection, there is a transient humoral response to sporozoite antigens; sporozoites antibodies decline, with a half-life of 3-4 weeks (Webster et al., 1988). In areas of high transmission, sporozoite antibody levels tend to plateau between 20 and 30 years of age, and do not correlate with premunition. Protective antibodies inhibit parasite expansion through co-operation with the monocyte-macrophage series by binding to parasitized erythrocytes and then activating these cells’ Fc receptors (Bouharoun-Tayoun e t al., 1 990). Non-specific effector mechanisms include the activation of phagocytic cells (including neutrophils) to release toxic oxygen species and nitric oxide, both of which are parasiticidal. The reaction of these oxygen intermediates with lipoproteins produces lipid peroxides (Rockett et al., 1988). These are more stable cytotoxic molecules and are unaffected by antioxidants. There is also augmentation of splenic clearance function in which both filtration (Looareesuwan et al., 1987), and Fc receptor- mediated phagocytosis are increased (Lee et al., 1989; Ho et al., 1990). Infected erythrocytes are more rigid and more opsonized than uninfected red cells that express both host and parasite-derived neoantigens on the erythrocyte surface. However, the parasite proteins expressed on the red cell surface undergo antigenic variation (Marsh & Howard, 1986; Hommel & Semoff, 1988), and this is probably instrumental in avoiding complete immune clearance and sustaining the infection. The monocyte-macrophage series appear to be the most immune effector cells in the direct attack on parasitized erythrocytes and merozoites, although neutrophils may also play a part. 33 University of Ghana http://ugspace.ug.edu.gh IgG diffuses more readily than the other immunoglobulins into the extravascular body spaces where, as the predominant species, it carries the major burden of neutralizing bacterial toxins and binding to micro-organisms to enhance their phagocytosis (Benjamini, 1996). The complexes of bacteria with IgG antibody activate complement thereby chemotactically attracting polymorphonuclear phagocytic cells (PMNs), which adhere to the bacteria through surface receptors for complement and the Fc portion of the IgG (Fey). Binding to the Fc receptor then stimulates ingestion of micro-organisms through phagocytosis. In a similar way, the extracellular killing of target cells coated with IgG antibody is mediated largely through recognition of the surface Fey by NK cells bearing the appropriate receptors (Cresswell, 1987). The interaction of IgG complexes with platelet Fc receptors presumably leads to aggregation and vaso active amine release, but the physiological significance of Fey binding sites on other cell types, particularly lymphocytes, has not yet been clarified (Roitt, 1988). 1.2.5 Methods for FcyR Genotyping and Phenotyping 1.2.5.1 Immunological Methods Neutrophil-specific antigens, NA1 and NA2 can be typed by leucoagglutination with a panel of anti-NAland anti-NA2 allosera (Huizinga et al., 1990). Whereas the cross linking of multivalent protein antigens by antibodies leads to precipitation, cross- linking of cells or large particles by antibodies directed against surface antigens lead to agglutination. 34 University of Ghana http://ugspace.ug.edu.gh Neutrophil-specific antigens NA1 and NA2 can also be determined serologically by radioimmunoassay (RIA) with Murine Antibodies CLB-FcR gran I, CLB-gran II and GRMI (Edberg et al., 1990). Using sera from donors known to be FcyRUIb- NA1/NA1 positive, the binding of CLB gran II relative to a standard is determined and set as 100% relative binding. Phenotyping can also be done by flow cytometry using CD16 MAb ID3, which selectively reacts with FcyRUI (Perussia and Ravtech, 1991), MAb CLB gran II which specifically recognizes FcyRHIb-NAl (Werner et al., 1986; Huizinga et al., 1989), and MAb GRMI, which detects FcyRIHb-NA2 (Edberg et al., 1990). Determination of the H I31 / R131 alleles can be done by quatitative flow cytometry using CD32 MAb IV.3, which reacts with both FcyRHa-H131 and -R131 (Looney et al., 1986) and MAb 41H 16, which reacts selectively with FcyRIIa-R131 (Gosselin et al., 1990) The FcyRUa phenotype of cells from different donors can be analysed by comparing the potency of mlgGl and hIgG2 blood. Three groups of donors can be discriminated: two groups with PBMC only responsive to either mlgGl or hIgG2 anti-CD3MAb, and one group with a comparable reactivity to both anti-CD3 MAb, indicating homozygous FcyRIIa-R131, homozygous anti-CD3-MAb induced Tcell proliferation in PBMC isolated from citrated FcyRIIa-H131, and heterozygous FcyRIIa-R/H131 individuals, respectively (Bredius et al., 1993). 35 University of Ghana http://ugspace.ug.edu.gh 1.2.5.2 Molecular Methods Polymerase Chain Reaction (PCR) amplification is used to distinguish between the FcyRIIa- HI 31 and R131 and FcyRIIIb-NAl and NA2 genotypes (De Haas e t a I, 1995; Osborne et al., 1994). PCR is an in vitro method for nucleic acid synthesis by which a target DNA is exponentially replicated (Saiki et al., 1985; Mullis et al., 1986). It uses a thermostable DNA polymerase isolated from Thermus acquaticus, Taq polymerase and two oligonucleotide primers which flank the target DNA sequence to be amplified. The reaction involves repeated cycles of heat denaturation of DNA, annealing of primers to their complementary sequences at a lower temperature, and extension of the annealed primers with the polymerase. The primers hybridise to the opposite strands of the target DNA and are oriented (3’ ends pointing towards each other) so that DNA synthesis by the polymerase proceeds across the region between the primers. The extension products are complementary to and capable of binding primers, therefore successive cycles of amplification result in the doubling of the target DNA synthesized in the previous cycle. Polymerase Chain Reaction uses equimolar concentrations of the two primers. These primers are usually designed to hybridise to conserved regions of the genome. Primers are also designed such that the annealing temperatures in the PCR reaction are as high as possible to ensure that they are specific during amplification (Thein & Wallace, 1986). Under standard conditions the annealing temperature in a reaction should be 5°C lower than the melting temperature (Tm) of the primers and this is determined using the following formula (Thein & Wallace, 1986); Tm =[4 (G+C) +2 (A+T)] 36 University of Ghana http://ugspace.ug.edu.gh where G, C, A, and T are guanine, cytosine, adenine and thymine, respectively. The standard PCR amplification protocol amplifies most target DNA, however optimal performance is sought by varying most parameters and conditions for each new amplification (Innis & Gelfand, 1990) The standard reaction mix contains IX PCR reaction buffer, 200(iM each of deoxyribonucleotides (dATP, dCTP, dGTP, dTTP), 2.5 units of Taq DNA polymerase, 0.5|jM each of the forward and reverse primers, and lng-l(J.g of template DNA. The temperature cycling is performed using a programmable thermal cycler, programmed to carry out the repeated cycling of denaturation at between 94°C and 96°C, primer annealing at a range of 58°C - 60°C and primer extension at 72°C. The sizes of PCR products are estimated by comparison with the mobility of standards of known molecular weights on agarose gel. In principle, the mobility of a DNA molecule is related to its size (Sambrook et al, 1989). The larger the molecule, the lower the rate of migration. The rate of migration of DNA molecules on agarose gels is inversely proportional to the logarithms of the molecular weights as expressed below: D= a - b (log M) where D is the distance moved by the DNA molecule on the agarose gel, M is the molecular weight of the DNA and a and b are constants. PCR method for identification of the FcyRIIa allotypes is done by first amplifying the FcyRIIa gene using gene -specific primers (Osborne et al, 1994). The sense 37 University of Ghana http://ugspace.ug.edu.gh primer used is upstream to the polymorphism encoding amino acid 131 in the second extracellular domain and does not distinguish between the genes for FcyRIIa, b or c. The antisense primer is located downstream of the polymorphism in the transmembrane domain and contains nine bases on the 3’ end of the primer which is unique to the FeRIIa gene FcyRIIa genotyping is accomplished by allele-specific polymerase chain reaction. Two more allele specific PCR reactions are carried out on the PCR product obtained from the first round of PCR described above. Both reactions will utilize a common antisense primer located downstream to the polymorphism, and one of the two allele- specific primers. The two allele-specific primers were designed with the 3’ base complementary to the allovariable base: H131-specific: 5’-GAA AAT CCC AGA AAT TCT CCC A-3’ R131-specific: 5’-GAA AAT CCC AGA AAT TCT CCC G-3\ FcyRIIIb genotyping can also be done using the polymerase chain reaction with primers designed specifically for the NA1 and NA2 allotypes (De Haas et al., 1995). Another means by which the FcyRIIa allotypes can be differentiated is by allele specific oligonucleotide (ASO) hybridisation. This method is an established technique used to distinguish single or multiple nucleotide polymorphisms (Saiki et al., 1985). 38 University of Ghana http://ugspace.ug.edu.gh CHAPTER 2 MATERIALS AND METHODS 2.1. CHEMICALS AND REAGENTS The reagents for PCR, 10X PCR Buffer, magnesium chloride (50mM MgC12), Taq DNA polymerase, deoxyribonucleoside triphosphates: deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP) and molecular weight marker (123 basepair ladder), were purchased from Sigma Chemical Company, St Louis U.S.A, and GIBCO BRL (Life Technologies U.S.A). Saponin, absolute ethanol, sodium chloride, sodium hydroxide, potassium chloride, sodium citrate, sodium phosphate, silver nitrate, potassium phosphate, mineral oil, chelating resin, bromophenol blue, sucrose, agarose (molecular biology grade) and ficoll, were also purchased from Sigma Chemical Company, St Louis, U.S.A. All the oligonucleotide primers, and cell lines, K562 and U937, which were used as controls, were purchased from Alta Bioscience, University of Birmingham, U.K. Tris (hydroxymethyl) aminomethane, ethylene diamine tetra acetate, (EDTA) disodium salt, acetic acid and ethidium bromide were obtained from Fluka AG Granite Chemika, Switzerland. Orange G was obtained from Kanto Chemical Company Ltd., Japan. 2.1.1 Preparation of Buffers and Solutions The various buffers and solutions used were prepared as described in Appendix I 2.2 BLOOD SAMPLE COLLECTION 2.2.1 The study areas The first part of the work, which involved collecting blood samples from children who were asymptomatic for malaria to serve as controls, was conducted in Dodowa, 39 University of Ghana http://ugspace.ug.edu.gh the capital town of the Dangbe West District of Ghana. The Dangbe West District is situated between longitudes 0° 5’ E and 0° 20’E and latitudes 5° 40’ and 6° 19’ N. Dodowa is predominantly a farming community with a population o f about 6,500 inhabitants (Appawu & Baffoe-Wilmot, 1997). The vegetation in Dodowa can be described as coastal forest, which lies between the coastal savannah to the south and secondary forest areas to the north. A permanent stream with forest gallery along the banks runs through the town. However as a result of deforestation very little of the original forest is left. Rainfall is seasonal with two peaks occurring in June and September (Appawu & Baffoe-Wilmot, 1997). Dodowa is known to be a hypoendemic area for malaria. Although a few cases of P. malariae is seen, most of the cases of malaria are due to P. falciparum, which is transmitted mostly by A. gambiae s.s. (Appawu & Baffoe-Wilmot, 1997). The second part of the study, which involved screening for children with clinical malaria, was carried out at the Department of Child Health of the Korle-Bu Teaching Hospital, in Ghana. Although people from all walks of life bring their ailing children to the Department of Child Heath, most of the patients seen daily are children from the immediate environs of the hospital, who are usually children of low- income families. The suburbs around the hospital are not very well planned as far as social infrastructure is concerned. There are no or very poor drainage systems in the areas, no waste disposal systems in place and poor toilet facilities. During the rainy seasons (May- August), very severe falciparum malaria is one of the major diseases reported at the hospital. 40 University of Ghana http://ugspace.ug.edu.gh 2.2.1.1 Field Sample Collection An initial cohort of 250 children aged between 1 and 14 years of age were randomly selected at Dodowa. The subjects were asked for their ethnic background and then examined by a medical officer to establish their health status. Venous blood of the individuals were then taken by a qualified personnel onto Whatman No. 5 filter paper and also onto glass slide. The filter papers were air-dried and preserved individually in plastic bags and stored at -20°C until ready to be used whereas the slides were sent to the laboratory for microscopy studies. Seventy-five of the children were selected to serve as controls based on the health status. This study was carried out over a period of 5 months from February to June 2000. 2.2.1.2 Hospital Sample Collection Patients reporting to the Department of Child Health, Korle Bu Teaching Hospital with malarial—like symptoms, were the subjects used for this study with the approval from the ethics board and informed consent of their parents. A questionnaire was given them to complete (Appendix II). The patients were first examined by the Medical Officer in charge and thereafter venous blood and urine samples were taken for analysis. The patients presenting malaria-like symptoms were grouped into different clinical categories using the inclusion and exclusion criteria that are stated below in Table 2.1. A medical officer ascertained the clinical status of each patient after the results of the blood and urine analyses had been obtained. 41 University of Ghana http://ugspace.ug.edu.gh Table 2.1. Inclusion and exclusion criteria used for grouping of patients into different clinical categories. Clinical category Inclusion criteria Exclusion criteria Cerebral malaria Parasitaemia Other neurological disease (CM) Blantyre coma scale < 3 Recent severe head trauma Duration of coma > 60 mins Other cause of coma Severe malarial Parasitaemia Blantyre coma scale < 5 at any anaemia (SA) Haemoglobin < 5 g/dl time Observed convulsions Recent severe bleeding Other cause of anaemia Uncomplicated Parasitaemia Blantyre < 5 at any time malaria (UM) Haemoglobin > 8 g/dL Reported or observed convulsions Full consciousness Respiratory distress “Coco cola” urine Other major organ failure Respiratory Parasitaemia Exclusion of other causes of distress (RD) At least one of the following respiratory distress (e.g. Abnormally deep (breathing) Alar flare Use of accessory respiratory muscles e.g supraclavicular, suprastenal Recessions Chest recessions pneumonia) 42 University of Ghana http://ugspace.ug.edu.gh 2.3 Blood Analysis 2.3.1 Parasitaemia Thin blood films were stained with 5% Geimsa solution and the films were examined by an experienced malaria microscopist using the standard examination protocol of 200 fields per film. 2.3.2 Haemoglobin level Estimation Whole blood was collected into a vacutainer containing K3EDTA and the haemoglobin level determination was performed using the automated Sysmex blood analyser. 2.3.3 Glucose Estimation An aliquot of 2ml of Glucose oxidase was mixed with 20pl blood plasma and incubated at room temperature for 25 minutes. The colour obtained was read off a Microlab 2000 analyser to estimate the blood glucose level. 2.3.4 Sickling Status A drop of venous blood was mixed with a drop of 2% sodium metabisulphite (Na2S205) on a slide and covered with a cover-slip. This was then left in a humid chamber for at least 30 minutes and examined under a microscope for the sickle cells or the holy leaf appearance. 2.4 Urinalysis The urine from the patients was collected in a transparent tube and visually examined to see if the colour was dark as the coca cola drink or not. 43 University of Ghana http://ugspace.ug.edu.gh 2.5 Extraction of Human DNA from Filter Paper Blood Blot Human DNA was isolated from the blood blot on filter paper as described by (Wooden et al., 1993). Briefly a piece of the blood spot was cut out of the filter paper with a sterile blade and placed into a 1.5ml eppendorf tube containing 0.5% saponin in 1 X Phosphate Buffered Saline (PBS) solution. This was then incubated overnight at 4°C and thereafter spun at 13 000 rpm using a Kubotall20 microcentrifuge for 1 minute. The supernatant was poured off and the filter paper then washed twice in 1ml of 1 X PBS. The filter paper was transferred into a fresh tube and 150)l i1 sterile double distilled water and 50j l i1 of 20% chelex solution were added and the mixture boiled for 8mins. It was then centrifuged for 5 minutes to pellet the chelex and debris. The supernatant containing the DNA was transferred into a fresh sterile tube and stored at -20°C until ready to use for PCR. 2.6. Determination of FcyRIIa Allotypes using Allele-Specific PCR This method involved two rounds of PCR. The FcyRUa gene was amplified as described by Osborne et al., (1994), using gene-specific primers. For the initial PCR, 5 |xL of extracted DNA were added to a 20 j j .1 reaction mixture containing 2mM MgCl2, 50mM KC1, 20mM Tris-HCl, pH 8.3, 0.1 mg/ml of gelatin, 200 |iM of each of the four deoxyribonucleotides, 0.5|xM of each oligonucleotide primer, P52 and P63 (Table 4) and 0.5U of Taq DNA polymerase. The PCR cycling conditions were 1 cycle of 95°C for 3 mins; 60°C for 45 s; 72°C for 4 mins, followed by 35 cycles of 95°C for 1 min; 55°C for 45 s; 72°C for 2 min: and ended with a final cycle of 72°C for 10 min. 44 University of Ghana http://ugspace.ug.edu.gh Two further PCR reactions which are allele-specific were c a r r ie d out on the PCR product obtained from the first round of PCR described above. Both reactions utilized a common antisense primer, R2A (Table 2.2) and one of the two allele- specific primers, R2R or R2H (Table 2.2). The PCR reactions were in total volumes of 2 5pi c ontaining 0. 5p.l o f t he P CR p roduct, 0.1 pM s ense and antisense primers, 2.75mM MgCl2, 50mM KC1, 20mM Tris-HCl (pH 8.3), O.lmg/mL gelatin, 200(J.M each of deoxyribonucleotides and 0.5U Taq DNA polymerase. The cycling program was set to the following parameters: 95°C for 5 min; 35 cycles of 95°C for 15s; 58°C for 30 s; and 72°C for 30 s, and a final extension step of 72°C for 10 min. Table 2.2 DNA sequences of oligonucleotide primers used in genotyping Primer DNA Sequence (5’-3’) Size Melting (bp) Temp (°C) P52 CAAGCCTCTGGTCAAGGTC 19 55 P63 GAAGAGCTGCCCATGCTG 18 57 R2A CTAGCAGCTCACCACTCCTC 20 55 R2H GAAAATCCCAGAAATTCTCCCA 22 60 R2R GAAAATCCCAGAAATTCTCCCG 22 62 NA1A CATGGACTTCTAGCTGCACCG 21 61 NA1S CAGTGGTTTCACAATGTGAA 20 52 NA2S CTCAATGGTACAGCGTGCTT 20 56 NA2A CTGTACTCTCCACTGTCGTT 20 49 45 University of Ghana http://ugspace.ug.edu.gh 2.7 Determination of FcyRIIIb Genotypes by PCR FcyRIIIb genotyping was performed using the PCR amplification of the genomic DNA. The reaction to determine the NA1 gene was done in a 25pL which contained 5jj.L of extracted DNA, 0.8|_iM each of the sense and antisense primers, NA1S and NA1A (Table 2.2), 2mM MgCl2, 20mM Tris-HCl (pH 8.3), 50mM KC1, O.lmg/ml gelatin 200|iM each of the four deoxyribonucleotides and 0.5U Tag DNA polymerase. The mixture was thoroughly mixed and centrifuged briefly at 10 000 rpm in a Kubota 1120 centrifuge. The temperature profile for this reaction was 95°C for 5 min, followed by 10 cycles of 95°C for 1 min; 60°C for 1.5 min; 72°C for 2.5 min; and then 25 cycles of 95°C for 1 min; 57°C for 1 min; 72°C for 1 min. A 10 min extension at 72°C concluded the reaction. For the amplification of the FcyRIIIb-NA2 DNA, a reaction mixture containing the following was prepared. 20mM Tris-HCl, 50mM KC1, O.lmg/ml gelatin, 5jal of extracted DNA, 0.1 (aM each of the sense and antisense primers, NA2S and NA2A (Table 2.2), 200(xM each of the four deoxyribonucleotides and 0.1 U of Taq DNA polymerase. The cycling parameters used were 95°C for 5 min, followed by 35 cycles of 95°C for 1 min; 46°C for 1.5 min; 72°C for 2.5 min, and thereafter 72°C for 10 min. 2.8 Analysis of PCR Products for Identification and Phenotyping Following the PCR, the products were electrophoresed on a 1.5% agarose gel and stained with 0.5[ig/ml ethidium bromide. One micro litre of bromophenol blue (5X) 46 University of Ghana http://ugspace.ug.edu.gh or Orange G (5X) gel loading dyes was added to five micro litres of each sample. The gel was prepared and run with IX TAE buffer using either a midi or maxigel system (BIORAD). The gels were run at 80V for one hour, visualised and photographed over a UV transilluminator (UPC, USA), at short wavelength using a Polaroid camera (IBI4 6 4 00) fitted with an orange filter and a P olaroid type 6 67 film. The sizes of the PCR products were estimated by comparison with the mobility of standards of known DNA molecular sizes. 2.9 Statistical Analysis The statistical softwares used for the analysis were SPSS 10.00 for Windows and Epi Info 6 for Dos. Fey Rlla allotypes distribution (H/H131, H/R131, R/R131) and allele frequencies (H, R) were analysed by applying the %2 test. To reject the null hypothesis, a probability of 0.05 was used. The FcyRIIa polymorphism was then analysed as a dichotomous variable comparing the homozygous FcyRIIa-H/H131 with the homozygous FcyRHa-R/R131 and heterozygous FcyRHa-H/R131 allotypes using the x2 test in controls (non malarious patients) and malaria subjects presenting with different phases of the disease. The same analysis was done for the FcyRHIb genotype distribution (NA1/NA1, NA2/NA2 ,NA1/NA2 and the null genotype) and allele frequencies (NA1, NA2). 47 University of Ghana http://ugspace.ug.edu.gh CHAPTER 3 RESULTS 3.1 STUDY POPULATION The details of the demographics and PCR data are given in Appendix HI 3.1.1 Control Group Seventy-five children out of the 250 randomly selected individuals from Dodowa who were without malaria parasites formed the healthy controls. Out of these 38, (50.7%) were males and 37 (49.3%) were females. The age distribution of the control group is shown in Figure 3.1. Their ages ranged from 1-13 years with a mean of 7.4 (standard deviation = ± 3.07). The ethnic distributions of these children were as follows: 13 (17.3%) were Northerners, 21 (28%) were Ewes, 30 (40%) were Gas and 11 (14.7%) were Akans 48 University of Ghana http://ugspace.ug.edu.gh Nu m be r of ch ild re n 10 Age (years) Figure 3.1. Age distribution of the control group 49 University of Ghana http://ugspace.ug.edu.gh 3.1.2 Patient Group A total of 254 patients comprising 147 (57.9%) males and 107 (49.3%) females who reported at the Department of Child Health of the Korle Bu Teaching Hospital and had parasitaemia were studied. The ages of the children ranged from 1-13 years. The mean age was 3.8 with a standard deviation 2.9 (Figure 3.2). About 77% of the children were below the age of 6. Out of these, 54 (21.3%) were diagnosed as having cerebral malaria, 76 (29.9%) had severe anaemia and 124 (48.8%) had uncomplicated malaria (Figure 3.3). Two hundred and forty-two (95.3%) of these patients were sickling negative, while 12 (4.7%) were positive. Eighty-three (32.7%) of the patients presented with 'coca cola’ urine, 39 (15.4%) with respiratory distress and 7 (2.8%) were hypoglycaemic. The mean haemoglobin level of the patients was 6.6g/dl (range: 0.4g/dl 14.0 g/dl) (Figure 3.4). The ethnic distribution was as follows: 64 (25.2%) were Northerners, 40 (15.7%) were Ewes, 41 (16.1%) were Gas and 109 (42.9%) were Akans. 50 University of Ghana http://ugspace.ug.edu.gh Nu m be r of ch ild re n Age (years) Figure 3.2. Age distribution of malaria patients recruited at the Korle Bu Teaching Hospital. 51 University of Ghana http://ugspace.ug.edu.gh Figure 3.3. The distribution of the different malaria presentations diagnosed among the 254 patients. 52 University of Ghana http://ugspace.ug.edu.gh HB levels Figure 3.4. The haemoglobin profile of the patient group. The mean haemoglobin value seen in the patients was 6.5 g/dl. 38% of them recorded Hb levels below 5 g/dl which is the cut off point for severe malaria anaemia. 53 University of Ghana http://ugspace.ug.edu.gh 3.2 FcyRIIa Genotype Distribution The electrophregram in Figure 3.5 shows the amplified region of FcyRIIa gene which is 1 kilobase in size. The 290 base pair bands shown in Figure 3.6 is an example of the portion of the FcyRIIa gene that contains the amino acid histidine at position 131 while Figure3.7 shows an example of the bands obtained when the polymorphic site containing arginine instead of histidine is amplified. 54 University of Ghana http://ugspace.ug.edu.gh M 1 2 3 4 5 6 7 8 9 10 Figure 3.5 An example of electrophoregram of PCR amplification of the human FcyRUa gene using P52 and P63. Lane M contains the 123 molecular weight marker, Lane 6 has the negative control Lanes 1-5 and 7-10 are PCR products of the FcyRIIa gene. 55 University of Ghana http://ugspace.ug.edu.gh 1 2 3 4 5 6 7 8 9 10 M Figure 3.6. An example of electrophoregram of PCR products using primers R2A and R2H that amplifies the region with FcyRIIa polymorphism. Lane M is the 123 molecular weight marker, Lanes 2, 9 and 10 indicating the absence of the H allele, can only be typed as R/R131. Lanes 1,3,4, 6, 7 and 8 have the diagnostic size of 290bp indicating the presence of the H allele and therefore can either be the H/Hl 31 or H/Rl 31 genotype. 56 University of Ghana http://ugspace.ug.edu.gh 1 2 3 4 5 6 7 8 9 10 M Figures 3.7 An example of electrophoregram of PCR amplification using primers R2A and R2R that amplify the polymorphic region of the FcyRIIa gene. Lane M is the 123 molecular weight marker. Lanes 1,2, 4, 6,7 and 9 have the expected band size of 290bp, indicating the presence of the R allele, and can therefore be either the R/Rl 31 or H/Rl 31 genotype. Lanes 3 and 10, indicating the absence of the R allele, can only be H/Hl 31. 57 University of Ghana http://ugspace.ug.edu.gh 3.2.1 FcyRIIa Genotype Distribution in the Control Group Fifteen (20%) out of the total 75 healthy children were H/H131 genotype, 44 (58.7%) were H/R131 and 16 (21.3%) were R/R131. Among the 13 Northerners in this group, 2 (15.4%) were H/H131, 3 (23.1%) were R/R131 and 8(61.5%) were H/R131 genotype. Five (23.8%) out of 21 Ewes were H/H131, 6 (28.6%) and 10 (47.6%) were R/R131 and H/R131, respectively. Within the Ga population, 6(20%) were H/H131, 5 (16.7%) were R/R131 and 19 (63.3%) were H/R131. Among the Akans, 2 (18.2%) were H/H131, another 2 were R/R131 and 7 (63.6) were H/R131. 3.2.2. FcyRIIa Genotype Distribution in the Patient Group Out of a total of 254 patients studied, 28 (11%) were of the H/H131 genotype, 147 (57.9%) were H/R131 while 79 (31.1%) were R/R131. Among the 64 Northerners, 5 (7.8%) were H/H131, 40 (62.5%) and 19 (29.7%) were H/R131 and R/R131 respectively. Among the Ewe patients 6 (15%) were H/H131, 25 (62.5%) and 9 (22.5%) were H/R131 and R/R131 respectively. Of the 41 Gapatients, 4 (9.8%) were H/H131, 22 (53.7%) were H/R131 and 15 (36.6%) were R/R131. Of the 109 Akan patients 13 (12%) were H/H131, 60 (55%) were H/R131 and 36 (33%) were R/R131. 3.2.3 Overall Relationship between FcyRIIa Genotype and Ethnicity Out of a total of 329 children recruited for this study, 77 (23.4%) were Northerners, 61 (18.5%) were Ewes, 71 (21.6%) were Gas and 120 (36.5%) were Akans. The genotype distribution found within the different tribes is shown in Table 3.1. On the whole, there was no significant association observed between this genotype and ethnicity (x2=3.25, P=0.77). Within the control group, statistical analysis revealed no significant association between the different genotypes and ethnic origin 58 University of Ghana http://ugspace.ug.edu.gh (H/H131, (x2= 3.751, P=0.29; H/R131, (%2 =2.919, P =0.40; R/R131, (x2=5.398, P =0.15). Similarly no significant association was found between FcyRIIa genotype and ethnic origin of patients (H/H131, (%2=1.475, P=0.68; H/R131, (x2=1.362, P=0.71; R/R131, (x2=2.205, P=0.53). Table 3.1 Overall percentage distribution of the FcyRIIa genotypes within the different ethnic groups FcyRIIa genotypes (%) Ethnic Group H/H131 H/R131 R/R131 Akan 12.5 55.8 31.7 Ga 14.1 57.7 28.2 Northerner 9.1 62.3 28.6 Ewe 18.0 57.4 24.6 3.2.4 Distribution of FcyRIIa Genotype of the Control and Patient Groups The Fey RHa genotypes for the patient and control groups were distributed as shown in Figure 3.8. No significant difference was observed in the overall genotype distribution between the patients and controls (x2 =5.49 P=0.06). However the differences between the FcyRHa-RTRl 31 genotype distribution in the patients and controls was significant (%2 =11.686, P=0.003). No significant differences were observed between the number of children possessing the H/R131 (x2 =12.157, P=0.07) and H/H131 (x2 =0.269, P=0.87) in both the patient and control groups. The genotype distribution within the various ethnic groupings in both the control and patient groups is shown in Table 3.2 59 University of Ghana http://ugspace.ug.edu.gh Table 3.2 FcyRIIa genotype percentage distribution among the different ethnic groups studied within the control and patient groups FcDIIa genotype (%) Ethnic group H/H131 H/R131 R/R131 Akan Controls 18.2 63.6 18.2 Patient 12.0 55.0 33.0 Ga Controls 20.0 63.3 16.7 Patient 9.8 53.7 36.6 Northener Controls 15.4 61.5 23.1 Patient 7.8 62.5 29.7 Ewe Controls 23.8 47.6 28.6 Patient 15.0 62.5 22.5 60 University of Ghana http://ugspace.ug.edu.gh i? so toc.oucu FcyRIIa genotypes Figure 3.8. Frequency distribution of the FcyRIIa genotypes within the control and patient groups. In both groups the H/R131 genotype was very dominant forming more than 50% for each group. The percentage of patient group found to be homozygous H/H131 were considerably lower than those in the control group. Conversely t here w ere m ore h omozygous R /R 131 in thep atient g roup t han i n t he control group. 61 University of Ghana http://ugspace.ug.edu.gh 3.3 Relationship between FcyRIIa Genotype and Disease Status The results obtained when the different malaria cases and their FcyRIIa genotype frequencies were analysed for association are illustrated in Figure 3.9. Of the 124 patients with uncomplicated malaria, 18 (14.5%) were H/H131, 80 (64.5%) were H/R131 and 26 (21%) were R/R131. Among the 54 patients diagnosed with cerebral malaria, 3 (5.6%) were found to be H/H131, 35 (64.8%) were H/R131 and 16 (29.6%) were R/R131. For the 76 severe anaemia cases, 7 (9.2%) were H/H131, 32 (42.1%) were H/R131 and 37 (48.7%) were R/R131. The association between the overall FcyRIIa genotype distribution and malaria was found to be significant (%2 =25.31, P=0.000) according to this study. While there was no significant association found between uncomplicated malaria and any of the FcyRIIa genotypes, the association between severe anaemia and FcyRIIa-R/R131 and FcyRIIa-H/R131 genotypes was significant; but no association was found between severe anaemia and FcyRHa-H/H131. Furthermore, there was significant association found between cerebral malaria and FcyRHa-R/R131, but there was no association found with FcyRIIa-H/Rl 31 andFcyRHa-H/H131 genotypes. 62 University of Ghana http://ugspace.ug.edu.gh Control Uncomplicated Cerebral Severe anemia Malaria cases Figure 3.9. Relationship between FcyRIIa and disease status The differences in the genotype distribution between the controls and patient groups gives an indication that the FcyRIIa-R/R131 puts an individual at risk while the FcyRHa-H/H131 confers protection against malaria. The H allele in the heterozygote state is seen to offer protection against severe malaria anaemia. This is however not the case in cerebral malaria or uncomplicated malaria. 63 University of Ghana http://ugspace.ug.edu.gh 3.4 FcyRIIIb Genotype Distribution The NA2 primer set amplified a 169bp DNA fragment while the expected size for the NA1 primers is 141bp. An individual testing positive for both NA1 and NA2 primers is typed as NA1/NA2 heterozygous. If an individual tests positive for NA1 but negative for NA2 and vice versa, then that individual is typed as NA1/NA1 and NA2/NA2, respectively. Results for the FcyRIIIb Genotype are shown in Figure 3.10. 64 University of Ghana http://ugspace.ug.edu.gh 1 2 3 M 4 5 6 7 8 9 10 11 12 Figure 3.10 An example of electrophoregram of PCR products using primer sets for NA1 and NA2 which amplify the region of the FcyRIHb polymorphism. Lane M is 123 molecular weight marker. Lanes 1 and 3 have the diagnostic size of 169bp indicating the presence of the NA2 allele and can therefore be either NA2/NA2 or NA1/NA2. Lane 2 indicating the absence of the NA2 allele can only be NA1/NA1 or Null. Lanes 4,5,6,7,9,10 and 12 having the diagnostic size of 141bp indicate the presence of the NA1 allele and can therefore be NA1/NA1 or NA1/NA2. Lane 11 indicating the absence of the NA1 allele can either be NA2/NA2 or Null. Lane 8 is the negative control. 65 University of Ghana http://ugspace.ug.edu.gh 3 4.1 FcyRIIIb Genotype Distribution in the Control Group The FcyRIIIb genotype frequency distribution within the control group is shown in Figure 3.11. Of the 75 children screened, 12 (16%) were NA1/NA1, 24 (32%) were NA2/NA2, 34 (45.3%) were NA1/NA2 and 5 (6.7%) possessed neither of these genes and were categorized as ‘Null’. Of the 13 Northerners in this group one (7.7%) was found to be NA1/NA1, 6 (46.2%) were NA2/NA2, 5 (38.5%) were NA1/NA2 and one was Null. Among the 21 Ewes in the group one (4.8%) possessed the NA1/NA1 genotype, 7 (33.3%) were NA2/NA2, 10 (47.6%) were NA1/NA2 and 3 (14.3%) were null. Five (16.7%) of the 30 Gas were NA1/NA1, 9 (30%) were NA2/NA2 and 16 (53.3%) were NA1/NA2. Out of the 11 Akans in this group, 5 (45.5%) were NA1/NA1, 2 (18.2%) were NA2/NA2 and 3 (27.3%) were NA1/NA2 and 1 (9%) was null. 3.4.2 FcyRIIIb Genotype Distribution in the Patient Group The results of the study showed that 104 (40.9%) out of the 254 patients were NA1/NA1, 22 (8.7%) were NA2/NA2, 61 (24%) were NA1/NA2, and 67 (26.4%) were Null genotype (Figure 3.11). Among the 64 Northerners, 21 (32.8%) were Null, 25 (39.1%) were NA1/NA1, 3 (4.7%) were NA2/NA2 and 15 (23.4%) were NA1/NA2. Of the 40 Ewes, 9 (22.5%) were Null, 18 (45%) were NA1/NA1, 6 (15%) were NA2/NA2 and 7 (17.5%) were NA1/NA2. Of the 41 Gas, 13 (31.7%) were Null, 15 (36.6%) were NA1/NA1, 2 (4.9%) were NA2/NA2 and 11 (26.8%) were NA1/NA2. Among the 109 Akans, 24 (22%) were Null genotype, 46 (42.2%) as NA1/NA1, 11 (10.1%) as NA2/NA2 and 28 (25.7%) were NA1/NA2. 66 University of Ghana http://ugspace.ug.edu.gh NA1/NA1 NA1/NA2 NA2/NA2 FcyRIIIb genotypes Figure 3.11. Frequency distribution of the FcyRIIIb genotype of the malaria patients and the controls. The trend in the distribution of the various genotypes seems very different between the control and patient groups. While the NA1/NA2 and NA2/NA2 were the predominant genotypes among the control group, it was the NA1/NA1 and Null genotypes that dominated the patient group. University of Ghana http://ugspace.ug.edu.gh 3.4 3. Overall Relationship between FcyRIIIb Genotype and Ethnicity The genotype distribution found within the different ethnic groups is shown in Table 3.3. On the whole no s ignificant a ssociation w as found b etween t he p atients a nd controls (%2= 11.61, P=0.24). Among the controls, statistical analysis showed that there was no significant association between any of the FcyRIIIb genotype and the ethnic groups (NA1/NA1, x2=0-759, P=0.86; NA2/NA2, x2==4.333, P=0.23; NA1/NA2, x2 =1.146, P=0.76; Null, x2 =3.341, P=0.34). Again no significant association was found between this FcyRIIIb genotype distribution and the ethnic groups within the patient group (NA1/NA1, x2=4.298, P=0.12; NA2/NA2, x2 =0.747, P=0.69, NA1/NA2, %2 =4.117, P=0.13; Null, x2 =2.194, P=0.33). 3.4.4 Comparison of FcyRIIIb Distribution of the Control and Patient Groups The FcyRIIIb genotypes for the patient and control groups were distributed as illustrated in Figure 3.11. There was a significant difference observed in the overall genotype distribution between the patients and controls (x2 =52.17, P=0.000). Furthermore, there were significant differences in the NA1/NA1 (%2 =6.548, P=0.04), NA2/NA2 (x2 =21.160, P=0.00) and the Null genotype (x2 =7.876, P=0.02) between the patients and controls. No significant differences were found between the patients and controls with the heterozygote NA1/NA2 genotype (x2 =0.604, P=0.74). 68 University of Ghana http://ugspace.ug.edu.gh Table 3.3. FcyRIIIb genotype percentage distribution among the different ethnic groups within the control and patient groups Fcg Rlllb genotype (%) Ethnic group NA1/NA1 NA1/NA2 NA2/NA2 Null Akan Control 45.5 27.3 18.2 9.0 Patient 42.2 25.7 10.1 22.0 Ga Control 16.7 53.3 30.0 0.0 Patient 36.6 26.8 4.9 31.7 Northener Control 7.7 38.5 46.2 7.6 Patient 39.1 23.4 4.7 32.8 Ewe Control 4.8 47.6 33.3 14.3 Patient 45.0 17.5 15.0 22.5 69 University of Ghana http://ugspace.ug.edu.gh 3.5. Relationship between FcyRIIIb Genotype and Disease Status The distribution of the FcyRIIIb genotype frequencies within the different presentations of malaria is shown in Figure 3.12. Out of 124 patients categorized as having uncomplicated malaria 35 (28.2%) were Null, 43 (34.7%) were NA1/NA1, 9 (7.3%) were NA2/NA2 and 37 (29.8%) were of NA1/NA2. Those presenting with cerebral malaria were 54 and out of these 10 (18.5%) were the Null genotype, 27 (50%) were NA1/NA1, 6 (11.1%) were NA2/NA2 and 11 (20.4%) were NA1/NA2. Among the 76 patients who were classified as having severe anaemia, 22 (28.9%) were Null, 34 (44.7%) were NA1/NA1, 7 (9.2%) were NA2/NA2 while 13 (17.1%) were NA1/NA2. Statistical analysis revealed that the overall FcyRIHb distribution was significantly associated with the disease malaria (x2=60.45, P=0.000). The individual FcyRIIIb genotypes were all associated with malaria as a disease but not with the specific categories. The association between FcyRlHb-NAl/NAl genotype and malaria was quite significant (%2=7.147, P=0.003) and likewise the FcyRIHb-NAl/NA2 genotype (X2=11.160, P=0.001) comparedto the control. FcyRmb-NA2/NA2 genotype also showed a significant relationship with malaria (x2=9.239, P=0.04). The association between the null genotype and malaria (Figure 3.13) was also found to be significant (X2=7.876, P=0.02). There was however, no significant association found between the FcyRIIIb genotype frequency and the presentation of ‘coca cola’ urine (2 X=2.692, P = 0.44) and also the presentation of respiratory distress (x2 = 3.555, P = 0.737). 70 University of Ghana http://ugspace.ug.edu.gh Control Uncomplicated Cerebral Severe anaemia Malaria cases Figure 3.12. Frequency distribution of the FcyRIIIb genotypes within the different disease categories. The relationship between FcyRIIIb and malaria shows that those with the homozygous NA1/NA1 genotype are more likely to be at risk while NA2/NA2 seems to lend some protection against malaria. 71 University of Ghana http://ugspace.ug.edu.gh Control Uncomplicated Cerebral Severe anemia Figure 3.13 Prevalence of the null genotype within the different malaria patient groups Compared to the controls the null genotype seem to be enhanced within the patient population, especially in the case of uncomplicated malaria and severe anaemia 72 University of Ghana http://ugspace.ug.edu.gh CHAPTER 4 DISCUSSION AND CONCLUSION This present study was set out to find out firstly, whether the distribution of the Fey receptors Da and nib was ethnically biased, and secondly to determine if there was any association between the genetic polymorphism of these receptors and the incidence of severe malaria in Ghanaian children. The study also tested the probability of the FcyRIIa, and FcRHIb polymorphisms, that is, the H-R and NA genotypes being associated with a person’s susceptibility to severe malaria. The homozygous H/H131 for the FcyRIIa receptor was found to be generally under represented among all the tribes, but the distribution was not significantly different when the control population was compared to the patient group (P=0.29). There was however a high representation of the heterozygous H/R131 in all the different ethnic groups, ranging from 47.6% among the Ewes to 63.6% among the Akans in the control group and 53.7% in the Gas to 62.5% in the Ewes within the patient group. Here again, the difference between the two groups was not significant (P=0.68). With regards to the homozygous FcyRHa-R/R131, there were also no significant differences between the two groups (P=0.63). Even though the distribution of the ethnic groups was not similar between the two study groups, the insignificance of the differences between the overall genotype distribution in the controls and patients validates the use of the subjects from Dodowa as controls for the study. The heterozygous H/R131 genotype was found to be the dominant genotype being 58.7% and 57.9% among the two study groups. That H/R131 was dominant is not 4.1 DISCUSSION 73 University of Ghana http://ugspace.ug.edu.gh surprising because this finding compares with the results of a study by Salmon et al. (1996) among black African Americans in which 50% of them possessed this same genotype and Shi et al. (2001) found 61% of Kenyan children possessing it. With regards to the disease category and the genotype distribution, three significant associations were found; that the number of patients with R/R131 was significantly higher in the cerebral malaria and severe anaemia groups and H/H131 was significantly lower in the severe anaemia group (P< 0.002 in all cases). These results suggest that possessing the homozygous FcyRUa-R/R131 genotype may predispose or increase the susceptibility of an individual to severe anaemia and cerebral malaria. Although a great deal of work has been done, the pathogenesis of the anaemia associated with falciparum malaria remains uncertain. It may well be that the inability of the FcyR/R131 to bind IgG2 coated parasitized erythrocytes efficiently, delays their immune clearance, thus leading to more parasitized erythrocytes in the human host, thereby resulting in anaemia. There is also the evidence that in severe anaemia, there is reduced monocyte function as a form of immune suppression, and this subsequently leads to reduced Fc-mediated phagocytosis, especially in the case of the less efficient R/R genotype (Ward et al., 1984). This could therefore explain why a large proportion of the patients who were diagnosed as having severe anaemia possessed this genotype. Abdalla and Weatherall (1982) have shown that in severe malarial anaemia, the monocyte erythrophagocytosis of non-parasitized erythrocytes is elevated, and this means that anaemia in acute malaria could be due to opsonization and phagocytosis of both parasitized and non-parasitized red cells. This reasoning, however, does not fully explain the reason for the over representation of 74 University of Ghana http://ugspace.ug.edu.gh the R/R131 genotype in severe anaemia cases, since the binding capability of the R/R131 genotype of the Fey receptor is not as efficient as the H/H131. In a recent publication, Shi et al. (2001), suggested that regardless of its association with increased susceptibility to encapsulated bacterial infections, the frequency of FcYRIIa-R/R131 remains relatively stable in most human populations; implying that it is being selected for. The authors explain that this could be an indication of infections that depend on IgG3 and IgGi but not on IgG2 to mediate protective immunity, thus providing selective advantage for the poorly IgG2-binding FcyRIIa- R/R131 genotype. Furthermore, Shi et al. (2001) reported that Kenyan children with FcyRIIa-R/R131 were less likely to have repeated high-density P. falciparum infection, which suggests that this genotype may rather have a protective effect and that this protective effect may be dependent on IgGi and/or IgG3 but not IgG2. However, i t must be noted that severe malaria is not solely dependent on parasite load but rather on an inter combination of other factors such as accelerated destruction of non-parasitized erythrocytes and bone marrow dysfunction. The finding that high proportion of the patients possessing the R/R131 genotype among cerebral malaria cases may be attributed to the inability of this receptor genotype to effectively bind and thus clear the parasites quickly enough. This may therefore lead to more parasitized red blood cells finding their way into the brain tissues where they are sequestered into the microvascular endothelium of the brain cells. The consequences of this sequestration are reduced oxygen and substrate supply, leading to anaerobic glycolysis and lactic acidosis which gives rise to the coma. 75 University of Ghana http://ugspace.ug.edu.gh There was however no association found between this genotype and uncomplicated malaria and this may be due to the low parasitaemia and therefore the relative inability of the FcyRIIa-R/R.131 to bind may not be relevant in the immune clearance of these parasites. The dominant effect of the R allele in severe anaemia cases is reduced as seen in the number o f the heterozygote H/R131. This is not surprising since this genotype is expected to be intermediate in the binding of IgG2 compared to H/H131 homozygous (van de Wirikel and Capel, 1993). This raises the possibility that the apparent association of this genotype with malaria may be due to events that occur after antibody binding to monocytes, such as monocyte activation and release of soluble factors. However it remains to be determined whether there is a potential interference between the two genotypes, expressed on the same cell, and / or whether the interference consequently causes a defect of activation and cytokine production of monocytes in the FcyRIIa-H/R131 heterozygotes. There was significant difference in the number of patients presenting with all disease forms with the homozygous H/H131 genotype (P< 0.01 in all cases). It indicates that children with the H/H131 genotype are less likely to be at risk from severe malaria than those with R/R131. This would mean that the allotype, H, confers some protection against all forms of the disease. The role of FcyRIIa-H/H131 genotype in malaria infection might be more complex, since this allotype can efficiently bind IgG2, as w ell a s I gGi and I gG3. P revious i n v itro s tudies h ave s hown t hat ADCI function mediated by IgGi and IgG3 is inhibited by IgG preparation with high IgG2 concentration (Bouharoun-Tayoun et al., 1995). Indeed, Shi et al. (1999) observed that the balance between IgGi, IgG2 and IgG3 is a biologically important factor in the 76 University of Ghana http://ugspace.ug.edu.gh role of FcyRIIa-H/H131 genotype in malaria infections. Although the H allele confers protection, possessing it in the heterozygous state, does not influence the development of cerebral malaria. It is therefore not dominant in its effect unlike FcyRIIa-R/R131 in severe anaemia. In a similar study to find the relationship between the FcyRIIa polymorphism and infection in children, H/H131 was found to be over represented, (H/H131 - 64%, H/R131 - 27% and R/R131 - 9%) in black children with sickle cell disease (Norris et al., 1996). C onsidering the fact that the sickle cell trait is a genetic factor which tends to protect individuals from malaria, it is therefore not surprising that those presenting with severe malaria showed an under representation of the H/H131 genotype. This is also supported by a study by Salmon et al., 1996 among certain Africa Americans with systemic lupus erythematosus (SLE), which has similar pathogenesis as malaria. FcyRIIIb polymorphism was found not to be significantly associated with any ethnic group within both the controls and the patient group. The genotype frequencies were found to be inconsistent between the control group and the patient population within any one ethnic group, and this gives an indication that this genotype is randomly distributed and not ethnically biased. However the FcyRHIb-NAl/NAl genotype was found to differ significantly (P=0.03), when the patients were compared to the control group, thus indicating an association with malaria and therefore predisposing individuals to the disease (Figure 3)'. The FcyRIHb-NA2/NA2 on the other hand seems to offer protection against all 77 University of Ghana http://ugspace.ug.edu.gh forms of malaria, as it significantly decreased in the case of all the different disease categories. Due to the differences in the binding capabilities of the neutrophil antigens receptors 1 and 2, in which the NA1 binds IgGi and IgG3 more efficiently than NA2, it was expected that the NA2 in the homozygous state would be over represented in the patients than in the healthy controls. On the contrary, it was rather the NA1/NA1 genotype, which was more represented (40.9%) among the malaria patients than the NA2/NA2 genotype (8.7%). Supposing the individuals studied were non-immune, the predominant antibody produced will be IgG2; and since the neutrophil antigen receptors do not bind this antibody, then a person’s susceptibility to severe malaria or otherwise will not be subject to his FcyRIIIb genotype. There may therefore be other properties of the FcyRIHb-NA2/NA2 genotype which help to protect individuals against malaria. There was significant difference found between the patients and controls possessing the heterozygous FcyRIDb-NAl/NA2 (P=0.001). The results showed these heterozygotes to be intermediate between the two homozygote genotypes. This also demonstrates the protective effect of the NA2 gene, in that its presence reduces the protective effect of the NA1. The FcyRIIIb polymorphism is thought not to play any role in an individual’s predisposition to bacterial infections (Rascu et al., 1997; Bredius et al., 1994). The reasoning is because IgG2 is the main antibody that fights against bacterial infections and neutrophil antigen receptors do not bind IgG2. However in the case of malaria, there is the interplay of IgGi, IgG2, and IgG3, and since these neutrophil antigens bind IgGi and IgG3, the difference in their binding capabilities is likely to ensure that they influence an individual’s susceptibility to malaria. University of Ghana http://ugspace.ug.edu.gh It is worthy to note that the Null genotype, where the individual possesses neither of these neutrophil antigens was more enhanced in the patient population (26.4%) than among the healthy controls (6.7%) and was found to be significantly associated (P=0.02) with malaria. This is to be expected because the absence of these neutrophil antigens will imply that phagocytosis of IgGi and IgG3-opsonized parasitized erythrocytes in a malaria patient may be inefficient. The lack of these genes therefore may lead to a delayed clearance of these parasitized erythrocytes and hence an upsurge in the disease condition. Apart from Enenkel et al. (1991) and Bredius et al. (1994) who found some Caucasians lacking the two neutrophil antigen receptors, not much is known about this condition and its relationship to any disease susceptibility. In another report by Schie and Wilson, (1997), in which the study groups were mainly Orientals and Caucasians, there was no reported incidence of the Null condition. The relative high incidence of the null condition seen in this study suggests that the condition may be probably more prevalent among Africans than their Oriental and Caucasian counterparts. 4.2 Conclusion hi conclusion, there was no significant association between the genotypes of the IgG receptors, FcyRIIa and FcyRIIIb and ethnicity and therefore the distribution of these genetic polymorphisms was not ethnically biased in the study population. 79 University of Ghana http://ugspace.ug.edu.gh The heterozygous FcyRHa-H/R131 was found to be the dominant genotype of the IgG receptor FcyRIIa among the study group and may probably be the dominant genotype within the overall Ghanaian population. A significant association was found between FcyRIIa and the incidence of severe clinical malaria. FcyRIIa-H/H131 seems to offer protection against severe malaria and cerebral malaria in the homozygous state. In the heterozygous state as H/R131, the H allele offers protection against severe anaemia but not against cerebral malaria. The homozygous FcyRJIa-R/R131, on the other hand, may be a predisposing factor for severe anaemia and cerebral malaria. In the heterozygous state its disadvantageous effect is not hampered by the presence of the H allele in cerebral malaria. The genotypes of the IgG receptor FcyRIIIb polymorphism were randomly and evenly distributed among the study groups. There was no prevalence of one over the others. However the null genotype was appreciably represented within the study group. The FcyRIIIb polymorphism was also found to be significantly associated with malaria. The homozygous NA1/NA1 was found from the study to be a heritable risk factor predisposing an individual to all forms of malaria. The NA2/NA2 on the other hand appears to offer protection against all forms of malaria. Even in the heterozygote state, its protective effect is still seen in the case of 80 University of Ghana http://ugspace.ug.edu.gh severe anaemia and cerebral malaria. The Null genotype is also suspected to be a predisposing factor in all forms of malaria. 81 University of Ghana http://ugspace.ug.edu.gh REFERENCES: ABDALLAH, S., Weatherall, D.J., Wickramasinghe, S.N. and Hughes, M. (1980) The anaemia of P. falciparum malaria. Br. J. Haematol. 4 6 ,171-183. ABDALLAH, S. and Weatherall, D.J (1982) The direct antiglobulin test in P. falciparum malaria. Br. J. Haematol. 54,117-121. ABO T., Tilden, A.B., Balch, C.M., Kumagai, K., Troup, G.M. and Cooper, M.D., (1984) Ethnic differences in the lymphocyte proliferative response induced by a murine lg GI antibody Leu-4 to the T3 Molecule. J. Exp. Med. 160, 303-312. AFARI, E.A., Nakano, F., Binka, F., Owusu-Adjei, S. and Asigbee, J. (1993). Seasonal characteristics of malaria infection in under-five children of a rural community in Southern Ghana. W.Afri. J. Med 12(1), 39-42. ALAZARI, P.M., Lascombe, M.B. and Poljak, R.J (1988) Three dimensional structure of antibodies. Annu.Rev. Immunol 6, 555-561. ANDERSON, C.L. and Abraham, G.N. (1980). Characterization of the Fc receptor for IgG on a human macrophage cell line, U937. J. Immunol. 125, 2735- 2743. APPAW, M.A. and Baffoe-Wilmot, A. (1997) A study of malaria vectors in relation to the transmission pattern in coastal forest and savannah areas in Ghana, Report on the epidemiology of malaria with special emphasis on transmission, morbidity, mortality and disease control in Ghana, N.M.IM.R. Legon, pp 62-80. BENJAMINI, E. (1996) Fc receptor (CD2). In Immunology: a short course. 3rd edition. Sunshine, G. Leskowitz, S. Benjamini, E. (eds). Wiley-Liss Inc. New York, pp 151. 82 University of Ghana http://ugspace.ug.edu.gh BLASINI, M., Stekman, I.L., Leon-Ponte, M., Caldera, D. and Rodriguez, M.A. (1993) Increased proportion of responders to a murine anti-CD3 monoclonal antibody of the IgGl class in patients with systemic lupus erythematosus. Clin Exp Immunol. 94,423-428. BOUHAROUN-TAYOUN, H., Oeuvray, C., Lunel, F. and Druilhe, P. (1995). Mechanisms underlying the monocyte-mediated antibody-dependent killing o f Plasmodium falciparum asexual blood stages. J. Exp. Med. 182,409-418. BOUHAROUN-TAYOUN,H., Attaiiath,P., and Sabcharoen, A.(1990) Antibodies that protect humans against P.falciparum blood stages do not on their own inhibit parasite growth in vitro but act in cooperation with monocytes. J. Exp. Med. 172, 1633-1641. BOUHAROUN-TAYOUN, H. Mid Druilhe, P. (1992) P. falciparum malaria: evidence for an isotype imbalance which may be responsible for delayed acquisition. J. Clin. Microbiol. 60, 1473-1481. BRANDT, J.T., Osborne, J.M., Chacko, G. and Anderson, C.L. (1995). The role of Fc yRUa phenotype in heparin induced thrombocytopaenia. Thromb Haemost. 73,1564-1572. BREDIUS, R.G., Derkx, B.H. and Fijien, C.A.P. (1994). Fc receptor Ha polymorphism in fulminant meningococcal septic shock in children. J. Infect Dis. 170, 848-853. BREDIUS, R.G., de Vries C.E.E., and Troelstra, A. (1993) Phagocytosis of Staphylococcus aureus and Haemophilus influenzae typeB opsonized with polyclonal human IgGl and IgG2 antibodies. J. Immunol. 151, 1463-1472. BREWSTER, D.R. Kwiatkowski, D. and White, N J (1990) Neurological sequelae of cerebral malaria in children. Lancet. 336, 1039-1043. 83 University of Ghana http://ugspace.ug.edu.gh BROOKS, D.G., Qiu, W.Q., Luster, A.D and Ravetch, J.V. (1989). Structure and expression of human IgG FcRII (CD32). J. Exp. Med. 170, 1369-1385. BRUCE-CHWATT, LJ. (1952) Malaria in African infants and children in Southern Nigeria. Annals o f Trap. Med. Parasitol. 46. 173-200. BURTON, D.R., and Woof, J.M., (1992) Human antibody effector function. Adv. Immunol. 51,1-84. CATTANI, J.A., Tulloch, J.L. and Vrbova, H.(1986) The epidemiology of malaria in a population surrounding Madang, Papua New Guinea. Am. J. Med. Hyg. 35, 3-15. CEUPPENS, J.L., Baroja, F., Van Vaeck F. and Anderson C.L. (1988) Direct demonstration of binding of anti-Leu4 antibody to the 40kDa Fc receptor on monocytes as a prerequisite for anti-Leu4-induced T cell mitogenesis . J. Immunol. 139,4067-4071. CHAROENLARP, P., Vanijanonta, S. and Chat-Panyapom, P. (1979) The effect of prednisolone on red cell survival in patients with falciparum malaria. Southeast Asian J. Trop. Med. Public Health. 10,127-131. CHONG, B.H., Pitney, W.R. and Castaldi, P.A (1982). Heparin induced thrombocytopenia, association of thrombotic complications with heparin- dependent IgG antibody that induces thromboxane synthesis and platelet aggregation. Lancet. 2, 1246-1249. CHONG, B.H., Fawaz, I., Chesterman, C.N. and Bemdt, M.C. (1989) Heparin- induced thrombocytopenia: Mechanism of interaction of the heparin dependent antibody with platelets. Br. J. Haematol. 73, 235-240. CINES, D.B., Kaywin P., Bina, M., Tomaski, A. and Schreiber, A.D. (1980) Heparin-associated thrombocytopenia. New Engl. J. Med. 303, 788-795. 84 University of Ghana http://ugspace.ug.edu.gh CLARK, M.R., Liu, L., Clarkson, S.B., Ory, P.A. and Goldstein, I.M. (1990) An abnormality of the encodes neutrophil Fc receptor III in a patient with systemic lupus erythematosus. J. Clin. Invest. 86, 341-346. CLARK, M., Stuart, S., Kimberly, R., Ory, P. and Goldstein, I. (1991) A single amino acid distinguishes the high responder form of Fc receptor II on human monocytes. Eur. J. Immunol. 21,1911-1916. COMMEY, J.O.O., Mills-Tettey, D. and Phillips, B.J. (1980) Cerebral malaria in Accra Ghana. Ghana. MedJ. 1980. 19, 68-72. CRESSWELL, P. (1987) Antigen recognition by T-lymphocytes. Immunol Today. 8, 67-79. CRISWELL, B.S, Butler, W.T., Rossen, R.D and Knight, V.(1971). Murine malaria: the role of humoral factors and macrophages in destruction of parasitized erythrocytes. J. Immunlo. 107,212-221. CUICA, M., Baluf, L. and Chelarescu-Vierum. (1934) Immunity in malaria. Trans. R. Soc. Trop. Med. Hyg. 27, 619-622. DAVIS, T.M.E., Krishna, S., and Looareesuwan, S. (1990) Erythrocyte sequestration and anaemia in severe falciparum malaria. Analysis of acute changes in venous haematocrit using a simple mathematical model. J. Clin. Invest. 86, 793-800. DAVIS, T.M.E., Pukrittayakamee, S. and Supanaranond, W. (1990) Glucose metabolism in quinine-treated patients with uncomplicated falciparum malaria. Clin. Endocrinol (Oxf). 33, 739-749. DAVIS, T.M.E., Suputtamongkol, Y. and Spencer, J.L. (1992) Measures of capillary permeability in acute falciparum malaria: relation to severity of infection and treatment. Clin. Infect. Dis. 114,256-266. 85 University of Ghana http://ugspace.ug.edu.gh DAVIS, T.M.E., Looareesuwan, S. and Pukrittayakamee S. (1993) Glucose turnover in severe falciparum malaria. Metabolism. 42, 334-340. DAVIS, D.R. and Metzger, H. (1983) Structural basis for antibody function. Annu Rev Immunol. 1, 87-95. DE HAAS, M., Kleijer, M., van Zwieten, R., Roos, D. and KR von dem Borne, A.E.G. (1995) Neutrophil Fey RlUb deficiency, nature and clinical consequences: a study of 21 individuals from 14 families. Blood. 86, 2403- 2413. DE HAAS, M., Koene, H.R., Kleijer, M., De Vries, E., Simsek, S., Van Toi, M.J.D., Roos, D. and Von dem Bome, A.E.G.(1996). A triallelic Fey receptor type IDA polymorphism influences the binding of human IgG by NK cells FcyRIIIa. J. Immunol. 156,2948-2955. DENSEN, P., Sanford, M., Burke, T., Desnsen, E. and Wintermeyer, L. (1990) Prospective study of the prevalence of complement deficiency in meningitis. Prog. Abstr. 30th Interscience conference. Antimier. Agents chemther. 140. DEO, Y.M., Graziano, R.F., Repp, R. and Van de Winkel, J.G.J. (1997) Clinical significance of IgG Fc receptors and FcyR-directed immunotherapies. Immunol Today. 18,127-134. DOCKERELL, H.M., de Souza, J.B. and Playfair, H.L (1980). The role of the liver in immunity to blood stage murine malaria. Immunology. 41,421-430. DUITS, A., Bootsma, H. and Derksen R. (1995) Skewed distribution of IgG Fc receptor Ha (CD32) polymorphism is associated with renal disease in systemic lupus erythematosus (SLE) patients. Arthritis Rheum. 39, 1832- 1836. EDBERG, J.C., Baarinsky, M., Redecha, R.B., Salmon, J.E and Kimberly, R.P. (1990). FcyRin expressed on cultured monocytes is an N-glycosylated trans­ University of Ghana http://ugspace.ug.edu.gh membrane protein. Similarity to FcyRIH expressed on NK cells. J Immunol. 144,4729-4734. ENENKEL, B., Jung, D. and Frey, J. (1991). Molecular basis of IgG Fc receptor HI defect in a patient with systemic lupus erythematosus. Eur. J. Immunol. 21, 659-663. ENGLISH, M ., W aruiru, C ., and Amukoye, E . (1996). Deep breathing in children with severe malaria; indicator of metabolic acidosis and poor outcome. Am J TropMedHyg. 55, 521-524. ERBE, D,V., Collins, J.E., Shen L., Graziano, R.F., and Fanger, M.W. (1991) The effects of cytokines on the expression and function of Fc receptors for IgG on human myeloid cells. Mol Immunol. 27, 57-63. FACER, C.A., Bray, R.S., and Brown, J. (1979) Direct Coombs’ antiglobulin reactions in Gambian children with falciparum malaria. Clin. Exp. Immunol. 35,119-127. FIGUEROA, J.E. and Densen P. (1991) Infectious diseases associated with complement deficiencies. Clin. Microbiol. Rev. 4, 359-367. FDIEN, C.A.P., Bredius, R.G.M. and Kuijper, EJ. (1993) Polymorphism of IgG Fc receptors in meningococcal disease; risk marker in complement deficient patients. Ann. Intern. Med. 119, 636-639. FRANK, M.M., Hamburger M.I., Lawley, T.J., Kimberly, R.P. and Plotz, P.H.(1979) Defective reticuloendothelial system Fc- receptor function in systemic lupus erythromatosus. NEng. J. Med. 300, 518-523. FROMONT, P., Bettaieb, A., Skouri, H., Floch, C. and Bierling, P. (1992). Frequency of the polymorphonuclesr neutrophil FcyRIH deficiency in the French population and its involvement in the developenment of neonatal alloimmune neutropenia. Blood. 79, 2131-2134. 87 University of Ghana http://ugspace.ug.edu.gh GARNHAM, P.C.C. Malaria parasites and other Haemosporidia. Oxford: Blackwell, 1966. GILLES, H.M. Management of severe and complicated malaria. (1991). A practical handbook. World Health Organization, Geneva. GOODMAN, J.W. and Parslow, T.G. (1994) Immunoglobulin proteins. In basic and clinical immunology. Stites, D.P., Terr, A.I and Parslow, T.G (eds). Appleton and Lange. Norwalk, Connecticut. Pp 66-78. GOSSELIN, E.J., Brown, M.F., Anderson, C.L., Zipf, T.F. and Guyre, P.M. (1990) The monoclonal antibody 41H16 detects the leu4 responder form of human FcyRII. J. Immunol. 144, 1817-1822. GURMAN, G., Schlaeffer, F., Alkan, M and Heilig, I. (1988). Adult respiratory distress syndrome and pancreatitis as complications of falciparum malaria. Crit. Care. Med. 16,205-206. GUYRE, P.M., Morganelli, P.M and Miller, R. (1983). Recombinant immune interferon increases immunoglobulin G Fc receptors on cultured human mononuclear phagocytes. J. Clin. Invest. 72, 393-397. HALDANE, J.B.S. (1949) Disease and evolution. Ric Sci. 19 (Supplement), 68-75. HENDRICKSE R.G., Hasan, A.H., Olumide, L.O and Akinkunmi, A. (1971) Malaria in early childhood. Ann. TropMed. Parasitol 65,1-20. HIBBS, M.L., Bonadonna, L., Scott, B.M, McKenzie, I.F.C and Hogarth, P.M. (1988). Molecular cloning of a human immunoglobulin G Fc receptor. Proc.Natl. Acad. Sci. USA. 85,2240-2244. HILL, A.V.S. (1992) Malaria resistance genes: a natural selection. Trans R Soc Trop Med Hyg. 86,225-226. 88 University of Ghana http://ugspace.ug.edu.gh HILL, A.V.S., Bennet, S., Kwiakowski, D. and Allsopp, C.E.M.(1991) Common West African HLA antigens are associated with protection from severe malaria. Nature. 352, 595-600. HILL, A.V.S., Elvis, J. and Willis, A.C. (1992) Molecular analysis of an HLA- disease association: HLA-B53 and resistance to severe malaria. Nature. 360, 434-439. HO, M., White, N.J., and Looareesuwan, S. (1990) Splenic Fc receptor function in host defence and anaemia in acute falciparum malaria. J. Infect. Dis. 160, 555-561. HO, M. and Webster, H.K. (1990c) T cell responses in acute falciparum malaria. Immunol Lett. 25, 135-138. HOMMEL, M. and Semoff, S. (1988) Expression and function of erythrocyte- associated surface antigens in malaria. Biol cell. 64, 183-203. HUIZINGA, T.W.J., Van de Schoot, C.E., Jost, C., Klaassen, R., Kleijer, M., Von dem Borne, A.E.G., Roos, D. and Tetteroo, P.A.T. (1988) The Pi-linked receptor Fc R E is released on stimulation of neutrophils. Nature. 333, 667- 669. HUIZINGA, T.WJ., M., Kleijer, M., Roos, D. and von dem Borne A.E.G.K (1989) Differences between FcyRIII on human K/NK lymphocytes in relation to the NA antigen system. In Knapp, W., Dorken, B. Gilks, W.R eds. Leukocyte typing. IV. Oxford, U.K.: Oxford University Press, pp 582-585. HUIZINGA, T.W.A., de Haas, M., Kleijer, M., Nuijens, J.H., Roos, D. and von dem Borne, A.E.G.K. (1990) Soluble Fey receptor HI (CD16) in human plasma originates from release by neutrophils. J.Clin. Invest. 86,416-423. 89 University of Ghana http://ugspace.ug.edu.gh INNIS, M.A. and Gelfand, D.H. (1990) Optimization of PCRs. In PCR Protocols: A guide to methods and applications.Innis, M.A, Gelfand, D.H., Sninsky, J.J and White, T.J (eds). Academic press San Diego, California pp 3-12. INSEL, R.A., and Anderson P.W. (1988) IgG subclass distribution of antibody induced by immunization with the isolated and protein-conjugated polysaccharide of H. influenzae b and G2m(n) distribution of serum IgG2 in man. Monogr. Allergy. 23, 128-137. JAMES, M.F.M. (1985) Pulmonary damage associated w ithfalciparum m alaria: a report often cases. Ann. Trop. Med. Parasitol. 79, 123-138. JEFFERY, G.M. (1966) Epidemiology significance of repeated infections with homologous and heterologous strains and species of plasmodium. Bull. World Health Organ. 35, 873-882. KELTON, J. G., S heridan, D .,Santos, A ., S mith, J ., S teeves, K ., S mith, C ., B rown ,C.and Murphy, W.G. (1988) Heparin induced thrombocytopenia; laboratory studies. Blood. 72, 925-930. KIMBERLY, R.P., Salmon, J.E. and Edberg, J.C. (1995) Receptors for immunoglobulin G; molecular diversity and implications for disease. Arthritis Rheum. 38, 306-314. KUBY, J. (1992) Immunoglobulins, structure and function. In Immunology. Kuby, J. (ed). W.H. Freeman and Company, pp 100-117. KUROSAKI, T. and Ravetch, J.V. (1989). A single amino acid in the glycosyl phosphatidylinositol attachment domain determines the membrane topology of FcyRIII. Nature. 342, 805-807. KURTZHALS, J.A., Adabeyeri, V., Goka, B.Q., Akanmori, B.D., Commey, J.O.O., Nkrumah, F.K., Behr, C. and Hviid, L. (1998) Low plasma concentrations of 90 University of Ghana http://ugspace.ug.edu.gh interleukin 10 in severe malarial anaemia compared with cerebral malaria and uncomplicated malaria. Lancet. 351,1768-1772. LALEZARI,P. (1977) Neutrophil antigens: immunology and clinical implications. In The granulocyte function and clinical utilization. J.Greenwakltand, G.S. Jamieson(eds). Alan R. Liss. New York, pp 209-225. LALEZARI, P., (1984). Granulocyte antigens. In Immunohaematology. Engelfriet, C.P., Van Loghem, J.J. and von dem Borne, A.E.G. eds. Elsevier. Amsterdam /New York. pp. 33. LANIER, L.L., Cwirla, S., Yu, G., Testi, R. and Phillips, J.H.(1989) Membrane anchoring of a human IgG Fc receptor (CD 16) determined by a single amino acid. Science. 246, 1611-1613. LEE, S.H., Looareesuwan, S. and Wattanagoon, Y. (1989) Antibody dependent red cell removal during P. falciparum malaria: the clearance of red cell sensitised with IgG anti-D. Br. J. Haematol. 73, 396-402. LOOAREESUWAN, S.,Ho, M. and Wattanagoon, Y. (1987) Dynamic alterations in splenic function in falciparum malaria. N. Engl. J. Med. 317, 675-679. LOOAREESUWAN, S., Davis, T.M.E., and Pukrittayakamee, S. (1991) Erythrocyte survival in severe falciparum malaria. Acta. Trop. 48,263-270. LOONEY, R.J., Abraham, G.N. and Anderson, C.L. (1986) Human monocytes and U937 cells bear two distinct Fc receptors for IgG . J. Immunol. 136, 1641- 1644. MABEY, D.C.W., Brown, A. and Greenwood, B.M (1987) Plasmodium falciparum malaria infections in Gambian children. J. infect Dis 155, 1319-1321. MAEGRAITH, B.G. (1952) Recent advances in tropical medicine :blackwater fever. West Afr.Med. J. 1,4-10. 91 University of Ghana http://ugspace.ug.edu.gh MARSH, K. and Howard, R. (1986). Antigens induced on erythrocytes by Plasmodium falciparum. Science. 231,150-153. MARSH, K. (1993) Immunology of human malaria. In Bruce-Chwatt’s essential malariology 3rd Edition. Gilles, H.M., Warrell, D.A. eds London. Edward Arnold pp 60-77. MARSH, K., Forster, D. and Waruiru, C. (1995). Indicators of life threatening malaria in African children. N. Engl. J. Med. 332, 1399-1404. MCGREGOR, I.A. (1964). Studies on the acquisition of immunity to P. falciparum infection in Africa. Trans. Roy. Soc. Trop. Med. Hyg. 58, 80-92. MCGREGOR, I.A. (1984) Epidemiology, malaria and pregnancy. Am. J. Trop. Med. Hyg. 33, 517-525. MERRY, A.H., Looareesuwan, S. and Phillips, R.E. (1986) Evidence against immune haemolysis in falciparum malaria in Thailand. Br. J. Haematol. 64, 187-194. MOLINEAUX, L., Muir, D.A., Spencer, H.C. and Wemdofer, W.H. The epidemiology of malaria and itsmeasurement. 1988: In Principles and Practice of Malariology. Wemdofer W.H. and McGregor I. (eds). Edinburgh: Churchill-Livingstone, pp 999-1090. MOLYNEUX, M.E., Looareesuwan, S. and Menzies, I.S. (1989) Reduced hepatic blood flow and intestinal malabsorption in severe falciparum malaria Am J Trop Med Hyg 40,470-476. MORROW, R.H., Smith.,P.C., and Nimo, K.P. (1981) A quantitative method of assessing the health impact of different diseases in less developed countries. Int. J. Epidem. 10(1), 73-80. 92 University of Ghana http://ugspace.ug.edu.gh MULDER, A. Heeringa, P., Brouwer, E., Limburg, P. and Kallenberg, C. (1994) Activation of granulocytes by anti-neutrophil cytoplasmic antibodies (ANCA): a FcyRII-dependent process. Clin. Exp Immunol. 98,270-278. MULLIS, K., Faloona, F., Scharf, S., Saiki, R., Horn, G. and Erlich, H. (1986) Specific en2ymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symposia on Quantitative Biology. 51, 263- 273. MUSSER, J.M., Kroll, J.S., Granoff, D.M., Moxon, E.R., Brodeur, B.R., Campos, J., Dabemat, H., Fredriksen, W., Hanel, J., Hammond, G., Hoiby, E.A., Jonsdoittir, K.E., Kabeer, M., Kallings, I., Khan, W.N., Kilian, M., Knowles, K., Koomhof, H.J., Law, B., Li, K , Montgomery, J., Pattison, P.E., Piffaretti, J.C., Takala, A.K., Thong, M,L., Wall, R.A., Ward, J.I. and Selander, R.K. (1990) Global genetic structure and molecular epidemiology of encapsulated Heamophilus influenzae. Rev. Infect. Dis. 12, 359-367. NAGATA, M., Hara, T., Akoli, T., Mizuno, Y., Akeda, H., Inaba, S., Tsumoto, K. and Ueda, K. (1989) Inherited deficiency of ninth component of complement; an increased risk of meningococcal meningitis. J. Pediatr. 114,2609-2614. NKRUMAH, F.K. (1977) Malaria in Ghana. Ghana. Med. J. 16,283-287. NORRIS, C.F., Surrey, S., Bunin, G.R., Schwatz, E., Buchanan, G.R. and McKenzie, S.E. (1996) Relationship between Fc receptor HA polymorphism and infection in children with sickle cell disease. J. Pediatr. 128 (6), 813-819. OHTO, H. and Matsuo, Y. (1989) Neutrophil-specific antigens and gene frequencies in Japanese Transfusion. 29,1927-1932. ORY, P.A., Goldstein, I.M., Clark, M.R., Kwoh, E.E. and Clarkson, S.B. (1989) Sequences of complementary DNA that encode the NA1 and NA2 forms 0f the Fc receptor m on human neutrophils. J Clin Invest. 84, 1688-1691. 93 University of Ghana http://ugspace.ug.edu.gh OSBORNE, J.M., Chacko, G.W., Brandt, J.T. and Anderson, C.L. (1994) Ethnic variation in frequency of an allelic polymorphism of human FcyRIIa determined with allele specific oligonucleotide probes. J. Immunol. Methods. 173,207-217. PARREN, P.W.H.I., Warmerdam, P.A.M., Boeije, L.C.M., Arts, J., Westerdaal, N.A.C., Vlug, A., Capel, P.J.A., Aarden, L.A., and Van de Winkel, J.G.J. (1992). On the interaction of IgG subclasses with the low affinity FcyRIIa (CD32) on human monocytes, neutrophils and platelets; analysis of a functional polymorphism to human IgG2. J. Clin. Invest 90,1537-1546. PARSLOW, T.G. (1994) Immunoglobulin G, Bcells and the humoral immune response. In basic and clinical immunology. Stites, D.P., Terr, A.I and Parslow, T.G. (eds). Appleton and Lange. Norwalk, Connecticut, pp 80-93. PASVOL, G., Weatherall, D.J. and Wilson, R.J.M. (1977) Effects of foetal haemoglobin on susceptibility of red cells to P. falciparum. Nature 270, 171- 173. PELTZ, G., Frederick, K., Peterlin, B.M and Anderson, C.L.(1988). Characterization of the human monocyte high affinity Fc receptor (hu FcRI). Mol. Immunol.25,243-252. PERRIN, L.H., Mackey, L.J., and Miecher, P.A. (1982) The haematology of malaria in man. Semin. Hematol. 19, 70-82. PERUSSIA, B. and Ravtech, J.V. (1991) FcyRIH (CD16) on human macrophages is a functional product of the FcyRIH-2 gene. Eur. J. Immunol. 21,425-429. PONNUDURAI, T., Lensen, A.H.W. and van Gemart, GJ.A. (1991) Feeding behaviour and sporozoite ejection by infected anopheles stephensi. Trans R Soc Trop MedHyg. 85,175-180. 94 University of Ghana http://ugspace.ug.edu.gh PORGES, A., Redecha, P., Kimberly, W., Csdmok, E., Gross, W. and Kimberly, R. (1994) Anti-neutrophil cytoplasmic antibodies engage and activate human neutrophils via FcyRIIa. J. Immunol. 153,1271-1280. QIU, W.Q., de Bruin, D., Brownstein, B.H., Pearse, R. and Ravetch, J.V. (1990) Organization of the human and mouse low-affinity FcyR genes: duplication and recombination. Science. 248, 732-740. QUINN, T.C. and Wyler D.J. (1979) Intravascular clearance of parasitized erythrocytes in rodent malaria. J. Clin. Invest. 63, 1187-1194. RASCU, A., Repp, R., Westerdaal, N.A.C., Kalden, J.R and Van de Wirikel, J.G.J. (1997) Clinical relevance of Fey receptor polymorphisms. Ann. NY Acad Sci 815,282-295. RAVETCH, J.V. and Anderson, C.L. (1990) Fey receptor family: proteins, transcripts and genes. In Fc receptors and the action of antibodies. Metzger, H (ed). Washington DC. American Society for microbiology, pp 211. RAVETCH, J.V. and Perussia (1989)...Alternative membrane forms of FcyRIH on human NKC and neutrophils: cell type-specific expression of 2 genes that differ in single nucleotide substitutions. J. Exp. Med 170,481-497. REPP, R., Valerius, A., Sendler, M. and Iro, J.R.(1991). Netrophils express high affinity receptor for IgG (Fc yRI, CD64) after in vivo application of recombinant human granulocyte colony stimulating factor. Blood. 78, 885- 889. ROCKETT, K.A., Targett, G.A.T. and Playfair, J.H.L. (1988) Killing of blood stage P. falciparum by lipid peroxides from tumour necrosis serum. Infect. Immun. 56,3180-3183. 95 University of Ghana http://ugspace.ug.edu.gh ROITT, I (1988) Essential Immunology. 4th edition. Oxford: Blackwell Scientific Publications pp 76. ROSENFIELD, S.I., Ryan, D.H., Looney, R.J., Anderson, C.L and Abraham, G.N.(1987). Human Fc receptors: stable inter donor variation in quantitative expression on platelets correlates with functional responses. J. Immunol. 138, 2869-2873. SAIKI, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnhem, N. (1985). Enzymatic amplification of p-globin genomic sequences and restriction site analysis for diagnosis of sickle-globin genomic sequences and restriction site analysisfor diagnosis of sickle-cell anaemia. Science. 230, 1350-1354. SALMON, J.E., Edberg, J.C., Kimberly, R.P., Mensa, E. and Ryan, R. (1990) Fey receptor m on human neutrophils: allelic variants have functionally distinct capacities. J. Clin. Invest. 85,1287-1295. SALMON, J.E., Edberg, J.C., Brogle, N.L., and Kimberly, R.P.(1992) Allelic polymoiphisms of human FcyRIIa and FcyRIIIb; Independent mechanisms for differences in human phagocyte function. J. Clin. Invest. 89,1274-1281. SALMON, J., Millard, S. and Schachter, L. A., Arnett, F.C., Ginzles, E.M., Gouley, M., Ramsey-Goldman, R., Peterson, M.G.M. and Kimberly, R.P. (1996) FcyRIIa alleles are heritable risk factors for lupus nephritis. J. Clin Invest. 97, 1348-1354. SAMBROOK, J., Fritsch, E.F. and Maniatis, T. (1989) Agarose gel electrophoresis. In Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory, pp 6.3-6.15. SANDERS, L.A.M., Feldman, R.G., Voorhost-Oginsk, M.M., De Hass, M., Rijkers, G.T., Capel, P.J.A. and Van de Winkel, J.G. (1994) Human IgG FcyRIIa University of Ghana http://ugspace.ug.edu.gh (CD32) polymorphism and IgG2- mediated bacterial phagocytosis by neutrophils; impact for patients with recurrent bacterial respiratory tract infections. J. Infect. Dis 170 (4), 854-861. SCHLECH, W.F., Ward, J.I., Band, J.D., Hightower, A., Fraser, D.W. and Broome, C.V. (1985) Bacterial meningitis in the United States , 1978-1981. The National Bacterial Meningitis Surveillance study. J. Am. Med. Assoc. 253, 1749-1754. SEKI, T. Identification of multiple isoforms of the low -affinity human IgG Fc receptor. (1989) Immunogenetics. 30, 5-12. SELVARAJ, P., Carpen, O., Hibbs, M.L. and Springer, T.A.(1989). Natural killer cell and granulocyte Fey receptor m differ in membrane anchor and signal transduction. J. Immunol. 143,3283-3289. SHEAR, H.L., Nussenzweig, R.S. and Biance, C. (1979). Immune phagocytosis in murine malaria../. Exp. Med. 149, 1288-1298. SHI, Y.P., Nahlen, B.L., Udhayakumar, V., Oloo, AJ. and Lai, A.A. (1999). Differential effect and interactionof monocytes, hyperimmune sera, and IgG on the growth of aseual stage Plasmodium falciparum parasites. Am J. Trop. Med. Hyg. 60, 135-141. SHI, Y.P., Nahlen, B.L., Kariuki, S., Urdahl, K.B., McElroy, P.D., Roberts, J.M. and Lai, A.A. (2001). FcyRIIa polymorphism is associated with protection of infants against high-density Plasmodium falciparum infection. VH. Asembo Bay Cohort Project. J. Infect. Dis. 184,107-111. SILVERTON, E.W., Navia, M.A. and Davis, J.R. (1977) The disposition, interaction and biological properties of the Ig domains in IgG. Proc.Nat. Acad. Sci. 74, 5140-5144. 97 University of Ghana http://ugspace.ug.edu.gh SNOW, R.W., Bastos de Azevedo, I. and Lowe, B.S. (1994) Severe childhood malaria in two areas of markedly different falciparum transmission in East Africa. Acta Trop 57, 589-600. STONE, W.J., Hanchett, J.E. and Knepsheild, J.R. (1972) Acute renal insufficiency due to falciparum malaria. Arch. Intern. Med .279, 620-628. TATE, B., Witort, E., Mckenzie, I. And Hogarth, P. (1992) Expression of the high responder/non-responder human FcyRII analysis by PCR and transfection into FcR-COS cells. Immunol. Cell Biol. 70, 79-87. TAX, W.J.M., Willems, H.W., Reekers, P.P.M., Capel, P.J.A and Koene, R.A.P. (1983). Polymorphism in mitogenic effect of IgG 1 monoclonal antibodies against T3 antigen on human T cells. Nature. 304, 445-447. TAYLOR, T.E., Molyneaux, M.E. and Wirima, J.J. (1988) Blood glucose levels in Malawian children before and during the administration of intravenous quinine in severe falciparum malaria. N. Eng. J. Med. 319,1040-1047. TETTEROO, P.A.T., Van der Schoot, C.E., Visser, F.J., Bo, MJ.E. and Kr von dem Borne (1987) Three different types of Fey receptors on human leukocytes defined by workshop antibodies; FcyR of neutrophils, FcyR of NK/K lymphocytes and FcyRII. In leukoctye typing El. AJ. McMicheal (ed). Oxford University Press. Oxford, U.K pp 702-706. THEIN, S.L. and Wallace, R.B. (1986) Oligonucleotides as specific hybridisation probes in the diagnosis of genetic disorders. In Human Genetic Diseases: A practical Approach, ed. Davis, K.E. Herndon, Virginia: IRL Press, pp. 33-50. TSE, W.Y., Abadeh, S., McTieman, A., Jefferis, R., Savage, C.O.S. and Adu D. (1999) No association between neutrophil FcyRIIa allelic polymorphism and anti-neutrophil cytoplasmic antibody (ANCA)-positive systemic vasculitis. Clin Exp Immunol. 117, 198-205. University of Ghana http://ugspace.ug.edu.gh VALENTINE, R.C. and Green, N.M. (1967) Fc structures are digested by pepsin. J.Mol.Biol. 27, 615-617. VANCE, B.A., Huizinga, T.W., Wardwell, K. and Guyre, P.M. (1993). Binding of monomeric human IgG defines an expression polymorphism of FcyRIQ on large granular lymphocyte /NK cells. J. Immunol. 151, 6429-6439. VAN DE WINKEL, J.G.J., Jansze, M. and Carpel, P.J.A. (1990) Effects of protease inhibitors on human monocyte IgG Fc receptor n. J.Immunol. 145, 1890- 1896. VAN DE WINKEL, J.G.J and Anderson, C.L., (1991) Biology of human immunoglobulin G Fc receptors. J. Leucocyte Biol. 49, 511-524. VAN DE WINKEL, J.G.J. and Capel, P.J.A., Eds 1996. In Human IgG Fc receptors. Landes Co. Austin, Texas. VAN DE WINKEL, J.G.J. and Capel, P.J.A (1993) Human IgG Fc receptor heterogeneity: molecular aspects and clinical implications. Immunol. Today. 14,215-221. VAN SCHIE, R.C. and Wilson, M.E. (1997) Saliva: a convenient source of DNA for analysis of bi-allelic polymorphism of Fc gamma receptor DA (CD32) and Fc gamma receptor HEB (CD16). J. Immunol. Methods. 208 (1), 91-101. WALLACE, P.K., Valone, F.H. and Fanger, M.W. (1995). In Bispecific antibodies. Fanger, M.W. eds. R.G Landes Company, pp 221-234. WARD, K.N., Warrell, M.J., and Rhodes, J. (1984). Altered expression of human monocyte Fc receptor in Plasmodium falciparum infection malaria. Infect Immun. 44, 623-626. WARMERDAM, P., van de Winkel, J. E. G. and Capel, P. (1990) Molecular basis for a polymorphism of human Fey receptor II (CD32). J. Exp. Med. 172, 19- 25. 99 University of Ghana http://ugspace.ug.edu.gh WARMERDAM, P.A.M., Van de Winkel, J.G.J., Vlug, A., Westerdaal, N.A.C. and Capel, P.J.A. (1991) A single amino acid in the second domain of the human FcyRII is critical for human IgG2 binding. J. Immunol. 147, 1338-1343. WARMERDAM, P.A.M., Nabben, N.M., Van de Graaf, S.A.R., Van de Winkel, J.G.J and Capel, P.J.A. (1993). The human low affinity immunoglobulin G receptor IIC gene is a result o f an unequal crossover event. J. Biol. Chem. 268, 7346-7349. WARRELL, D.A., Looareesuwan, S and Warrell, M (1982). Dexamethaxone proves deleterious in cerebral malaria. N Engl J Med. 306, 313-319. WARRELL, D.A., White, N.J. and Veall, N. (1988) Cerebral anaerobic glycolysis and reduced cerebral oxygen transport in human cerebral malaria. Lancet 2, 534-538. WEBSTER, H.K., Brown, A.E. and Chuenchitra, C. (1988) Characterisation of antibodies to sporozoites in falciparum malaria and correlation with protection. J. Clin Microbiol. 26, 923-927. WEE, S .L., Colvin, R.B., Phelan, J.M., Pleffler, F.I., Reichert, T.A., Berd, D. and Cosimi, A.B. (1989) Fc receptor for mouse IgGi (FcyRII) and antibody- mediated cell clearance in partients treated with Leu2a antibody. Transplantation. 48,1012-1017. WENGER, J.D., Hightower, A.W., Facklam, R.R., Gaventa, S. and Broome, C.W. (1990) Bacterial meningitis in the United States , 1986: Report of a multistate surveillance study. J. Iinfect Dis. 162, 1316-1323. WERNER, G., von dem Borne, A.E.G.K. and Bos, MJ.E. (1986) Localization of the human NA1 alloantigen on neutrophil Fey receptors. In Reinherz, E.L., Haynes, B.F., Nadler, L.M. and Bernstein, I.D. eds. Leokocyte typing n. New York: Springer Verlag. pp. 109-113. University of Ghana http://ugspace.ug.edu.gh WHITE, N.J., Warrell, D.A. and Chanthavanich P. (1983) Severe hypoglycaemia and hyperinsulinaemia in falciparum malaria. N. Eng. J. Med. 309, 61-66. WHITE, N.J., Warrell, D.A. and Looareesuwan, S. (1985). Pathophysiological and prognostic significance of cerebrospinal fluid lactate in cerebral malaria. Lancet. 1, 776-778. WHITE, N.J., Miller, K.D. and Marsh, K. (1987) Hypoglycaemia in African children with severe malaria. Lancet. 1,708-711. WHITE, N.J. (!988). Drug treatment and prevention of malaria. Eur. J. Clin. Pharmacol. 34, 1-14. WHITE, N.J. and Ho, M. (1992) The pathophysiology o f malaria. Adv. Parasitol. 31, 34-173. WHITE, N J. (1996). Malaria. In Manson’s tropical diseases. Manson, P., Cook, G.C. and Saunders, W.B. (eds) London Paston Press Ltd. pp 1087-1164. WOODEN, J., Kyes, S. and Sibley, C.H. (1993). PCR and strain identification in Plasmodium falciparum. Parasitol. Today. 9, 303-305. WORLD HEALTH ORGANIZATION, (1979): Expert Committee on Malaria. 17th report, Technical Reports Series. 640. WORLD HEALTH ORGANIZATION, (1990) Severe and complicated malaria. Second edition. Trans R. Soc Trop Med Hyg. 84 (Suppl 2), 1-65 WORLD HEALTH ORGANIZATION (1996). World malaria situation in 1993. Weekly Epidermiol Rec. 71,17-48. ZUCKERMAN, A. (1966) Recent studies on factors involved in malarial anaemia. MilitMed. (supplement) 131,1201-1216. 101 University of Ghana http://ugspace.ug.edu.gh APPENDICES APPENDIX I PREPARATION OF SOLUTIONS The following standard solutions were prepared using sterile double distilled water (sddw). Where appropriate, the solutions were autoclaved at 1211b/sq in. for 15 minutes in an Eyela autoclave (Rikikkaki, Tokyo). DNA Extraction 0.5% saponin 0.5g of saponin was dissolved in 100ml of freshly preparedlX Phosphate Buffered Saline (PBS) IX Phosphate Buffered Saline 8g of NaCl, 1.44g of Na2HPC>4 and 0.24g of KH2PO4 were dissolved in 800ml of sterile double distilled water and the pH adjusted to 7.4 with concentrated HCL, and volume was made to 1000ml with distilled water and the solution was autoclaved. 20% Chelex 20g of Chelex was dissolved in 100ml of distilled water and autoclaved. 5mM Sodium Phosphate 0.71g ofNa2HP04was dissolved in 1000 ml of sddw and stored at - 20°C. 102 University of Ghana http://ugspace.ug.edu.gh EtBr (lOmg/ml) lg Ethidium Bromide was completely dissolved in 100ml sddw and stored in the dark at 4°C.. Solutions for Electrophoresis 1 OX TAE buffer 242g Tris base, 57.1ml glacial acetic acid, 100ml 0.5M EDTA, pH adjusted to 7.7 (with glacial acetic acid) and the volume made up to 1000ml with sddw. 0.5M EDTA (pH 8.0) 186g of EDTA, dissolved in 800ml sddw, pH adjusted with NaOH pellets and volume made up to 1000ml and stored at room temperature. Gel Loading Solutions 6X Bromophenol Blue 0.25% bromophenol blue was added to 40% sucrose in water and stored at 4°C. 5X Orange G 20% (w/v) Ficoll, 25mM EDTA, 2.5(w/v) Orange G were mixed and stored at room temperature. 103 University of Ghana http://ugspace.ug.edu.gh APPENDIX II SEVERE MALARIA STUDY QUESTIONAIRE Recruit and case record form ID number.......................................................................... Date of admission............................................................. Name................................................................................. Ethnic origin..................................................................... (Hausa, Fafra, Dagomba=l, Ewe=2, Ga-Adangme=3, Akan=4 Other=5 Specify------------------------- ) Sex (1=M, 2=F)................. Age (Last half year passed)..................... Weight (in kgs) ......................................... Height (in cms).................................... Referral on the basis of a lab report positive for malaria parasites (l=Yes, 2=No)........ History of a febrile illness in the preceding 2 weeks (l=Yes, 2=No)............. Duration of symptoms before presentation...................................... Temperature (At time of blood collection)............. Total coma score (0-5)........................................................................... Motor Response (0-2).......................................................................... Verbal Response (0-2)............................................................. Eye Movement (0-1).................................................................. Duration of coma (0= no coma, l=0-60mins, 2=60+ mins)............... Observed convulsions (l=Yes, 2=No)...................................... Respiratory Distress (l=Yes, 2=No)................................ Observed coca cola urine (l=Yes, 2=No) Sickling status (l=positive, 2=negative).................... Parasite density (per microlitres) Haemoglobin (Hb)................................. BM-Stix (in mmol/L).................................. 104 University of Ghana http://ugspace.ug.edu.gh Exclusion criteria Presence of Neurological disease history (1=Yes, 2=No) Recent severe head trauma (l=Yes, 2=No) Other causes of coma (l=Yes, 2=No) Recent severe bleeding (l=Yes, 2=No) Other causes of anaemia (l=Yes, 2=No) Obvious clinical evidence of bacterial infection (1= Yes, 2=No) Molecular biology analysis FcyRIIa genotype H R ..... FcyRIIIb genotype NA1 NA2............... 105 University of Ghana http://ugspace.ug.edu.gh University of Ghana http://ugspace.ug.edu.gh >A a I* £ twoa i 53 ou o >/-i 'Oo \ ( n q t ^ ( N \ q o ' q f ^ i£; m ' 5 | ; ' t ! S ' ! | ; ( S ^ q o l h r^^ i n f n > o i O ' ! t v i i r i r ' r H v i i o t ^ O \ i n r ' i n r ' d o 6 w X w Ph 5 0t»•p<-+->C3Ph a>« H © ’CO O P Z O O O O O W O O W O O W O O O O W O O O W 00 ooai .S <_> <* Q £ 2 H C/3 _ ooo w o o o p o o o o o o o o o o o o w o m 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 - - I C N C S I CO oo CO l> co 00 co vd co co o\ co 00 CO vd CO o\ CO oo CO 00 CO 00 CO C\ CO 00 CO CO as CO t> CO cK CO t> CO CO vd CO o vq o o oo 00* 00 CO cK oo o\ oo in oo' oo 00 in r-~ o in VO © ■'3- m '^|- T—< in o VO vo 00 o m On o o CO t> T—( o VO o CN I> r—(CO m o t> oo ON 00 t—1in VO '^}_ ■^t r— CN in CO a>OX) (N v o M n ^ ^ n i n i n i n c s /">ooi/->cor<-)<^0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 - - H ^ o in i-t> cn ro tj- University of Ghana http://ugspace.ug.edu.gh i 5 a 5 a 5 £ 5 a a 5 £ a a 5 3 5 ^ ^ 5 a 5 £ 3 a 5 § 3 3 .CS r* 1 )-^ r * i-J 1 *—1 *—1 h h 1 i—■1 t-hi r - n j —) > - j ^ —i i -h <-h [ D l D 3 t~ - ( ! D i-h —^ < h-J t-h cN r~< co oj H O O ' v o m M H .ONini -Hco^NpONOooooqcNi -^cNOinqt ^qoooooo * n i n ^ i n ^ i n c 0 ’ i nc00Ni n ,'Nt: in' '3: t>NdNdinvdT3: 0NNdi>'nc0vd co co co co 00 05 g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g | g g g g g S g g g g g | g g ^ g g p g g g ^ g ^ g g g C N O O O O O O O O O O O O O ( N O O O O O O O O O O O O O O O 00o CNJ m in in m in in in in in m in in in m m in in in m in in in m in in in in IT) CO© in NOp ONo © p 00 o in in l> Os I> no NO00 NO © t> ON00 NO00 ONON00 t> NO ON t> 00 t> NONO00 i>co CO cn cn COCOCOco COCOTfr COCOCOCOCOco COCOCOCOCOCOCOco COCOCOCOCO o o Oo © o o m o o o o o o o o o o o o o o o o o o o o o o o(N (N ON t^ VO vq ONoo oo in CO l> 1— o o o , tI- r—( m o t> oON ONCN1—t 1 ( o in ONON ON ON m vo NO CN *—i CONO ONCOCNvoco OS i—I vo ONCOo CO m O CN CNONCO00 r- o CN 00 CN »~h 00 oo NOo(N t—( ONCNONCOONr-**CONOCOCOO o CO in 1— CNT—< n^ CN*■“<00 ■^t o CO l> rr COONNOCNCN CN in in CO Tfr T—1T—( CN M M fa s s s s fa s s fa fa fa s fa s fa s fa fa fa fa s s fa s fa s s fa ©COi-HCOot—1 co NOCNo in CN l> NO r—H NO H in CO CO CN c s o m < ^m o o o o o v D—i ' 0 ' ^- (Nvi c^cNr~-oo ' £Jc^T- i ^r -~i r>vovoTfas 2]>osoo^o^ov©'ooo' ' sr^ov©r<")0\oo»' ">mcN' ' i ' lo ‘/'>'^i'^t'oot-~.Tt-ooa' iO\o\ University of Ghana http://ugspace.ug.edu.gh — CN r 1 (N ^ j i n t ~ ; ' - ; c n r - ^ vS r ~>^v6 \ d t ^ ' -H^ ' o o \ vd ' o i / S ' 0 ' o ,^ i: >o' t^: uS>/ivDiri>riiri^or~^t: t>'£> g^ggg igg l s ggeggegggggg i a l s ggpgggg g g g g g g g g p g g g g g g g g g s g s g g g g s g s g g O O O n » n i n ^ i ^ in 00 © o wo q in in t> o o © o 00 in o o o q CN o CN t> q o q q o K r^ 00 t> 00 c\ oo t^ o n ON t> © oo vd vd 00 00 00 00 t> Os 00 00 vd CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO o o o o o o o o o o o o CN o os vo o o o o O o o o o o o o o o o o o in o T— 1 *n vq T“H 00 o CO © © in © CN 00 © *— < os o n 00 OS o T— I o o CN *n os t-H VO oo CN (N O CN o 00t> C"> in T—* t-H CN vo CO ON CO CN o VOo VO vo OO CN •n oo CO r- oo o OS CN mo T-H T-H 00 On in r- o 1-H OS 00 CO1 '( CN T-H oo T-H r-H CN CO CN vo CN t-H CO CO CN s Ph s s s fc Ph s 2 s pH s Ph s s CN CN T—( t-Hr-H t^* vd 00 CO CN1“H ON t-H r—< 1 in m VO CO CT\ C"» T-H 00 l> vo CNr-H CN CN CN CN CN CN CN CN CN CN CN VO CN CN CN oo00 m o o inin o CO m o 00 o t> CO "3- in CO vo 00 t-H t-Hin o 00 CO CO CN CN CO o 00 CN CO CN Os CN 1—1oo os CO CN t> CO CN CN s? § £ 9M o £ w < £ W H oo m ON oo CO ONCN CN CN CN CN O^ rH Tt cn \f vo m cN CN ’—1 vo co t>^ T—I University of Ghana http://ugspace.ug.edu.gh y—) y—* H - u J r—( r—< t-H r—I t-H L_J u«J r-H p y—i ,—| ,—( ,__| ,-h ,__( ,_ ( r*H t-H t-H £ £ fc vq O n CO vq ON in vd in vd in i> C/3 CZ) C/3 P o O W O O£ fc fc ;* fc fc P o o 00 o o o o £ fc £ fc fc fc fc O O j -H \d \d vi oo oo oo £ £ GO ^ i ^ c h o o o N O h m cnoo * CN m i n v o i n m i n v o o o v o i n 00 GO § § § § § 1/3 oo O £ O O O O O O C S O O O O O O O O O O O C N O O O O O »n >n J^- in in *n CN in m m in «n n in in m m CO m in in in in CN CN in CN o t-H p CN CN p o o p in p O o CN oo On 00 m o o CN in o p o O o in O 00 ON On oo vd vd ON vd t > 00 oo On «> vd vd t> vd 00 oo oo ON r - ‘ vd vd OO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO o o O o o o or4" o o o t-H o O o o o o o o o oCO o o o ovq o o o oOn p 00 o vd vq CO in rH 00 N ^ t vq in ON t-H1 ( oo !> CN CO t> ^t ovq in oCN vq CO T—( m vd ooo 00vd dt-H in ON in © S CO* vo p oi CO t-H CN OO O ON CO O in00 CO o >n O CN VO 00 vo 00 o O t-H O COCN o m On on CN o O l> O On o r-H CO vo o T--1 voCN in ■ o OO On vo On T-H t > CO om CN o in ON in in i-H Os t-H in vo m CO CO 00 CO o 00 CN r- CN CO On ON T-H CO t-H co T_HCO t-H n ' « 0 ' O O i > t s' i n CNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCNCOCOCO University of Ghana http://ugspace.ug.edu.gh 555555555555 r -H t -H t -H t -H t -H t—4 t-H t-H t-H i-H fSl t -H £ £ r-H »£>m ^ ' o m v i t ^ ^ ' t w ^ r t O j N v q o i v q o N ^ ^ p j v o o o w v o H m ’t o o q ' O o d v - i v d i > ,^ : '^: >ri^i; o \ v £ j o 6 v - i \ o ' O cH ^ d o s ' - - i T i : ^ - i od i r i f5>2gS2ggSggg GO CO 00 00O w O O O O O O O O O O O O p O w O O O O O O O O O O O O p K Os vd vd oo ON 00 On vd 00 vd t> vd i > i> i>Cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn oo o o o ocn ol> oOs ocn Ooo o OCN oi> oq o o00 oVO oin oCN oCN oin o oOs o00 ocn oOs o o oin oCN ocn 00 in in 00 00 00 oo 00 00 cn vd in in in in in 00 vd cn ^t cn cn cn cn CN ON O o o in CN o vo VO O ■^t* Tt vo CN VOcn m CN in CN CN rj- in CN cn o m Os o cn CN o cn i> o cn00 t> vo T“H Os cn CN CN cn vo 00 in i i CN vo CN t> i-H o VO o cn vo m (N vo o00 in VO m CN cn vo 00 OO m Os os t-H o CN l-H OS CN CN i> ON «> cn t> os o oin t> cn Os r- 1—1 00 vo o cn os ON OO o t> CN CN cn «— CNcn cn cn cn cn cn cn cn cn cn cn C/5 o Z r-H vq vq vd T—riodiri 'vdvi'^-r-: rnv^irjiriTt: >ncn x n c/i £ £ O O Z £ C/3 00 CO C/2 O O Z Z § § CO 00 0 0 0 0 ( N < N ( N O < N O O O O O O O O C N O O O O O O O O O O O O n in m m m M>nMcN i n > n i n i n i n i n ' nm i n i n > n ' n i n i n > n i n i n > n i n i n o o q o o oo in o CO in CN in in 00 co vd co VD CO vd CO t> CO oo CO t> CO vd CO 00 CO oo CO t> CO oo CO vd CO oo CO vd CO oq oco o00 oin ot> o oo d o CN o00 oin o ot> o in T—H oq oo om in CO CO cn t-h Os in oo 00 00 OS 00 00 CN in vo o o VO o CN o in CN in 00 00 vd 00 vd os vd vd os 00 t> 00 CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO o o o CN o o00 oq oCN ovq ovq oCO oq oO) oON o o00 00 oo CO 00 CO CO ^ F CO CO o in vo o CN OSvo in m CN o CN CN o CN CO o "3- COT-HiH vo CN Os **^f m in r-H VO T-Hm t> CN o CN t"» C"» o r-H 00 CN Os o vo CN CO in 00 O CO o in CO OS oo CN o CN CO in r-HCN vo C"- OS o00 vo Os t> oo CO ro o Os On CN o 00 T—( vo OS oo CN t-H ^t 00 CN 1-H 00 COCO CO t-H CN Os T—H CO CN CN ■'3- VO CO r-H CO in CN t> 00 T-H 1 N r t M M « o o n h ’} N 'O « N tn n PI N $ u U % u £,o I Io o s s m P* (Jh S fc CO CO cn cs o cn CN >n vq o cn oo vq CN in oo vo vd 1> in rn '-'1 >n vd >n *=t i-H1 >n CN f* vo cn 00 in vd ON oi o o o o o O o oo w O o o o w O o o o Y E S Y E S o o Y E S Y E S O o O GO m O O O fc fc fc fc fc fc fc >< fc fc fc fc £ fc fc fc fc fc fc fc fc fc P fc fc fc w o o o o CO p O o P o o Y E S Y E S o o o o o o o o o o o o o o O O o >< fc fc fc fc > fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc fc O O O O O C N C N O O O O O O O O O O O C N O O O C N O O O O O O C N v n n m v i i n N n i n v i i n N » i w i / i i n i n » i i f l n i n v i i n M x i « v ) i n « v i n in «n 00 m CN »n p in in o o p O 00 CN o On vo p p 00 m «n 00 CN CN CN o oo CO 00 CO t>CO vd CO On CO vd CO Os CO vd CO vd CO CO Os CO 00 CO oo CO OO CO K CO t>CO CO VOCO CO ooCO 00CO OsCO vdCO vdCO vdCO oo CO vd CO Os CO 00 CO vd CO o op oON oOs o vq ovq ovq o00 oT—H o o o oCN o oCO o Os oo oin oCN d o op o ovq o o00 o’"t ovq oVO oin om CO •o CO 00 00 on CO CO in in vd vd vd in T-H »n co CO in in vd in 00 o o o r H CO vo m o CN CO vo ON 00 VO o t> CNvo t> m vo in ON 00 m t-H Os o in O OO r —1 Os o o o 00 CN CN in inoo 00 CN on in VO ON VO 00 00 CN CO 00 r-H CN in CO vo ■'sf 00 00 (N 00 ON ON in oo CN00 CN oo On "st’ in t-H "5J- oo CO in t> in CO vo in vo CO oo CN CN CN o ONC"* T-H t-H Os n CN CN o\ CN in CO CN - d d d d s £ d ■5 a d d £2 C! £ M rH JS % rS g c3 TO 3 a t5 COS s a c3 V, 3 t5 ■c tJ § 03 tsM M o M Cj $ ClJ o o o O _ K/j o< o < < < < < W fc o < fc < < < < o w a fc < fc a fc fc < < < fc 00 ON in vo r- vo r -H CO vo in vo CO T-H t-H CO CO CO tj- in in m m r -Tl" Tf rj* ^ t - tj- in vo 00 o CN in 00 CN r—( m ONCN CN CN CN Tt '3- m m VO vo vo vo*'3- «**• tj- ri- University of Ghana http://ugspace.ug.edu.gh 47 1 No rth 1. F 819 9.0 0 39 .0 5 0 NO NO 3.2 Y H/R N 2/ N 2 474 No rth 3. M 27 72 88 9 .40 37 .0 1 2 YE S NO 9.5 N H/R N 1/ N 2 480 Ak an 12 F 14 35 6.4 0 37 .0 5 0 NO YE S 5.4 Y H/R N l/N l 036 Ak an 5. F 20 77 0 8.7 0 40 .0 5 0 NO YE S 5.3 N R/R N l/N l 044 No rth 3. M 66 74 40 7.3 0 38 .8 5 0 NO YE S 5.3 N H/R N 1/ N 2 5 5 5 5 5 3 5 5 5 5 5 5 5 5 ^ 5 5 5 5 5 3 z z z z z § z z z z z z § z i z z z z z z z s * z z z z z z z z z z z z z z z z z z z l/"> CN ON o in p 00 in t -H vd Os 00 ^ vd co CO co CO GO CO CO N O N O B NO W>* £ £ NO £ o O COW O o CO O o O O O fc z P z z £ fc fc 2 fc fc ^ f ^ ^ a \ ' ^ 0 0 ( S > n ^ ; 0 0 i n^vd r f i n i nONvdod i n oz co O W O O O O Oz ^ z z z z z z § o o 0 < N O O O O O © O O C > 0 0 < N O O O O in «n CN in cn in «n in in m in in >n wn in m cn oo’cn vdcn cn ONcn i>cn cn cn i>cn 00cn 00cn ONcn vdcn cn t>cn oo cn vdcn vdcn vdcn vdcn o r-H cn 00 O VO cn CN o o o o 00ON cn o in o in m CN CN t> oo m oo CN c^ c*^ ONT—<1—1 i—*T—1 T-H cn in vo CN CNONr-H vo r- r-H CNm cn 3. 1. 4. 2. 3. 1. 7. 6. cn o o*-H 1-H 9 § 3 tHa s - i > t > o o o o w q t n q o \ q ' O r t t r ) t s w N o \ o ; ^ ^ o ; vd>^ivdf^l>' ^: C^'^: >r>' :^ >X'Oo6'^: 'v6irirt: -7l: fn<—I to oo oo oo ^ ^ oo_oo^&o^_ W O O W O W O O f f l O W O W O O O O W O O W O 00O O O O O O O O O O O O O O O O O O O O O W O O C N O O O O O O O O O O O O O O O O O O O m in CN in m in in in m m rj- m in m in in in «n in in m o o q «n o q oo o 00 q 00 «n vo CN o as q o in CN in 00 cn t> cn t> cn vd cn cn 00 cn cn K cn vd cn vd cn cn cn vd cn vd cn cn O n cn 00 cn O n cn 00 cn cn vd cn O r-H o o cn o T—H o o CN oo ot-H o00 ooo o o ovo o o*^ f Ocn o o oo oCN o cn in as cn vd oo t-H ON in cn in O n vd «n vd 00 in as l> in t-H in cn vo o00 VO t-H *'nI- oo t—Hcn vo ON in o vo t-H O t-H F-mo in ’" t l > CNCNocn i>O VO t-H vo o r- i> 00 o cn 00 t> t-H o t-H T“H CNT—< CNCN 00 cn t-H T-HO n o ^ , v ) ^ , o o o O N t ' O o a H o o i n o n < t i n N ^ , ooNoo cnrnmTt -^tvoNoc^r~t~oooo»—i c s t Nmi n ' » o ' o ^ o i > r ' c n c n c n n c n mmm r n m r n c n ' a ‘ '^t' '^-^t-T}-'^-Tf'^-'^-'^ University of Ghana http://ugspace.ug.edu.gh B. Control group demographics and PCR results code tribe sex age temp Wt/kg Fey Ila Fcylllb DD002 Ga M 4. 36.60 18.00 H/R N2/N2 DD004 Ga F 7. 36.10 22.00 H/R N1/N2 DD005 Ga M 9. 36.30 27.00 R/R N2/N2 DD014 Ga F 9. 36.50 25.00 H/R N1/N2 DD015 Ga F 11 7.70 60.00 H/R N2/N2 DD016 Ga M 2. 36.00 12.00 H/R N2/N2 DD017 North F 7. 36.90 17.50 H/H N1/N2 DD018 Ga F 12 36.60 31.50 R/R Nl/N l DD019 Ga M 13 36.00 31.00 H/R N1/N2 DD021 Ga F 6. 36.60 15.00 H/H N2/N2 DD023 Ga F 6. 36.30 14.00 H/R N1/N2 DD026 North M 7. 36.50 30.00 H/R N2/N2 DD027 Ga F 8. 36.20 22.00 H/R N2/N2 DD028 Ga F 1 36.20 28.20 H/R N2/N2 DD032 Ga F 10 36.60 25.00 H/R N1/N2 DD035 Ga F 7. 36.10 18.50 H/R N2/N2 DD039 Ga F 5. 36.40 17.50 R/R Nl/N l DD041 Akan M 7. 36.80 16.50 H/R N2/N2 DD042 Akan M 9. 36.50 21.00 H/R Nl/N l DD047 Ga F 36.60 26.50 H/R N1/N2 DD051 Akan M 2. 36.10 13.20 H/H Nl/N l DD059 North F 7. 37.00 24.00 R/R N1/N2 DD063 North F 13 37.00 40.00 R/R N2/N2 DD065 North F 8. 36.20 24.50 H/H N2/N2 DD076 Ga M 9.00 36.80 24.00 R/R N1/N2 DD078 Ga F 10. 37.00 25.00 H/H N1/N2 DD079 Ga F 9. 36.00 27.00 H/H N1/N2 DD081 Akan M 5. 36.80 19.10 H/R Nl/N l DD082 Akan F 5. 37.20 14.00 R/R Nl/N l DD083 Ga M 3. 36.50 16.00 H/R Nl/N l DD084 North M 12 37.10 28.00 H/R N2/N2 DD085 North M 9. 37.20 22.00 H/R N1N2 DD086 Akan M 3. 36.30 12.00 H/R N1N2 DD087 Ga M 6. 36.70 17.00 H/H N2/N2 DD088 North F 10 37.20 27.00 H/R Nl/N l DD090 North M 7. 37.00 17.00 H/R NULL DD103 Ewe M 8. 37.20 25.00 H/H N1N2 DD104 Ewe M 12 36.80 42.00 R/R NULL DD105 Ewe F 4. 37.30 13.00 H/R N2/N2 DD108 Ewe M 4. 37.20 11.50 H/H N2/N2 DD109 Ewe M 5. 36.40 15.00 R/R N2/N2 DD110 North M 3 36.10 29.00 R/R N2/N2 DD125 Ewe F 5. 36.60 13.00 H/H N2/N2 DD128 Ewe F 4. 36.90 15.50 H/R N2/N2 116 University of Ghana http://ugspace.ug.edu.gh DD130# Ga F 6. 37.20 19.00 R/R N1N2 DD131 Akan M 6. 37.40 17.00 H/R N2/N2 DD132 Ewe M 11 37.40 27.00 H/R N2/N2 DD133 North M 3. 37.20 15.00 H/R N2/N2 DD134 Ewe M 9. 36.40 26.00 R/R N1N2 DD135 Ewe M 8. 36.50 14.00 H/R N1N2 DD138 Ga F 10 36.50 26.50 H/R N1N2 DD139 Ga F 12. 37.40 26.00 H/R N1N2 DD149 Ga F 2. 36.60 11.50 H/R N1N2 DD150 Akan M 10 37.20 26.50 H/H Nl/Nl DD151 Ga M 9. 37.00 25.00 H/R Nl/N l DD153 Akan M 6. 36.20 18.00 R/R N1N2 DD154 Ewe M 10 35.80 27.00 H/R N1N2 DD156 Ga M 8. 37.20 27.00 H/R N1N2 DD159 Ewe F 8. 36.60 18.00 R/R N1N2 DD160 Ewe F 4. 36.50 12.00 R/R Nl/Nl DD161 Ewe M 10 36.20 30.00 H/H N1N2 DD166 Ewe F 11 36.60 35.00 H/R N2N2 DD167 Ewe F 19. 35.10 53.00 H/H N1N2 DD169 Ewe M 3. 36.90 11.00 H/H N1N2 DD172 Ga M 4. 37.50 14.00 H/H N1N2 DD181 Ga F 9. 36.00 23.00 H/R N1N2 DD189 Ewe F 9. 38.00 29.00 H/R NULL DD190 Akan F 3. 36.40 10.50 H/R N1N2 DD192 Ewe M 4. 37.20 14.50 H/R N1N2 DD193 Ewe M 0. 37.00 20.00 R/R NULL DD195 Ewe F 11. 36.90 33.00 H/R N1N2 DD196 Ewe F .8 36.80 18.00 H/R N1N2 DD197 Akan M 8. 37.20 22.00 H/R NULL DD198 North M 6. 36.90 17.00 H/R N1N2 DD199 North F 2. 36.10 12.00 H/R N1N2 117 University of Ghana http://ugspace.ug.edu.gh