University of Ghana http://ugspace.ug.edu.gh
CHEMOKINE MEDIATORS OF CEREBRAL 
MALARIA: A COMPARATIVE STUDY OF 
THE ROLE OF RANTES IN MURINE AND 
HUMAN CEREBRAL MALARIA 
BY 
BISMARK YAW SARFO 
THIS DISSERTATION [S SUBM[TTED TO THE 
rN[VERSITY OF GHANA, LEG ON IN PARTIAL 
FULFILMENT OF THE REQUIRE.\1ENTS FOR THE 
AWARD OF PH.D. DEGREE IN IUOCHEMISTRY 
SEPTEMBER 2004 
University of Ghana http://ugspace.ug.edu.gh
DECI.ARA nON 
I, Bismark Yaw Sarfo hereby declare lhat the experimental work described in thi. 
research work was conducted by me under the supervision of Prof. Jonathan K. Stiles, 
Prof. Fredrick N. Gyang and Prof. Michael D. Wilson. excq>t for- the references to the 
WOftofotherrcsean:hcrs which were duly cilCd . 
..... {l~,L .... 
(Candidate) 
.. ....~  
Prof. FredrickN. u}'llng 
(Supervisor) (SupeJVisor) 
~V~· 
Prof. Michael D. Wilson 
(Co-SupervilOf) 
University of Ghana http://ugspace.ug.edu.gh
DEDICATION 
To my family 
University of Ghana http://ugspace.ug.edu.gh
ACKNOWLEDGEMENTS 
I wish to express my sincere thanks and apprttialioo to Prof. Jonathan K. Stiles for 
gi\-ingme tbe opportunity to conduct this research work in his laboratory, and alm Cor his 
immeme suKJance and advice dwing the entire period of my studies. I am also grateful to 
Prof. James Lillard Jnr, for his guidance and contribution. I am indebted to the following 
people of Morello"", School of Medicine, Atlan.. Georgia, USA; Prof. Gerald 
Sonnenfeld. Dr. Sbailesh Singh. Ms. Ikovwa lrune. Ms. Yvonne Powers. M, Ethel Mills, 
Dr. Ravichandra Palaniappan. Dr. Udai P. Singh and Dr. Jacqueline Hibbert, all of the 
[)qmtmeot of Microbiology. Biochemistry and Immunology, Prof. Winston Thompson. 
Dr Melissa Green and Ms. AJici. Branch of the Department of Obstetrics and 
GyDaccology. Prof. Joseph Whittaker and Mr. Tabari Baker of the Department of 
AoaIomyand Neurobiology, Dr. Alexander Quarshie of the Clinical Research Center and 
Mr. Lawrence Brako of the Electron microscopy department 
Thank you. Dr. P. Jolly of the University of Alabama., at Binningham, USA. for 
providing the human plasma samples for this study. 
I am also thankfuJ to the following people for their diverse role and support during my 
stay in the USA; Ms Agnes Aboah of Augusta Georgia, Messrs Rexford Asare of the 
Uni\'WSity ofKCDtUclcy and Aboagye Dacosta of the Oklahoma State Universily. 
My utmost grntitude goes to "'of. M.D. Wilson and Dr. Daniel Y. Boakye oflbe Noguchi 
Memorial Institute for Medical Resean:b (NMIMR) (or the confidence they have reposed 
ill me. Their mentoring and falberly guidance will forever remain in my memory. My 
University of Ghana http://ugspace.ug.edu.gh
sincere thanks also go 10 all the memben and staff of the Panuitology department of 
NMIMR. 
I am pateful to Prof. F.N Oyang for his mentorship and contribution to this study. To Dr 
Val OKi·Difie. Or. W.S.K G~yo, Dr. Naa Adamafio, Mr. Sulemana Dramanu. Ms 
Christiana Neney and Ms. Hetty Antwj·Boasiako. all of the Department of BiochemiSIrY, 
Universif)'of Gbana, thank you forallyoursuppott. 
My approciIIioo Ibo goes .. Ibe following people; Dr. R.K.GyIIi, Prof A.A Adjei ..d  
Or. H Armah of the Pathology department. University of Ghana Medical School. 
May the almighty God richly bless aU of my family member$., including Mr. Kwabena 
Donkor. Hon. Francis Osei-Sarfo. Mrs Rebecca Ampong, Mr. Richard Sarfo, Mr. Boakye 
Sarto and Mr. Emmanuel Sarfo for their prayers and support. 
I also wish 10 acknowledge the support and prayers of the following people; Mrs Salla 
&akyc and the fanily, Mr. Abdul-Inusah Nasiru and h.is wife Fatima Ibrahim as well as 
Mr. Kpcbll K. Smith. 
I am very thMkfuI to the volunteers and members of families of dc~ascd patienlS whose 
samples were used for some aspcctsoflbiJ study. 
This study received financial support from UNDPfWorld BanklWHO Special ProgIWD 
for Rae.rcb 8IId Training in Tropical Diseases. 
University of Ghana http://ugspace.ug.edu.gh
TABLE OF CONTENTS 
DECLARATION ....... . .••••••••••• .•••••• ••• . •• .1 
DEDICATION ............ . .. . ....... . .. •.............•................ ............... ii 
ACKNOWLEDGEMENTS ........... . .......•...•.••••••..•..•••••••........•.••••...•••..... 111 
TABLE OF CONTESTS .................•.. •••••••••.••••.•.•••••••••••••.... ......•• ..... . _v 
LIST OF ILLUSTRATION ....... . ... . ...................................................i ii 
LIST OF T A8LIo:S. . ... . ..... . .. . ................................... ....................... J.iv 
ABBREVIATIONS.. . .................................................... ..... ....... .... ... xv 
ABSTRACT....... . ..................................................... .. .. .... xU: 
CHAPTl:R ONE... .. ...... ................................................. 1 
INTRODUCTION .................. ........................................................ _ 1 
1.1 PlasmodiJllft pansitesand malaria ... ............... ... ... ... 1 
1.2 Rationale andjuslification of study ............. . ..... . ........... ....... .. .......... 3 
1.3 Generalbypothesis ... . ...... 4 
Objectives ... . ............. 5 
1.5 Approach of study .. . . .....6  
CHAPTER TWO .................... . ........................... . .. . ............. . ............._ .7 
LITERATURE REViEW ........................................................................7  
2.1 Life cycle of Plasmodium parasites. and the malaria disease. . ........7  
2.2 Global epidemiology of malaria. and economic development ..................... ...... 11 
2.3 Currena strategies for malaria cootrol. .................... ...... . ................... 16 
University of Ghana http://ugspace.ug.edu.gh
2.3. 1 Tbeuse ofaoti-malarial drugs and their discovery ... ". .... 16 
2,3.2 VectorcontroJ. .. . ...... 18 
2.3.2.1 Use of nets and insecticide treated bed nets ... . .. .lS 
2.3.2.2 Larva.l cODtrol ... . .. 19 
2.4 Clinical manifestatiom and pathogenesis of malaria ... .. 19 
2.4.1 Uncomplicated malaria .. . .. ... 19 
2.4.2 Complicated or severe maJaria ... . .. 20 
2.4.2.1 SeveremaJariaanaemia. .. . ....... 21 
2.4.2.2 Cerebral rnalarla(CM) ... . .... .. 22 
2.5 lnununil)'lOmalariainfection... .. ..........................2 5 
2.6 Central nervous system (CNS) and malaria... . ..... .. . . .. . 29 
Immune mediators of malaria in mouse models, human and primate... . ...... 31 
2.7. 1 Immune mediators of malaria in mouse models ........................ .. 3) 
2.7. 1. 1 The roleofadhes.ion molecu.les .. .......... . ..... )1 
2.7.1.2 The rolcofc)1okines ......................................... 33 
2.7.1.3 The roie ofchemokines and receptors ............. ........ . ..... 34 
2.1.2 Immune mediators of malaria in human and primate models ....... .. ....4 0 
2.1.2.1 The role of adhesion ffiolecu1es ........................ . ......... .. 40 
2.1.2.2 The role ofcytokines. .................. .. .. . ............ ..... .45 
2.1.2.3 The role ofchemokines and m:epton . ....... . ...........4 5 
2.8 RANTES as. proinflammatory chemokine . .................................... ... 46 
2.9 Curran researcb strategies for Wlderstanding malaria pathogenesis . . .......4 9 
2.9.1 Mwine malaria models and malaria research ......................... 49 
2.9.2 Humon post mon.m tissue and peripheral blood wnples .. . . .. 52 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER THREE ..• .•••..•..•. •••.•• •• •••••• .. ••. •. ..•• •..••.• •.•• ••. .•• •••• •• •• .•. ••• ••• •• .••5 3 
MATERIALS ASD METHODS. . ...•. .. . ...• ... ... . ....... •.•.. ..•.•..• •• .•. ••• •. •.. •. 53 
MATERIALS .. •.•••••. .. .. .... .... ........ . ... ... .. ...... .•..•. ..•..•...• .••••.. .. .. •.. 53 
Laboratoryanimals.. reagentsandsupplies ... .... 53 
3.1.1 P.yoelil17Xparasites . .. 53 
3.1.2 eDNA micro-array .... ..•. 53 
3.U TRlZOL· .... ........... 54 
3.1.4 EUSA .... . ... 55 
3.I.S Antibodies ... .. .. . . ... .. .5 5 
3.1.6 RT·PCR and PCR ..... . ... .. 55 
3.1.8 SDS·PAGElWestem Blot ... . .. 56 
METHODS ....... .............••......... . ... 58 
3.2 Mouscmalariastudies-I ... . ....... 58 
3.2.1 P.yoell i J 1X mwine malaria model.. . ....................5 8 
3..2.2 Preparation of infected mouse brain tissue samples . ........ . .. ... .. . ... .5 8 
3.3 Transcriptiooal analysis of P.yo~1iI17X induced immunomodulator mRNA 
expression ... ............................. ..... ..... ............ ... " .. .. .......... 59 
3.3.1 Total RNA isolation from P.yoelii 17X infected mouse brain . ........... 59 
3.3.2 DNase treatmenl of total RNA samples. . .. .. .. ......6 0 
3.33 Testing or lOW RNA sompleo r"'poaible DNA contamination . .......... 61 
3.3.4 eDNA &I'T3),·screening of P.yoelfll7X induced immunomoduJators .. ... 62 
3.3.4.1 Probe synthesis from total RNA . ... . .... ............... .. ... .. .... ... 62 
33.4.2 Coh. .. purification or I)'JIlbcoized probes. . .. .. .... ...... 63 
University of Ghana http://ugspace.ug.edu.gh
3.3.4.3 Hybridizing eDNA probe! to the Atlas amy ... ....... . ... 63 
3.3.4.4 Washing of hybridized anay membrane .... . ... 64 
3.3.4.5 Gene analysis ...... . . ...6 5 
3.3.5 Reverse transcription of purified mouse brain RNA to eDNA for peR 
analysis .. ..... . ... 66 
3.3.5.1 Amplification by PCR and semi-quantitative analysis of P.yoelii 
17X induced immunomodulators ..... . ........6 6 
3.4 Tissue and plasma protein analysis of P.yoe1i/17X induced RANTES 
expression. ...6 8 
3.4.1 SDSlWestem BIoI analysis of P.yoelii 17X induced RANTES protein 
expression in mouse brain ..................... ................ . ...6 8 
3.4.1.1 Prolein ilOlationand assay from mouse brain... . ......6 8 
3.4.1.2 PreparingSDS-PAGEgel... ......6 9 
3.4.1.3 Transfer of protein onto membrane .. ..................... .... .......7 0 
3.4.1.4 Westem Blot analysis ... .. ....................................... ... . 71 
3.4.2 Peripheral blood analysis of P.yoe/ii 17X induced RANTES 
expression .... . ............. ................ ................7 3 
3.5 Ultrastructural and immunohistological analysis of P.yoelii J 7X infected 
brain samples ... . .................. . ......... ......... 74 
3.5.1 Uhrastructural analysis of P.yoe1il17X infected brain samples ....... .... 74 
3.5.2 lnununohistological analysis of OF AP expression in P.yoeli; t 7X 
infected mouse brain.. . ......... ............................. 75 
3.6 Human malaria studies... . ................................................ .. 76 
3.6.1 HI.DlWI cerebral malaria (eM) and non·malaria (NM) brain samples ....7 6 
viii 
University of Ghana http://ugspace.ug.edu.gh
3.6.2 Tnooscriptiooal analysis of RAlITES, CCRI , CCRJ ond CCR5 in 
CCRbrum. cerebellum. brain stem and hippocampus of eM and NM 
samptes ......... . ..... 77 
3.6.2.1 RNA isolation and DNase tJatment. from eM aDd NM samples.. . ... 77 
3.6.2.2 Reverse transcription of purified human brain RNA to eDNA for peR 
ana1ysis ... .... .... 78 
3.6.2.3 peR amplification and semi-quantitative analysis of eM induced 
RANTES, CCRI , CCRJ, and CCR5 ... .. ...... .. 78 
3.6.3 Tissue and plasma protein analysis of malaria induced RANTES. CCRI. 
CCRJ and CCRS expression ..... 79 
3.6.3.1 Protein isolation and analysis from eM and NM samples ........7 9 
3.6.3.2 P~n.g 50S·PAGE SCi for protrin analysis . ......... ... . ..... . 79 
3.6.3.3 Transfer of protein onto membrane ... ..80 
3.6.3.4 Western Blot analysis .......................... ..... ................ 80 
3.1 Detmnination of P falciparum antigen and malaria induced pIasmI RANTES 
expressiOD by ELISA ... " ...... II 
3.7.1 Determination ofPjalciparum antigen ... .. .......... 11 
3.7.2 Pjalciparwlt inducod plasma RANTES expression ........... , ......... ..& 2 
3.8 StatisticaJaoalysis ... .. .. ...................8 3 
MousemaJariaSlUdies-2 ... .. ........ ............ ......... 83 
3.9.1 Ro&eofRANlCSinseverityandmortalityofmurinemaiaria. ......... 13 
CHAPTI:R FOl·R .. ...... ... ... .. , ........ " ... .... , ..... . .. . ............ , ... , ...... .. .......... 16 
RESULTS .................. .... ................ .. ....... . . .. .................................... .16 
University of Ghana http://ugspace.ug.edu.gh
4.1 Mouscmalariastudies-I ..... 86 
4.1.1 P.y«/ii 17X murine malaria model .... ..... 87 
4.2 Transcriptional analysis of P.yoelii 17X induced immunomodulator expression.89 
4.2. t cDNA array gene statement and ana1yses of P.yoelii t 7X induced 
immunomodulators... . ........... 89 
4.2.2 Semi-quantitative RT-PCR validation and analysis of immunomodulator 
gene expression dwing P.yoelii 17X infection ....... . ..............9 2 
4.2.2.1 Adhesion moh:cul~PECAM-I, ICAM-I, VCAM-l mRNA 
expression . . ................9 2 
4.2.2.2 Cytokine-INF-y, TNF-a, lL-12 and iNOS mRNA expression .....9 6 
4.2.2.3 Chemokine· MIP·2a1pha. MCP·1. RANTES mRNA 
expression .... ................................................... 101 
4.2.2.4 Chemokine receptor-CCR I. CCRJ and CCRS mRNA 
expressIOn ....................... 105 
4.3 Tissue and plasma protein expression of P.yoelii 17X induced RANTES ...... 109 
4.3.1 P.yotlii 17X induced RANTES protein expression ...................... 109 
4.3.2 P.J'M1ii 17X infection induce plasma RANTES expression .. ............ 111 
Ultramuctunll and immunohistological analysis of P.yoelil J 7X infected 
bl1linsamples ......................................................................... 113 
Ultrastructural anaJysii of P.yoel/ll7X infected brain samples ...... . .. 113 
4.4.2 lmmlmOhistological analysis ofGFAP exprnsion in P,yoelil17X infected 
mouse brain .. ............................................... ............... 115 
4.5 Human malaria studies. .. ................... ·· .... · ................ 117 
4.5.1 Post-mortem eM and NM brain samples. · .............. 117 
University of Ghana http://ugspace.ug.edu.gh
4.5.2 Transcriptional analysis of RANTES. CCRI. CCR3 and CCRS in 
cerebellum. cerebrum. brain stem and hippocampus of CM and NM brain 
samples ... .. ....• 118 
4.5.3 Western Blot and plasma onaIyses ofRANTES. CCRI. CCRJ and 
CCRS ... ........ 123 
4.5.3.1 Western Blot analysis of RANTES, CCRI . CCRJ and CCRS 
protein in cerebellum. cerebrum. brain stem and hippocampus of 
CM andNM samples.... .. ...... ... 123 
4.5.4 P./alcipcvu," induce RANTES expression in plasma. . . .... .126 
4.5.5 Correlation ofRANTES expression with maJaria infection.. 128 
4.6 Murinemalariastudies-2 ......................................................... 130 
4.6.1 Role of RANTES in severity and survivaJ during P.yoeliJ 17X malaria in 
mice ... .. .... 130 
CHAPTER FIVE .................. ............................................. ............... \35 
DISCI.'SSION .................................................................................. 135 
5.1 P.yoellil7Xmurinemalariastudies-t ... . ........ .. 135 
5.2 Murine maJariastudi. ..2  ...... . ................. 146 
5.3 Human malaria studies .. . ............. .... . 147 
5.4 Coaclusions ... .. ....... .. ..... 152 
SUGGESTIONS FOR !'UTl'IU: STUDIES. .. .. .............. ...... ............. ..... ..1 55 
REFERENCF.S ...... .. ........................................................................ 156 
APPENDICES. ········. .......• . ......... ··· .. ·· .. · ··· .. · .. .. · .. · · .. · .... · ...... ...... .. 172 
University of Ghana http://ugspace.ug.edu.gh
USTOF ILLUSTRATIONS 
FigUJOl ' Approacb ofstudy ....... .. ....... 6 
Figurt'2: Lifec:yde ofhwnanmalariapanLSite ... .. ... 9 
Figurc:3: GlobIJdistributionofmalari • ... . .. 12 
Figure 4: Classification of cilemokines and receptors ... .. .. .. 38 
Fisure 5: Sequestration of Plak.porum LRBC in brain microvessel. . . . .. 43 
Figure 6: Schematic illustration of cellular adhesion in P.folclparum malaria ... .....4 4 
Fipwe 7: RANTES recruits inflammatofy cells into site of inflammation .... ..4 8 
Flgurc8: MurinemaJariamodel. .. 
FlglR 9: P.JlMIiII7X infection induces spleno-hepatomegaly in SW mice ... . .... 88 
Figure 10: Autoradiograph of eDNA microarray analysis ofmRNA expression in 
tnOUiebrain . ...... .. 90 
Fi&"ft 11 : P. yc¥Ii' 17X uprelUlates PECAM-I mRNAexpression in mouse bcain ... .. 93 
Fipre 12: P. )IOflil17X upregulates teAM-I mRNA expression in mouse brain ........9 4 
Figwe 13: P. yoelill7X upregulates VCAM-t mRNAexpression in mouse brain ..... .9 5 
Figutc: 14: P. yoelii 17X upreauJates INF-gamma mRNA expression in mouse brain .... 97 
FiguR 15 P. yoeifl17X up~gu1atesTNF-alphamRNAexpression in mouse brain ..... 98 
Fiaure 16 P. )W1ii 11X upregulateslL-12 mRNA expressjon inmoUie brain ..........•9 9 
Figure 17· P.y«lIi 11X induced iNOS mRNAexpression io mouse brain ............. 100 
Figure 18: P. yoelli 17X upregu1ates MIP-2alpha mRNA expression in mouse brain ... l02 
Figure 19: P }'(Hili 17X upreguJmes MCP-t mRNA expresston in mOUlC brain .. ....•• 103 
Fi1Ufe20: P. y«/ii 11X upn:gulates RANTES mRNA expreukm in mouse brain •. 104 
Fiawe21 : P. y«iiJ t7X upresulatesCCRI mRNAexpression in mouxbraia .. .. .. 106 
llii 
University of Ghana http://ugspace.ug.edu.gh
Figure 22: P. yoelii 17X upregulatesCCRl mRNAeKpression in mouse brain .. .... 107 
Figwe 23: P. plii 17X upregulates CCRS mRNA expression in mouse brain ...... 108 
Figwe 24: P. y«/ii 17X upregu1ates RANTES protein expression in mouse brain .. 110 
Figure 25: P. J'O,/ii 17X upregu1a1es RANTES protein expression in mouse plasma.l ] 2 
Figure 26: P.yoelii 17X induces ultra structural changes in mouse cerebellum. . .... 114 
FiguR 27: P.yoelii 17X induces morpbologic:aJ changes in astrocytes in mouse 
brain .. . .... .116 
Figure 28 CM upreguJales RANTES. CCRJ and CCR5 mRNA ex.pression in 
ceJObellum ..... ... 119 
Figure 29: C~ upreguJales RANTES, CCRJ and CCR5 mRNA expression in 
cerebrum ... . ... 120 
Figwe )0: C~ upregulales RANTES mRNA expression in brain stem ....... .. ..... 121 
Figure 31 : CM upregulates RANTES mRNA expression in hippocampus.. . ...... 122 
Figure 32: CM upreguIates RANTES and CCR protein expression in cerebellum . . 124 
Figw-e 33: C~ upreguiales RANTES and CCR protein expression in cerebrum ... ... 12S 
Figwe 34: P /olciparum upregulates RANTES expression in plasma ........ ......... 127 
Figure 35: Plasma RANTES expression correlated positively with malaria antigens.129 
Figure 36: Course of P.yoelii / 7X  infection in mock and anti-RANTES antibody 
treated mice . . . .... . . .... . .. .. . . .. ... ... . . .. .132 
Figure 37: Survival of mock and anti·RANnS antibody treated mice, infected with 
P.yo<lIIl7Xparasi.... .. . ... ............. ................ . . . . .. . . ....... .. 133 
Figure 38: P. y«/ii 17X i.nfection upregulates RANTES expression in plasma of 
mock antibody Ireated mice •... . . . . . .. ............ 134 
figwo 39: Proposed model for RANTES-medialed brain pathogenesis during eM ...1 54 
xiii 
University of Ghana http://ugspace.ug.edu.gh
LIST OF TABLES 
Table 1: Loss from the economic growth pcnalty of malaria endemicity in 31 Africao 
countries ...... . .... . .... 15 
Table 2: Cbemokinc nomenclature ... . .... 35 
Table 3: Examples of animal models used for malaria brain immunopathological 
studies .... 51 
Table 4: PIQ,Jmodium yoefill7X infection alters imrnunomodulator gene expression 
in mouse brain st peak parasitemia (day 8 post infection) .................. ...... 91 
xiv 
University of Ghana http://ugspace.ug.edu.gh
ABBREVIATIONS 
BBB, bloodbrainbarrier 
BCA-I, B-cell-attracting cbemokine I 
bp. basepair 
BT, Bacilluslhuringiensis 
CCL, c-cchemokineligand 
CCL2, c-ccbemokine ligand 2 
eels, c-c cbemokine ligand 5 
CCRI,c-cchemokinereceptorl 
CCR3, c-c chemokine receptor 3 
CCRS, c-c chemokine receptor 5 
CD 36, cellular differentiation antigen 
eDNA, complementary DNA 
CSF.cen:brospinalfluid 
CM, cerebralmaiaria 
CNS,central nervous system 
CTACK. cutaneous T -cell-attracting chemokine 
CTL. cytotoxic T lymphocytes 
DARC. duffy antigen receptor for chemokines 
dATP. deoxyadenosmc triphosphate 
DC-CKt, dendritic cell-derived CC chemokine 1 
dCTP, deoxycytidine tripbosphate 
dGTP, deoxyguanosinetriphosphale 
DDT, Oichloro--Oipbenyl-Trichloroethane 
University of Ghana http://ugspace.ug.edu.gh
dITP.deoxythymidinclriphosphale 
DNA. dcoxyribonucJcic acid 
DNase, deoxyribonuclease 
ECM. experimentaJ cerebral malaria 
ELAM I. Endothelial leukocyte adhesion molecule 1 
ELC. EBL-l·ligand chemokine 
ELISA. eDZyme-linked inunun050rbenl assay 
ENA-18,epitbelial-ceJl-derivedoeutrophilanrac:tanI78 
eV.etcctronvolts 
FACS, fluorescence activated cell sorting 
GAPDH.g1ycera!debydes.3·phosphaledehydrogenase 
GCP.graouloc:ytccbcmotacti<:protcin 
ORO, growth-reWed oncogene 
HCe. iIIcmofiltnde CC chemokine 
mv, bumIo immunodeficiency virus 
HIVE.HJVencephalitis 
HRP.Hlstidinrichprolein 
)CAM .. I. ialat:ellular adhesion molecule-I 
lL-12.im«1..wn·12 
iNOS.induciblenibicoxidesyntbase 
lP.IO.inlerferon-;ooucibieproccin 10 
IRBC. infectcd rod blood ccli 
1.TAC.inIerf. ...... ioducibleT.cellalpha 
University of Ghana http://ugspace.ug.edu.gh
1uJr, knockdownresistance 
LARC.liver- and Ktivarion-reguJated chemokine 
LEC.liver-expressedchemokinc 
Lkn-I.leulcotactin 
LSA-I.liverstaaeantigell"'t 
MCP. mooocyte chemoattractant protein 
MDC, macrophage-de:rived chcmokine 
MEC,IDIDU1lM)'-<nricbedchemokinc: 
MHC-l, major bi.stocompatibility complex clus I 
MIG. moookine induced by interferony 
MIP, macrophage inflammatory protein 
mM.millimol .. 
mRNA, mesxnger ribonucleic acid 
MPlF. myeloid progenitor inhibitory factor 
NAP,neutrophil-activalingpeptide 
NM.ooo-malaria 
PCR.POlymerasc cbain reaction 
PECAM-I. platelet endothelial cell adhesion molecule-I 
PF4.plale1elfactor4 
PFP·KO. pore forming protein- knock out 
PjEMP. P/tJIffOdjllllljaJclparu". erylhrocytc membrane protein 
RANTES. regulated on activation. normal T-cell expreued and secreted 
RBC, red blood cell 
xvii 
University of Ghana http://ugspace.ug.edu.gh
RNA. ribonucleic acid 
RT-PCR. reverse transcriptase-polymerase chain reaction 
SCM·la/II.singJeCmotif·la/II 
80F,stromaI-eeU-derivedfaclor 
80S·PAGE. sodium dodecyl sulptulle polyacrylamide gel eleclrophoresis 
SLC, secondary lymphoid tissue chemokine 
SW, swisswebster 
TARC, tbymut-aodactivation-reguiated chemokinc 
TECK., thymus-expressed chemokine 
TEMEO, N.N, N,-tetramethyl ethylene-diamine 
ThI . Tbelperl 
TNF-a, tumcu necrosis factor-alpha 
TSP. Tbromboopodin 
J'M, mieromolar 
VCAM-l . vascular cell adhesion molecule-I 
vlv,volwnelvolume 
wlv, wei&bllvolume 
xvin 
University of Ghana http://ugspace.ug.edu.gh
ABSTRACT 
Ahbougb the involvement of cytokines and adbesion molecules in malaria-induced brain 
~D his been established.. the roLe of chemokines and cbemokine receptors 
remain uncte.. This unexplained component of «rebral malaria (eM) pathology may be 
rcspoosib)e for the heterogeneity in the observed features of eM and the difficulty in ill 
characterization. RANTES (regulated on activation normal T cell expressed and 
secreted), a chemokine involved io the generation of inflammatory infiltrates plays • 
special role in the modulation of infl3.ffimation. Trafficking of inflammalol)' T helper I 
(Thl) ceUs into the brain is mediated partly by RANTES interactions with c-c 
chemokine rtteJMor 5 (CCRS) receptor. 
The ",.iJf iypodlesu of tills S'"t1y are: (tJ) RANTES. and corlftpondilfg recepton 
~ ",./arill Induced brain /ncmulfopathogenesis (6) BlocAing RANTES whieh " 
IqWqWtlJet d",1n6 malo";11 injection will _brogate or minimize the outcome 0/ tire 
Studies were directed at i) CbatacterizinS and analyzing the expression of RANTES and 
""'"'POnding _rs CCRI. CCRJ and CCRS in. mouse model orCM (SW mice/Po 
~Il; 17X) using eDNA microanay. RT-PCR and Western Blot analyses ii) Evaluating 
effect of P.yoelil 17X infection on IDOUIe brain by eleetron microscopy and 
imnlllDobistologicaJ analyses iii) Evaluating expression of RANTES and receptors i.a 
cerebellwu. cerebrum, brain stem and hippocampus of post-mortem eM and OOD-maJaria 
(NM) Us.ue -ptcs using RT·PCR and Western Blot analyses 
University of Ghana http://ugspace.ug.edu.gh
iv) Comparing.nd cootrasling levels ofRAN'reS lf1 plasma of rodent malaria model and 
malaria-poIitiw bwnan subjects using ruSA 
v) Detmnioe the functiooal role of RANTES by anti-RANTES antibody blocking 
~usin&P. yo<IIi17Xinr.ctedmi<:e. 
Transcriptiooal analyses re£UJts indicate significant upregulation of chemolUncs; 
macrophaae inflammltOry protcin-2a. (MIP-2a.). monocyte chemotalttK: protein-I (MCP-
I) and RANTES. chemokine rec:eplOfS; CCRI. CCRJ. and CCR5. adhesion mokcuJes; 
plMdec eodotbeli.al cell adhesion molecule-I (PECAM-I). intercellular adhesion 
molecWe- (lCAM-I), vascular cell adhesion moleeule-l (VCAM-l) and eytokines; 
intcreferon-gamma (INF-y). twnour necrosis factor-alpha (TNF-a.) and interleukin-12 
(U...-12) at peak .,...,.temia dwina P.yMJii 17X infection. Western Blot analysis revealed 
upquIaIioDofRANTES proee;n inP.yo<lIi 17X infecu:dmowe bnlin. 
Uhrasuuctutal. aoaIysis sho ..... ed tha1 P. yoelii 17X infection induces perivascular oedema 
iD oeJ'd)el1wn in mOUlC brain at peak parasitemia. lmmunohiseotoa,ical analysis 
demonstnles rugh immunoractivity of glial fibriU.-y acidic protein (GFAP) ill P. yoe/il 
l7Xinfectedmousebrain. 
RANTES. CCR3 and CCRS but not CCRI mRNA are siitUficantly upregulated in the 
=bellum ODd ccn:brum (P < 0.0001) in CM than NM samples. 
There were DO ctlanges in the expression of CCRI. CCRJ and CCRS mRNA i.D brain 
stem and ruppocamPlli of eM and NM. RANTES mRNA expres.sion in cerebellum aDd 
University of Ghana http://ugspace.ug.edu.gh
__ ;. iUAbIY oiaJUficanl (p < 0.0001) compared,.jlb!be bnin lIem (p = 0.0018) 
and hippocamPUS (p • 0.0027) in CM group. 
CCR.S and RANTES proteins "0,("0: significantly upregulated in cerebellum (P < 0.0013 
for CCRS. P < 0.0001 for RANTES) and ce ..b rum (P < 0.0124 for CCRS. P < 0.0001 for 
RANTES) but DOt brain stem and hippocampus of eM than in NM. We*m 81oc. 
-)'lit could no! delcel CCRJ proIein 
RANfES was significantly upregulmed in plasma oC murine malaria model aDd. malaria 
positive subjects compared with controls. RANTES conccntra1ion in plasmt corret.lcd 
with P. jaiciponma infection. 
At day of sacrifice. level of parasitemia (4.2x I06/mi ±O.2) In mock antibody lteared mice 
was higher (P < 0.05) than in mice in which RANTES was blocked with antl-RANTES 
aotibodJ' (1.2 x 106/m1 ± 0.2). Anti-RANTES antibody treated mice survived &anger (14 
days) than mock antibody treated mice (10 days). 
This is the first temporal study of murine malvi. assoclaled RANTES and receptors 
CCRI. CCRJ aad CCRS expression. P. yoe/il 17X murine malaria model is useful in 
cbInc\aizina differentially expressed genes associated with human clinical malaria. 
There is an as.5OCiation of RANTES expre.uion in malaria-induced brain 
immWlOpatboKenesis and cndotbelial lesions in infectcdmice. 
University of Ghana http://ugspace.ug.edu.gh
CCftbclium IDd cerebrum in hwnans were the focal points for increased maJari.induced 
RANTES aftd CCRS ex~on. Active sequewation of inf«ted red blood cells (lRBC.) 
1M platelets in addition to leukocytes in Ibex regions oft.be brain could exacerbate CM 
immooopathology. 
Sioclong of RANTES decreased parnsitemla and mortality associated with P.yoelJl 17X 
iJlfoetioo. 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER ONE 
INTRODUCTION 
P/luIffO(/;ump.arasitesaodmalaria 
Malaria is cauxd by infection with Plasmodium •• 8enus of protozoan parasites. The (our 
species of PlasmodUl known to be causative agents of human malaria are Plasmodium 
vlva;r, Plasmodium ova/e. Plasmodium IPIlIlarlae and Plasmodium /alclparum, the latter 
beiDa !he most lethal (WIlD, 1996), 
P. max bas the widest geographical distribulion. It is prevalent in tropic and subtropical 
regions and a150 found in some temperate zones. Relapses may occur up to eight years 
after initial infection. It causes benign tertian malaria and is the second most harmful of 
all malaria species. 
P.U'IOk is the rarest of the four species of Plasmodium and a150 causes benign tertian 
malaria. II is tied with P.rno/arille as being less dangerous and is common on the West 
Coua of Africa. P.maJariae infection is difficult to diagnose because of its similarity with 
P.";var. P. twGle on the contrary is quite easy to diagnose with its distinctive 
I'DCXphology. P. C1WJ/. infected cells are oval ahapedand slightly larger than uninfccted 
m1 blood cells. Both P.ovaJe and P.vivax have a donnant hypnozoite stage in the liver 
lbat can last for weeks or months before the development of erythrocytic schizogon),. 
University of Ghana http://ugspace.ug.edu.gh
P.aalarlat is pelchily distributed over tropical Africa, EasterD Asia. Oceania and the 
AmazOn area (WHO. 1996). It causes quartan malaria and accounts for 7% of malaria 
cases aDd can have relapses 53 years after initial infection. The classic symptoms of 
malaria- fever. malaise with intenmnent paroxysms are typical of P. vivax', P.ovale, and 
p.IlfDIQTloe. 
P-falciparwrt malaria infection is the commonest and widespread of human malaria and is 
generally more severe and fatal in oon-immune individuals and young children aged 0-9 
years if untreated. It is responsible for more than SO~ of all malaria cases in the world 
aDd characterized by febrile illness which may be expressed 85 periodic paroxysms 
occurring every 48 hoW'S with afebrile and relatively asymptomatic intervals (Campbell, 
1997). Other major symptoms of P. !alciparum maJaria are chills, vomiting, convulsion. 
headIche,drowsinessand skeletal muscle pain. 
Malaria is a significant cause of abortion, stillbirth. child mortality, low birth weight, 
death in pregnant women. impaired growth in children and loss of productivity in adults. 
Fokiparum malaria annually infects 300 million people causing at least 100 million cases 
of acute illness leading to approximately 2 million global deaths per year (Campbell, 
1997). Increasing towism, failure in vector control and increasing resistance of malaria 
parasite to cuneot antimalarials has increased the threat of this disease. Approximately 
15% of falaJ malaria cases are due to cerebra] malaria (eM) (Greenwood, 1999). 
resulting in brain inflammation, coma. convulsions. neurological complications, acidosis, 
hypoglycemia, and sudden death particularly among children and immunocompromised 
adults (WHO. 2000). Increasing migration, failure in \'«oor control and increasin8 
University of Ghana http://ugspace.ug.edu.gh
resiJCaDceofmaJaria parasite to currenl antimalarialshu increased tbe threat ofmaJaria 
_«lion. Recent studies in Africa and South East Asia show that acute: Of chronic 
inf111D11lMion usocialed with malaria is deleterious to braiD development of survivors 
and reportedJy impairs cognitive function even after treatment (Fernando el al. • 2003. 
Boivin. 2002). Malaria-induced brain inflammation is reportedly mediated by complex 
cdlular aDd immunomodulalor interactions of co-regulators including c)'tokines and 
adbcaion molecules. However the involvement of chemokines in brain 
immuopalbogenesis of this disease is still unclear. In this study, RANTES expression W8I 
upegulIted in plasma during malaria infection, implicating these molecules in 
immunopltboeencsil oftbe disease. 
1.1 RatioDIIleaadjustifkatioDofltudy 
Adbeiion molecules, eytokincs and cbemokines are involved in suppression of 
erytbtopocsis, _ blood brain bGrier (BBB) inflammation during parasite infections. 
Allboup adhesion molecuJes and cyrokines playa role in immunopathogenesis of eM, 
the mechanisms by which leukocytes, pl ...l ets and infected red blood celis are 
sequuaered have not been elucida&cd at the molecular level. Since chemok.inesdim:t1y 
infIumce leukocyles migration. it is plausible that they will influence sequestmioo of 
~ocyICS. platelets and lRBCs. Recent ftndinas iodicate that sequestration of 1euk0C)'tcl 
occuriDCM. 
University of Ghana http://ugspace.ug.edu.gh
Studies using rodent CM models have been criticized as not reproducing the brain 
pathology associated with CM in bwnans. In the P.Mrglwi model. the presence of 
platelets and monoouclear cells in brain venules finds a parallel in pediatric CM; platelet 
activation during parasite infection may entrap leukocytes which are recruited to distal 
brain microvessels where IRBCs are sequestered. In other studies upregulation of ICAM-
1 md VCAM-l adhesion molecules in Plasmodium yoelii and P.lrerghel ANKA suggests 
another parallel between human and rodent malaria pathogenesis. Recent data also 
indicates that experimental eM is induced in perfo rin-deficient CPFP-KO) mice after 
adoptive transfer of cytotoxic CDS+ T cells from infected mice. which were directed. to 
the brain ofPFP-KO mice. 'This specific recruinnent ofT cells might involve chemokine-
chemokine ~tor interaction. Other studies also indicate thai susceptibility to ECM is 
delayed mC CRS-knockout mice. 
Furtbennore. trafficking of inflammatory T helper 1 (Thl). but not Th2. cells into the 
brain it mediated in large part by RANTES interactions with CCRS receptor. 
Scquestntjoo.ofplateletsandleukocyteSinbrainmicrovascu1arurearealsolSSOCiated 
with eM immunopathology. Malaria enhances expression of CCRS on placenta in 
pregnant women. Chemokines and their corresponding receptors mediate malaria and 
CM conditions hence Wlderstanding the role of these inunune markers could enable a 
DC'W straIcgy for preventing or minimizing the outcome of eM and other severe fonus of 
tbedi!ICaSC. 
University of Ghana http://ugspace.ug.edu.gh
1.3 GenenlltypotbesiJ 
It is hypodlesiud tbat tbe chemokille RANTES and its cornspoDding rcc::epton 
CCRl, CCRJ and CCRS playa role lD malaria brain patbology and tbat bloddnc 
RANTES whitb is up-rqulaled i. tile brain duriDg CM could prevent or miDiDtize 
tbeOMtCOllleoftbedisease. 
1.4 Objectives 
Determine malaria·induced global alterations in immunomodul.tor gene 
expressioa in brain III peak parasitemia in Plasmodilllll yMlli 17X mouse model 
ii) Evalualc: temporal expression of the chemoltine RANrES and its correspondini 
receptOr.; CCRI. CCRJ. and CCRS in broin IUld RANTES in plasma during 
P.)IOfliil7Xmalariainfection 
ilil Evaluate effect of P.;W1ii 17X infectioa 00 mouse brain 
iv) Evaluate: retrospe<:tively, expression of RAN"rnS and receptors CCRl, CCRJ, and 
CCRS in post·mortem human cerebral malaria tissue samples 
v) LocaIiz< expre";o. ofhwnan brain RANTFS. CCRI. CCRJ and CCRS during 
CM 
vi) Evaluate RANTES expression in plasma ofmuriDC malaria model and rnafaria. 
vil1 Determine the fWlClional role of RANTES by anti·RANTES blOCking experiment 
Ftt-~ 
. Of~ role O~RANTES and its ra:eptors CCRI. CCR3 and CCRS 
uoopathogenesls of eM In particular and malaria in general will emerge after 
~lhisstudY. 
University of Ghana http://ugspace.ug.edu.gh
1.5 Approacb of study 
Figure 1: Approach of study; Utilize. cDNA. "'icro-array, RT-PCR, Weslern Blo/ 011( 
ELISA. to charQC1erlze and localize expressions of selected immunomoduJators includinA 
RANrES and receptors CCRJ, CCR3 and CCR5 In brain and plasma 01 murine malari, 
modIl and human !JOsf.I"Orle", CM tissue samples Electron microscopy mtt: 
itmrnlltOhlslology wue used 10 ewHuate 'he effect 01 P.yoe/il I7X inlection on mous, 
braill An/i-RANTES experiment was performed 10 analyze Ihe /unction of RA/Vf'ES it 
murinema/ariamodel. 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER TWO 
LITERATURE REVIEW 
2.1 Lite cycle or Plosmodium parasites, and tblt malaria dise-ase 
P/Q:ptfodiUl1f infected female Anopheles mosquitoes inject sporozoites into the 
bIoodsIream of the host dwing feeding. The sporozoites invade the hepatocytes where 
they \Ddergo maturation and multiplication catled Olo-erythrocytic schizogony. Some of 
the sporoZlOites enter mto a donnanl pbase called hypnozoite in P. Viral" and P.ovale and 
can reactivate and undergo schizogony at a later time resulting in a relapse, a 
pbeoomenonreferredtoasrecrudescence. 
In PJ okiptIrum. infected hepatocytes become enlarged, rupture and release schizonts 
(merozoites) toto the bloodstream (Figure 2A). The merozoites invade erythrocytes 
(figure 28) aDd undergo an asexual replication to form the trophozoites. The paruite 
breaks dowu the hemoglobin of infected erythrocytes releasing hemozoin as a by. 
product. Hemozoin bas been identified as a distinctive feature of blood-stage parasites. 
The end of erythrocytic stage is marked with nuclear division (Figure 28). Infected 
cryIbroc ytes rupture and release more merozoites. These merozoites invade new 
et)'Chrocytes and initiate anotber a.sextW replication. 
A percentage of schizonts (merozoites) differentiate into miao (male:) and matJO 
(&mile> gamet_es which when "'SOSI<d by fceding female Anophelu mosquitoes 
University of Ghana http://ugspace.ug.edu.gh
develop into micro-and macro-gametes respectively (Figure 2C). The microgamete fuses 
with the macrogamete forming a zygote which develops into an ookinete. The ookinete 
migrates across the mosquito midgut wall and matures into oocyst within the body cavity. 
The oocyst undergoes asexual replication called sporogony which results in the 
productiOD of loIS of sporozoites. The oocyst ruptures and releases the sporozoites which 
migrate to the salivary gland of the mosquito ready to be transmitted during the next 
feeding cycle of the vector (Figure 2C). 
University of Ghana http://ugspace.ug.edu.gh
SoW'ce: www_dpd.cdc.gov/. " , M~RJMalanai body_Malaria ""page I JlIm 
Fipre 2: LIre cycle or b ....a o malaria parasite 
University of Ghana http://ugspace.ug.edu.gh
The clinieaI symptoms of maJaria infection including clUlIs., vomiting. convulsion. 
headache and drowsiness bas been associated with the rupturing of infected red blood 
cells (ROC) during the eryt1uocytic stage of the life cycle. The simulww;ous rupturing of 
parasitized RBCs and the release of parasite antigens and waste products is associated 
with the intermittent fever paroxysms comm\}n1y seen in malaria episodes. The rupturing 
of infected ROC is synchronous with the incidence of the disease. The typical pattern of 
fever with febrile episodes every 48 or 72 hours of Plasmodium infection is associated 
witb the cyclic maturation of asexual stage; nausea and vomiting with fever spikes 
coincidewithruptureofinfectedRBCs. 
Eacb stage of the life cycle of the parasite is associated with species-specific proteins 
expressed OIl the surface membrane of the parasite, which appear to be targets of the: host 
immune mponse. These species-specific proteins tend to be antigenitically variable and 
highly polymormopbic (McCutchan el al.. 1988). Notable among the malaria induced 
proteiDJ on RBCs surface membrane is the Plamodiumfalciparum erythrocyte membrane 
proleW (PjEMP) which have been implicated in adherence of infected RBCs 10 
CDdotbeIial ceOs as well as non-infected RBCs leading to erythrocyte rosettes (Baruch el 
aI., 1996). lnIcmaJ. antigens released from infected RBCs during rupturing triggers the 
C)1okine cascade of the immune system leading to much of the symptoms and 
immunopa1bogenesis associated with the parasites (Taverneel al., 1990). 
10 
University of Ghana http://ugspace.ug.edu.gh
2.2 Global epidemiology oemalaria, and economic development 
At present. 11: kast falciparum malaria annually infects )00 to 500 million people and 
causes over 2 million global deaths (WHO. 20(0). Malaria is Africa's leading l:aW!e of 
under-five mortality (200/e) and constituSes 20-50% of the continents overall disease 
burden. Il accounts for 40% of public health expenditure, 30-50% of inpatient 
admiJaiooJ., and up to 50% of outpatient visits in areas with high transmission (Roll Back 
Moloria.2002). 
MalW is seoerally eodemic in the uopiCl, with extensions into the subtropics. 
Distribution ~ greatly from country 10 country. More than 90% of all malaria cases 
occur in Africa. Approximately 10'1e of malaria is concentrated in other countries such as. 
Iodio, Brazil. Sri-Lanka. Afghanistan. ViellWJl, Cambod;a, llWlond, 1n000es;a, sod 
ChiDL The disease is endemic in 91 countries worldwide (Figure 3) (WHO, 1996). 
University of Ghana http://ugspace.ug.edu.gh
Sow-te: http://www.ponmc.inlfil-freelvcrcJmalana3.html 
Fipre3: Global distribution of mall ria 
12 
University of Ghana http://ugspace.ug.edu.gh
Malaria affccts the health and we.llb of nations that are endemic to this disease. The 
diIeasc IS responsible for 44 million disability adjusted life years (OALV a) in Africa 
(WHO. 1996).11 is estima1ed thai malaria accounts for a reduction of 1.3% in the annual 
economic growth rate of endemic coUOlries.. and that me long-term tmpac1 in these 
couotries is a reduction of gross national product (GNP) of more than haJf (Sachs & 
MaIaDcy .. 2002). In Africa. maJaria accounts for up to one-third of all hospital 
admissions aod up to one-fourth of all deaths of children under the .ge of 5 (Greenwood, 
1999). MalIria is a significant cause of poverty in developingcoWltries especiaJly Africa, 
aad_ameasurabledirectandi.ndiRctCOSl. ltisalsoresponsibJefor.major'cOftStraint 
to CCOIlOmiC development (Table 1). The direct costs of malari. include expenses 
incurred on individuals and public expenditures on both prevention and treatment of the 
discuc. The cost of malaria _nl ""'8'" from US$O.80 10 USSS.30 depending on 
IOCII drug resistanee. In countries with. heavy maJaria burden. the disease may account 
for II much II 400,1, of public health expenditure, 30-SO';' of inpatient admissions. and up 
10 50% ofOUlpMieot visits (www.who.inVinf-fslenllnfonnationSheet to.pdf). 
The ind.ir«t coIlS ofmaJaria include loss of productivity or income associated with 
illoeu. A bout of malaria is estimated 10 cost 10 working days, adding. to the ecooomic 
burden. 
AIIDDIlccoDOmicgrowtbincountriawithbigbmaJaria transmiasioDbas been estimated 
lObe lower tbin COWltries without maiari .. Regrcssionanaiysisuaingcrou-coururydall 
between 1965 and 1990 confirmed the relationship between malaria aod economic 
growth. DcpeodiDg OD a coUDb)"s poverty. economic policy. tropical location. and life 
13 
University of Ghana http://ugspace.ug.edu.gh
expocaancy among other facton, coWlmes wilb intensive malaria incidence recorded an 
~ growth of 1.3% less per person per year. while a JO'ID reduction in malaria was 
asoociMed with 0.3% increase in growth (Gallup &: Sacbs, 2001). Sachs and Malaney 
(2002) demonsb"lted the link between maWia in a country and that country's per capita 
gross domestic product (GDP) and argued that there is an inverse relationship between 
the two and tbat malaria causes underdevelopment. The totaJ cost of malaria in terms of 
hulth care. treabnenl, and loss of productivity in Africa is estimated to be USS2billion 
per ~ (WHO, 2000). Malaria may also impede the flow of trade, foreign investment 
and commerce, thereby affecting a country's economic growth. 
14 
University of Ghana http://ugspace.ug.edu.gh
Table 1. Loss from tbeeconomic growth penalty of malaria endemicity in 31 African 
countries. 1980-1995 
Aggregate loss Per person loss Mafractionof 
~ (millionsofPPP- (PPP-adjusted1287$) actual 1995 
adjusted 19875) ~ 
)172 2)4 18% Beoin 5% 
BoISWWlll 503 347 18% 
BurkinaFaso )684 162 
730 117 18% BUJUIllli 18% 
Cameroon 4227 318 
CenttalAfrican 884 270 18Y. 
Republic 
Chad 995 154 
17% 
18% 
Congo 759 288 
Congo. Oem. Rep. 7125 162 18% 
CoIed1voire 4107 294 18% 
Goban 1389 1290 17% 
Gambia 251 226 18% 
Gambia 25) 226 18% 
Ghana 5355 314 18% 
Guinea Bissau 152 142 14% 
Kenya 5272 198 18% 
Leootho 0 0 0% 
Madagascar 2280 167 18% 
Malawi 1072 110 18% 
Mali 1222 125 17% 
Mauritania 611 269 15% 
Mauritius 0 0 0% 
Namibia 832 539 10% 
Niger 1457 161 17% 
Nigeria 17315 156 18% 
Rwanda 656 102 18% 
Scoepl 2426 286 18% 
Sima Leone 366 87 17% 
South Africa 4056 98 1% 
Togo 1166 285 180/, 
Zambia 1359 151 18% 
Zimbabwe 4214 383 18% 
TOIIII 73618 185 IO~ 
Sourte: Malaria Foundation International. Based on results in Gallup J. and Sacbs J. • 
"The Economic Burden of Malaria" in Economics of Malaria. Figures are reported in 
""",basing power parity (PPP) adjusted dollar.; held constant at 1987 prices. 
15 
University of Ghana http://ugspace.ug.edu.gh
2.3 CUrrellt Itnt~es for malaria ('onlrol 
2.3.1 Tbe use or anti-malarial drugs and Ibeir discovery 
Anti-malarial drugs prevent symptomatic blood stage asexual infection of malaria and are 
used fOf oon-immune people wbo stay for a short time in malaria endemic area, pregnant 
women who are more susceptible to the disease and blood schizontocides in infected 
individuals. 
Therapeutic use of drugs against malaria prevc.:nts development of asexual blood stage of 
the plftiite. The discovery of drugs for malaria treatment bas been through several 
appro«:hes: 
a) Consider natural compounds such as quinine and artemesia 
Quinine, derived from a plant- the bark of the cinchonatrec has been widely used (or 
t:reatiD& malaria since the ITli and 18111 centuries. Artemesinin is also a drug against 
ma1W derived from plant in China and has also been effective against the malaria 
parasite. Though the mechanism of action of these compounds is not very clear, they are 
believed to be responsible for inhibiting haem polymerization in the parasites. Haem is a 
by-product of haemoglobin degradation and is toxic to the malaria parasite if it il not 
polymerizod. Quinioe and artemesinin are believed to inhibit this process thereby leaving 
tbe toxic baemoglobin degraded product to kill the parasite 
16 
University of Ghana http://ugspace.ug.edu.gh
b) Scmening lap numbel'5 of potential compounds 
Screening of lIrgc numbers of compoWlds led to the discovery of cbloroquine, one of the 
cheapesl and effective drugs against malaria for years. Mechanism of action of 
chloroquine is unclear but it is also believed to interfere with haem polymerization, 
c) lcokingal cbemica1lyrelated compounds 
By looking for chemically related compounds, other quinoline compounds were 
discovered including metloquine (lariam) and amodiaquine which are used primarily IS 
propbylaxiJ against maJaria parasite, 
d) By studying the metabolic pathways in the parasite 
Follle,-hway inhibilOrs 
Some of the lIItimaIarial drugs inhibit folate metabolism, Inhibition of two key enzymes 
in the folate metabolic pathway typically inhibits the parasite's growth at concentrations 
thai have no detectable effects GO host cells. Pyrimethamine (Daraprim) and Proguanil 
(Plludrine) are anti·malarial drugs which inhibit dibydrofolate reductase while 
sulpbooamides and sulfones (Dapsone) M ~11 as Fansidar (pyrimethamine·sulfadoxine) 
inhibit dihydroptcroate synthase enzyme in the folate metabolic pathway, 
ii) Inhibitors of pyrimidine synthase-dehydroorotate dehydrogenase 
Inhibitors of dihydroorotate dehydrogenase including 8-aminoquinolines such as 
Primaquine wbich is used for cure of relapsing P.vi\Iat"·tissue schizonts and also as 
pmeIOCytOcidai against P/ alciparum and Alovaquone are effective drugs for controllina 
17 
University of Ghana http://ugspace.ug.edu.gh
ill) Protein inhibitors 
Since degraded blemoglobin products provide amino acids for malaria parasite. 
inhibitors ofMemoglobin degrading enzymes like Plasmepsin I and U (aspartic 
proteinase) aod Fakipain (cy§teine proteinase) are used to control malaria infection. 
iv) Phosphollpid metabolism inhibitors 
PbospbolipKi metabolism inhibitors which target blockage of choline transporter are also 
UIed for malaria parasite control. 
2.3.2 Vector control 
2.3.1.1 Ule ofoeh and insecticide treated bed nets 
Tbeobjective oftbe malaria vector control strategy is to reduce malaria monality and 
morbidity by redUClng transmission of the disease. Vector control strategies include the 
use of insecticide impregnated bed.nets, indoor spraying of insecticides, personal 
protection measures, larval and environmental control. Dichloro-dipbenyt· 
tricboloroethane (DOn was previously used in the 1960s as an insecticide for malaria 
vcctorcootrol but because ofvcctorresistancr: and its residual effect intheenvironmeot. 
its usage has becn discontinued. 
Cum:ntly pyrethroids including deltametluin and lambacyhalothrin are the insecticides of 
choice and are effective at far lower doses with very minimal or no residual effecl 
compared wilh DDT. A popular application of pyrethroids is in the impregnation of 
bcdaeb(Curtis, 1997) so as to add a chemical barrietta the imperfect physical barrier 
..-edby .... net 
18 
University of Ghana http://ugspace.ug.edu.gh
1.3.1.1 Larval coDtrol 
Some oftbe strategies for mosquito larval control include: 
Preventing mosqwto breeding in stagnanl waters 
Stocking the breeding sites of mosquitoes with larvivorous fish such as Guppies 
The use of bacterial toxin from Bacillus thuringiensls (BT) at the breeding sites as 
a mghJy specific agent agaiDst mosquito larvae 
SiNations where irrigations are camed out in carefully regulated intermittent 
schedules. such that fields are dried once a week. to prevent the complete larval 
cycle. 
1.4 Cliaicalmaoifestationsandpathogeoesisofmalaria 
1.4.1 Uacomplic.trdmalaria 
Prescotation of uncomplicated P./ofciparum malaria is very variable and may resemble 
thai of many other diseases. Non-immune patients with Wlcomplicated malaria are prone 
to the development of severe life threatening malaria complicatio~. Although fever is 
very common in uncomplicated maluia, it is abscm in some cases. The fever is initially 
persistent ralbet thaD tertian. In addition symptums such as rigors, headacbe, sweating, 
tim:IDess. lossof.ppetitc and nausea may arise. 
University of Ghana http://ugspace.ug.edu.gh
1. ... 2 C_plkated or Jevere malaria 
I( P. fDlclt>tr- maIoria is not promptly diagnosed ond trealed, the cJini<:aI picture 
maydeCcriorate rapidly. often with serious and severe consequences. Severe malaria is 
de60ed as parasitaemia ofbigher than S%. a haemoglobin of less than 6Wdl.lpoDtaneous 
bypoalyclelDia Of major Ofsan dysfunction. puticu1arly cerebral malw. Most people 
who haw P. foJcipill1Dlt parasites in their blood usually suffer from uncomplicarcd 
rnaa.ria AIIOCiaIed with he.tacbe5. fever. chills. IDd weakness with muscle pains. 
However in • small minority of cases, severe and life threatening complications sucb Ai 
enbqement of spleen and liver (spleno-bepatomegaly), ~idosis (acidic blood), 
bypDBlycemia (low blood sugar). kidney failure. severe anemia and cerebral malaria may 
Spleno-hepalomeply, results from lysis of hepatocyte! during schizogony in the liver in 
addition 10 massive immune response to the malaria parasites. One of the outcomes of 
bepuomeply is jllUDdice. Cytoadbcrente of parasitized RBCs coupled with deposition of 
maa.ia puasite pigments and induction of proinflammalory cytokines in the spleen bave 
been ~ in splenomeply (MasbaaJ, 1986) 
Malaria acidosis also referred 10, as; hyperpnea is lIiOCiated with respiratory 
dislurbances. The source of this complication is unknown but it is known 10 be 
n:spoasible (or most childhood maJaria deaths (English ./ al., 1997). 
20 
University of Ghana http://ugspace.ug.edu.gh
1D areas of low trmsmission. hypoglycemia. anemia and convulsion are common in 
children. HypogJyoemia is the outcome of low blood sugar in PJ aJcipmum infected 
per5OO- Though direct parasite products and human immune response have beeP 
implicated in this condition, the mechanism involved is still not clear. About 38% of 
infcctcd children die ofbypoglycemia related complications (ChogIe, 1998). 
In most cases, cytoedhereoce of parasitized RBC 's in glomerular capillary walls of 
infected adull mullS in kidney damage and renal failure (Mehta et aJ .• 2001). Acute reoal 
failure occurs as a complication of Pj alciparum in less than 1%  of cases but mortaJjty 
rate associated with this complication is estimated to be 45% (Saroj et 01.,2002). 
Tbouptbe iDc:ideooc of fever and dulls have bcen associated with the lysis of infected 
RBe's during the erythrocytic stage of the parasite's life cycle, it is still unclear why only 
some episodes of malaria infection in non-immWle and semi-immune individuals results 
Lncomplicatioos. 
2.4.2.1 Severt: ••l aria anaemia 
Se-Yeft malaria anaemia is a result of hemolysis of parasitized RBC·s. This complication 
is common in children between 1-2 years old. This complication is one of the principal 
IDIIlifestuioDS in areas of high stable tran.smllrlsion. Non-parasitized RBC's exhibit 
deformability which causes more to be taken out by phagocytes in the spleen. This in 
Iddition 10 suppression of bone marrow and erythropoiesis results in anaemic conditiOftl 
inpatients. 
21 
University of Ghana http://ugspace.ug.edu.gh
1.4.2.1 Cerebral malaria (eM) 
Cerebral malaria (eM) is defined according to establiihed World Health Organi23tion 
guidelines as Glasgow Coma score of II or less in adult or Blantyre coma score of S or 
less in children during the episode of severe malana (WHO, 2000), other causes of 
UDCOnac:iOU5llC$ssuch as hypogiyc:emia, meningitis or omer encephalopalhy having been 
cx(:luded by clinical, biochemical, and cerebrospinal fluid (CSF) examination. Glugow 
or Blantyre coma iCOI'e iI a sooring system used in quantifying level of oonsciOUSDeSS 
following IraUmaIk brain injury or during P' /alc.pClrum infection. 
It coasists of three parameters: best eye responsc. best verbal response and best motor 
response given as: 
No eye openina: 
Eye opening to pain 
ByeopeningtoverbaJconunand 
Eye openiD& spooIIDoously 
Bel Vqbt! Respang M 
Noverbolresponx 
IncomprehensiblesoWlds 
!nappropri ... wonIs 
Coafuscd 
8qI MwuRpponse fMl 
No Motor Response 
Extension to pain 
Flexion to pain 
Witbdrawal from pain 
22 
University of Ghana http://ugspace.ug.edu.gh
Locali7Atioo 
Obeyaco .....d s 
TotaJ 9COre "'E+V+M 
A total score of 13 to 15 indicates mild coma. A score between 9 and 12 indicates 
moderate coma, and a score of 8 or less indicates severe coma for Glasgow score (Jennett 
et 01 .. 1976 & 1978). The Blantyre Coma Scale. a related diagnostic tool. is used for 
children. A coma score of less than 3 indicates cerebral malaria infection. 
Cerebral malaria (eM) complications are associated wilh seizures. convulsion, severe 
headache. drowsiness, bebavioral changes and ultimately coma. lbis complication is 
common in areas of inlenninent malaria transmission. Children below the age of S and 
QOO-imnnme individuals usually suffer from eM incidence. About 15% of eM patients 
die of the disease (Mtwi el 01., 2003). It has been hypothesized that the neurological 
mIIlifeswjoos of eM are due to either sequestration of parasitized RBCs to the 
microvascular endoIheliaJ cells or induction of proinfammatory molecules. 
Sequestration refers to the cytoadherence of trophozoite and schizont parasitized 
e:rytbroc:yteslOcndothelial cel1s. This leads to mechanical blockage (cerebral ischaemia) 
in the distal microvessels in the brain and subsequently limits the supply of oxygen, a 
condition referred to as bypoxia The parasite can also induce localized metabolic effects 
such as hypoglycemia. The bypoxia and metabolic effects would then cause coma and 
other neurological complications and death. Cytoadbereace involves receptor lipDd 
PltmIIOdium /alciparum erythrocyle membrane proteid- I (PtEMP-I) 
2J 
University of Ghana http://ugspace.ug.edu.gh
expressed as an induced proteiD on parasitized erythrocytes have been implicated as a 
I.ipnd. which binds to parasite's induced host endotheJia receptors such IS IeAM-I, 
VCAM.l and CD 36 (Udomsangpetch et 01., 1997). PjEMP-I is a member of a bighly 
vlriable(var)gene family with 40-50 different genes. This antigenic variation associated 
wi1h PjEMP-l allows the perasite to evade the immune system and may also be 
te5pODSible for differeoces in disease outcomes 
Others have suggested that coma which is associated with eM is mediated by short-lived 
molecules such M TNF-a and nitric oxide thai affect cerebral functions. In this 
hypothesis. malaria antigens stimuJate TNF-a production, which induces nib'ic oxide. 
TheleproinflammatorymoJecuJespartly induce the pathological effects associlted witb 
eM. Nitric oxide is known to affec1 neuronal function and, may lead to intracranial 
bypertensionthrough its vasodilator activity. It has been postuJated that, the sequestration 
and the proinflanunatory moJecu!es hypotheses are not mutuallyexc)usive and that both 
phenomenon mediate eM pathogenesis. Thus anllgens released by rupture of parasitized 
erythrocytes stimuJate leukocytes such as macrophages which secret TNF-a which in 
tum upreguJatcs expression of TCAM-I on brain endothelial cells (Porta et al., 1993). 
This eventuaJly leads to increase in binding or infected erythrocytes and increase in 
effects whether they are due to vascular blockag..:, soluble mediators or metabolic effec:ta. 
24 
University of Ghana http://ugspace.ug.edu.gh
2.S lm ••a ityto ••l ariaillfcdioD 
In malaria stable endemic regions. Pj oJciparum parasitemia and its associated clinical 
disease is most common in children and non-immune aduJts. In The Gambia for iastaDce. 
where P laic/porum transmission is highly seasonal but relatively stable from year to 
y• • parasite rates do not begin 10 decline until the age of 10 to 12, whereas the 
i..ac:idcDce of clinical di!JtaSe. that is fever which is associated with malaria puasitemia 
peobal age 6 {Riiey .,al.,I990}. 
Not all people infected with the malaria paraiite in endemic areas exhibit clinical 
symptoms.. Healthy individuals are found with parasites in their blood without cllnical 
S)'IDp&OmS. The iocidcoce of parasitemia dcc::lines gradually with age. This pbenomeoon 
is iDlerpretcd as a steady acquisition of specific immunity to malaria (Barragan tl al. • 
1998). Immunity to malaria is the ability of the individual to control parasite 
multiplication. which can occur at either the pre-crythrocytic (hepatic) Slage or during the 
erythrocytic staat or minimize clinical disease outcome. Antibodies directed against the 
tDIjor lUlfacc ptC*in of tbc: sporozoite called the circwnsporozoite protein. (CSP) can 
inhibit their entry into liver cells (lIollingdale ~I ai., 1984). The: precise pattern of 
immunity 10 malaria depends 00. local patterns of malaria transmission and also the 
dqree of endemi4::ity. It is s:ugestcd lhat muillple infections seem to be necessary 10 
achieve effective anti·parasite immunity. Though l"eiistance to infection with malaria 
i.acraases witb l8e in individuali livmg in endemic regions. it can take severaJ decadCl 10 
racb optimal protection. which may sometime never attain. Because immunity to 
malaria has been fow.d to depend OD both parasite transntissionl and age, it has been 
25 
University of Ghana http://ugspace.ug.edu.gh
hypothesized thai the malaria antigens that induce protective immune resPODK might be 
pooriyimmunogeniC. 
The malaria antigens reportedly exhibit polymorphism; variation between different 
straiosoftbe parasices as well as variability (changing within strains in line) (Felgeret 
d., 1997). Thcrdore immWlity 10 the parasite requires accumulation of immWlologicaJ 
memory to a large number of different antigenic epitopes before substantial protection is 
acb.ined. Cum:ntty the slow dew:topment of immunity to malaria is explained by two 
mainbypotheses; 
a) Antimalarial inununity is essentially stram specific, and effective immunity is not 
acbined UDtiI the individual has been exposed to all the major antigenic variants 
cimllating wilhin Iheoommunity (Day & Marsh, 1991) and 
b) Acute lDIlIaria is auoci.Med wilh immunosupression, which hinders the 
development of protective immune response (Cohen el 01 .• 1961) 
ADtibody-dependent and antibody-independent immune effector mechanisms have been 
implicated in oaturaIly acquired protective immunity to malaria. The ability of antibodies 
10 confer immuruly against malaria parasites in both P.falciparwrr and P. v#Vca i.J apparent 
from the prolection afforded to neonates sod infants by maternally deriVed antibodies 
(Edoz:ien el al. . 1962, Logie et oJ., 1973) and from clinical treatment trials with immuoe 
serum or purified immWlOglobulins (Cohen el of .. 1961. McGregor et al. • 1962). Also. 
26 
University of Ghana http://ugspace.ug.edu.gh
researcb conducted using rodent maJaria models with the transfer of whole immune 
serum or purified immunoglobulin to naive animals indicates substantial modification of 
the course of blood stage infections. reduceJ peak parasilemia. and spontaneous 
resolWooofinfection(Holder, 1988) 
Unlike antibody«pendent or humoraJ inunW1ity. less is known about cellular immune 
response to malarial infection. Studies using mwine modeb indicate that T-cell 
dependent immune mechanisms are crucial to the development of effective antimalarial 
immunity. For example. immunity against Plasmodium yoelii depends on the cooperation 
of immune T aDd B lymphocytes {Mogi! ~I aJ., 1987} while inununity 10 Plasmodium 
chaboudi adom; appears to be antibody independent (Gnm el ai., 198]). Direct killing of 
infected hepe.tocytes by cytotoxic: T lymphocytes (en) appears to be mediated by major 
histocompatibility oomplex class 1 (MHC·J)-restricted recognition of sporozoite or liver 
SIa&C antigens presented on the swfa.ce of infected liver celb in experimental murine 
syilems {Kumar tl al.,I 988}. Sporozoite and liver stage antigen-I (LSA-I) specific: en. 
ICtivily has been demonslralcd in ~';Iro using peripheral blood lymphocytes from people 
with prior exposure to malaria (Malik elol.. 1991 , Hill, eta!., 1991) but. at present. it is 
DOt known whether such mechanisms contribute to protective immunity in humans. 
Since matw'e erythrocytes do not express MHC antigens, T cells are believed 10 fulfill 
two major functions in inunwUty 10 erythrocytic parasistes, by providing help for 
llllibody production and producing cytokines which aclivate macrophages to 
~ infected erythrocytes and kill malaria parasites. Followilli activation by 
27 
University of Ghana http://ugspace.ug.edu.gh
ioieTferoo gamma (INF..y), phagocytosis occurs via much more efficient Fc receptor-
mediated parasice binding (Brown etal., 1986). 
Though macrophage-produced tumor necrosis faclor-aipha (fNF-a) reportedly plays I 
role in the pathogenesis of acute malaria, itis aJso believed to mediate parasite killing 
(Clark &;. Cowden 1992). A potential mechanism for TNF-mediated parasite killing may 
be via induction of nitric oxide, (Rockett el oJ .• 1992) wbich bas been implicated in 
mwine inununity to Plasmodium berghfi (Nussler el 01 .• 1993). 
Wbcther T cell-mediated immunity to blood stage malaria predominates over antibody-
mediated or vice versa is still unclear. Though several merozoite-specific antigens have 
been identified, the best characterized arc the major Plasmodium Ja/ciparum merozoite 
sudace proteins (PfMSPI) (pn95) (Holder. 1988) and PfMSP2 (Pf48-53) (Smythe" 01., 
1990) aDd the ring-infected erythrocyte surface antigen (RESA; Pfl 55) which is 
dcposiled lido lilt erythrocyte membrane during invasion (Cowman el al., 1984). 
Antibody-medilded immunity to these antigens and a number of other defined antigens 
appear to correlate with population level of acquired immunity, but this association does 
DOt always prove ttue at the individual level. Levels of antibody to parts of PfMSPI in 
Obanaiao children reportedly did not correlate with protection from clinical malaria 
(Dodoo elol., 1999). However cellular proliferation and INF·y responses to PfMSPI 
appeartobeassociatedv.ith resistaneelociinical disease and bigb parasitemia(Riley~1 
aI.,I992). 
28 
University of Ghana http://ugspace.ug.edu.gh
2.6 Central nervouS system (eNS) and malaria 
Tbebrain is the control cenrerofthebody. Different areasoftbe brain control functions 
in diJ}'ereot parts of the body. Infectious pathogens modula!e these fwtctions depending 
OD the pet of braio they infect (Shrestha t l al., 2003. BitTate el al., 2003). For instance, 
the braiD is one of the most prominent targets of buman immunodeficiency virus (lHV) 
infection,. where it leads to mv encephalitis (HIVE) and HIV -associated dementia (price 
"01. • 1990). 
Knowkdge of the distribution. physioloi!Y. and pathology of immune mediators in the 
brma is fundamental for understanding the pathogenesis of the interaction between 
diseaeeausingpathogensandtbeCNS. 
Malaria infection of the CNS by Plasmll./ium parasites (CM) is associated with at least 
2.3 millioo deaths annually. from an eslimated 400 million cases each year worldwide 
IDd is the le.ding cause of hospitalization, mortality. and morbidity of children under five 
ya:rs in sub-Saharan Africa (Turner, 1997). The neuropathology of eM is characteri:md 
by neW'Ological abnormalities precipitated by oedema in the brain. The cause of these 
complicatioos is not very clear but it is known to beassocillted witb the malaria parasites 
blocking cerebral capillaries and obstru~ting microcirculation causing necrosis in the 
braiD (Groce el al~ 1997); 8-' well as irlduction of proinflammatory molecules by the 
JW&Site. Although the mechanism of action for the pathogenesis of eM suagests global 
aodpossiblydiffuseCNSinvolvcmenl, il is diffusc and difficult to preci5ely cbaraclerize. 
Studies of CM cases from Vicmam :ohow differenlial rates of sequestration within 
29 
University of Ghana http://ugspace.ug.edu.gh
differenc areas of the brain (Sein el al• • 1993). while axonaJ iojury reportedly occurred in 
the cerebral cortices IDd cerebellum Cor11pared to the mid·brain structures ortbe brain 
.... (Medana<tal.,2002). 
Diffcn:ol regions of the brain such as ccrebrum. cerebellum and brain stem have been 
impltcated in neurological associated disorders. Analysis of postmortem samples of 
victims of malc'ia revealed higher sequestration of infected RBe's in the cerebellum than 
lbe cerebrum (Sei.n et aI., 1993). This explains varied neurologic manifestations that 
rauh from brain dysfwlction in human ... ~rebral malaria. However. it is no! clear wby 
certaiD regioGa of the brain are more slI'>Ceptible to malaria infection than others. The 
mechanism involved in eM neuroropathology is also unclear. 
eM factors predictive of neurologIcal sequelae are prolonged coma, protnM:ted 
convulsions, ICvere anemia and a two phase clinical course in which a patient recovers 
CODXiou:soess ooIy to be followed by r~'"unin8 convulsions and coma (Brester et al .• 
1993). Loolr.i.ng at the seriOU$llCSS and Ii I~ -threatening natw'e of CM including intensive 
oeuropa1bologieal cerebrovascular eff'cch. it is asswned that the incidence of the disease 
duriDg a critical period of brain developm('nt and orpnization as it occurs predominantly 
in children. will impact those brain system" which are most vulnerable to cerebrovascular 
damage. 1'bcx vulDerabk regions may support attention capacity, memory aDd cognitive 
ftmctjOOSandtbatanyneuropsychologicai sequelae forCM will involve these abilities to 
8 val)ing degree. 
30 
University of Ghana http://ugspace.ug.edu.gh
2.7 Immunc medialon or malaria in mouse models. human and primale 
2.7.1 ImlAUDe mooiaton or malaria ill OlOvse models 
2.7.1.1 Thc role or adbesioa moleeales 
Adhesion molecules are a diverse ramily of extracellular and cell surface glycoproteiDJ 
involved in «11«11 andcell-extracellular matrix adhesion, recognition, activation. and 
migration. Some oftbese molecules are calcium dependent while others are DOl. 
Cakiwn dependent adhesion molecules allO called c;:adherins are involved in cell to cell 
adhcston. Almost all vertebratesexpre5S cadherins. Cadherinsconnect cells together at 
Cdl to cell SlII'fKc carbohydrate biodang proteins also f:allcd seleclins bind to specific 
oIiJOSllCCbarides 011 lIlother cell an the presence of calcium. P-selcctin is an example of. 
selectin which allows wrute blood cells to band to endothelial cells. 
Intepins are another clasi of adhesion molecules which mediate c;:ell to cell binding. 
Integrins are tr'imSJDembrane binding glycoproteins and they also bind cell. to cellular 
IDIIrix IDd .-e calcium dcpeodent. 1ntegrins 011 wlUte blood cells allow tighter binding to 
codotheIiaI cells berore they migrate out of the blood stream 10 tissue. Leukocyte factor 
associated antigen (LF A-I) on white blood cells i. an example of this class of molecule. 
NoD-Calcium dependent cell to ceO binding molecules helona to the immWloglobulin (Is) 
superfamily . Neuronal cell adhesion molecuJes (NCAM's) and interceliuJar adhnion 
moIecu&es (lCAMs) are examples of non-calciwn dependent adhesion molecuJes. 
31 
University of Ghana http://ugspace.ug.edu.gh
Murine cerdnJ malaria studies have rohown that cytotdhercnce of parasitized RaC via 
adhesion molecules tncluding intercellular adhesion molecule 1 (ICAMI), vascular cell 
adbcIioo molecule 1 (VCAMl), and cluster of differentiation 31 (COli) plays an 
~ role in the pathogenesis of the disease. lmmunostaining for ICAM.' for 
instaDct: revealed .. increase in expression of this protein in the small venules aDd 
capiJlIries of the brains of P.yoell/ infected mice (Shear ~l DI .• 1998). 
Although rCAM·l and VCAM·I for example, bave previously been implie81cd in 
teqUCStratioa d1l'iD& ECM. recent cxperimental mwine microcirculatory cvidence 
indic8tes involvement of ICAM-I , but DOt VCAM·I . in the sequestration of IRBCs (KauJ 
.,01,, 1998). 
Recent findings also indicate that inhibilion of P-selectin (platelet adhesion molecule) to 
the bnlin microvucu1ature proICct$ against development of experimental maJaria brain 
pathogenesis (Sun n oJ .• 2003). 
32 
University of Ghana http://ugspace.ug.edu.gh
2.1.1.2T.eroieofeytokines 
Cytokines are noa-antibody proteins secreted by inflammatory leukocyteS and some non-
leukocytic cells that act as intercellular mediators. They differ from classical hormones ill 
that they are produced by a number oftissuc or cell types rather than by specialized 
glands. They genetally act locally in a par1lcrine or autocrine rather than endocrine 
mamer. Cytokines made by lymphocytes are called Iymphokine. while those made by 
monocyteS are refernd to as monokine. Cytokines with chemotactic activities are 
collectively referred to as cbemokine and those made by one leukocyte and .-L.;tLJlg nn. _. ~ 
OIherleukocyt .. "",callcdint. .l eukins. ~'J~ 
0\ , 
~'>.-, ...; 
The potential of cytokines as pathogenic elements of malaria can contribute directly, I, A" 
iDdirectlyto many pathological processes associated with the disease. Rodent malaria 
models have prO\;ded further evidence of the imponMt role of inflanunatory processes in 
the development of CM (Brian & Riley. 2002). Cytokines such as interferon gamma 
(INF'''f). interleukin 12 (IL-12) and tumor necrosis factor alpha (TNF-a.) have been 
implicated in the pethogenesis of eM. Studies with knockout mice infected with 
PlartrtOdill1lf btrgMi ANKA have revealed an essential requirements of INF-r. and Q....12 
in thedeveJopmentofCM (Rudin el aJ., I 997, Yanez et al. . 1996). 
lD malaria models in which INF-y and n. ... 2 display a dominant pathological role. a 
pootcctivc effect bas been demonstrated by lL-10 (Tran et al .• 2000). Neutralization of 
anti-inflammatory cytokine (lL-I 0) in vivo has been sbown to increase the percentaae of 
mice with CM in • CM-resistant strain CKoaodo et al.. 1997). In the cue of TNF..a.. 
33 
University of Ghana http://ugspace.ug.edu.gh
allhoug.h it rcponcdIy plays 8P important role in CM peLhogenesis. there was 
coandictina findings with TNF-a knockout mice infected with P.yoeUi parasites. These 
anim81J pve slighdy higher levels of infected erythroc:ytes. but their susceptibility 10 
dealh from this infection wa& not observed (Shear el 01., 1998). It wu therefore 
coocluded lhat thouab TNF-a may play a role in CM pathoaenesis. it is Dot absolutely 
2.1.1.3 The roleohbemokines ••d  receptors 
Chemokines constitute a superfamily of small (8-16 kDa). soluble. pro-inflammatory 
pro&cinJ produced and secreted by a wide variety of cell typc:sduring the initial phase of 
boll re:tpOOiC kl injury. allergens, antigens, or invading microorganisms. They are 
involved in I variety of immune and inflammatory responses, acting primarily • 
c~andactivatol'3ofspecifictypesofleukocytesandotbercelltypes. 
The chemokmes have been classified into alpha (C-X-C), beta (e-C), gamma (C) and 
delta (C-X)...c) based on the relative position of their first N-tenninal cysteine residues 
(Figure 4). The alpha chemokines (C-X-C) have a sinale amino acid inserted between the 
first IDd second of their four cysteine residue. wbcreu these cyste:ines are nol separated 
in the beta IJ'OUP (C..c). The gamma (C) chemok.ines bave onJy onc pair of cyteine while 
in the delta cbemokiDcs C-X)-C, the firsI two cysteines are separated. by three amioo 
.ada. The S)'StemIIlic name of cbemokines is designated as CXCL, CCl. XCl. aod 
CX)CL baed on each class (Table 2) 
34 
University of Ghana http://ugspace.ug.edu.gh
Table 2: (hcmoklne nomenclature 
~YmMAllt ~AMF. ORIGINAL NAME ~ 
ar Cbemokiues 
CXCLI GROo CXCR2.CXCR 
CXCU GROp CXCR2 
CXCU GROy CXCR2 
CXCIA PF4 Unknown 
CXCU ENA·78 CXCR2 
CXCL6 GCP-2 CXCRI. CXCR2 
cxeL7 NAP-2 CXCR2 
cxeL3 IL-8 eXCRI. CXCR2 
CXCL9 Mia eXCRJ 
excLlo P-IO eXCRJ 
CXCLII HAC cxeRJ 
CXCLl2 SDF-IaiP eXCR4 
CXCLIl BCA-I eXCR5 
CXCLI4 BRA]( Unknown 
CXCLI5 Unkno"'n Unknown 
cxeLl6- Unknown exeR6 
!; ~
XCLI LymphOlaCli.nISCM-la XeRI 
xeu SCM-IP XeRI 
~ Chemokines 
CXJC\.1 FractaJkine eXJeRI 
~ CbemoltineJ 
CCLI 1-309 CCR8 
eCL2 Mep-I eeR2 
CCU MlP-la CCRI.eCR5 
CCUlI LD78P CCRI.CCR5 
CCtA MIP-IP CCR5 
CCU RANTES eCRI. eeRJ. eeR5 
CCL6 Unknown Unknown 
CCL7 MCP) eCRI, CCR2, CCRJ 
CCL3 MCp·2 CCRJ,CCR5 
CCL9ICCLIO Unknown CCRI 
CClII Eotaxin ceRJ 
cell 2 Unknown eeR2 
CCLI) Mep ... CCR2,CCRJ 
eeLl4 Hee-I eCRI,CCR5 
CCllS HeC-2ILkn-11MIP-16 CCRI,CCR 
CCLI6 HCC"'ILEClLCC-1 CCRI,CCR2 
CUl7 TARC CCR4 
CUl8 DC-eKI Cnknov.n 
3S 
University of Ghana http://ugspace.ug.edu.gh
CCLI9 MIP-3~IELC CCR1 
CCL20 MJP-JaJLARC CCR6 
CCUI 6CkineJSLC CCR7 
CCL22 MIX: CCR4 
CCU3 MPIF-IICKbS CCRI 
CCL24 Eotaxin-2 CCRJ 
CCL2S reCK CCR9 
CCU6 Eotaxin-3 CCRJ 
CCU1 crACK CCRIO 
CCUS MEC CCRJ/CCRIO 
Soun:e: http://www.expertreviews.org 
36 
University of Ghana http://ugspace.ug.edu.gh
ne mechanism of chemolUne action involves initiaJ binding 10 specific seven 
transmembrane spanning G protein-linked n:ceplors on target cell.. Several of these 
recepIOrs have been discovered for the different class oC chemokiDes as CXCR, CCR, 
XCR. and CX)CR (Figure .. ). Chemokine ligands (eCl. Figwe 4) can interact with more 
tIwI one m;eplOt and vice versa. For i.nslance., regulated on activation normal T ceU 
expressed aad secreted (RANTES. CClS). • beta chemokine, can bind 10 receptors 
CCRl, CCRJ ODd CCRS. 
37 
University of Ghana http://ugspace.ug.edu.gh
.... : ... ,: : ~ 
.~ ...- ~:~ -C'5 ;~
"uo , ~, ,,~ - ii::: ~ 
cxc<' " ' , 
~ n u"U ""I:' , .. ~ cx~. .:~~ ,,:~(1 ,U O l W 
c., 
~---' O~~I 
SouR:e: BajC'no nal. . 20()J 
F'1I'ft 4: Cluslf'~tioD or cbcmokines and receptors-based on the .frVCturaJ 
CMroutui.llics of their reta/we ligands. 1M lisl 0/c hemokinu signDUng through eQCh 
University of Ghana http://ugspace.ug.edu.gh
Chemokines control immune ceO trafficking and recirculation of leukocyte popuI.uon 
between the blood vesseJs, lymph, lymphoid organs and tissues. a process significant in 
bosilmmtme surveillance, and acute and chronic inflammatory responses. In addition SO 
their expressions dwing injwy and infection. cbemokines also play fundamental role in 
bomeosLIsis, angiogenesis and angiostatic process, tumor and metastasis progression, and 
in the CNS (Bajeno ef oJ., 2001 . Belperio el al. • 2000. Rossi & Zlonilc. 2000). 
A comparative study using PlasmodiuM berglw!l ANKA infected C57BU6 and BALB/c 
mice indicate thai both strains ofotice expressed CXCLIO (interferon-induced protein 10. 
IP-IO) aod CCL2 (monocyte chemotactic proteiD -I. MCP-I) genes as early as 24 0 :C ~. "- 0 ~ 
~-inlOctioo (IIaoum etal. • 2(03).,( . 
-,.---~----"'.'''-~.~.  
perforia-deficient mice (PfP·KO) after adoptive transfer of cytotoxic CDS' T cells from 
infected C57BL6 mice • which were directed to the brain of PFP-KO mice. The 
recruitment of C)1OCoxic CDS' T cells into brains of PFP-KO mice might involve 
cbcmokine and their receptors, and this suggests that lymphocyte cytotoxicity and cell 
trafficking could be key players in ECM (Nitcheu e(ai., 2003). 
'f'be use of rodent murine malaria models has demonstrated the involvement of leukocyte 
traffickiD& during eM pathogenesis. The P.berghei ANKA model suggest! thad 
""Iuesttatioo of iafected RBCs and platelets mediate eM. Thus, activalcd plateleu may 
eDWp leukocytes recruited to disIaI brain microvesscls where infected RBea are also 
]9 
University of Ghana http://ugspace.ug.edu.gh
sequestered. In this model substlluia] nwnber of COS· T cells in brain-sequestered-
kulwcytes (BSL) of CM infected mice were CCRS" (BelDoue et ai. • 2003). Also 
treatmc:a1 of mice with monocJonal antibody (mAb) to leukocyte factor-associated 
antigen-I (LFA-I) selectively abrogated lhe cerebral sequestration of platelet! lhat 
concla1ed with prevention ofECM (Grau ~I oJ. . 19S6) 
While chemokine receptor CCR2 was observed to be non-essential for development of 
experimental cerebral malaria (Belnoue ~I al., 2003a). CCRS deficiency in mice 
reportedly decreases susceptibility to ECM (Belnoue et al .. 2003b). Though brain-
seques&en:d CDS· T cells which express certain chemokines and receptors are known to 
be responsible for ECM pathology. it is still unknown which class of chemokines aDd 
cbemokine ~ expressed on these cells mediate ECM pathology. 
1.7.2 Immune mediators of malaria in human and primite models 
2.7.2.1 The roleofadbf'liionmolec:uJes 
The factors that detenninc whether CM develops or not are not clearly defined. However, 
ODe important determinant may be the role of endotbelial receptors in cytoadherence of 
paruitizcd RBCs (FiJ1ft 6). Many of these receptors such as teAM-I. VCAM-I. E-
sek=ctin, pweld cell adhesion molecule-) (PECAM-l) and cluster of differentiation 36 
(C036) bave been identified and characterized (Silamut et al., 1999, Turner el al. . 1994) 
The molecules or knobs expressed on the surface of infected erythrocytes mediating 
C)'tOadbucnce 10 adhesion molecules on endothelia cells belong to a large family of the 
clooaUy variable antigens (Plasroodium /a/cipcuum erythroc)1e membrane protein I 
40 
University of Ghana http://ugspace.ug.edu.gh
(PjEMPJ) (Craia & Scherf. 2001) encoded by the vtlT II. .... The knobs adhae 10 
recepcon 011 codotbelial ceUs of cerebral vessels. followed by rosene fonnarion aDd 
aaJutination of the oon.parasitized erythrocyteS (Ringwald et al., 1993) resulting in 
oc:ctusiofl of cereI:nJ YC*lJ. UpreguJation of teAM· J expression increased the binding 
of PjEMP' to brain capillaries and contributed to complications associated with cerebral 
maa.riL Additionally. tCAM-1 expression is upreguJatcd by cytokincs such as 1NF~ 
lIldD..-l (RudiDtlaJ., 1997. Jakobson elal .• 1995). 
Furthermore. adhesion of infected erythrocytes to moleculel such IS chondroitin ... 
sulphate and hyaluronic acid has been 85sociated with placental malaria (Rogerson., aI., 
1995). FollowiDI cytoadherence, there is sequestration of parasitized erythrocytes to 
co4otbelw cells (Macpherson el 01 •• 1985) leadina to endothelial cell damage and 
aaocilled complications. 
Macrophage actimion and stimulation of the respiratory burst also results after binding 
of infected erythrocytes to CD36 (Ockenhouse et 01 .. 1989). lnterestin&iY many of these 
rccep&onalJoact as endothelial receptoBforkukocytesduringinOamrnaaoryre&pOR5eI 
and immww sUl"Yeillancc. In most caes sequestration is mediated by parasite induced 
Iipoda OG infected erythrocytes noubIy PjEMP-1 which have been. discovered to be 
respoasible for ancigenic variation in P.falclparum. PfEMP-1 expressed on the surface of 
pnsitized red blood cells (PRBC), specificaJly binds 10 CD36 and thrombospondin. 
41 
University of Ghana http://ugspace.ug.edu.gh
adhesion molecules 00 the V85CU1ar endotbelium (cytoadherence) and to uninfeaed 
erythrOC)1es (rosetting) (Figure 4) leads to occlusion of the microvasculature and thereby 
coatribule directly 10 the acute pathology of severe human malaria. 
42 
University of Ghana http://ugspace.ug.edu.gh
Courtesy of EMSrU F"ongporant) 
ligure 5: SeqUestTatioD of P.jakiparum infected erytbrocytes in the distal 
microvuculahln of tbe bnlo of cenbralmalaria Infected deceased pstieDt. 
43 
University of Ghana http://ugspace.ug.edu.gh
Souree: Man,,", ' s Troptcal DikascS tell' book. 20· cdilion. pp 1098. 
Fiprc 6: S<=be ••t k iliustrahoD or ceilu&', IMIhesion In P.faldpa",m ,.ala,ll. Ftw' 
CJfOIItI/ttreftCt! (red eellto vascular endothelium) more lhan five polenlilll rlceplors lor 
Ilwotlltnive varianl s~rftlceprole;n PjEMPI how bun I«ttlified. The molecules Oft 1M 
red ceQ surfot::r inmIwd In l'tJum", (i1l/«1rd IWI eel/to u"mfocted red cell) tlppear 10 
bedlJ/wenllOlltosecQlUi",cyttNlll/lherertCe. 
University of Ghana http://ugspace.ug.edu.gh
1.7.2.lT"~rol~ofc:ytokines 
The inmasc in nwnber and activity of macrophaaes and T lymphocytes during maluia 
Infection cause the release of soluble cytOkines including TNF-a, INF.., and [L.l~ 
(Macpberson et oJ .• 1985. ManceretetaJ. . 1999)wruchmducecytoadberence,vucular 
.... actiY8lioo of cloning and seveR metabolic cbanges (Ringwald el al. • 1993, 
Roekcttelai. , 1994. Nicoiaselai. • 1994). 
AI*' from the: possibie direct effect of malaria parasites OD blain endothelium and other 
orpD& such as the liver and kidney in infected hosts, the parasite also stimulates the host 
iaDuoe RSpODJe. leading to overproduction of cytokines (NF·y. TNF-a, GM·CSF aad 
IL-l by Tbl cells (Grou, 1992). The5e T-«ll derived cytOkines then amplify the 
activation and recruitment of platelets and leukocytes via cbemokinc and chemokine 
recepton. 
2.1.2.3 TH rol~ of c"~ ..o killu and reeepton 
The poIentiaJ roles of chc:mokines during malaria infection include host derense 
fuDctions, such as leukocyte recruitment, participation in cell-mediated immunity and 
ami-protozoal activity. Though chemokines and chemokine rec:eptors reportedly mediate 
pdbogtDeSis of several parasitic disea!\¢s such aa loxoplamoJ/s. IrypanOJomiasu. 
I,WvuJniu.tl.l, d1ft«bia:sis and trichomoniasis (Denny et oJ., 1999. Liu el 01., 1999, 
BIdoI-., eI aI., 1996, Yu et 01., 1997, Sbaio el at .• 1995) their involvement in malaria. 
c:spcciaUy CM is still UDClear. 
4S 
University of Ghana http://ugspace.ug.edu.gh
Obiervations made in a time-<:OW'3e studies of macrophage intlarnmalOry protein- J alpha 
(MIP-la) aDd iolerleukin-8 (lI.-8) secretion in patients with P. /oJciparum malaria 
indicate 1ha1lL-8 concentration corn:lah.-d positively with parasite count and severity of 
the disease (BW"gJDanP el al., 1995). Recent studies also indicate that placentas of 
malaria-infected women have higher levels of CCR5 chemokine receptor expression than 
pllcentu of women without malaria (Tkachuk el aI., 200 I) and that both fetal and 
macmaI cells secrete inflammatory and immWlOreguJatory cells including beta-
cbemokines such as MCP-1. MIP-Ialpha and lP-10 in response to P. /alciparum 
(Suguitan el al .• 2003). This is further evidence that malaria infection induces the 
expression of chemokines. which may contribute to the immunopathology of the disease. 
2.8 RANTES as. proiaflammatory cbemokine 
RANTI:S is • cbemokine that is involved in the generation of inflammatory infiltrates. It 
was MieDtified as part ofa screen for genes expressed 3-5 days after TeeIl activation. 
RANTES binds a variety of receptors including CCRI . CCR3 and CCRS, expressed by 
monoC)1eslmacrophages, memory T cells., eosinophils. basophils and mast eeUs 
(Baggiolini&'Oahinden., 1994). 
Elevaaed levels of RANTES have been found in brORchoaveolar lavage (BAL) from 
aslbautics within 4 hr of allergen challenge (Holgate etal. • 1997) and in nasal lavage 
fluids from patients with allergic rhinitis (Rajakulashingam et al .• (997). Thus, RANTES 
is implicated iu the pathogenesis of allergic-type reactions with tbe potential to contribute 
to pathological changes observed in allergic inflammation. Immunoneutr.lizarion of 
46 
University of Ghana http://ugspace.ug.edu.gh
RANTES in CCRS knock out murine model of chronic fungal asthma induced by 
A1pergilllLf fomlg(IIUS significantly reduced the peribronchial inflanunation and airway 
bypcrrespoosivencss in asthmatic mice which demonstrate that functional RANTES and 
recqMOr CCRS play. role in the persistence of chronic fungal asthma in mice (Schuh el 
oJ .• 2002). 
RANTES binds to endothelial surfaces. where it acts as a signpost for immune cells. The 
intCl'Ktion of immune cells in the bloodstream with selectins leads to tbeirslow rolling 
a100g the vascular endothelium. (Figure 6). RANTES does not only attract immune and 
othcrceUs, but also upregulates bom inlcgrins such as lymphocytes function-associated 
antigen (LFA-I) involved in adhesion. Activated T lymphocytes. platelets and endomelial 
cells release large amoWlt of RANTES 3-5 days after activation. giving this chemokine a 
5peCiai role in the maintenance and prolongation of an immune response (Kameyoshi et 
01.. I 992). Rccently. the function of RANTES as a pro-inIIammalOly chemokine 
reportedly lncreued tbe likelihood ofmv infection (McDermon el al., 20(0). Though an 
a.5.5OCialion between malaria and HIV co-infection has been established (Xlao el aI., 
1998). the involvement of RANTES as a pro-inflanunatory chemokine vis-A-vis malaria 
immunopathologyisstillunelear. 
University of Ghana http://ugspace.ug.edu.gh
L. ..o cyte Fim 
-.v ~ 
l~, m,'," t E~ ! X t .:'' .. ~ .~. T 
COW1Csy Alan M. Krmsky 
Fiprc 7. RANT ..: S re<:ruils iotlammalory cells from hloodslream into ,He of 
i.Ram ••o o.. 1M bloodstrram octs a.t 0 reservoir Jor inj1ammoJory cel/s. Upon 
m/e"lion nsjar'll macrophoges r,lease IL-l and TNF-alplto. which In turn prumote the 
rei. . of dwntOki,.u A solNbie grodUttt oftMse cJwmokitJU Is established willUn lhe 
tiuur, recruiting varIOus cell types thot express receptors for different chemokifU!S. 
RANTES binds 10 glycosaminoglycans on lite ,ndoIhellaJ cell surface. wh"e it acts as a 
Signposlfor IIN1U"W cells. 
48 
University of Ghana http://ugspace.ug.edu.gh
2.9 Current research slTat~ies for underslanding malaria patbogeoesis 
2.9.1 Murial' ... alaria models aDd malaria rnearcb 
To understand the pathogenesis of eM, several animal models have been established with 
various types of Plasmodiwn parasites. Although these animal models do not exactly 
reproduce the buman disease, they nevertheless exhibit some simi larities to human CM, 
including cIuucW signs of the nervous syskm dysfunction and cerebral pathology. 
Recently. seque5tration of platelets and leukocytes i.n brain microvasculature which was 
reported to be J*1ly responsible for ECM has been identified to play an important role in 
human CM (Gnw el aI., 2003). Also the similarities between defined malaria antigens in 
rodent and human parasites and between inunune response pathways in mice and humans 
(KauJ et al.. 1994. Belnoue, et al. • 2003b. Gran, I 992) justify the use of models. 
Akbough the histopathology of experimental CM varies according to parasite-host 
combinlUoas, there are advantages and disadvantages in each of these models depending 
OIl the parameters of interest. Whereas parasitized RBC sequestration is common in 
P.yoe1ll17X models, leukocyte sequestration is usually associated with CM in C57BLl6 
and CBAlCA mice infec1ed with P berghei ANKA (Belnoue, et al. • 2003b). 
The P. yofUI model bas an advantage over the P. berghei ANKA model including IRBC 
sequestration which cone1ates with CM in bwnans and the tendency to allow models to 
survive over long periods of time so thai immunological parameters can be measwed 
dwiDa the infection. P.berghei ANKA (PbA) also has its own advantage including 
clinical re~vance expression to human and the availability of susceptible and resistant 
5tl'ains. T'hesusceptibility and resislance of these strains enable studies to be conducted 10 
49 
University of Ghana http://ugspace.ug.edu.gh
uccrtain wby oo.ly some percen. of buman population infected with malaria develops 
eM. The genetic variation associated with this pbenomenon in PbA models may be 
compved with that of bwnans to ascertain the diffemlces in eM susceptibi lity and 
resistance 
Differences in pathological changes in animal models have been found to be related to 
different malaria parasites. eBA mice exhibit a brain vascular pathology when infected 
with PbA but DOC with P.yoelii (Grall., tl oJ., 1987, Fujioka tI al .• 1994). Pathological 
chlnges indPCed by a given parasite may vary among different mouse strains. For 
instance PbA-infected eBA develop fatal cerebral malaria (Rest. 1983), while DBA12 
mice develop a noD-fatal cerebral syndrome (Neill el al., 1993) but BALB/c mice do nOl 
dtveloplDycerebralpathology(Grau,elai., 1987). 
Experimental eM cmDOt exactly mimic the brain pathological complications in human 
due to genetic variations, but the common feaNraofthiapathoJogy which is shared by 
both hwnan and mwine model (Table 3) justify their use in research 10 Wlderstand 
dilC8Secondilionsin hwnan. 
so 
University of Ghana http://ugspace.ug.edu.gh
Table 3: Examples of animal models UICd for malaria bnLin immunopathological studies 
Charactcnstics Reference(,) 
P.pIJlI7X Swissmic:e lRBCsequestration KauJetal.,1994, 
P.b.rlo<, ANKA CS7B1I6 Leukocyte sequestration Belnoue.elal..2003b 
CBAlCa Leukocyte sequestration Grauetal.,1986 
DBA12 Non falal CM Neil.,aI..1993 
Hamster Rest 1983 
BALB/c Hanum el al. • 2003 
P.btrghelNK65 CBAfea Wakietal .• 1992 
P.clltlubaw/ C57BU6 Garnica el al.,2003 
P.knowles; Rhesus monkey Tatke elal.. 1989 
P.cotJl1Wyi Rhesus monkey IRBC Kquestration Smitheloi. . 1996 
P· fraglle Rhesus monkey (RBC sequestration Fujioka tt al. • 1994 
51 
University of Ghana http://ugspace.ug.edu.gh
2.9.2 Humaa POSI mortem tiuue: and perip"~1 blood 51.pla 
Post.mortem tissue and peripheral blood samples provide access to hwnan samples 
Infected with PJasmodiwn. Though cell degradation occurs after death. post·mortem 
samples taken shortly after death and preserved in the appropriate storaae reagents are 
viaI* (or researeb purpoSd and may serve as an .dequatc system (or understanding 
malarilpathologyandpathogenesisatthecellutarandmolecularlevel. 
For the pwpose o( malaria research. it is important thar. patients from whom tiasues are 
obIaiDcd be diagnosed before death for PJannodill," parasites in peripheral brood usinl 
ttandard metbods such as microscopy. Cerebral malaria is diagnosed Iccordina 10 the 
GIas80w or Blantyre coma JC:Ot"e d\Ding • malaria episode. 
A peripheral blood sample from patients with maWil also provides a means by which 
rtsearch can be perfonned to underscand systemic maJaria pathogenesis during 
PJasmodillRf infection. While serum samples contain both peripheral and cellular 
rna&criaJ. pa.. smtpla contain only secreted protein products. For instance, plasma 
SIaIp&es iDStcIId o( smun have been foWld to be idul for det.ennining secreted R.ANTES 
in pcripbcraJ bk>od because of the exce:u.ive release of RANTES during: platelet and 
leuk.ocyte:Iysisioserum. 
52 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER THREE 
MATERIALS AND METHODS 
MATERIALS 
3.1 L.bontory animals, reagents and supplie! 
All animal experiments were conducted according to the principles set up by the Nali01lal 
/rutilules of Health Guidt for (hi eme and Use of lAboralory Animols and approved by 
the Animal Care and Use Comminee of Morehouse School of Medicine. Atlanta. 
Georgia. USA. Female SW mice (0-8 weeks) obtained from Jackson Laboratory (Sar 
Harbow, Maine, USA) were maintained on a 12br light/dark cycle with access to food 
md water ad IibJtum. and maintained in luninar flow racks under pathogen-free 
conditions. 
3.1.1 P.yoeliil1Xparasites 
Slacks of P. yoelii 17X parasitized blood were generously provided by Dr. Harmah Shear. 
(Division of Henwology. Montefiore Medica) Center, Bronx, New York. U.S.A.). P. 
)'fHlii l1X rodent malaria strain causes a syndrome in female SW mice that resembles 
hUITIIJI malaria cbua<:terized by, r..., (ruftled fur) and ,pleno-hepatomegaly by day 8 
posl infection (peak parasitemia). 
3.l.l cDNAmicro--array 
The commercial system used to investigate eDNA micro-array gene expression (AtlalN 
1.0; CLONTECH. Palo Alto, CA, USA) consists of two identical nylon membraDa 
spotted with S88 diffen:nt mouse genes grouped in functional blocks, including immune 
S3 
University of Ghana http://ugspace.ug.edu.gh
mediators. growth ractors, neurotrophins. neurotransmitters and pro- and anti- apoptotic 
genes. An approximate estimate of the abundance level of a wget eDNA in RNA 
popu1alior'l can be made by comparing its signal to the signals obtained with 
housekeeping genes of known abundance (eg GAPDH). A complete List of the eDNA 
samples and controls on each array, as well as their corresponding GenBank. accession 
numbers. may be found at CLONTECH's Atlas web site (www.atlyc!ontscbcom). [a-
JlPJ dATP (Amersham Biosciences. Piscataway. NJ. USA) was used to label mRNA. 
Expression profiles of different mouse brain mRNA populations (from infected and 
uoinfected mice) at day 8 post-infection were compared and analyzed byautonadiography 
and quantified by CLONTECH gene analysis software. 
3.1.3 TRIWLR 
TRlZOL ~ reagent (GlBCO BaL Life Technologies, Gaithersburg. MD, USA) was used 
to isolate total RNA from tissue samples (P.yoellJ 17X infected, hwnan CM and control 
samples). TRIZOL R is a mono-phasic solulion of phenol and guanidine isothiocyanate 
and allows for the maintenance of RNA integrity while disrupting cells and dissolving 
cell compooents. It has the added advantage of allowing for simultaneous isolation of 
DNA, RNA and protein for gene analysis. TRIZOLR  was stored at 4 °C until used. 
54 
University of Ghana http://ugspace.ug.edu.gh
3.1.4 ELISA 
Enzyme-Linked lmmunosorbent Assa~ (ELISA) kits for quantifying amount of 
peripbaal blood cbemokine (RANfES) expression were pun:hased from BioSource 
lDttmationa1 (Canwillo. CA. USA). Plasmodiwn /aJdparum specific antigens present in 
malaria-positive subjects were detected using • P. /aldparum specific ELISA kit 
purcbased from CcU.abs PTY Ltd. BrookvUe NSW. Australia. All asSilY components 
includina primary and secondaty antibodies, biocking reagents, and washing bufTerwere 
aU suppliedandUiedw::cordinalOmanufacturer'sinstruclions. 
3.1.5 Aalibodles 
Commercially available antibodies against RANTES (R&D Systems, Inc. MN), CCRJ 
(A1~,us Biocbentica1s, CA, USA), CCRS (ProSei Incorporated.. CA. USA), a-tubulin 
(Sigma-Aldrich. MO, USA) and mouse: anti-GFAP (Santa Cruz, CA, USA) were used to 
dctcrmiDetbeirprotemproducts. 
~Total RNA samples were treated with DNase I (GmCO 
SRI... Life TechDo1ogies, Gaithersbw'g, MD, USA) to mnove possible genomic DNA 
coOllmination. 
~ Reversc Transcriplion of RNA tocDNAwasperfonned using reverse 
tlWlScriptasc (Rn kit (Maxim Biotech. Inc., San Francisco. CA. USA). 
~ Amplilicotion of eDNA by PCR was perfonned usins Toq DNA 
~ lOX Buff", and dNTP. (Qiogcn, Santa Clarita, CA, USA) . 
... MolecuJar biology grade aprose (Fisher Scientific Suwanee., GA, USA) 
55 
University of Ghana http://ugspace.ug.edu.gh
was used for gel separation of DNA < IOOObp whiles agarose-LE. (Ambian Inc. Austin 
TX. USA) was wed for RNA analysis. 
~hqliDQ nmpanesulfonjc (MOPS) buffer. Agarose-LE for RNA 
electrophoresis analysis were prepared in I X MOPS buffer for fannaldehyde denaturing 
gel (Ambion ,"c. AU!Iin, TX, USA). 
~ RNase ZAP (Ambian Inc. Austin, TX. USA) was used to remove 
poss:ible_RNaseeonlamination from glass and plast.icsurfaces, 
~. Tissue samples were stored in RNAlater (Ambion™ Inc. TX, USA) to 
prevent degradation of cell products 
~ IX finaJ concentntion of Blue/Orange loading dye {0.03o/. 
bromophenol blue. 0.03% x.ylene cyanol FF, 0.4% orange G, IS% FicoliR 400, 10mM 
Tris-HCI (PH 7.S) and SOmM EDTA (PH 8.0) (promega Madison. WI. USA) was used to 
monitor migration of ON A products samples on agarose gel. 
3.1.8 snSoPAGElWatff'D Blot 
~TlSSUCsampleswerehomogenized with lysis buffer (O,S%Triton 
X-IOO, O.ISM NaCl, 2mM EDTA, ImM PMSF, Aprotinin, IX PBS). 
~ Protein samples were suspended in sample buffer (1.24M Tris. 
pH 6,8. 20% (w"') 50s, 23% (w/v) glycerol, O,05~o BromophenoJ blue before loading on 
gel. 
~Tbecompositionofthe 80S·PAGE separation gel were 30% 
AcryIamide. I.5M Tris pH 8.8, 10% SOS, 10% Ammonium Persulpbate, and TEMED 
(Sigmo-AIdrlcb.MO,USA). 
~ SOS-PAGE stacking gel was prepared with 30% Acrylamide, 
S6 
University of Ghana http://ugspace.ug.edu.gh
I.OM Tri>, pH 6.1, 10'-' SDS, 10% Ammoftium Pcrsulpl.- and TEMED (Sigma-
Aldri<h, MO. USA). 
~ SOS.PAGE running buffa-conslSledof 2SmMTri5.I92mM 
Glycine. 0.1% (w/v). SOS pH 8.3. 
Transfer Buffer. Transfer buffer ingredtenlS were 2SmM Tris base, 192mM 
Glyc .... ZO%Methonol 
nitrocdJuJose membrane (BioRAD. HercuJC$ CA, USA). 
I!IsHik!n&. . A&mUMil.!U NitroceJlulo5e f1lmlbrane was blocked with 5% (w/v) ev.porated 
Msmbrane Washing RuffCI. Membrane was wa5hed \vitb buffer made from TBS +- 0.1 % 
Twem20. 
ProWo l2s'SiliQ" Kil. Chemilurninescent detection kit .l..uminol (Enhancer) 
IDd peroxide buffer (PIERCE Biotech Inc, Rockford, n., USA) was used to detect protein 
boods. 
~ Bandsofprocein wen: developed and detc:ctcdon higb 
perfOI'ttlioOCC cbcmilumincsc.ence ftlm. CFiWr Scientific Suwmee, GA, USA). 
57 
University of Ghana http://ugspace.ug.edu.gh
METHODS 
3.1.1 P.y«I;; t 7X murine malaria model 
Female Swiss Webster (SW) mice were injected intn.peritoneaJly with lei (100. ... 1) P. 
)«1" 17X parasitized blood kindly provided by Dr. Hannah Shear, Division of 
HcmaIO~. MOO1t:fiore Medical CeDter. Bronx, New York. USA. UninfeC1ed control 
mice were injected with IOOj.1l of wUnfe<:ted blood. Paruitemi.l was determined by 
COUDling the number of parasitized red blood cells (RBC's) in a total count of 300 to 500 
RBCs 00 Wriibt-Giemsa-staincd tail·snip-thin blood smears. 
Plnlitc:mia wat monitored 2, 4. 6. and 8 days post· infection . This rodent maJaria ,train 
~. syndrome in Canale SW mice thai reiembk:s hwnan malaria (Kaul et al., 1994) 
characterized by fever (ruffled fur) and spleno-hepetomegaly by day 8 po~ infection. 
3.2.2 Preparation or infected mouse brain fusue lamples 
All mice were sedated with haJothane (2-Bromo-2~hloro-l , I. I-triflooroethane, 0.01% 
Thymol. HaJoc.boa Labs. River Edge. NJ. USA) prior 10 dissection. Groups oflC:o (10) 
faWe mice wen:: JllCri6ced after day 2, 4. 6 and 8 post infections. Uninfectedcontrol 
nUc.e (10) were also sacrificed on ea::h of the time point. For each time point, 5 brai.nJ 
&om infect«l mice were collected and stored in RNAlatcr (Ambioa"" Inc. U.S.A) at -
so"C for RNA isolation, 3 brains were cryoprotected in 4~. paraformaJdehyde at 4°C for 
;nununohislo1ogy and the rat (2) wen: _ at -so'C for pro1rin analysis. SUniJorty, 5 
brains from uninfcacd mice 'Were stored for RNA isolation., 3 for immunohistology and 2 
for protein analysis. 
58 
University of Ghana http://ugspace.ug.edu.gh
3.3 TraDscripriouJ aDalysis of P.yoe/ii .7X induced immuDomodulator 
expression 
3.3.1 Total RNA isolation from P.),oeUi 17X infected mouse brain 
EItb of the mouse brain stored in RNAlater \\1lS homogenized and toW RNA was 
i~laIcd using TRlZOL R reagent (GmCO SRi. Life Technologies, Rockville. MD. USA). 
Six hundred microliters (600j.ll) of chloroform (200~1 of chloroformll ml of TRIZOLI t) 
was added to homogenized brain samples in TRIZOlR . vortexed for IS seconds followed 
by iDcubetion at room temperature for 3 minutes. 
The samples were centrifuged at 12.000gl4oC for 15 minutes and the supernatant 
(aqueous phase) was pipened ineo new microfuge tubes. Five bundred microliters (SOOj.ll) 
isopropanol (95%) was added to the supernatant, mixed by vonexing and incubated at 
room tempernture for 10 minutes. Following centrifugation at 12.000gl4oC for 
ISminut.cs. the RNA pellets were washed in 7()O,4 ethanol by centrifugation at 7,500g/4 °c 
for 5 minutes. RNA pellets were dried briefly and dissolved in 50~1 of nuclease free 
Coocemn.tioo. of RNA was determined by measwing absorbance at 260Mt/280run. A 
2600m/28Onm ratio of I.S-2.0 was considered to be good quality RNA sample. The 
inlegrity of RNA sample was determined on 1%  fonnaldehyde-agarose gel using 
elhidium bromide SIaUt. 
S9 
University of Ghana http://ugspace.ug.edu.gh
J.3.2 DNau treatmellt oCeolal RNA samples 
TotIllDOUlC brain RNA samples were treated with RNase--ftee DNase I (G1BCO BRL. 
ure Technologies. Rockville, MD U.S.A) to remove possible genomic DNA 
contamination. A bundred microliter (100.-1) reaction mix containing mouse brain tota] 
RNA (I2U8l. HI"I of lOX ON"", I buffer. 5,., of IUDiliul DNase 1 (Lif. Tecboologi ... 
RDckville. MD U.S.A) and nuel .... free ..- was prepared and incubokd II 3"C for 
3OmiDule$. 
Ten micn>li .... (IOpI) of lOX Termination mi. (O.IM EOTA. pH 8.0. ImglmJ glycocen) 
wu added to the reaction mixture to terminate DNase I activity. The reaction mix was 
divided. into two 1.5m! microfuge: tubes after which 55J.l1 of pbenol:chJorofonn:isoamyl 
aIcobol (25:24:1; pH 4.5, Fisher Scientific, Suwanne, GA, USA) was added to each and 
subjected 10 vortex mixing followed by 10 minules centrifugation at 12,000gl4oC to 
scpara&c phases. The purpose of this step was to remove DNase I enzyme protein from. 
the reaction mixture. which might inhibit downstream PCR reaction. 
The top aqueous layer was pipened into a new rnicrofuge tube and chJorofonn (55J.l1) was 
added to Ibc tube. mixed by vortexing and cenarifuged at 12,OOOgf4oC for 10 minutes. 
Tbetopaqueous lay<robtained after this process contained the RNA and wastnllllferred 
imo • frah microfuge tube and precipitated in 5)11 of sodiwn acetate (2M NaOAc pH 
4.5) with 150f..i.1 of 95'/, ethanol. The reaction mix was kept on ice for 10 minutes 
fo_ by centrifugation at 12.000gl4'C for 15 min. .... RNA pellets were washed with 
60 
University of Ghana http://ugspace.ug.edu.gh
80". ethanol (50J,lJ) at 12.000gI4oC for 5 minutes. Ilir-dried briefly and rcIluspeoded in 
5OpIOfDUC~frec""'8tet. 
3.3.3 Tntin, o(togl RNA samples (or possible DNA contamination 
After ONAse treatment. RNA samples were tested by PCR ana1ysis using the mouse 
GAPDH PCR primer pair to ensure ChIt there was no DNA contamination after DNase 
tnIIimeot HWldred nanograms (IOOog) of DNAse-treated lotal RNA samples were used 
loS template in a standard PCR reaction mixture consisting of 10 mM KCI, 10 mM 
(NlUhSO., 20 111M Tris-Hel (PH 8.8), 2 mM MgSO., 0.1% Triton X-IOO, 200~M each of 
f. .. deoxynuclcotides,(dATP, dCTP, dTTP dGTP) and lunit of AmpliTaq Gold DNA 
polyrne1'1!SC (perkin-Elmer, Boston, MA, USA), in a reaction volume of 100 ..-1. 
Amplification was performed for 30 cycles in a thermocycier (Perkin Elmer Gene Amp 
peR System 2400 lM, Fisher Scientific, Pinsburgh. PA, USA), each cycle being for 2 min 
aa:94 °C,I min III 5S °C and then I min It 72 ClC. with a final incubation of 10 min at 72 
"C. The presence or absence of peR products was detennined on 2Y. .. agaroseletlUdium-
bromide_gel. 
University of Ghana http://ugspace.ug.edu.gh
3.3.4 eDNA array~sereening of P.yoeIii t 7X induced immunomodulators 
3.3 .... 1 Probe synlbesis from total RNA 
Globe.] alterations in P.y«1ii 17X induced immunomodulal0r gene expressions in mouse 
blain at peak parasitemia were determined by cDNA microarray (CLONTECH. CA. 
USA). Five micrograms (51lg) of P.yoelii 17X infected (day 8 post infection) and 
uninfctted DNaso-treated. pool mouse brain RNA was reverse transaibed in the presence 
of IO.,.Cilj.l1 of(a~llP)dATP. for micro-array analysis. 
The following reagents were combined in a O.5ml microcenuifuge tube at room 
temperature; 2J.ll o(SX reaction buffer. If.lI of lOX dNTP mix. 3.5j.l1 of IOIlCi/ll1 of (a· 
Up) dA TP to provide 8 total volume of 6.5j.l1. The reaction mix was preheated at 70°C. 
In. separate O.Sml microfuge tube. SIJI of IOta! RNA and I III of cONA  synthesis primer 
mix (CLONTECH. CAl were combined. vortexcd briefly and incubated at 700e for 2 
minutes. The reaction was fun.her ineubated for 2 minutes at sooe. During this 
incubation, I~ of reverse transcriptase (CLONTECH, CA, USA) was added and the 
ractionwukeptatroomtemperature. 
After the 2-minute incubation at 50°C, the radiolabeled 6.5j.l1 master mix probe was 
added to each tube, mixed briefly and incubated for funher 2S minutes at 50°C. The 
reaction process was stopped by adding IJ.1l oftennination mix (O.lM EDTA in Imglm1 
sfycogen). 
62 
University of Ghana http://ugspace.ug.edu.gh
3.3.4.1Col.lIlDpurilieatiodo(lyntbe.1izedpmbes 
To purify [be labc~ eDNA from unincorporaLed 12p nucleotides and small (<O. lkb) 
eDNA fragmettb, probe synthesis reaction was diluted to 200~.d total volume with buffer 
NT2 (ClONTECH. CA, USA). The reaction mix was transferred into a Nucleospio 
Extraetion Spin Column (CLONTECH, CA, USA) placed into a 2·ml collection tube and 
centrifuacd at 14.000 rpm for 1 minute. The collection tube was discarded into 
appropriate radioactive W'IS1e container. Four hundred microliters (400j.11) of buffer NT3 
(ClONTECH. CA. USA) was added onto the NuclcoSpin column. which have been 
insened lnto. fresh 2·ml collection tube. and centrifuged al 14,000 rpm for Imin. The 
coUcction tube and ilScontents were again discarded into the radioactive container. This 
step was repeated twice. The NucleoSpin column was finally transferred into a clean I.S· 
ml microfuge tubes and soaked with IOOJ..l1 of buffer NE (CLONTECH. CA, USA) for 2 
minutes. The purified cDNA probes were finally eluted from the column by 
centrifugation at 14,000 rpm for I minute. 
3.3.4.3 HybridiziDgcO/'llA probe5to tbeAtlas array 
ExproosHyb (CLONTECH. CA. USA) was prewarmcd at 70'C while O.Smg of sheared 
salmon testes DNA was denatured by heating at 100°C for S minutes and quickly chilted 
011 ice. Heat..denattnd sheared salmon testes DNA was mixed with prewarmed 
EopmsHyb (CLONTECH, CA, USA) and kept at 70'C until used. 
The Atlas array membrane was pre· ...." C1. in a hybridiZltion bottie so that it adhered to the 
m.ide walls of tIw: boctIc without creating air pockets. Five milliliten (Sml) of the 
6) 
University of Ghana http://ugspace.ug.edu.gh
denItuted shewed salmon DNA and the ExpressHyb solution wu added to the bottle.. 
such that the solution is evenly distributed over the membrane. This step was prepared 
quickly to prevent the array from drying. The membrane was prehybridized with 
ooutinuousagitation at 15rpm al 70°C for 30 minutes in a hybridization incubator. 
Hundred microliters (100~I) of the labeled probe was added to 11~ of lOX denaturing 
solution (1M NaOH. 10mM EDTA) and incubated at 70°C (or 10 minutes. The labeled 
probe reaction mIx was added directly to the array membrane and the prehybridization 
solution, and hybridized ovemigbt It 70°C (l6hrs), 
3.3,4.4W.5hiagofllybridizeduraymembrsoe 
After the overnight hybridization. the hybridization solution was carefully remov 
the bottle and discarded mto the radioactive waste container and replaced with 200m) of 
prewanned {700q wash solution I (8.7658 NaCI. 4.41g Na)Citrate.2H20, pH 7,0, 109 of 
5DS) with continuous agitation at IS rpm for 30 minutes. This step was repeated three 
more times after which the membrane was again washed with 200.,a1 of wash solution 2 
(O.44g NaCI. O.22g Na3Cilrate.2HzO, pH 7.0, 0.5& ofSOS) at 70°C. 
The Atlas array membrane was carefully removed from the bottle with forceps. Excess 
wah tolutioo ""-as removed from the membrane by shaking. The damp membrane was 
immediately rnarkedwitb a notch at one comer for easy identification and covered with a 
plIIIic wnp. The membrane was exposed to Kodak BioMax Ms x-ray film a! SOflC with 
64 
University of Ghana http://ugspace.ug.edu.gh
aD lntensifying screen. overnight. The film was deveklped by Kodak X-Omaa 2000A X-
ray auIOf1Idjogmphcr. 
3.3.45 Gene aaalysis 
The positions nfbybridization signals on the x-ray film were identified and anaJyzed 
IIiiDt! Atlas'" bmF 1.0 softwan: (CWNTECH, CA, USA). This 1Oftwan: provides 
oricOII1ioo gridsucb that scannin& the signaJson the x-ray film and precisely aligning it 
to the &rid di.agnm. it PfOvidea the eoclosed array gene list on the membrane. The 
diffemdiaJ ,me expression in P.yoelil 11X infected and control mouse brain were then 
anoiy2Jod and normalized to tho .. of glycenoldehyd ....3 -pI!ospl!.te dehydrog. ..... 
(GAPDH). which wu used as the housekeepina aene. The resulting dala were expressed 
as the raDo of the relative change in mRNA levels in the infe<:ted brain samples and 
llllinfectedcontrob. 
Due to tequeDCC-dependent hybridization characteristics and variation inherenl in Illy 
bybridiDrioo reactIOn. it is importanl that eDNA array results are corroborated with RT-
peR analysis. RT·PCR analysis was therefore conducted CO confirm expression of 
te1ectedaenesofinaerest. 
65 
University of Ghana http://ugspace.ug.edu.gh
3.3.! Rt'Venc: traD3CripiiOB of purified !Dome bnill RNA to eDNA lor peR 
aaalysis 
To I)1ltbeme the fmf -strand cDNA for PCR amplification, 10iJg of DNasc·treated 
mouse brain RNA and 4~ (SOJ!M) of random hexamer (50",M; Maxim Biocech,lnc .. San 
Fracisco, CA, USA) (used as a primer) wert combined in a tolal volume of 14.5JiI with 
nuclease free 'A'lIter and incubated at 70°C for 5 minutes. The reaction mix was quickly 
chilled on ~ and O.s~ of RNase inhibitor (1 30 UniUlIJI) (Maxim Biotech, Inc .. San 
Francisco, CA, USA). 10J.i1 of 5X RT buffer, 20111 of 10mM mixed dinucleoside 
~ ad IJ1I of reverse uanscipwe (250 Units/",I) (Moloney Murine Leukemia 
Virus Reverse Transcriptase . Maxim Biotech. Inc .• San Francisco. CA. USA) we~ 
added and incubated at 3t'C for 60 minUle$. The reaction was tennioa.ted by incubation 
II 9S'c for 20 minutes BOd quickly chilled on ice. Fifty microliters (50",1) of nuclease 
free water was added to dilute the RT mixture to a vohune of IOOJ.1l. A VOl...u , mI . , oO. o 
eDNA was UKd ia ...h  PCR ,,,.c.wn. ~·o 
=> i 
• ..... .<. 9. .... 'i -,!< 
3.3.5.1 Amplification by peR and Icmi·quaotHativc ana lysis of P.)'Oe1ii 17X indu 
••u nomodulaton 
Oeae sequences with accession numbers for adhesion molecules; PECAM-i 
(NM_" ')'"'6) ICAM·I (BE_630415), ond VCAM·I (NM_OI1693); cyrokines, INF-"/ 
(K_00083), lNF ... (NM_OIJ693). IL,I2 (M_86671). ond iNOS (NM_OO87)2); 
cbauakincs. M1P·2 (NM_OO9140), MCP·\ (NM_0I\333) and RANTES (AF_252285); 
~ l'CC<pto,", CCRI (NM_0099)2), CCRJ (NM_0(9914) ond CCR5 (0_83648) 
I0Il g\yI:<n!debydc-3·phospha!. dehydrogenase (GAPDlI. XM357288) w.,. obtained 
66 
University of Ghana http://ugspace.ug.edu.gh
from the NariooaJ Center for Biotechnology Infonnation (NCBI) database. Sense and 
aotisense primers. optimized for PCR amplification which gmerated amplicons of 1~ O, 
106. 102.98, 100, 102. 101.94. 100. 97, 103.96, 100 and 120 bose pairs in size for 
PECAM-I.ICAM-I. VCAM-I.INF-y. TNF- .. 1L-12. !NOS. MJP-2. MCP-I, RANTES. 
CCRI, CCRJ. CCRS and GAPDH respectively were then designed (Appendix) using 
Primer 3 software program from Whitebead Institute at the M.usachusetts Institute of 
Tec:tmotogy (MIT. Boston. MA. USA). Tbennodynamic analysis of the primers waa 
conducted using computer programs: Primer Premier TM (Integrated DNA Technologies, 
Coralville. IA. USA). and MIT Primer III (Boston, MA. USA). The resulting primer sets 
were compared against the entire mouse genome using the national center for 
biotechnology and infonnation (NCBl) to confirm specificity and insure that the primers 
flanked mRNA splicing regions. 
PCR was conducted. OD P. yoelii 17X infected mouse brain RNA samples using these 
primers. Complementary DNA sequences were amplified in a 50~1 reaction mixture 
!ftpUCdbyaddinlthefoliowingcomponents;3S~ofnucleasefreewater,5J..110flOx 
peR buffer, 20ng each of specific primer pair/J.d. 2 ....1  of dinucleoside triphosphate 
(10mM). O.SuI (5 Unitsl~l) of Taq polymerase and 2)Jl of diluted RT product (eDNA; 
wed as templllc). Conditions for DNA amplifications \YC1'e set as (onows: lleating at 
940c for 5 minutes, followed by 25 cycles of DNA denaturation at 94°C for 1 minute, an 
anneaIiDg step .. :XOC (see appendix vii (table 3» for respective temperature values) for I 
minute. strand extension at 720e for I minute and a final extension step at nOc for 10 
mmutes in a thermocycler. Primers specific for GAPDH (housekeeping gene) was used 
67 
University of Ghana http://ugspace.ug.edu.gh
85 iDtemaI control. Negative controls, from which templa1e mRNA was omitted. were 
iDcludedineacbampli6cationexperimenL 
The nwnber of cycles required 10 attain products in the linear range of the PCR was 
delCnJlioed before the final assays were run. Working within this range, it was possible to 
detennine expres.sion differcnces after 25-30 cycles. 
PCR products ~ere anaJyud on 2%-agaroseIethidium-bromide gels and quantified using 
Gelexpert .,ftware (NucleoTcch. San Mateo. CA. USA). Band intensities in each 
experimem. were normalized to the mean intensity of OAPDH. Data were expressed as 
therclativeebanaeinmRNAlcvelininfectedanduninfectC'deontrols. 
3." Tissue ••d  plasma protein analysis of P.)'oe/U 17X induced RANTt:S 
expression 
3.4.1 SDSfWestera Blot analysis of P.yoelii I7X induced RANTES protein 
expressioDinmousebrain 
3.4.1.1 Protein isolarion aad assay from mouse braiD 
Protein was isolated from P.yotlii 17X infected and uninfect.ed mice brains using lysis 
buffer (0.5% TrilOD X-I 00. O.ISM NaCi. 2mM ethylenediamine tetra-acetic acid 
(EDTAl, ImM pbenyl methyl sulfo')'l fluoride (PMSFl, 22~g aprotininl~I, IX phosphate 
buffered saline (PBS)). Brain tissue samples were homogenized in SmJ of lysis buffer, 
and centrifuged at 13000 rpm for 20 minutes. Supernatant containing the protein was 
pipeu.ed. and IIOm1 III -80 °C until used. Protein concentration was determiTlC'd by Lo'M')' 
method (BioRad.. Hercules, CA, USA) IlIiD& Bovine Serum Albumen (BSA) IS Ilandard. 
68 
University of Ghana http://ugspace.ug.edu.gh
Stock c:oncentntion of 1.4m&1ml ofBSA standard was diluted with lysis buffer 10 prepare 
serial concentraliona; 0.2. 0.4. 0.6. 0.8,1.0,1..2. 1.4mglml. Duplicates often microliters 
(tOtal) of standanis and protein samples were pipetted into. 96 well plate. Twenty five 
microtiten (25~) of reagel'tl A (BioRad, Hercules, CA, USA) was added to each well 
fol&owed by 200JJ.1 of reagent B (BioRad. Hercules. CA. USA). Optical density of 
samples wu reid at 750nm using Micro-Tiler plate reader (Molecular Devices 
SpectraMax 250TNSwmyvale, CA. USA). Concentration of samples was extrapolated 
fromBSA __ .".... 
3.4.1.2 .....p anag 80S-PAGE gel 
0_ plates and sp8CCn were assembled in aodium dodecyl sulphate polyacrylamide gel 
cIcctrophoresiJ (SOS-PAGE) mini-venical ael Wtit (HOEFER Scientific Instruments San 
Fnmcisc:o, CA. USA) before gel was case. SeparatinS gel (15%) was prepared as follows; 
8m! or 30% aaylamide, and Smi of ISM Tris. pH 8.8. (BioRad. Hercules. CA. USA) 
weR added to 6.6mJ distilled water and stirred in • baker briefly, after which 200f11 of 
10% ..unoruum persulphaJ:e was added followed by addition of 40f11 of N.N.N'.N'-
Tctramethylethylmcdiamine;N.N,N',N'-Di-(dimethylamino) ethane (TEMED) (Sia,ma-
AkIrieh. MO. USA) with brief mixing. Gel "'as poured immediately and overlaid with 
10% ethanol to create smooth surface. followed by intubation at room lemperature for I 
After Ibr incubation. the ethanol was poured off and the scparating gel was rinsed twice 
with distilled wa&eraod overlaid with 5% stacking gel prepared from the followina 
...i pa: i.8mI, 30"10 acrylamide. 1.3m1. 100M Tris. pH 6.8 and IOO~I or 10"10 SDS with 
69 
University of Ghana http://ugspace.ug.edu.gh
6.8ml distilled waler and deganed for 3 minuIes. H~ microliters (IOOpl) of 10% 
ammonium pcr.;ulpblJe was added. with 4(11'1 of TEMED (Sigma-Aldrich, MO, USA) 
mixed briefly and poured immediltely on top of the separating gel before casting comb. 
Gel was incubated for 1 hour at room tempenllUJ'C. Equal amounts of protein (2Sug) 
SPpIes were precipitated in cold acetone and resuspended in loading buffer (1.24M Tris. 
pi! 68. 20% (w/v) SDS. 23% (w/v) glycerol and 0.05% bromophenol blue) before 
nmaiae on SDS·PAGE. Twic:c the volume of cold a:etone (100%) was Mldcd to samples. 
vortcxcd briefly and incubated on ice for 10 minUks to precipitate protein. SampAes were 
then centrifuged at 14000 rpm for 10 minutes and the lupemalant was poured off. The 
pellet was resuspended in IS",I of IX ioading buffer before to.ding. SDS·PAGE was run 
for3hoursatloo...andli0mA 
1.3,192 mM glycine, 20% methanol) until uted. Nitrocellulose membrane (BioRad. 
~ CA, USA) was cui according to the dimension of the gel and soaked in transfer 
buffcr.Filtcr~cuttothesizeofmembrane/ae:landspongesweresoakedintransfer 
buffer in different container before the transfer unit (IDEA Scientific Company, 
Minneapolis, MN. USA) "as assembled. The b'lDsfer sandwich unit containina aome 
amount oftraosfcr buffer was aucmbled in the following order starlina from the cathode; 
wbik plastic grid. sponge, filler paper. gd nitrocellulose membrane (without moving 
IDCIIIbr-. .. sd. an object with smooth surface. (4ml pipette) was rolled over set up to 
temove any trapped bubbles). 61terpaper, sponge and white plastic a;rid. 
70 
University of Ghana http://ugspace.ug.edu.gh
The traDsblot sandwich W8& elowly slide lolo the transfer tank after more transfer buffer 
bad been ..tded to the unit. Running condition for uansfer was set It maximum voltage 
and 3SOmA for 9 boon. After transfer. nitrocellulose membrane was removed from 
b"InSbIot sandwich; rinsed briefly with deionized waler before western blot was 
petfonnod. 
3A.1.4WateraBlet ...l ysis 
Nitrooel.Iu&osc memlnnes: were incubaled on orbital shaker (4OOrpm) iD S% (w/v) 
eYIIpOl1Ited milk for I hour to block non·spec:ific spots on membrane. Membranes were 
then washed with tri,..buffered saline (TBS)~O.I % Tween 20 (washing buffer), 3 timcs 
(cbaogingbufferatlOminutesinterval).Aftertbethirdwash.membtaneiweTescreeoed 
with primary antibodies according 10 manufacturers realmmendation: 1:1000 
tooti.yWed anti ..............b ilUlll( RANTES (R&D S)'1teIIlI. In,. MN. USA) and 
1:2000 lDti·moUIC a~tubu.lin (Sigma-AJdrich. MO, USA). Membranes were incubated 
with borizoatal shakin& (Bell<:o Biote<b, Vineland. NJ. USA) set ot 300rpm at 4 ·C 
Membranes were wuhed twice on a shaker (Sellco Biotech. Vincland., NJt USA) set at 
400rp:nwithwubbuffer(S minuIes each) and incubatcd witb the appropriate secoDdaJy 
antibodies. Membrane probed with biotinylaled aDIi-mouse recombinant RANTES (R&D 
S_ '"'. MN. USA) was i",ubatod with 1:4000 stteplavidin-borse.radish peroxid&se 
(HRP) sceoodary antibody for I hour It room temperature while membrane probed with 
71 
University of Ghana http://ugspace.ug.edu.gh
a.tubulin was incub81ed with I :5000 anti-mouse IgO secondary antibody .. the same 
conditions. 
After !CCOrOdary antibody incubation. membranes were washed again for 30 minutes, 
(hangin, wah buffer at every 10 miouaes interval.. Membranes were then devetoped with 
• cbemihaiDc-=ent (pIERCE Biotech Inc. fl. USA) detection kit. Five hundred 
microliters (S~1) each ofluminol (enhancer solution A, PIERCE Biotech loc. fL, USA) 
and peroxida!e buffet (solution 8, PIERCE Biotech lne:. n., USA) were mixed on 
transparent spread wraps. Memblaoes were removed from wash buffer. Excess buffer 
was bJoued out with filter paper and incubated at roomtemperarure on dele<:tion reagenlS 
on wrIIpS for 5 Il1iMdes. with protein surface 00 membrane facing down. MembrlDes 
were wrapped in uansp.tent wraps after deleelion reagents have been blotted out and put 
in autoradiography cassette (Fisher Scientific Suwanee. GA, USA). 
Baods of protein were developed and det.ectcd on rugh peTfonnancc cbemilumioeseeo.ee 
film (Fisher Scientific SUWIDee. GA, USA) using Kodak x-Omat 2000A (Eastman 
Kodak CompIn),. Roc~kr NY, USA) autoradiographer. Bands of protein 
com:spoodina 10 RANTES (7.8 ltDa) and Q·tubulin (55.0kDa) were quantified for 
P.yoelil 17X infected and uninfectcd control cues usina Versa Doc Imaging System 
(SteRad, CA, USA). RANTES protein expression was nonnalized to thai of a-tubulin. 
n 
University of Ghana http://ugspace.ug.edu.gh
304.2 Peripbcral blood aualy,u of P.yodU 17X indU(ed RANTES eJpres,ion 
To ddmnine if expression of RAJ'.ITES is localized or systemic. peripheraJ blood plasma 
RANTES expressioa from P.~"i 17X infected (day 2 .... 6. aod 8 post infection) and 
control mice was determined using RANTES specific ELlSA kit (Biosource International 
Camarillo, C~ USA). Since RANTES can be releued by platelets during serum 
colLection. the use of serum samples to detennme peripheraJ RANTES expression was 
....,;dod. _ blood .... collcc:ted in SO~I of heparin (I Urutsl",) (Elkins-Sinn. lac. 
Cber!y Hill. NI. USA). centrifuged •• Il.OOOrpm for 10 minu ... '0 obWn plasma 
samples, whieh were stored at - 80 °c until used. Duplicates of standards (39.0. 71.1. 156, 
ll2, 625.1250. 2SOO P8iml concentration ""'Il"~ controls. and """pies (1:20 diluted) 
Mrt aliquotcd (1 (0).11) into RANTES coetcd microliter wells and incubated for 2 hours aI 
}7 "C. The: solution was aspirated after incubation and wells were washed with 400J.11 (4 
lima) wuh buffer (Biosowce InternatIOnal Camarillo. CA, USA). Biotinylated anti-
RANTES conjupled ontibody (100 "') (Biosource In.emotional Comorillo. CA. USA) 
was added to the v.~lIs and incubated a' 37 "c for I hour. Wells were washed again. 
Hwdred mierolita-s (IOG,.aI) of Streptavidin-Horse Radish Peroxidase (Streplavidin-
HRP) wa then added to each well. iDeubated at room temperature for 30 minutes and 
wubed apin as ~fore. Hundred microliters (1001-11) of stabilized chromogen 
(TdrIIDethylbenzidine) was added 10 each well and kept in the dark at room temperature 
for 30 minuIes. The .." ".ion was SlOpped by odding I OO~I of SlOp oolution (O.lM 
H,SO.) 
13 
University of Ghana http://ugspace.ug.edu.gh
CoocentraIioos of le5( samples wen: determined It 4SOnm in a micro-liter plate mader 
(Molecular Devices SpectnMax 250"" SunnyvaJe, CA, USA). The ffilDimum detectable 
do5C of mouse RANTES using this kit have been found 10 be <20 pgfmJ. 
3.5 UUrutnmral ud i.muDobistologiral an.lysis of P.yoelii 17X infected 
3.S.1 Ultrastructural analysis of P.yoelil17X Infected bnin s8mpln 
To evaluate effects of P.,wlli 17X infection on mouse brain microvessels at peak 
parasitemia. whole infected and uninfectN brains .....e re diS!eCted, cut into smaller c:ubei 
(2 mm'). wasbed twtce with phllsphate buffered saline (PBS), and fixed for 60 minules in 
100 mM potassium phosphate buffer pH 7.2. containing 0.1 % aJuteraJdehyde and 20/0 
formaldehyde, fresb1y prepared from parafonnaJdchyde. After fix.tion, the brains were 
~ in methanol (9S~o) and embedded in lowicryl K4M at -20 °c. Thin!eCtions 
'Weft coUected on JOO-mesh nickel grids .ad examined by transmission elec:lron 
mlCTOSCOpy at 60 eV. 
3.5.2 1. ...D OlIlstolog;cal analysl5 ofGFAP expression in P.yoet;; 17X infecltd 
bralo 
P.,wlii 11X infected aDd uninfected mice brains harvested at peak parasitemia were 
porfuocd in 4% parafom>aldchyde in O.OlM KPBS (P ...... wn Phosphale Buffered 
-Saline) un-til com.pIdely  Wutated. and thea transferred into 10% sucroae for 4 ho\U'S at 
74 
University of Ghana http://ugspace.ug.edu.gh
pansagiuaJ sections of 20,.un thickness brain tissues obcaincd usiala eryoSlal were 
teriaUy p&Ieed infO O.02M KPRS solution in • 12-well micropla1e for free floating 
TIssues \Io'C1"e incubated for 10 minutes in a 0.2% JOdium botobydride (prepared with 
O.02M KPBS) on I rocker set at 400rpm to minimize auto-fluorescence. Tissues were 
washed 3 times (10 minutes each) in O.02M K.PBS. Ti5S~ samples were blocked for I 
hour in O.02M KPBS sclutioncontaini.ngO. I%biton X-IOOand 10% nonna1 goat ICf\IIIl. 
Samp6ea were mcubated with 1:200 rlbbit anti-GFAP (glial fibrillary acidic protein) 
primary IUltibody for 2 hours at room temperarure OIl a rocker. Tissues were washed 3 
times (10 minutes each) after primary anlibody incubation and then incubated again at 
room tcmpc:ralure OIl I rocker for an hour, in 1:1000 dilution of goat-anti-rabbit 
secoad.y antibody Jft1*CId in O.02M KPBS. Tissues were wubed 3X (10 minutes 
each) in O.02M KPBS after secondary antibody incubation. and mounted on slides in 
..n-f_ medium and visualized and photographed, OD an Olympus BH70 microscope 
with .. attached laser confcx:aI-imagina Sf*m. 
1.6 Huml ...l ariastudie.s 
3.'.1 H. .... «reb,.1 malaria (eM) aad nOQ-lUbria (NM) brain .....p ta 
A~ samples were oblaincd with informed parental consent of children below the age 
0(9 who died from eM (n-12 cues) and NM (n-6 C4SCS) while on admission al the 
Chik!ren's Ward of Koric-Bu Teaching Hospital. Univmiry of Ghana Medi<:al School. 
7S 
University of Ghana http://ugspace.ug.edu.gh
Accra, GbaDa. 1Dclusion criteria for sample collection were WHO Blantyre coma score of 
3 or less and the presence of malaria parasites. The presence of P.jalciparwn parasites in 
the peripheral blood was detected by routine parasitological examination in aU patients' 
while on admission. Exclusion criteria were detennined as absence of unconsciousness 
due to hypoglycemia, absence of encephalopathy, no history of neurological illness and 
.-ofmalariaparasi. ... 
To determine which region of the brain expresses high levels of RANTES and receptors 
CCRI. CCRJ and CCRS, brain sections taken from four regions of the brain. (namely, 
cerebellum. cerebrum, brain stem and hippocampus) of confinned human CM and NM 
poIt.monem brain tissue samples were used in this study. CM was defined according to 
established World Health Organization guidelines (WHO. 2000); a Blantyre Coma score 
of 5 01 less during the episode of severe malaria. excluding other causes of 
UDCOu.:ioumess -..cb as hypoglycemia, meningitis or other encephalopathy. 
Noa-mallria cootrols were cases in which no history of neurotogicaJ illness was 
m:orded. Brain tissue samples were stored in RNAlater (Ambion™ Inc. TX. USA) to 
preserve RNA dwing transportation and subsequently processed for total RNA and 
protein isolation. Consent of parents/guardians/relatives of deceased subjects aDd 
approval by the Institutional Review Boards (IRB) of the University of Ghana Medical 
School. Accra, Ghana and Morehouse School of Medicine, Atlanta. USA. were obtained 
pnor to commencement of this study. 
76 
University of Ghana http://ugspace.ug.edu.gh
3.6.2 TraDlJcriprio.a' analysis of RANTES, CCRl, CCRJ and CCRS in cfrcbrum. 
cc,..u.m. braia stc. and hippocampus of ('M and NM samples 
3.6.2.1 RNA isolation and DNaR trcahlltDt, from CM and NM samples 
Total RNA was isolaled from four regions of the brain (namely. cerebellum. cerebrum. 
bniD Slab IPd hippocampus) of confirmed human eM and NM post-monem brain tissue 
snpks usioa TRlZDl Reagent (GIBeD Bll. Ufe Technologies Inc., Rockville. MD, 
USA) and procedure as provided in 3..1.1. PotentiaJ genomic DNA oonlamiDllion was 
removed from these samples b) treatment with RNase-free DNase (lnvouogen, San 
Diqo, CA. USA) for 30 minu&es at 37 °C. RNA was then precipitated and resuspended 
in nuelcae free water and tested for traces of DNA contamination. 
3.'.2.2 Rneru tnMcription of purifit'd human brain RNA 10 rDNA for peR 
analysis 
Synthesis of purified human brain RNA to eDNA for peR analysis was performed as 
delcribed in 3.3.S. 
3.'.2.3 P( 'R amplif'teation and semi-quaotilaliVf: analysis of eM induced RANTES, 
CCRl, CCR3. and ('CRS 
H. ..... onRNA seqUCIICC of RANTES, CCRl , CCRl, CCRS ond glyceraldehyde,3, 
pixl..,..., dehydroge .... (GAPDH) obtained from the National Institute of Health, 
National CCQkr for Biotechnology lnfortnalion (NIH·NeBI) gene bank database 
......... IUllbersNMJ)0298S, NMJlOl295, NM ,001837, NM_OOOS79 and M, 33l97, 
77 
University of Ghana http://ugspace.ug.edu.gh
respectively wett used to design primers (or peR analysis. PCR amplification genenlted 
ampIicollSof 1504.130.193.101. and 226 base pairs in size for RANTES. CCRI.CCRJ. 
CCRS I!Id GAPDH mRNA respectively. 
Primers were designed U!ing the Primer 3 software program from Whitehead Institute at 
the Massachusetts Institute of Technology (MIT. Boston, MA. USA) as before and 
compII'UI. against the entire human genome using NCBI to conftml specificity and insure 
that the primers flanked mRNA splicing regions. Complemental}' DNA (eDNA) was 
generated, as before, and amplified with specific cDNA primers using Taq polymerase 
and polymerue chain reaction (peR) reagents (Qiagen Inc. Valencia. CA. USA). 
Conditions for DNA amplifications were set as follows: heating at 94°C (or 4 minutes. 
followed by 2S cycles of DNA cienattmltion 8t 94°C for I minute. an annealing step at 
x'C (appendix) for I minute, strand extension at nOc for 1 minute and a final extension 
step It 72°C foc 10 minutes in a tbermocycler (Perkin-Elmer, Norwalk, CT, USA). 
Primers specific for GAPDH (housekeeping gene) was used as internal control. The 
required Dumber of cycles needed 10 attain products in the linear range was detenninedas 
before. Negative controb wm: included in each amplification experiment. PCR products 
\W:le aalyzed CD 2o;..·agarose/etbidium-bromide gels and quantified using Gelexpert 
softwlre (NucleoTecb, SM Mateo, CA, USA). Band intensities in each experiment were 
normalized to the mean intensity ofGAPDH. 
78 
University of Ghana http://ugspace.ug.edu.gh
3.6.3 Tissue and plasma protein analysis of malaria induced RANTES, CCRI , 
CCRJ ailld CeRS expressioa 
3.6.3.1 Protein isolation aad aaalysis froID eM and NM samples 
To localize portioo of brain where RANTES, eeRJ and eCR5 expression occur, protein 
wa l5ol.l1ed from cerebnun. cerebellum, brain stem and hippocampus ofCM (n=12)and 
NM (0-6) post-mortem brain tissue samples using lysis buffer and procedure 8i 
described in 3.4.1.1. 
3.63.1 Preparing SDS-PAGE gel for protein analysis 
Fifteen percent (1 5-;.) ofSOS-PAGE gel was prepared with the same running conditions 
. dacribedin3.4.1.1 
3.6.33 TraDsfer .fprotein ooto membnoe 
The same procedure described in 3.4.13 was used to transfer eM and NM tissue proteins 
onlo membranes. Running condition for transfer was set at maximum voltage and 350mA 
for 91Wld 22 hows for RANTES (7 .8kOa). and CCRJ (4IkD.). CCRS (40kD.) and •• 
tubWiarespectively. 
3.6.3.4WeslemBlolanalysi, 
Membranes were washed as before and screened with primary antibodies according to 
mIINf'actw-er's recommendation: 1:1000 biotinylated anti·human recombinant RANTES 
(RAO Syaenu, Lnc.. MN, USA), I: 1000 polydonal IIIti-human eCRJ (Alexis 
Biochemicals, CA, USA). 1: 2000 polyc1onal BIltj·hwnan CCRS (ProScj lncorpor!lled, 
79 
University of Ghana http://ugspace.ug.edu.gh
Poway CA. USA) and I :2000 anti-human a-Nbulin (Sigma-Aldrich. MO. USA). 
Membrane probed with biotinyL.&ed anti-human recombinant RANnS (R&D SystemS. 
Inc. MN. USA) was incubated with 1:4000 streptavidin-horse.radish peroxidue (HRP) 
ICC:OPdary antibody for I hour at room temperature while membranes probed with uti-
humID CCR3. CCR5 and a-tubulin were incubated with 1: 5000 anti-human Jg(} 
~ antibodies .. the same coodjtions 
o..ds of protein were developed and dec.ec:ted on high performance chemiluminescence 
film (Flsber Scientific Suwanee, GA. USA) using the Kodak X-Omat 2000A (Eastman 
Kodak CompaPy, Rochester NY. USA) autoradiographer as before. Bands of protein 
comspoodina 10 RANnS (7.8 kDa), CCRS (40.0kOa) and a-tubulin (SS.OkOa) wen: 
qtaDIified for all C~ and NM cases usina the Versa Doc Imaging System (BioRad. CA, 
USA). RANTES and CCRS protein expressions were nonnalized to that of a-tubulin. 
3.1 Determination of P.jalcifJIUum aDtign and malaria induced pl.~~ 
RANTES nprcnioD b) ELISA / 
3.1.1 Determiaatioa or P.j_lt:ipttruIN antigea l 
P4wttodJ1IIIt/a1dparllm specific antigens present in plasma, collected from 64 ~;~~  
positi\le aWe and female adult \'OIWlleeri with infonned consent in Ejura., • peri-urban 
CXIIDIIIUftity in the Ashanti region of Ghana. were detected using a P.lalclporum specific: 
aabp ELlSA kit (CcLLabs Pn' Ltd. Brookvale NSW. Australia) which is $peCific fot 
tht bistidiDe rich procrin secreted by P.folclparum at lhe merozoite stage of the infection. 
Blood pw... of malaria anlisms iD the 64 adult GhaIWc subjects (NCM) and 19 ..... 
80 
University of Ghana http://ugspace.ug.edu.gh
expotedmalariana1Vemalcand femaleAfrican-Americanadult volunteers in Atltnta, a 
c:ity in lhe Georgia Stale of USA. as controls were determined. Two hundred microliter 
(200J.1.I) duplicates of nqative and positive controls as well as sample diluent were 
dispenJed into microplates coated with pwified recombinant proteins specific for- the 
hiJtidinc rich proteiD. Ten microliters (I~I) of sample WAS added in each sample well 
and i.ntubeled for 4S minutes at 37 °C. Microplate was washed five times by delivering 
and aspirating )~ wash buffer (CeLLabs PTY Ltd. BrookvaJe NSW. Australia) per 
well. HWldtcd microliters (IOO~I) of diluted enzyme conjugate was pipetted into each 
well of microplate. sealed and incubated for- 45 minutes at )7 °C. MicroweUs were 
wuhedagainasbefoteaftetwhicb lOOJ,tlofchromogen(tetramethylbenzidine /substrate 
.hydrogen peroxide} (CeLubs PTY Ltd, BrookvaJe NSW, Au5tralia) mixture was added 
and inc:ubttcd at room temperature for IS minutes. Hundred microliters (IOO~I) of stop 
IC)IUlion (O.3M H2So..) was added to each well before optical density was read at 4S0nm. 
The sensitivity as well as specificity of the test has been shown to be > 98% with a 
reported false positive rates of<2%. 
3.7.2 P.Jakiptuum induced plasma RANTES espnssion 
PI&5I'NI samples obca.incd from malaria positive subjects was used to determine peripheral 
RANTES expression during parasite infection. Blood was collected in EDTA . 
ceDtrifuged at 13,000 rpm (or 10 minutes to obtain plasma samples. which WC1'e stored at 
-2rt' C until ldCd. PeripberaJ blood pLasma RANTES levels in the 64 adult Ghanaian 
malaria positive subjects (NCM) in Ejura and the 19 non-exposed malaria naive Afrieao-
American adult volwlteers in Atlanta IS controls, was determined using a RANTES 
81 
University of Ghana http://ugspace.ug.edu.gh
opecifi< EUSA (8-- lnt. CA, USA). HundmI mic:rolilCt CIOOj1I) duplicate. of 
$WldardsCSOpglmlIOSOOOP@lmlcOOCCDtrationrange).conuol.and .... _IesCI:SI 
dihad) were added to anti· RANTES antibody coated wells. Fifty microliters (SOt.tI) of 
anti.RANTES hone.of1Klish peroxidase conjugate was added to each well and incubated 
for 2 hours • room temperature OD a horizontal shaker (Belko Biotech Vineland NJ. 
USA) set at 700 rpm. Wells were subsequently washed with 400. ... 1 of wash buffer 
(8io5OlJfC.e Int. CA, USA). T"1> hundred microliters (200,.11) of freshly prepared 
chromogenic solution (Tetramethylbenzidine) containing hydrogen peroxide was added 
to CIdl well and incubated for 30 minutes at room temperature on a horizontal shaker at 
700 rpm. Fifty microliters (50)11) of stop solution (O,3M H2S04) was added to each well 
to tenninatc the reaction. Samples optical densities were read at 450 nm with Micro-Tiler 
ec..cenlralions of lest samples were read from a standard curve and multiplied by S I to 
comet for the 1:5 I dilution. The minimum detectable concentration for this kit is 
CItimated 10 be 2pWmi. The strength of association between RANTES expression and P. 
foiCiparumantigensinmalariasubjectswcreauessedusingcorrelationanaJysis. 
3.8 Slatistiulanalysb 
A two-tailed student'! (.lest software (lntercooled Stata 8.0, STAT A Corporation, TX. 
USA) was U5ed for statistical analysis. Avenge of densitometric measurements from 
aprose gel electrophoretic and Western Blot lnIIyges for CM and NM samples were 
log-trauf'onDed to oormalize the distribution for eM (0=12) and NM (n=6) and also to 
12 
University of Ghana http://ugspace.ug.edu.gh
correct for small sample size for parametric statistical analysis. Data were ex.pressed as 
the mean ± SEM. Data from eM (n-12l and NM (0=6) group were then compared using 
the two-tailed student's He5t software. for which P < 0.05 was considered to be 
sig:nificant. The results obtained in this work were from duplicate detenninations and 
represent independent experiments performed by identical methods. 
3.' MOU!le malaria studies-2 
3.9.1 Role or RANTES in severity and lIIorblity of murine malaria 
The hypothesis for this study was that blocking RANTES expression will minimize or 
abropte the severity of malaria infection. lberefore. to determine the functional role of 
RANTES during P. yoe/ii 17X infection. a group (I) of twenty two (22) female SW mice 
were injected with anti~RANTES polyclonal anlibody (PAb) (200jlVmouse). while 
another group (II) oC 22 mice received mock polyclonal antibody (200llllmouse) kindly 
provided by Dr. James Lillard, Morehouse School of Medicine. Atlanta, GA. USA. At 
day O. poll inoculation. plasma samples were collected from 5 mice from each group and 
stomI at ~ 70 DC UDtiI used. The remaining seventeen (17) mice in each group were 
challenged iDtra-peritonea1ly with P.)!Oelii 17X (106 infected RBC) parasire while another 
group of seventeen (17) mice serving as controls received uninfected blood. Infected 
mice were given a boost of 200J,1Vmouse of antibodies at day 2 .... and 6. 
13 
University of Ghana http://ugspace.ug.edu.gh
Tbcdt$cription ofthccxperimentaJ design is shown betow; 
MOUIC strain : SW  fcmaJ(!'~6 weeks old 
P. ....t e strain : PlosllfOdium yoelil 17X 
Group I : Positive control (Weedon .. anti·RANTES pAbs) 
<inq) U : Experimental (lnfcction + aoti~mock pAt.) 
Oroupm : Negative control 
iAbn ! Ab Ab r nl rnnml 
-2 n 6 
84 
University of Ghana http://ugspace.ug.edu.gh
Parasitemia was monitored by making smeaJ'l of blood obtained &om the tail vein and 
counting SO Giems,a.stained fields or at least 300 RBCs Wider oil immersion (1 .200X). In 
addition, S)'IDpIOCDI of P.yMlii 11X infettion and mortality were dclennined to ascertain 
me severity of disease. Plasma was collected from both infected and uninfected mice at 
day 4 and 8 post infection. EUSA was performed on samples to determine RANTES 
expra'Sion using specific antibodies as described in 3.4.2. 
85 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER FOUR 
RESULTS 
~O¥K malaria studies-l 
~ eDNA Microarray Infected 
Pln'f'e''c''tlm7ioXew ith Mouse brain ·_-_• i'• .• ]·,*_,. ; 
.... "...  I~-, I...  I-•T• : -. I .. - ~-: ..... : unin~~ Evaluate-
Uninfected 
Gene statement profiling 
Evaluate- Analysis of transcripts of interest 
Panwites. fever, spleno-. Cell morphology and ultra 
andhepato-megaJy, strucntre 
Protein analysis by ELISA & 
Westemblots 
Figure 8: MuriDe malaria model: Mice were infected with P.yoIii 17X parasites and 
pt;JraJit('mja ntOIIjton!d by t!Wlluating tM presence of parasifeJ. fever, .,pleno-. and 
Mpalo-"",aIy Qf day 2. 4, 6 and 8 J1'OI,.lnj«tion. Braim were evaluated for P.yoeW /7X 
itttNcN gene Jlalnnnu profiling and transcripts of interesl using eDNA miaoorray and 
RT-PCR. UltrGJlrUChlro/ changes In brain sections we're analyzed by trammi.uion 
eleurtNt microscopy. Wt'stern BIOI and ELISA analyses wt're used to determine P.yoelii 
17X induced protein upreuion o/RAVTES. 
University of Ghana http://ugspace.ug.edu.gh
.(.... ,.ywlJi 17X ..m oe malaria model 
All mice infected with P. )'MI/I 11X developed maJaria·related-symptoms, which 
included appearance of ruffled hair. shivering and ataxia by day 8 post infection. 
PerccnIIF parasilemia in mice "'-ere approximllely 12o/e and 32% for 300-500 RBCs 
COUIlI at day 6 and 8 post infection respectively. Examination of the viscera ofdislected 
mice confirmed spleno- and bepato-megaly at peak parasitemia (Figure 9) concordant 
with reported P. yoelli 17X malaria infections (Kaul el al.. 1994). None of the control 
mict' showed aD)' oftbese signs. 
University of Ghana http://ugspace.ug.edu.gh
f"tpre q. p.,.m t7X i.rec:tkMI i.d.cft ,,teIlO-MpatO-.qaly i. SW .-iu Fe'" 
:,oldu W,bSIt, (!WJ IItia WltU inpckd UtITa-ptenlotwal/y wllh Ifl (JOOJ,J1) of P. JIM/it 
P. )'Olin J7X ctJllJI'.l syndrome_, In SW nuce charact~nz~d w"h $plt no-Iwpalomegaly aI 
""'pDfIi!rfoctiolt(peokpara.ute""uJ 
II 
University of Ghana http://ugspace.ug.edu.gh
4.2 TraDscriptional InalysiJ of P.yoelii 17X induced immunomodul.tor mRNA 
expression 
4.2.1 eDNA array gi!oe slatemenl aad analyses of P.y«1ii 17X induced 
immuDomodulaton 
P. J«/ii 17X·attributable alterations in approximately 7.5% (42/588) of genes encoding 
lmmuno-modulators. growth factors. stress factors. transcription factors, and 
neurocransmiuen; wen:: observed aD the micro-array analysis of brain samples. 
Exprenion of the altered genes at peak parnsitcmia in the infected mice varied when 
compared with that in the uninfe<:ted mice, showing anything from 2.0-fold down-
regulation to 23.0-fold up-regulation (Table 4 and appendix viii). Marked alterations in 
expreiSioo of immunomodulator mRNA including adhesion molecules; PECAM-l, 
(CAM-I. and VCAM-t, cytokines; INF-y, TNF-(l. IL-12, and iNOS, C-C chemokioe; 
MIP-2a, MCP-I, and RANTES. C-C chemokine receptor; CCRI. CCRl. and CCRS. 
growth f.acton; growth differentiation factor 2 (GDF-2), and tumor growth factor beta 
(fOF)-P precursor. were observed to be 2.0 to 23.o-fold upregulated (Table 4. P < 0.05) 
at peak parasitemia whereas GAPDH levels remained unchanged. Semi-quantitative RT-
PCR was performed to specifically examine lhe expression dynamics of selected 
immWlOmoduiator gene expression during P. yoelJi t 7X malaria infection to validate the 
microuraydata. 
89 
University of Ghana http://ugspace.ug.edu.gh
~.  . I 
• ~ • . • ...i;i   
J• ~#  !.. -a .......... . ~ ...... : __ ., .... •
Figure 10: Autoradiograph of eDNA microarray analysis of mRNA npression in 
mou!e braiD (day 8 po~t·infeclioD). Five hundred and cighIy eight (588) reported genes 
'tIIIn anaJyud. J}P_IQ~lItd eDNA were prepared from 5J1g each o/Iotal RNA from 
infocled t1IId unlnfocted mOUSt brain. The probes were hybridized by autoradiography. 
DijforenJiaJly UfXtlUd genes were reproducibly detected. Arrows indicate so~ 
differences In paltern 0/e xpreSSIon between infecled and uninftcted membrane 
90 
University of Ghana http://ugspace.ug.edu.gh
TaMe 4: Pld.n'ItOdi"')06111 17X infection alters Immunornudulator sene expreSSloo in 
mouIebrainatpeM,*",itemia(day8posHnfection) 
GENE FOLD CHANGE DESCRIPTION OF GENE 
NAME EXPRESSION 
PECAM-I 23.0 Platelet Endothelia Cell Adhesion Molecul~ 1 
MlP-2a 11.0 Macrophage Inflammatory Protein-2 alpha 
ICAM-I 13.0 lntercellularAdhesionMolecule-1 
MeP·1 7.0 Monocyte Cbemoattractant Protem.1 
VCAM·I 6.0 VasculatCeIlAdhesionMolecu.le-1 
IIAN1CS 6.0 Regulated upoa Activation NormaJ T cell EXJnssed 
aDdSeaeted 
INF·y 6.0 Interferon-pmma 
lNF-a 5.0 TtmlOrNecrosiJFactor-alpba 
JL.12 4.0 1n..,leukm-12 
CCRI 4.0 C.cchernokintrcceplorl 
CCR} 4.0 C-Cchemokinereceptor) 
CCR5 4.0 C-C chemok.ine receptor S 
INOS 4.0 Inducibte Nitric Oxide Synthase 
GDF·2 2.0 Growth Differentiation Factor 2 
ZO-I 2.0 Zonula Occludin-I 
GAPDH 0.0 Glyceraidehyde·3·I'bosphat<Deilydrogena$c 
eDNA nticroarray ana/)'J/$ of P.yoelii 17X infected OM uninf«ted mOUle brain. Gene 
IlIItd wen o/llrN/ > J.5 fold of peak parasitemia. Fold change In expression Is defined 
as GAPDH 'fOrmalized mRNA expression 1'01;0 of gene signals o/Injecled to "",Injected 
91 
University of Ghana http://ugspace.ug.edu.gh
4.2.2 Semi-qu.ntitative RT-PCR validation and analysis of immunomodulalor 
gt."ne el.pr~sion duriD2 P.yoe/ii 17X infection 
4.1.2.1 AdbesioD Mol«ule-PECAM-l,ICAM-l, VCAM-J mRNA espressioD 
Adbesion molecules, PECAM· I (IOO·bp), ICAM·I (106·bp) and VCAM·I(102·bp) 
mRNA expression wert' induced by P.yo~1ii 17X infection and were significantly 
upregulaled in the brain at peak parasitemia. Ingenera1, induction of these markers began 
day 6 until day 8 post infection. 2-4 fold upreguJation over control (Figure 11-13). Semi· 
quantitative analysis also jncficated relatively high upregulation of mRNA of PECAM-I 
aod (CAM·! IIwl VCAM·1. PECAM·! , !CAM·! and VCAM·! exp ....i on by 
Illlcroanay data were markedly pronounced compared with semi-quantitative PCR data. 
Microamay experiment is based on hybridization of mRNA sequences; therefore less 
complemenlaly sequence couJd bind to inunobilized sequence on membranes and can 
provide results with significant upreguJation of mRNA. PCR ensmes that primers flank 
mRNA splicing regions and generate specific ampticons for gene of interest. Generation 
ofoolt-specific amplicoDS is eliminated or minimized. It is therefore not surprise that 
microarray data for mRNA for PECAM-I, tCAM-1 and VCAhr1-1 are higher than semi-
quantitativePCRdata. 
Histological analysis using antibodies against tCAM-t and VCAM-I has shown that 
there was greater expression oCICAM-I in capillaries and small venules of P.yoellll7X 
infected mouse brain than VCAM·J (Sbear et al. , 1998). Similar pattern in terms of 
mRNA expression was observed in this study. The level of expression of these adhesion 
molecules increased with time after lnfection, corresponding to the increase in 
parasitemia 
92 
University of Ghana http://ugspace.ug.edu.gh
========= 
F"lgUR 11 : P. ytW/ill7X upregulates PECAM·I mRNA expression in mouse brain at 
d.,. , aDd 8 posl-infedioD. Seml-qumuirolive RT-PCR comparative analysis ofa dhesion 
molecule. PECAM-I (IOObp) mRNA expressions in brains of P.yoelil J 7X Injected (1, 
blade bars) day 2. 4. 6 and 8 post-injections and control (C. grey bars) mice. DOlo 
pnsen/ed are fMtuU and standard rkviations of duplicate experiments and were 
ftOr1It/JJtud to GAPDH expression. 
93 
University of Ghana http://ugspace.ug.edu.gh
Figure 12: P. yoelii 17X upregulates (CAM-l mRNA expression In mouse brain at 
day 6 and 8 post-infection. Semi-quantitatlve RT-PCR comparative aJUltysis ofa dhesion 
mol6cu1e. ICH1-1 (I06bp) mRNA. expressions 'n brains of P.yoeliJ 17X infected (1. black 
btlrl) day 2. 4, 6 and 8 post-infectIOn:; and control re. grey bars} mice. Data presenled 
on IIWmU and nattdard deViations of dwplicale experiments and were normalized to 
GAPDH expresslo" 
94 
University of Ghana http://ugspace.ug.edu.gh
Figure 13: P. Joe/Ii 17X upregulates V('A.1\1-1 mR."'IA expreS!liOD in mouse brain at 
day 6 aad 8 pOit-iafeetion. &mi-qUlJl1Jitative RT-PCR comparative analysis ofa dhesion 
molrnJe VCAM-/ (I01bp) mRNA eI{J'essioIU I" brains of P,yoelii 17X infected (1, black. 
bars) day 1. 4. 6 and 8 post-infections and control (C grey bars) mice, Data presented 
are means and slandmd deviations of duplicate experiments and were normalized 10 
GAPDHexpression 
95 
University of Ghana http://ugspace.ug.edu.gh
4.2.2.2 Cytokioe-INF-y, TNF-o.. lL-12 and iNOS mRNA expression 
Upo<gWat;on or 1NF-1 (98-bp) and TNF-a (I00-bp) mRNA began early after day 2 po5I-
P yoelii 17X u.r«tion while IL-t2 (t02-bp) and iNOS (I0t-bp) Slarted after day 4. INF-
y (type U interferon) was significantly induced in infected mouse brain 81 day 6. 
approKima1ely 5 fold over control and declined to about 2 fold increase at peak 
parasitemia (Figw-e 14). Type D interferon is important in clearance of pathogens in bost. 
INF-, was highly iDduced at the initial phase of infection presumably to activate 
macrophaaes and natwaI killer (NK) celis to enhance their activity against the malaria 
parasite. 
After day 4 posl-infection, TNf-a and IL-12 mRNA expression were upregulated over 3 
fold in infected mouse brain compared with controls (Figures IS &. 16). Meanwhile there 
wu only • marginal iDcrease (less than 2 fold) in iNOS mRNA expression in infected 
moux brain rell1ive to control (Figwe 11). 
96 
University of Ghana http://ugspace.ug.edu.gh
·1_ P)~"'I7X",.a", I 
5 ~Ctlll'llr<UdCllJlra 
D. 
21 X 41 4C II IIC =---... 
:ute 14: P. y«1iJ 17X upreguiatell INF·gamma mRNA expression in mouse brain 
day 6 and 8 pOd-infection. Semi-quantitative RT-PCR comparative analysis of 
okine INF-gamma, (98bp) mRNA expressions in brains of P.yoelii 17X (I. black bars) 
~ 2, 4. 6 and 8 posl-infections and control (C. grey bars) mice. Dala presented were 
ans and standard deviations 01 duplicate experiments and were normalized 10 GAPDH 
97 
University of Ghana http://ugspace.ug.edu.gh
_ !>.,~ ,n! - I 
~ l-"'"<~It,1,,·n .-''' 
' i - - -1] 
ill. 
Fipre IS: fI, JIO,IU 17X upreKUlates TNF·alpha mRNA cxprtssion In moule bram at 
TNF.Q/pita (/00bp) ",RNA. txptreSSjOfU ill bNnru of P.jWliI / 7X infected (1, black. IKIrs) 
." 2. 4. 6 tIIfd 8 posl-iff.foctions and control (C, gny ban) mice. Data presented were 
mt'OI'U and slcmdard t;kvjations ofd uplicate experiments and were normalized 10 GAPDH 
University of Ghana http://ugspace.ug.edu.gh
f: 
! " IDJDJr ~J I' • ," 
o.,s~taIt4' .. 
FlSIft 16 __ P. yodii 17Xupregulates 1L-12 mRNAexpression in mouse brain at day 6 
1M 8 po.t• •r edio .. Semi-quantitative RT-PCR comparative analysis of cytOldM 11..../2 
(102bp) mRNA expressIOns in brains of P.yoelii J 7X infocttd (/, black bar~) day 1. 4, 6 
and 8 pMI-infoctkms and l.'onIroi (C. grq bars) mice. DaJa presented were means and 
sJllIIIilvd devlolions of dupl/CQle apni",rnts and wer~ normalized to GAPDH 
uptusiOll. 
99 
University of Ghana http://ugspace.ug.edu.gh
Figure 17: P. yoelii 17X induced iNOS mRNA expression in mouse brain at day 6 
and 8 post-infection. Semi-quantitative RT-PCR comparative analysis of iNO S (I0lbpj 
mRNA expressions in brains of P.yoelii ) 7X infected (1, block bars) day 2, 4, 6 and 8 
post-infections and control (C, grey bars) mice. Data presented were means and standard 
tietJioJions ofd uplicate experiments and were normalized to GAPDH expression. 
100 
University of Ghana http://ugspace.ug.edu.gh
4.2.2.3 C.~OkiDe- MIP.2alpha. Mep-I. RANTES mRNA expressioD 
MIP-2aJpba (94-bp) and MCP-I (I00-bp) mRNA expression were induced by P.yoelii 
17X after day 4 post infection (Figure 18 & 19) while expression of RANTES (97·bp) 
mRNA began after day 2 (Ficure 20). This indic.tes early mRNA expression of 
RANTES compared (0 MIP-2 alpha and Mep-I during P.yoelii 17X infection. MIP· 
2a1pba. Mep-I and RANTES were up.-egulated 3-4 fold in ~ted mouse brain 
~witbOOOlrobatday6and8pos1infection(Figures 18.19&20). 
101 
University of Ghana http://ugspace.ug.edu.gh
Figw-e 18 P. yoelu t7X upregulates MIP-2alpba mR.~A expression in mouse braiD 
at day 6 ud 8 post-infcdioo. Semi-quontitotive RT-PCR comparative analysis of 
chnto/dne MlP-2aJpha. (94bp) ",RNA expressloM I" brains of P.yoelii I7X Inficled (/. 
block bars) day 2. 4, 6 and S posl.injections and control (C, grey bars) mice. DaJa 
preserJted were means and standard deviations of duplicate experiments and were 
nonna/lZed to GAPDH expression 
102 
University of Ghana http://ugspace.ug.edu.gh
.~-  I 
r~k1 
Pipn 19: P.y«1U 17X upregulates Mep-) _RNA CJ.pr~sio. iD mouse brai. at day 
6 ••d  8 posl-lDfedioD. Sem,-quanIllQlIw: RT-PCR comparatil'r mUJlyli. of che",olrine 
MCP-/ (lOObp) mRNA expressions in brains of P )'oe/ii /7X infected (1, black bars) day 
2. 4. 6 0IId 8 post-infections and COnlP'oI (C. grey ws) mice. Data preseru,d ~re meQlfS 
cwl IkINJtJrd ~ of drfJ/icate ~ritMnlS and were nonnalized to GAPDH 
10) 
University of Ghana http://ugspace.ug.edu.gh
G.lJ'IHi IDp 
c+ np 
.. lC 41 «: II a: II Ie 
Figure 20: P. yoetii 17X upregulates RANTES mRNA expression in mouse brain at 
day 4, 6 and 8 postwinfection. SemiwqUQlllitalive RTwpCR comparative analysu of 
chtmolorM! RANTES (97bp) mRNA rxprenion$ in brains of P.yoelii / 7X Infected (I, black 
INn) da;v 2, 4. 6 and 8 poslwinjecliofU and control (C. grey bars) mice. Dala presented 
'!VUt means and standard ckvia/iom of duplicate experiments and were normalized to 
GAPDHerpresslon. 
104 
University of Ghana http://ugspace.ug.edu.gh
4.2.2.4 Cbr.okiale Ifteptor-CCRI. ccru and CCRS mRNA upression 
A1lthtee C-C .bemokine recop""" CCRI (lOl-bp), CCRJ (96-bpl and CCRS (IOO-bp) 
analyzed. were significantly upregulalcd al day 6 and 8 post-infection (Figures 21, 22 & 
23). Messenger RNA expression levels of these receptors at day 6 and 8 post infection 
were 2-3 fold upregula1ed in infected mouse brain compared with controls. Messenger 
RNA expression of these receptOrS followed a similar pattern of their corresponcting 
RANTESligand. 
105 
University of Ghana http://ugspace.ug.edu.gh
I 
Ir:"L:'-~dJt~ 
o 1 6 8 to 
Dr"der~CIII 
Fiaure 21 __ P. yoe/ii 17X upregulates CCRJ mRNA expressioD in mouse brain at day 
6 aDd • polt4 iD'«tiOn. Seml-quarrtitot;Vf! RT-PCR comparative analysis of chemokin~ 
receptor cell (lOJbpJ mRNA expressions in brains of P.yotlii 17X infected (I, black 
bars) day 1. 4. 6 and 8 post-injections and con/rol (C. grey bars) mice. Data presented 
Wfre "'eam and standard deviations of duplica/e experiments and were normalized 10 
GAPDH expression 
106 
University of Ghana http://ugspace.ug.edu.gh
name 22: P. yoelii 17X upregulates CCRJ mR.1\jA expression in mouse brain.t day 
6 aDd 8 post-iafectiolL Semi-quantitative RT-PCR comparative analysis of chemohlle 
reel"'", CCRJ (96bp) mRNA upressiotU in braiIU of P.YMIIi 17X infected (1. black 
INn) tIDy 2. 4, 6 and 8 post-injections and control (C, grty bars) mice. Data presented 
WC7'e IftN1IS and sltmdmd deviations of duplicate experiments and were normalized 10 
GAPDH expre.u;on. 
107 
University of Ghana http://ugspace.ug.edu.gh
Figwe 23: P. J'oelii 17X upregulatea CCRS mRNA expression in mouse braiD at day 
6 aM 8 po~t·infedio • . Semi~qflanlitative RT-PCR comparat''I.'e anolysis of chemokine 
ret:q1Iot' CCR5 (lOObp) mRNA expressions in b,aim of P.yoelii 17X infected (I, black 
ben) day 1. 4. 6 and 8 post-infections and control (C. grey bars) mice. Data presented 
WffY means and standard deviations of duplicate experiments and were not'tnQlized 10 
GAPDH expression 
University of Ghana http://ugspace.ug.edu.gh
4.3 Tissue and plasma prolein e.s:pressioD of P.yoelii 17X induced RANTES 
4.3.1 P.yoelii 17X induced RANTES prolem e.s:pressioD 
Resu1t.s from the Western Blots analysis indicated the expression of RANTES (?8kDa) 
protein in brain tissue samples from infected mice at day 4, 6 and 8 post-infection (Figure 
24). Expression of a-tubulin ('housekeeping') gene was similar in both infected and 
uninfected control samples. Expression of tissue RANTES protein follows a similar 
profile to the transcript expression. This is an indication that tissue RANTES mRNA 
expressions in P.yoelii 17X infected mice are translated into protein. Brain tissue 
RANTES protein expression in infected mice was approximately 2-3 fold upregulated at 
day4,6and8(Figure24)comparedwiththeexpressionintheuninfectedcontrolrnice. 
109 
University of Ghana http://ugspace.ug.edu.gh
·.,~ I 
rJ I 0' Wuj' 
o 
• ' j 6 I .. 
:'=IC=.="'=.: IC:.=IC:--"D~ 
rtpR 24: 1'. yoelii 17X infection upregulalcs RANTES protein npressiob in mome 
brabl at day 4, 6 aDd 8 pod-infection. Comparative analysis of RANTES (1,8 Wo) 
prrHml UJKeSS'Off lit bra;" (jullt samples from P. )'M/II J 7X Infected mice day 2, 4. 6, & 
8 post injutio" (black baTs) l'tfSUJ IIl1injecled controls (guy bars). Brain tiSSlU! protein 
s~ /rom ir(ected and unmfecled mice were tmalyted lor RANTES expression by 
WeSknl Blot. Data presented were means and standard deviations of duplicate 
University of Ghana http://ugspace.ug.edu.gh
4.J.l P.y«lii 17X iaredioD induce RANTES npre.ssioD in plum a 
Levds or plasma RANTES expression was dctcnnincd at different stages of P. yoelii 
17X infection by ELISA. As shown in figure 25. expression of RANTES in plasma began 
al day 4 after infection.. until day 8 post infection. RANTES levels in plasma were) times 
maher in P yoelii 17X iofected mice at day 8 than in controls. Systemic RANTES 
expralioo in plasma appeared to follow similar pattern as observed in the brain dwina: 
tbeinfC<tion. 
University of Ghana http://ugspace.ug.edu.gh
Fipre 25. P. YOI!Iii t7X inrection upreKUlates RANTES protein expression in mouse 
plasma at day 4, 6 aad 8 post·iofedioD_ Comporalive analysis of RANTES expression 
inpiasmaofP. yoeW J7Xinfeciedmice day 2, 4, 6, & 8pOJt infemon (black bars) VO'SUI 
IIIIiJtfocIU controls (gr-ty bars). Plasma samples from infected and uninfocted mice were 
wroiyzed for RANrES expression by EUSA. Data presented were means and standard 
deviQtionsojduplktJIel!xperiments. 
University of Ghana http://ugspace.ug.edu.gh
4.4 UltnlItrumral aDd immunobistologicalanalysis of P.yoe/ii 17X iofmed 
braiosa. .p les 
4.4.1 Ultndlructural sD.lysis of P.yoelii 17X infected braiD samples 
Braim from parasitized mice were ultra structurally analyzed by transmission electron 
microscopy to evaluate effects of P. yoelil I7X infection on brain micro vessels at peak 
s--itemia (day 8 post infection). The result shows that uninfected mice (Mas. XIS) 
haw: aonnallDtact rnicrovessel endothelia (ME) at blood brain barrier (BBB) while some 
infected mice (Mag. X15) show disintegrating ME and in certain parts of BBB (Figure 
26). Although parasitized RBes were observed in the distal microvasculature of infected 
mouse bnUn. evidence of extensive erythrocytic (RBC) adherence in micro vessels was 
not observed as expected for the 17X strain of P. yoe/iJ. 
113 
University of Ghana http://ugspace.ug.edu.gh
Figure 26. P.¥«lii 17X iIIduceJ ultra .truchlral cbanges in mouse cerebellum at peak 
pua5itnJIia (day 8 poIt-infectioa). Certbttllum from pal'tBilized miet WCIS ultra 
muChlrtlllyllftQ/pH by trQrumUSlon electron microscopy ro evaluate effecrs ofP .,wlii 
17K u,foctlon on brain micro Yessels. Uninfecred micf1 (Mag. XIS) 1mw norma/lnract 
micro 1.Ie3Sel endothelitJ (ME) at blood brain barrier (BBB). Infect,d mice (Mag. XIS) 
show disiltltgrGIinJ ME and BBB (16TII. ...) . 'Thtre Waf no evidence of exr~n.Ji\~ 
lI'}IIhrot:ytic (RBC) adlft'reftCt In micro vessels ofP . yoelii 17X 1traln. 
114 
University of Ghana http://ugspace.ug.edu.gh
4.4.2 IlDlPuDohistological analysis orGFAP expn .. sion in P.yoelii 17X infetted 
mousebraia 
The effect of P.yew/ii 17X infection on astrocyte expressions in mol1!le brain waa 
evaluaccd by immunohistology using antibody againSi GFAP, which is a specific rurker 
for utrocytes_ Results demonstrate that OF AP W<b upregulated in P.yoelli 17X infected 
mouse braiD (Fipre 27) compared with control. Upregulation of GFAP indicates 
activation of aIb'oc)1eS dwing the infection. 
University of Ghana http://ugspace.ug.edu.gh
Fiprt 21: , .yoeUi 17X upr~a:ulates (;FAP npressioa 5a moult: br• • at p~ak 
parutte. .. (day' post-lafu:tIoo). GIUJI fibrillary «idic prokItt (OFA P) ww antJlyzed 
ill P.yottIli 17X ;nj,clfti and u"ittfocW 1IIIOILff' brabf tlSl", QIfII-GFAP 111ft/bodies. 
P.)IOfIIU 11K iff/retN brain stlllfpla ,/tow, high GFAR immunoreactl"ity compared with 
University of Ghana http://ugspace.ug.edu.gh
4.5 HUllIanaaalaria.tudies 
4.5.1 Posl-morte. eM aDd NM brain samples 
A Blantyre coma of 3 or less during severe malaria. in the absence of other causes of 
unconsciousness, such as hypogJyctmia. meningitis or other encephalopathy, was used to 
define cerebral maJaria (WHO 2000). The non-malaria cases. used as controlJ. had no 
hiiIoryofneurological illness. Prior to deaths, the CM cases had been febrile and hyper-
~1Iitnlic (38,213-87,570 Pfolciporum parasitesfJ.LI). Examination of the brain 
sampks revealed numerous rins-form-infected erythrocytes in the cerebral microvascular 
eudomelia of the eM but no infected erythrocytes in the cerebral microve!sels of the NM 
CI5C8(Prof. Andrew Adjei personal communication) 
117 
University of Ghana http://ugspace.ug.edu.gh
4.5.2 TnascriptioaaJ analysis of RANTES. CCRI. CCRJ aDd eeRS mRNA 
expressioo i8 «rebeUulD. cerebrum. braiD stem and bippoc:ampu!I of eM and 
AI expeeted, the 1e. .1  of GAPDH (226-bp) mRNA expiOSSion in the CM samples was 
the same as;n the NM. A1thougl> the level ofCCRI (130-bp) mRNA ... ,....;on was .... 
.urular", all of"" b"';n samples, express;on ofRANTES ()54-bpJ, CCRJ (193-bpJ and 
CCRS (I0t-bp) mRNA were significantly higher (P < 0.0001) in the cerebellum (Figure 
28) and cerebrum (Figure 29) from the eM samples tlwl in the corresponding samples 
&om &be NM controls. The expression of RANTES mRNA (but not thai of CCRJ and 
CCRS mRNA) was also slightly higher in the samples of brain stem (P<O.OO27, Figure 
30) and hippocampus (P ... 0.OOt8, Figw-e 31) from the victims of eM than in the 
conapoodina samples from the NM controls. 
1D IDe samples of cerebellwn and cerebrum from the CM eases, there was a direct 
~lItioaship between the (up-regulated) expression of RANTES mRNA and tbIt of each 
corresponding receptors (i.e. CCR) and eCRS). 
III 
University of Ghana http://ugspace.ug.edu.gh
_ c.tiDid1ll ptt.1l4IOI 
_)Nand 
5 Cerebellum --"" ----
-,--, ...  .... .. ,. . 
Figure 28: eM upregulates RANTES, CCRJ and CCRS mRNA expression i. 
cnebelham. Semi~wmI"ali\'e RT-PCR comparative analysis of RANTES (/54bp). CCRJ 
(lJObp). CCRJ (19Jbp). and CCR5 (lOlhp). mRNA txpI'ession in c ...h ellum ofh_n 
pon-"""~,,, CM-irrfected (black bQTs) and NM (grey bars) c01tlr01 brain tissue samplel. 
lNtttIlDmetric dola presented were log-transformed (to adjust for small sample size) and 
repnunl the Non and :t SEAl of duplicates CM (11 - 12) and NM (11""6) ctJS~s. 
1ttInIftIIlud 10 thou/or GAPDH (226bp). Alterisk(s) Indicate statlsllcally 
sipific01tl differences between CM and NM groups. 
University of Ghana http://ugspace.ug.edu.gh
----,----,--
_-101" 
Figw-e 29: eM upregulates RANTES, CCRJ and CCRS mRNA expression in 
ecrebrullL Semi-qllOnJitative RT-PCR comparative analysis of RANTES (I54bp). ceRl 
(JJObp), ceRl (/9Jbp), and CCR5 (lO/bpJ, mRNA expression in cerebrum of humon 
post-Morte", CM-Uifeclfti (black bars) and NM (grey bars) control wain tissue samples 
DnuIIoMeftlc data presented were log-Iransformed (10 adjust for small sample size) and 
represenl the mIlQn and r SEM oj dvplicales eM (,, - 12) and NM (,,=-6) cases, 
ttOmtGJJzed 10 those/or GAPDH (126bp). As/erisk(s) indicate Itatistically 
si"'~a1U diJforences between eM and NM groups 
120 
University of Ghana http://ugspace.ug.edu.gh
Brain stem 
Figure 30: eM upregulate!!l RANTES mRNA expression in brain stem. Semi-
qUQII/itative RT-PCR comparative analysis of RANTES (J54bp). CCRJ (J30bp). CCRJ 
(l93bp). and CCR5 (I01bp). mRNA expression in brain stem of human post-mortem CM-
infected (black bOTS) and NM (grey bOTS) control brain tissue samples. Densitometric 
data presented were log-transformed (10 adjusl for small sample size) and represent the 
_an and :tSEM o/duplicates CM (n=/2) and NM (n '=6) cases. normalized to those/or 
GAPDH (226bp). Asterisk(s) indicaJe statistically significant differences between CM 
andNMgraups. 
121 
University of Ghana http://ugspace.ug.edu.gh
Hippocampus 
Figure 31: eM upregulattll RANTES mRNA expression in hippocampus. Semi· 
qUDllrirative RT-PCR comparative analysis of RANTES (l54bp), CCRJ (l30bp), CCR3 
(/93bp), and CCR5 (lOJbp), mRNA expression in hipocampus of human post·mortem 
CM·ln!ected (black bars) and NM (grey bars) control brain tissue samples. 
Densitometric dJJta presented were log-transformed (to adjust for small sample size) and 
reprtsent tM mean and ~ SEM of duplicates eM (n= J1 ) and NM (n=6) cases, 
normalized 10 tlwse for GAPDH (126bp) Asrerisk(s) indicate statistically signijicanl 
diffirences between eM and NM groups. 
122 
University of Ghana http://ugspace.ug.edu.gh
4.5.3 Weltera Blet ud plasma aualyses of RANTES, CCRI. eCRJ and CCRS 
4.s.3.1 Wntfl"ll Blot analysis of RANTES. CCRI. CCRJ and CCRS proteiD in 
cerebeUum, oerebrum, braia steu aDd hippocampus ofCM aDd NM samples 
The Western blots analysis indicated that the expression of RANTES and CCR5 proteins 
ill boCh cerebellum (P < 0.00 13. ficure 32) and cerebrum (P < 0.000 I, Figure 33) were 
abo sipificantly higher for the eM sampla than for the NM. Expression of a-tubuliD 
rhous<keeping .....J  was unchanged as expected in samples anaIy=!. Although Ihe 
I'CiUits of the transcriptional analysis indicated up-regulation of CCRJ in the samples of 
cerebeUum and cerebrum from the eM cases. CCRJ protein could not be detected. by 
western bkltting in the same samples. 
123 
University of Ghana http://ugspace.ug.edu.gh
Fi,aure 32: eM upregulates RANTES and CCR proteiD expression in cerebellum. 
SDS-PAGElWesJern Blot tkmolUfra/ing upression oj RANTES 0.8 1cDa) and CCR5 
(4(J,O kDa) in cerebtllNll'l oj human pos"'1fortem CM (bloc! bars) and NM (grey bars) 
brabf so.pks. BlOIs lW!re probed wilh RANTES and CCR5 antibodies. Densitometric 
dMo prese",'" were log·rromJonned (10 adjust Jor small sample size) and represent 1M 
""mln:tSEM oJdMpIica/es CM ('1"12) and NM (n - 6) C(J.fes, ntNmo/iud 10 lhose/or 
a·,lIbWiIt. Expnuion aJ Cf-lUbulin (55.0 kDa) was unchanged in eM and NM. 
124 
University of Ghana http://ugspace.ug.edu.gh
Fiaure 33: eM .pucu1ateJ RANTES aDd CCR protein ~xpre5lioD iu cerebrum. 
SDS-PAGElWestem BIOI deMOnstrating expression a/ RANTES (7,8 kDa) and CCR5 
(400 kDa) in cerebellum of human post-mortem CM (black barl) and NM (grey bars) 
bn:rln samples BloIs were probed with NANTES and CCR5 antibodies. [Nnsilometric 
_ pruenl6d were log~trans/ormed (10 adjust for smoll sample size) Qnd represenllhe 
.-an and ::tSEM o/duplicates CM (n · 12) and NM (n~6) cases, normalized to thou/or 
CHIIbulin. Expression of a-tubulin (55. 0 kDa) was unchanged in CM and NM 
125 
University of Ghana http://ugspace.ug.edu.gh
4.5.4 P.jaJc"''' iaduce RA... .. TES es.prnsioa in plasma 
Examination of plasma RANTES expression by ELISA revealed that plasma from 
subjeds with P.falciporum antigms bad significantly higher (p < 0.000 I) level of 
RANTES than control subjects (Figw-e 34). 
126 
University of Ghana http://ugspace.ug.edu.gh
Fipre 34: P. /akipllrum upregulates RANTES expression in pl.sma ' Comparative 
tJIttJIysu 0/ IUNTES apresslon in pla~ma ofm alaria positive (n=-64) and control (n s /9) 
SNbjtclJ. Plasma sampl~s from P. falclparum irifectcd and control subjects were analyz~d 
for RANJ'ES expression by ELISA. Data presented were means and standard deviations 
o/tbJplkaJeexperiments. 
127 
University of Ghana http://ugspace.ug.edu.gh
4.5.5 Cornlatio. of RA.1'Ii/TES npresUoD with lIIal,ria iafection 
There was a positive com:lation between pluma RANTES expressions and malaria 
infecOoo (Figure 35). Though tbepreseoceofOlberinfections was not determined in this 
study, the COrrelatiOD ~lXO plasma RANTES and malaria infection was midly positive 
witb RZ • 0.093. Mathematically the correlation equation was determined as r1.30S + 
O.813X. TbiJ is ioterpreted as an increased in malaria antigens results in an incn:ued in 
RANTESnprcssion 
128 
University of Ghana http://ugspace.ug.edu.gh
1'.1 -U -.. U 
1'ipn135 _IWITES"",-D_ ....l tIveIJ with -1IJItiaea•  
...- ...... "'~_ ",,,-1IANTES (y-oxis) andmalarla 
...... f-zxbJ-_ramr the /_ Slllla8.0 Jtiftwrn.7Iwruu/16 
.. g pDIIIl/Mr _an ,.",...- by lire eqot;1IIan y-/.305 + 0.8/3% with Q 
"""""*",,,,R'-tl.09J. 
University of Ghana http://ugspace.ug.edu.gh
4.6 M.riDe ••I .ri.studies.2 
4.6.1 Role of R.ANTES in severity and survival during P.yoelii 17X malaria in mice 
SiDce results demonstrate that RANTES levels were elevated during P.)IOt/ii 17X 
infectjoQ. it was of interest to re·evalua.te the cow-se of infection when RANTES 
expression is blocked with anti-RANTES antibody. Mice treated with mock and anti-
RANTES antibodies ""-ere infected with P.yoe/il 17X parasites and parasitemia and 
mortaIiry analyzed. The parasitemia in mice treated with mock antibody was 
comparatively higher at day 8 (P < 0.06) than mice treated with anti-RANTES antibody 
(Figure 36). At day 8 post.infection (peak parasitemia), parasitemia in mice treated with 
mod antibody was approximately 35% of P.yoe/ii 17X compared with 23% of P.yoeliJ 
17X in mice ueated with anti-RANTES antibody (Figure 36). 
AI peak parasitemia (day 8 post infection) when most mice died, the survival in mock 
8D1ibody treated mice was 12% of seventeen mice compared with 42% of seventeen mice 
ill the anti-RANTES antibody treated ones (Figwe 37). Anti-RANTES antibody treated 
mictsurvived 6 days longer (day 14 post infection) than mock antibody treated mice 
iDd.icating that blocking of RANTES extended the lives of infected mice by probably 
deata5ingpamsitemia. 
Tbcre wu 30% change in survival al day 8 post infedion. Decrease:: (approximately 10%) 
in RANTES production effecu:d 30% reduction in mortality by day 8 post P.yoelii 17X 
i_(Figure38). 
The le\'d of RANTES provided in antibody treated mice that v.-ere subsequently infected 
with puasites was pealer (2-3 fold incrase) than wtinfected control mice at day 8 
130 
University of Ghana http://ugspace.ug.edu.gh
(Figtft 38). P )'oe/il 17X parasite infection in mice induces RANTES expression above 
nonnaI~ls. 
131 
University of Ghana http://ugspace.ug.edu.gh
~l r---
Io :- ~ I 
o 2 4 6 8 10 12 I' 
o.ysafi:eriiectioo 
Figw'C 36 COUrH of P.yoelii /7X iDfection to mock and anti-RANTES antibody 
trH.led ..i l:!e. M'IC« were ch4Uenged with para.ute (day 0) after they wert" treated with 
mQd and anil-RANTES antibodieJ. Le~'f!J ofp arasitemia was monitoredfrom th~ tail vein 
blood and counting at least 300 RBes under immersion oil. Data represent mean ± SEM 
of $-/0 counlS ~r pO;nI. Parasilemio was comparQ/ively high£r (p < 0.06) in mod 
aMbody (triDngular poifl/s) treated rhon in '"'ti-RANTES antibody (square paiNs) 
trllll«lmice. 
132 
University of Ghana http://ugspace.ug.edu.gh
o 2 • 6 a 10 
F"tpn 37: Sun-ivai of IItO(k aDd aDti-RANTES •• tibody treated mice. infetted with 
P.y«lii 17X pansitn. Miu wer~ challenged wl,h porasif~ (day 0) after ,Iwy w<re 
t/'tlJlt4 willi mod and Qn(j·/UNTES antibodies. Mortolity am symptonu of InfectiOff 
WUf dlkmliMd ;n ,och group. Twelve percent of seven/een mice treated willi mock 
GIIIjbody 'Ntre obit to survi~ compared with 42" of seventeen mice trealed with anli-
J.ANTES 1ftIhody, at puIIc pcrarUt",ia. Atfll-RANfES anllbody trtDIed ",/a were able 10 
_6days bqondpeakparos/lem,a(tkzy8) 
III 
University of Ghana http://ugspace.ug.edu.gh
Fpe 38: P. yodiJ 17X i.fedioll upregUlatH RMHES upreasion in plasma of 
RANfI::S npreSMOrf Ilf pluslrta of P. plil / 7X  mfocled mICe Irl!Cl/r!d with mock (blod 
~ and mn.-RANTES (blue bars) anhbodie$ wr:n.s u",n.focted controb (while baTs) 
I'knmo ~s from mjecled and IIImifecled ml(:e were analyzed for RANTJ::S 
apI1'INtfU. 
134 
University of Ghana http://ugspace.ug.edu.gh
CHAPTER FIVE 
DISCUSSION 
s.t P.y«Ui 17X ...r ine malaria studies-I 
Malaria-induced brain inflammation is mediated partly by complex cellular and 
immuoomoduJator interactions involvini co-rcgulators such as cytokines and adhesion 
mokcuJcs. However. the role of chemokines and chemokine receptors in malaria brain 
tmmlJDClll*hogmesis ... only been recently considm:d. The incomplete understanding 
oftbc ro&c of the immune response during malaria infection has becn partly responsible 
(or the tnabiliryto dewtop a succasful malaria \·accine. 
The brain pathology associated with malaria remains a major cause: of death with severe: 
, faJrj~ ia.fectioo.. Using experimental modtls has racililalcd a bctta undemanding 
of tlIe J*hogmc:sis of this syndrome and therefore better in1ervention strategies can now 
btdewlopcd to minimize or abrogate the $everity oCthe disease. Some experimental 
mockb of cerebral malaria have been identified, showing similar palhologjcal (el(Ul"Cl 
with that of bwnan eM. For imIaDce, infection of Rhesus monkeys with P. cOa/neyi 
i.odut.ed knobs on the surface of lnfected erythrocytes (Aikawa el aI., t 992). Grau ~I al. • 
(1917) have shown that lesions found in lhe brain of mal.aria-infected mice ArC' 
ebnct.riz.ed by endothelial damage. TbouiJ> P.yoelii infected rod blood cells do not 
dispI.y surface knobs, close adherence of infected Raes to brain endothelium was 
obIerved. by transmission microscopy. Mice infected with P.yoelil often develop bind 
IJ5 
University of Ghana http://ugspace.ug.edu.gh
limb paralysis; an observation which is in parallel with the srudy of comatose Mal.wian 
chikJJen who exhibited signs of decortication (anns or legs extended) during cerebral 
malaria infection (Molyneux elo1., 1989). Also, like P/alcipanmt, P.yMlII can invade 
both mature and immature red blood cells (Shear ~t aI., 1~8). Experimental cerebral 
malaria models may not exactly duplicate the brain pathological complications in hwnlJl 
eM due to genetic ... ariabons, but the COnunOD features of this pathology which is shared 
by both human and murine models justify the usc of these animal models in research to 
WIdenland disease c:onditions inhuman. 
In this SlUdy aU the mice infected with P. yoe/ii 17X developed malaria-related-
I)'mJ*lmI, which included appearance of ruffled hair. shivering with hind limb paralysis 
by day 8 post infection. Splcno-and hepa1o-megaly at peak parasitemia (Figure 9) was 
(.Ommon and concordant with reported P. yotlil malaria infections (KauJ el al. , 1994). 
Spl~ bepato-megaly (enlargement of spleen and liver), which have been observed 
to be important sympcoms of humanfalciparum malaria. develop as a result of deposition 
of malaria pigmentS in infected liver during the exoerythrocytic schizogony, and 
iocreMedphaaocytocyticactivityintbespleen. 
The compJemeruary DNA (cDNA) microarray resulu confirmed with semi-quantitative 
RT·PeR aoaJysis &om thit study revealed changes in expression of a number of new 
ilDlllWKmOdut.aontbll were previously unknOWD lObe associated with malaria-induccd 
taiadysfi.mction. Tbis study is the fU"St tha1 may lead to the developingofafingcrprinl 
for tni.n immuoopathoaenesis associated y,ith eM. eDNA microarray analysis allows for 
136 
University of Ghana http://ugspace.ug.edu.gh
~ oftbe mRNA levels for a large number of acnes simuitlDeOusly. thus 
providing a uxfuJ tool for identifying broll(l..spectrum changes in acne expression in cells 
aadtissues in response..,agiven Slimulus. Receolstudies with infectious l18ents sucb as 
SD/Jrfonella. ClUamydJa aDd TrypanosOftfo using eDNA microarray technology have 
revealed UDique gene-expression profiles (Oessus-Babus el al., 2000; Rosenbera et 01., 
1000. StiIeI el oJ •• 200l)whicb may be of unique diagnostic value. 
Among allered immunomodulator ~erre expression in the brain due to infection with 
P.yoelii 17X. in the current study are adhesion molecules. PECAM-I (23 fold), (CAM-J 
(13 fold) and VCAM-l (6 fold) at peak parasitemia. Temporal expression analysis by 
RT -PCR revealed that mRNA expression of these adhesion molecules began early during 
oIIoinf_.-Iy byday61nd pIaIeoued by day 8 post infection (Figures 11,10& 
13). II appcas that increase parasitemia during P.),oelii 17X infection resuJlS in increased 
expraROIlofthclCmolecules. 
PECAM-I biodI to platelets. and its exprnsion has recendy been reported to be 
upreplalod ill the post-mortem braiD tissue samples of Malawian cerebral malaria 
p8eaI:a (Waamer el aI., 20(3). AlIO, using antibodies againsllCAM-l and VCAM-I in 
otbcr studies have revealed an increased expreuion of these molecules in the 
micnwesselsoflhe braiD durioa murine malariI infection (Shearel oJ .• 1998). 
- exprossioo in<1s or PECAM-I, ICAM-I and VCAM-I may thereror< be 11\ 
IIl1pOltaIUcorrclatesofmalaria brain immunopathology. 
1)7 
University of Ghana http://ugspace.ug.edu.gh
GeDe expression analysis by eDNA microamlY have alJo revealed significant 
............ of mRNA exp<SSioo of cytOkiDes INF-y (6-fold), TNF-«, (s-fold) aod JL. 
12 (4-fold) at peak parasitemia in this study. Temporal expression analysis by RT-PCR 
Mve shown that expressIOn of these molecules started at day 6 and peaked .t day 8 post 
_(Fi_14,IS,andI6). 
1Nf-y mRNA expression "ti significantly upregulated at day 6 bu( declined to a lower 
1~lIday8po5tinfection.lNF-ybelongstotypellinterferonsandisessentiaJ(or 
parasite clearance during infection. There are other data which reinforce the importance 
of ••r 1y productioo of INF-y and TNF-o by T Iympboc:ytes ood natural killer (NK) cells 
iD paaaites clearance (Choudhwy, ~I aJ., 2000). Increued level of INF-y expression in 
IDOUIC braiD _day 6 in this study could be plltJy due to the early immune response 
IIKIlIrdedbythchoeltotheP.yoeWI7Xparasiteinfection. 
ItqJort by Grau (1992) indicated thai high TNF-u level is associated with the severity of 
malaria in bumana. A decrease in TNF-a level reportedly resulted 10 a reduction in 
dlll'lboo of coma in cerebral mal ..... in cbildml (Oi Perri et aJ .• t 9(5). More so. bi&b 
cxpraaoa of TNF-u receptor. twnor necrosis factor re«pCor-2 (TFR2) reportedly 
pNdiIpoxd rodents to experimental ecrebnl malaria (Stoelcker et al., 2002). Althougb 
the ICOpe of lhis study did noc involve analysis of TFRl, increased level of TNF-a which 
is Ilipnd for TFR2, in the brain in the current study could potentially increase the risk of 
malarial:nin~logyininfectedmicc. 
138 
University of Ghana http://ugspace.ug.edu.gh
A role for lL-12 iD early response against Pltumo(/iwn has been proposed. It may be 
iPvoIved in maki.nJ mice: resistant or susceptible; it may also possibly mediate pathology 
(SU el a/ .. 2002). Zhong &. StevenllOD (2002) demonstrated that IT...t2 exhibited 
jmmuoOreguiatory role to antibody-mediated immunity againit Plasmodium parasites. 
Url2 exprcssioo dwilll maluia infection appears lO be linked or act through INF~ 
produetion. IlA2 induces NK cells to produce lNF-y (Tripp el 01 .• 1993) which in tum 
activates mac:ropbages to present antigens to antigen-specific Tcells(Farra.elal., 1993). 
This type of immune response is involved in the clearance of microbia1 pathogens. 
upression of IL-12 together with INF~ in P.yoelii 17X infected mice in this 
investigation demonstrate the involvement of antibody and T cells mediated immunity 
during murinc malaria infoction. 
Cerebral malui8 is characterized by coma in patients with P./a/ciparum infection that is 
also accompanied by metabolic acidosis, seizures and hypoglycemia (Miller el al., 2002). 
ADimaJ. models have provided enough evidence implicating the role of inflammatory 
processes in the development of maiari. brain pathology (Brian el al., 2002). However 
DOt all lX'Oinflammalory cytokines are relevant for the development of the brain pathology 
~ with malaria Expression of [NF-y. TNF-a and n.-12 bave been identified as 
imrmIIloreguiatory cytokines in eM. Adhesion molecuJes and platelets induced immune-
mediaIed damage of vucular endothelium of the brain has also been reported (Lou el al., 
2001). With the ex~on ofINF.." which expression declined to a lower level after day 
6 IM* infection, expression of aU the other inummomoduJators were o~erved to be 
eImoedSladilyafterday4 until day 8 post infectioo in this SlUdy. 
139 
University of Ghana http://ugspace.ug.edu.gh
co+ T celli produce imaume mediators and it comprises of II leest two fuoctiooally 
__•  distingu;sbed 00 the bWsoflympholtine "",. .t ioo Ul Thelpe< I (fbI). 
("'F.y pn>ducUlg C)1Okine). and Th2 (11.-4 cyto)une, ceUs (Doaa" 01.,2001). Thl or 
Th2 ceO typcI have reguJatory functions in malaria. Recent report indicates that both Thl 
aDd Th2 reIpOIlIieS seem to be required to control malaria infection (Torre el 01 .• 2002, 
KoMyuhi el ai .• 2000). Increased expression of [NF..., and nA2 in the current srudy 
.., iDdic:aIes 1b I immune rcspoDSe ill P.yoelil t 7X infection. 
lDdutibie nitric oxide I)'IItbase (iNOS) mRNA was marginally expressed in mouse brain 
dwing P.yoelii t 7X infection compared with the other immWlOmoduJators. Though iNOS 
... been reported 10 pla)' a role in human CM (ManeeIW. 2000). its low expression in 
iIlfcctcd mouse brain in this investigation, suggests that it might not be one of the~:. 
moIccuIco mwlwd ;"lbe ;mmunopalholgy of P.yoe1il17X Ulfection. J( 
~..e~ 
This is the first report of the global profile as well as temporal expression studies 0 
lmmunomodulator gene expression in the brain at peak parasitania in mwine malaria 
model which demonstraIcd that. cytOkines, 00'"1. TNF-a. and 1l...I2 mRNAs were 
~y uprepaa.ed M day 6 and 8 post-infection. implicating these molecules in the 
immunoregulatory or immWlOpathogenesis dwing P.yorlii 17X infection. 
This S1Udy has also _ for the r"" time, IhoI MIP·20 (CCl), MCP·I (CCU) 
aDd RANTES (CCLS) chcmokme and receptors CCR I. CCRJ and CCRS mRNA! are 
importIIIt in P.".,,, 17X infection'in mi.ce. MlP-2a. MCP-I and RANTES are 
JIfOinflamnwory chemokines which are involved in chemotaxis of &eukocyteJ dwina 
140 
University of Ghana http://ugspace.ug.edu.gh
iDfection. CbemokiDes are UnmWloregulatory factors that play an Unportmt role in the 
~actiwtionandhaemalopoiesi50fleukocytes(KeaneelaJ. • I998.Ullaniel 
tJI. . 2001. 2003). Activation of cbemokines involves initial binding to specific. seven-
lJ"IIl5[DemlJrane..domain. G-(guanine-Duclcotide-b~proU'in-c:oupled recepIOI"S 00 
wget cells. lD respouae to a relatively higher concentration of chernokines al the site o( 
i!ljW')'oriDfection.leukocyteaareactivated to perform effector fwK:tions such as release 
of then granule CODIeDt5 and increase In c)10kinc production. Increase in mRNA 
expres:sioo oflNF-y.1NF-aaDd ll.-12 duringP.ywlll17X infection in the currmtstudy. 
oouJd be attributable to this phenomenon. Unique expressions of chemokines and their 
receptor! lnvolved intbe immunopatboaeoes.is of malaria brain pathology could serve as 
DCW markers for following the course and poiaibly predicting the outcome oftbe disease. 
The eDNA microcny analysis his revealed significant upregulation of MIP-2n (18. 
foId~ MCP·I(7·fold) one! RANTES (6-fold) oJ peak parasitemiL The results ofRT-PCR 
lIIII)'is indicate ilia! oJ day 6 and 8 pe. . infection (Figure>, 18. 19 & 20) mRNA 
expra$iOIlS of tbcae molecules are significaatly upregullled in infected mouse brain 
compared with controls, indicating tbm. these chemokines are involved io 
immunorcgulatory or immUllopathogenesis in P.)'Deli; 17X infected mouse. 
Expasioa by <DNA analysis has shown tbaI eCRI. CCRJ and CCRS, _IS for 
RAHrES wm also upregulated 4-fold. in infected mOllIe brain than in conttols. RT .PeR 
....,.. ~ opproximllely 3 fold incn:ase in mRNA (Figures, 21, 22 '" 23) 
expression oftbesc ~ors in mouse brain III day 6 and 8 poll infec:tioa.1n addition to 
141 
University of Ghana http://ugspace.ug.edu.gh
tbeir RANTES ligand. thcx receptors could be playing an important role in migration of 
imnnme markers into the brain in P.yMlii 11X infected mice. 
The cDNA microarray data showed a higher fold increase in mRNA expressions 
COIIIJIIred with the RT·PCR results. This discrepancy in cDNA array and RT·PCR data 
could be ataibutabk to sequence-dependent hybridization characteristics or variations 
wtUchareinherentiDhybridizationreactiolU. 
MCp.l aod RANTES in addition to CCRI and CCRS are ex.pressed by Thl cells. 
Trafficking of inflammatory Thl but not Th2 cells into the brain was reportedly mediated 
lqely by RANTES interaction with CCRS receptor (Zang el ai., 2001). Also the absence 
of CCRS ftteptor in P/mmodium bf!rgJ¥i ANKA infected mouse brain resulted in • 
reduced Thl cytokine production (Belnoue et 01., 2003b). The observed C'xpression of 
RANTES and CCRS in addition to INF-y mRNA in P.)loelii 17X infected mouse brain in 
this study demonstrated Th I mediated immune response and that factors capable of 
iDduciDa Thl respollSC couJd play an important role in managing malaria infections. 
RANTES is an inflammatory chemokine. Activated T lymphocytes, platelets and 
endoIbelial cells release large amoWlts of RANTES dwing infection. RANTES plays ID 
imponaot role in the maintenance and prolongation of inflammatory response during 
infcction. Macrophascs and other leukocytes release proinflammatory cytokm 
inducliaa: l'NF-a1lld n...-I which in twn promote the release of chemokines. A soluble 
sr-diem of these cbemokines within the tiuue recruit8 various cell types that expreu 
142 
University of Ghana http://ugspace.ug.edu.gh
recq1lOf5 for differad cbemokines. Expressions of all the C-C chcmokine receptors., 
eCR I , CCRJ and CCRS for RANTES were upregu)ated in the brain of P.yMlii 17X 
infected mouse. RANTES expression possibly enhanced the expression of its receptors. 
RANTES also binds to endothelial ~ll swflCC. where it acts as a sign post for immune 
_ (figwe 7). Repon by Sano et .1., (l998) deDlOllStt8ted !hot ICAM·I induce 
RANTES mRNA expression and also increase its protein synthesis and secretion by 
endochelial cells. P. yMlii 17X lnduced RANTES production. observed in the current 
srudy. poIIibly enbmccd by ICAM·I , could actiV8le leukocytes in the inflammatory siles 
10 iaduce intense inflammation to exacerbate the immunopathology of the diKUe. 
laveitiptions conducted by Belnoue et 01., (2003b) showed that. brains of wiJd· type 
mice with mW"ine cerebral malaria have significant levels of CCRS. a chemokine receptor 
for RANTES. impItcating these molecules in the pathological conditions in the brain 
lIttra.structur analysis of mouse braio by transmission clectroo microscopy at peak 
paruitcmia in thiI study revealed msinlegrltina microvesscl endothelia layer at the blood 
braiD barrier in the cerebellar reiPOIl of infected moU5e brain (Figure 26). Infected RBe's 
occIIdiDi the micfot..eaels of the braio was also observed. This breach in microvestels 
ca:iodIdiaI t.yer could be associated with the action of RANTES. Perivascular oedema 
- ., observed in this region of infected mouse brain as a result of endothelial cell 
dImIec which bas allowed l)11lpbllic aod ocher tiS3ue fluids to move acros.s the blood 
braiD barrier. Endothelia cells lRteractiDa with P.yoelii 17X parasitized RBCs can be 
~ to produce IIld present specific cbemokines, such IS RANTES, which can hft 
143 
University of Ghana http://ugspace.ug.edu.gh
CCRI. CCRJ IIIId CCRS cells infO the brain (pober ef aI •• 1991). CCRI and CCRS 
m:eptors arc expressed by brain endothelial cells (Dzenka el 01 .• 2001 . Andjelkovic et 
ill. . 2(00). BraiD endotbdial OOls. microglia and astrocytes express CCRS receptors 
(Berger et 01., 1999) and could be playing a role in the brain immWlOpathology dtuing P. 
>«1" l1X infection. The binding of RANTES to its receptors on these cells can serve to 
further activale them and enhance the breakdown of the microvenel endothelia, as 
obtcm:Id in infected mouse brain in the cwrenl investigation. 
ImmuaohiJtological analysis revealed bigh reactivity to glial fibrillary acidic protein 
(GFAP) ia P.yoelll l1X infected mouse brain. High GFAP expression is an indkation of 
activadou of utrocytes in infected mouse brain. Astrocytes are involved in the 
developocot ofllSb'ogiiosis (iocrease in astrocytic proliferation and hypertrophy) which 
could ad to nauodegeneration (Wilhelms50o el 01., 2004). Also, astrocytes are 
sigruflCallt soun:e of RANTES in the brain (Kim et aI .• 2004). 
a.ed 011 this observation. this report sugge~;ts that. P.)'wlii 17X-induced atrocytes which 
it • greaI source of RANTES will potentially induce astrogliosis. leading 10 brain 
iIMluoopalhologjc:aloornplicalions 
CIIrmokinea hive bceo Ihown to have a direct Mtiprocozoal activity for three protozoans: 
T~ gontlJi, uishmonia donovatrJ and Trypanosoma cruz; (Mannheimer et oJ., 
1996, Villalta tl aI .• 1998). Chemokine production is important for host defense against 
iDfectiOll. However, excessive production is deleterious to the host. It bas been observed 
tbalCC ~ sucb as MIP-Ia. MIP-IP and RANTES '"" significant1y upregulated 
144 
University of Ghana http://ugspace.ug.edu.gh
in brains of Trypanosoma brucei brucei infected ralS (Sharafeldin el oJ .• 2000). This 
iocreISC in expressioo. of these chemokines occun before brain lesions developed in 
infected rats (Sharafeldin et aJ., 2000), implying that induction of these cbemokines could 
be directly responsible for the observed brain lesions. Over expression of chemokines 
therefore appears to be detrimental to the host during African trypanosomiasis disease. 
TIw hypolhesis irrv~sllgated in the present study was thai upregulation of RANTES 
clttlltObn~ and re~plor expressions are associated wilh the immunopathology ofm alaria 
1r{m10ll mtd thol blocJcjn8 RANTES overexpress;on will minimize or abrogate Ihe 
OIIIcofM of/he dlseGJI. The results demonstrate that increase in production of RANTES 
follows the course of P.yoelii 11X maJaris infection such that RANTES and receptors 
CCRI. CCRJ and CCR5 were detected 8t high levels at day 6 and 8 post infection. 
impItcating these molecules in the immunopathology of P.yoelll 17 X infection. 
The ELISA dm from this study lndicatc significant upregulation of RANTES after day 4 
until day 8 10 P.yoelil 17X infected mouse plasma than in controls (Figure 25). Also. 
Western blot analysis revealed that brain tissue transcripts of RANTES "-ere actually 
translated imo protein and were significantlyupreguJated in infectcd mice (Figure 24). It 
WIi evident from the resullS obtained in this investigation that the expression pattern of 
RAN1CS was similar to the increase level of parasitemia. RANTES production was 
sipificwMIy elevated at day 6 and 8 posI·lnfectioo (Figure 20 & 24), Parasitemia in mice 
~a1soobservedtobehigbltday6and8. MostofthepathologicaJconditionswere 
OOoerved on those clays, especially 01 clay 8 (peak parasi1emia). Increase in RANTES 
produetioo correlaled with increase in parasitemia and. pathological conditions. RANrES 
145 
University of Ghana http://ugspace.ug.edu.gh
causes inflammIIion which opens up spaces between eells, allowing the escape of 
leukocytesintotissuesandaisotbespreedofinf~tiousagents.Withreducedleukoeyte 
population in blood vessels, phagocytosis of infected RBCs is minimized and parasites 
could therefore increase in numbers. This could be a plausible correlation between 
RANTES production and the increase level of parasitemia in P.yoelii 17X infected mice 
in this invesliption. 
P.yoelti 17X infection upreguIates RANTES and its corresponding receptors. CCRI. 
CCR3 and CCRS in mouse brain and that wtrastructural change in microvascular 
endothelium layer occurred in the cerebellum of infected mice. This is the fint tempontl 
expm.sioo study of RANTES and receptors associated with murine malaria. 
S.2 M.riDe malaria studies-2 
Tbil snx1y .nows that blocking RANTES causes a decline in the level of parasitemia in 
infectcdmice. 1bis decline was associated with increased life expectancy for the infected 
mite. At day 8 post infection, the percentage of parasitemia was 23% in anti-RANTES 
tRaIed mice compared with approximately 35% in mock antibody treated ones (Figure 
36). Since the expression of RANTES causes inflammation which opens up the spaces 
betweeo cells aUowing the escape of leukocytes, blocking of RANTES dwing P.)1OI/ii 
17X infection in this study purportedly prevented the escape oftbese leukocytes. and 
witb1heiraccwnulatiooinbloodvesse15togetherwithplatelets.,pbagocytosisofinfected 
red blood ceU iseahmc:ed and parasites numbers isdcclined. 
146 
University of Ghana http://ugspace.ug.edu.gh
h is believed that. over expression of R.ANTES does not only play a significant role in the 
immunopathology of maJaria infcctioD. but it also mediates increased parasitemia. This is 
evident from the survival plot in the current study (Figwe 37) which demonstrated that 
comparatively higher percentage (42O/.) of mice, treated with anti-R.ANTES antibody 
were able to survive compared with mock antibody treated ones (12%) at peak 
Plftlitcmia. RANTES therefore play an imponant role in mortality during malaria 
iDfection, Analysis by ELISA has shown t.baL. RANTES was expressed more in mock 
antibody treated plasma thaD in anti-RANTES antibody treated and uninfected controls 
(Figure 38). The level of RANTES expression in plasma of P.ytH/ii 17X infected mock 
and anti-RANTES antibody treated were observed to be higher than uninfected controls. 
This i. further evidel1Ce thal RANTES exp=sion is associared with p_yoe17lXi ('";  
iDftction. . oj -, 
"( 
-'.'----' 
5.3 Humin mlb.ria ,tudies ~ ...... 
The mccbanism by which chemolcines mediate immunopathogenesis and newopathology 
usocilted with human eM is not well understood. This lack of Wlderstanding is partly 
due to the fact tbII dI1a from patients in which a clinical diagnosis of eM has been 
eDbIi.Ibed prior to death are rare. Studies using rodent cerebral malaria models have 
prniousJy been criticized as inadequately comparable with human eM. In particular, the 
P. be"gh~1 ANKA model suggest! tkn sequeslr.tlion of infected red blood cells. 
lcukoc:yks aDd platelets mediale eM pathogenesis. Leukocyte sequestration in bwnan 
lniomicrovasculaturc has 001 been previously considered as a diagnostic featureofCM. 
However. recent histopathological analysis of eM brain samples from Malawian patients 
147 
University of Ghana http://ugspace.ug.edu.gh
demollStJ'l1ed a high degree of plalelets and mononuclear cell accwnulation in brain 
microvcssels(Grau rtaJ. • 2003: WassrncrdCJJ., 2003). Thissuggestsancwoverlap 
_ bumoo mil rodent CM. 
saa this invesligation has revealed that RANTES and corresponding receptor 
cxprnsloo oc;.curs in the bram of murine malaria model, we tested the hypothesis lhM 
themokine RANTES MId receptors are as.sociated with brain immWlOpa!hogcnesis in 
bumIm due to eM. and also detcnninro which regions of the brain these expressions 
This study shows that expression of RANTES (a C-C chemokine produced by endothelial 
and COl ' T cdl. mil macrophage$). a poCcn' chcmoatlraclan. fot lymphocytes, 
eosinophils, NK cells and CDSI cells (Kameyoshi d 0/., 1992; Kuna et 01., 1998; Iijima 
"111 .. 2(03) and CCRS (a C-C chemokine receptor). are significantly upregulated in 
oerebelh.m and cerebrum of post mortem human eM samples. 
Ahhouab. much Larger sample size would have been desirable for this study. the rcsu1ta 
ob&aioed using toc-tranlformed data wet'e IlUlistically significant between CM and NM 
~. This survey has provided the opportWlity to report for the ~ time tbaI: 
RANTES aod CCR5 81 the mRNA and protein levels are significantly upregulated in 
-.. post-mortem CM tissue samples 
148 
University of Ghana http://ugspace.ug.edu.gh
Mestmger RNA (mRNA) and protein expression analyses revealed differential 
exprtssioo patterns of RANTES and its receptors in different parts of the brain. 
R,ANTES, CCRJ and CCRS but not CCR 1 transcripts were significantly upregulated (P < 
0.001) ia the cerebeUum and cerebnun in CM infected brain tissues than in NM controls 
(Fipre 26 & 27). AJso, expression of RANTES mRNA was upregulated in the brain 
_ (P < 0.0027) and hippocampus (P • 0.0018) of CM-infected samples than in 
.-v1s(Figures28.t29). 
Western blot lDIlysis indicated that RANTES and CCR5 proteins were significantly 
~oted in =beUum (P < 0.0001 for RANTES, P < 0.013 for CCRS) and cerebrum 
{P < 0.0001 for RANTES, P < 0.0124 for CCRS} but not in brain stem and hippocampus 
dwiDg CM. However. CCRJ protein expression in a1l the eM samples examined cowd 
DOC be detected though. its mRNA was expressed in cerebellwn and cerebrum. This 
procrin loss could be due to post-transcriptional modification or other downstream 
mecbmisms that may have resulted in inhibition or degradation of the protein product. 
1D the current Rudy RANTES, in association with its receptor CCR5 could be major 
imm1lJe modulators of brain immunopatbalogy, particularly in the cerebellwn and 
ccrdwum during CM. It is proposed thaI CM infection may induce localized holt 
lIDDlUDe n:sponses mediated in part by RANTES. which in tum recru.itlll CCR5+ 
let&k.ocytes and possibly elevating the expression of CCRS (Jijima el 01.. 2003). The 
obse:vatioo of aa association of RANTES and CCRS with eM in the brain is interesting 
Bad. requires further examination in malaria endemic populations. 
149 
University of Ghana http://ugspace.ug.edu.gh
RANTES expressioo was also analyzed in plasma samples obtained from patients who 
have bad malaria epi50de to determine if its expression is systemic or localized during 
human malaria infection. Results indicate that expression of RANTES in plasma of 
malaria positive subjects are significantly upreguJated (P < 0.0001) compared with 
COIlb'Ols (Figure 32). Also, regression analysis indicates that plasma RANTES expression 
c:om:la1cd positively with P jaiciparum antigens. The regression equation shows that 
increIse in malaria antigens resulted in increased plasma RANTES (Figure 33). 
Srudies by Burgmann el al., (1995) showed that serum concentrations ofMIP-la and II..-
8 cbemokine were upregulated even in cases where P faiciparum parasite was not 
detecWd in the smears. 10 this investigation., it was observed that there were elevated 
leve" of RANTES in plasma of patient3 who were positi\'e for malaria antigens 
Indicating that the presence of malaria antigens can even induce RAN"rnS expression. 
Tbougb. plasma samples from malaria positive subjects were not screened for other 
infectious agents to detennine if the source of RANTES was due to other pathogens, 
aprcasioD of RANTES was observed to be significantly higher in malaria antigen 
poUtive pIama comp.red. to the non-malaria controls. This demonstrates that RANTES 
expre.ion,aDd levels in plasma could be caJibrated and used as a diagnostic marker for 
lu.amalariainfection. 
Rcceady, it bas been shown that malaria infection induces CCR3 and CCRS expreasion 
in placaaa of pregnant women (Tkachuk el al. • 200t) giving credence to the fact that 
150 
University of Ghana http://ugspace.ug.edu.gh
CCRJ and CCRS expression is associated with malaria infection. Luo er 01.. (2001) have 
indicated that CCRI and CCRS 00 hwnan astrocytes function in the recruiunent of 
leukocytes 10 specified brain regions. During eM in Vietnamese adults, Medana " aI., 
(2002) observed axonal injury in tbceerebraJ cortices and cerebellwn, the regionsoftbe 
bniD in which. during CM, RANTES, CCRJ and CCRS transcript expressions were 
found to be significantly up-regulaled in the present study. This observation was 
uprising since other brain compartments may equally be exposed to circulating soluble 
cbemokines in plasma and probably the cerebrospinal fluid. In addition to malaria 
infected red blood cells adhering to cerebral micro-capillaries and obstructing 
microcircu1atioo, RANTES may recruil CCR5+ leukocytes 10 these regions of the brain 
ciuriDs eM tnfection and possibly causing localized necrosis. An incidence of CM dwing 
lc:rilica1 period ofbraindevelopmenl and organization will especially impact those brain 
systems most vulnerable to cerebrovascular crisis. These vulnerable regions support 
cognition. memory, and executive neurological functions (Riva & Giorgi. 2000; 
Schmahnwut. 1992) and any neuropsychological sequelae for eM will involve these 
abililies to a varying degree. Interestingly, CM has been implicated in cognitive 
imp&irmeaI in children in Kenya and Senegal, some of whom were survivors of eM and 
acwre malaria (Holding tt al. • 200 I; Boivin 2(02). 
lntreased circula1ion of CCRJ and ecRS receptors mediate fusion and infection with 
HIV (Cboe elaJ., 1996). Thus., malaria infections increase the potential reservoir for HIV 
by iDaeasins the number of target cells. Therefore the increased levels of circulatins 
receptor.; in CM~infected individuals. which are also, utilized by HIV presents a grim 
151 
University of Ghana http://ugspace.ug.edu.gh
scenario for the «vcloping world where disease burden is rugb and both infections are 
prevalent 
It 15 nol clear at this stage which cell types over express RANTES and CCRS in the 
ombeUum aod CCf't'brum during CM. However, evidence from PCR and 
lJDmW1OhiItoIogicaI studies have revealed thai microglia express CCR), and CCRS 
_(JIeetal. • l997). 
Due 10 technical constraints. post·mortem eM tissue 5ample! could not be obtained and 
poccssed for immWlO-histological analy~s to detcnnine which cell types express these 
receptors. It will be: of interest in the future to examine expression of these markers in 
......· infeeacd Wood samples as ~H. 
SA Coodusio., 
Tbit is the 6m temporal expression study of RANTES and corresponding reeeptors 
CCRl, CCRJ and CCRS associated with murine maJaria. This :>tUdy has concluded that 
, . IOIIii 11X murine malaria model is useful in characterizing differcntiaJly expressed 
aeaa ..ociMecI with human clinical malaria. This shidy has also revealed that 
~ of RANfES and its corresponding receptors CCR1, CCRJ and CCR5 is 
~withma1aria.indueedbrainpathogenesisandultrastructuralalterationsin 
c:erebdlum of infected mice. High expression of RANTES mediates increase in 
P"'Sit<mi.a and monality of murine malaria models. Blockina of RANTES reduced 
parasitemia .. mortality associated with P. }'«/il 17X infection. 
l52 
University of Ghana http://ugspace.ug.edu.gh
The ccrebellwn and cerebrum in humans have been observed to be the focal poiou for 
IftQ'CIIIeId maJaria-lndlK:ed RANTES and CCRS expression, which suagest that active 
sequc:stmion of IRBCs and. platdets in addition [0 leukocytea in these regions of the 
brain ",in eucero.te eM immllDClpetbology. The interaction of RANTES and associated 
CCR5 reoeplor in lhc cerebelhun and cerebrum could lead 10 localized 
byperinllunmation in these regions of the brain, which in twn eouJd lead to coma and 
CllJlDibveimpairment. 
Also, uJftSUlltion ofCCRS expression. a co-receptor for HIV- I suggests a potential link 
~ infeclious disease burden and susceptibility to HIV/AlDS in malaria endemic 
153 
University of Ghana http://ugspace.ug.edu.gh
,. ..... 
'iN "'M-' • 
Ci\l'''''-' 
(i\)P"'- (•?J  
Figure 39 __ p."piRd modd for RANTES-mediated brain pathoge.esis duriag CM. 
~ ,rrfocted RBCs In additIOn to RANTES-mediated recnlllmrtnl of lelllwcyks 
.. dtt CCRS receptor and platelets may be trapped in 1'" distal ",tcrCNeSMIs of dw 
bnnll. 1Jris may impede ,he smooth flow of nutnents and oxygen. lhe resulling ISchemia 
and nano/ogiaJI cond"iom aSSl)(.:iat~J with cerebral malaria possibly COIIId kad 10 
degndmon Ot' IWchamm/ breaching of lhe BHB whtch COIIIJ lead 10 the ,_·urapatlfology 
GSSOCIakd..,IltCM 
University of Ghana http://ugspace.ug.edu.gh
SLGGESTIONS FOR FnURE STUDIES 
1. Pafonn ultrastructural studies with hwnan samples to examine role of BBS, glial 
cells and astrocytes in eM post tteabnenl encephalopathy (PTE) 
2. Perform FA CS onaIysi, 10 delennine cell' producing RANTES and CCRS 
l Use specific glial, astrocyte, endothelial and neuronal cell antibody probes in 
immuPobistochemistr)' 10 localize and determine the role of these cell types in 
eM immunopathology. 
4. DctmniDe whether the cerebellar and cerebral regions recruit and sequester 
CCRS+ astrocytes, Ilia or T celli 
ISS 
University of Ghana http://ugspace.ug.edu.gh
R£t"I::RI':NCfo:~ 
Aibwa. M. • Brown. A. • Smith, C.D .• Tegoshl, T., Howard, R.i., Hasler, T.H. • IID, Y., 
Perry. G .• Collins. W.E. &; Webster, K. (1992). A primate model (or buman 
cerebral malaria: Plasmodium coamey;·inf'ected rhesus monkeys. Am .J .Trop 
.Mtd. Hyg.46:391.397. 
AndjeIkovic, A.V. &; Pachler. J.S. (2000). Characterization of binding sites for 
chmlokiDcs MCP-l and MlP-la, on human brain microvesscls. J. N~urochem. 
75:1898-1906. 
Badolato. R .. Sacks, O.L.. Savoia. O. &. Musso T. (1996). Leishmania major: infection 
of human monocytes induces expression oflL-8 and MCAF. Exp. Parasito/.82: 
21-26. 
BlgpJlini M. & Dahinden C.A. (1994). CC chemokines in aJlergic inflammation. 
I",,,,ultol. Today. l5:127. 
8ajctto, A .. Bonavia., R.o Barbero. 5., Florio. T. &: Schetb1.i O. (2001). Chemokioes and 
their receptOrs in the central nervous system. Front. NellTOcndocr/nol. 22:147-
184. 
8ampn. A. • Kmnsner, P.G .. Weiss. W., Wahlgren, M. & Carlson, J. (1998). Age-
R:1a1ed buildup of humoral immunity against epilopes for rosette formation and 
lGiulinationinAfricanareasofmalariaenciemicity./n/ecl. lmmun. 66:4783-
4787. 
BaNdI, D.I., Gormely, i.A., Ma, C., Howard, RJ. & Pasloske, B.L. (1996). 
Plasmodill1fl falcifX1"1l'" erythroc)'le membrane prOlein I is a parasitized 
eryt.hrocy\e receptOr for adherence to CD36,thrombospondin, and intercellular 
adhesion molecule L Proc. Noli. Acad Sci. 93:3497-3502. 
156 
University of Ghana http://ugspace.ug.edu.gh
BcInoUe. E. • Costa, F.T .. Vigorio. A.M .• Voz.a. T .. GOMet, F .. Landau, I.. Van, Rooijen. 
N. . Mack. M. . Kuziel. W.A. &: Reni&, L. (20030). Cbemokine rocepl~ CCR2 IS 
DOt essentiw for the development of experimental cerebral maJana. Infect. 
l_unoI.71:3648·3651. 
Beinoue. E. . KayabBnda, M. &: Deschemin. J.C. (2003b). CCRS deficiency decreases 
susceptibility to experimentaJ cerebraJ malaria. Blood. 101:42534259. 
Belperio lA., Keane, M.P .• Arenberg, D.A., Addision. C.~ .• Ehlert. J.E .• Burdic~, M.D. 
&. Strieter, R.M. (2000). CXC cbcmokines in angiogenesis. J. LeM/we. BIoI. 68: 
1·8. 
8cTgc:r, 0 .• Gao. X .• GujuJuva.. Bwns. A.R., Sulur. G., Stins, M., Way, D., Wine, M., 
Weinand, M .. Said. I .. Kim, K.S. Taub. D .• Graves. M.e. & Fiaia, M. (1999). 
CXC and CC chemokinc receptors on coronary and brain endothelia. Mol. Med. 
5:795-805. 
Bihre. V.D .• Gianinazzi, C .• Imboden. H. t Leib. S.L. & Tauber, M.G. (2003). Bacteria] 
meningitis causes two distinct fonns of cellular damage in the hippocampal 
dentate gyrus in infant rats. Hippocampus. 13:481--488. 
Boivin, MJ. (2002). Effects of early cerebral malaria on cognitive ability in 
Senegalese children. J. Dev. Ikhav. Pediatr.23:353-364. 
Bra&er. D.R.. Kwiatkowski, D. & While, N.J. (1993). Neurological sequelae of cerebral 
malaria in children. Lancel. 336:1039-1043. 
Brian. S. J. cl Riley, F.~. (2002). Cerebral malaria: the contribution of studies in 
anima] models to our understanding of inunWlOpathogenesis. Microbes Infect. 
4:291·300. 
Brovm. K.M. & Kleier, J.P. lI986). Effect of macrophage activation on phagocyte 
Plasmodium interaction. In/eel. Immun. 51: 744-749. 
IIurpnaon, H. • HoHenstein, U. . Wenixb, C. • Tha1hammer. F. • Looll<eSUwan. S. & 
Graoiog. .. w. (1995). Serum coneenttlltionsof MIP·I a1pbaand IL-8 inpatients 
157 
University of Ghana http://ugspace.ug.edu.gh
su1fc:rin8 from acute Plasmodium faJdpartml malaria. Clin.lmnnmol. &; 
1_1to1. 76,)2·)6. 
Campbell, C.C. (1997). Malaria: an emerging and ce-emerging global plague. lmmlPlol. 
Mt d Miuoblol: 7':325-331 . 
Qoe, H. • Farzan. M .• Sun, Y .• Sullivan. N .• Rollins, B .• Ponalh. P.O .• Wu. L., Mackay, 
C.R .• LaRosa. G .• Ne"",an. W .. G..-anl. N .• Gecard, C. & Sodroski I. (1996). 
The beta-chemokine receptors CCRJ and CCR5 facilitate infection by primary 
HJV-I isolates. Cell. 8S:1 135-1 148. 
eoope, A.R. (1998). Hypoglycaemia in faJciporum malaria. J. Assoc. Phy. Ind. 46:921-
922. 
CIIoudhu<y. HR., Sheikh. N.A .• Banchrolt, G.I., Katz, DK & DeSouza. 1.B. (2000). 
Early non-speci fi c immWle responses and immunity to blood-stage non· lethal 
Plasmooillm yoelfi malaria. Infect. Immlln. 68: 6127-6132. 
Clark.. tA. & Cowden, W.B. (1992). Roles of lNF in malaria and other parasitic 
lnfcctions. lmmunol.&r. S6 :3650407. 
Cobm, S. • McGregor, I.A. & Carrington S. (1961). Gamma globulin and acquired 
immunity to human malaria. Nature. of: 73 3· 737. 
Cowman. A.F. . Cappel, R.L. • Saint, R.B., Favoloro. 1" Crewther, P.E., Stahl. H.D., 
Bianco. A.E., Brown. G.V .. Ander,;. R.F. & Kemp, 0 .1. (1984). The ring. 
infected erythrocyte surface antigen (RESA) polypeptide of P1Q.f1ftOdj"",. 
foJ~iparIlm contains two separal.e blocks of lande m repeats encoding antigenic 
tptlOpcstbatare naturaJly imrnunogenic inman. Mol. BioI. Med. l : 207-221 . 
CRig. ~. & Scberf. A. (200 I). Molecules on the swface of the Plasmodium /aJdparum 
infected erythrocytc and tbeir role in malaria pathogenesis and immune evasion 
Mol Biochem. ParaJitol. llS: 129-143 . 
Cwtis, C. ( 1997). Prevention of malIri. with pyrethroid treated bednets. Afr. Health . 
• ' ,17·18. 
158 
University of Ghana http://ugspace.ug.edu.gh
DIy. K. &. Marsh. K. (1991). Nanarally acquired immunity to Plasmodiumjalciporunt. 
ParosiloJ. Today. A: 6S·71. 
Denney. C.F .• Eckmann, l. &. Reed. S.l. (1999). Chemokine secretion of human cells 
in raponse to ToxoplosfnQ gond;; infection. Inject. Immun. 67: 1547-1552. 
[Jessus-Babus, S., Knight, S.T. & Wyrick, P.B. (2000). Chlamydial infection of 
polarized HeLa cells induces PMN chemotaxis but the cytokine profile varies 
between disseminating and non.msseminating strains. Cell Mic:robiDl. 2:317-
327. 
Di Perri, G. • Guasparri, I., Monteiro. G.B .• Bonora. S .• Hennig. C .• Cassatella, M. • 
Micciolo, R. t Vento, S., Dusi. S .• Bassetti. D. & Conicia, E. (1995). 
PeotoxifiJline as a supportive agent int the treatment of cerebral malaria in 
cbiJdren.J.lnfocl.Dis.171:1317·1322. 
Dodoo, D. • Tbeander. T.G., Kurtzhals, I.A .• Koram, K., Riley, E., Akanmori, B.D., 
Nkrwnah. F. &. Hviid, L. (1999). Levels of antibody to consen"oo parts of 
Plosmodium!a!ciparum merozoite surface protein in Ghanaian children are not 
a.uociatcdwithprotectionfromclinical malaria. Inf Immufl. 67: 2131·2137. 
DoDs.C.& F1aveU,R.A. (2001). Thl and Th2 cells. CU". Opin. Hemolol. 8:47·51. 
Dzmko. K.A .• Andjelkovic, A. V., KU7jei. W.A. &. Packter, J .S. (200 I). The cbemokine 
receptor CCR2 mediates internalization of monocyte chemoattractant protein-I 
alouabraiomicrovessels.J. Neurosci.21: 9214-9223. 
-. J.C., Gilles, H.M. & Udeozo, 1.1<. (1962). Adult and cord blood 
pmmagIobulin and immunity to malaria in Nigerians. Lancet. 2: 951·955. 
Eaglish, M.,.Muambi. B., Mithwani, S. & Marsh.~. (1997). Lactic acidosis and oxygen 
debt In African children with severe anaenua. QJ M~d. 9: 563.569. 
159 
University of Ghana http://ugspace.ug.edu.gh
F.,., M.A. & Schreiber, R.D. (1993).Tbe molecular cell biology of interferon-gamma 
and ill receptor. Annu. Rev. [mmuno/. 11:571. 
Felger, I., Marshal, v. M., Reeder, I. c., Hun~ I. A. Mgone C. S. & Beck. H.P. (1997). 
Sequence diversity and molecular evolution of the meroZOite surface anbgcD 2 
ofPlasmodiwnjalcipanmt.J. Mol. Emf. 45:154-160. 
Fernando, D., Wickremasinghe, R.. Mendis, K.N. & Wickremasinghc. A.R. (2003). 
Cognitive performance at school entry of children living in malaria-endemic 
areuofSriLanka.Trans. R .Soc.Trop. Med Hyg. 97:161-165. 
Fujioka, H., Mill~ P., Maeno, Y., Nakazawa, S., 110, Y., Howard, R.I., Collins, W.E., 
& Aikawa, M. (1994). A non-human primate model for human cerebral malaria: 
rhesus monkeys experimenlally infected with Plasmodium fragile. Exp. 
Parcuilol. 78: 371-376. 
GalJup. J.t. & Sachs, J.D. (2001). The economic burden of malaria. Am. J . Trop. Med 
Hyg.6H5·96 
Garnica, M.R., Silva, I.S. & de Andrade. H.F. (2003). Stromal c:ell-<lerived factor·1 
production by spleen cells is affected by nitric oxide in protective immwtity 
against blood-stage Plasmodium chabaudi CR in C57BU6j mice. Immunol. Lett. 
89:133· 142. 
Gnu. a.Eo (1992). Essentilll role of tumor necrosis factor and other cytokines in the 
palhogenesisofcerebralma1aria:experimentaJandcli.nj~studies. Yerh. K. 
ActMJ. Genuskd. Be/g. 54: I 55-175. 
Orau, G.E., Fajudo. L.F .. PigU<!, I.F., Allet, B., Larnban, P.H. & V. .s aili, P. (1987). 
Tumor necrosis factor (cachectin) as an essential mediator in mwine cerebral 
mallriLSct~nce. 237: 1210-1212 
Otau, G.a, Ma.:kenzie, C.D., Can, R.A., Redan!, M., Pizzola1o, G .• Allaoia, C., 
Caf:aldo~ C., Taylor, T.E. & Molyneux, M.E. (2003). Platelet accumulation in 
brain mlcrovessels in fatal pediatric cerebral malaria. J. lnjeci. Di$. 187:461466. 
160 
University of Ghana http://ugspace.ug.edu.gh
Gnu. a.E.. Pigue1. P.F. Enger.;. H.D., Louis. l.A .. VasaaJli, P. & Lambert. P.H. (1986) 
L3T4+ T lymphocytes playa major role in the pathogenesIs ofmunne 
cerebral malaria. . Jlm",unoJ. 137:2348-2354. 
QreerJwood, 8. (1999). Malaria mortality and morbidity in Africa. Bull. WHO. 77:617-
618 
Oro&c. C.L.. PierJe.LoWs. I.C. & Durward. W.F. (1997). Deficits in delayed memory 
followingceo<bralmolaria.Acaaestudy.Corlex.33:385.388. 
GNn. J.t. & WeKianz. W.P. (1981). lmmunity to PltJSmodium chabaudi adam; in the 
8-cc1l-deficientmouse.Natwt.Z90:143-145. 
Manum. P.S .• Hayaoo. M., & Kojima. S. (2003). Cytokine and cbemokine respoMn in 
a CCft'braI malaria·susceptible or - resistant strain of mice to Plasmodium 
be,.,htl ANKA infection: early chcmokine ex,pression. Inl. Immuno/, 15:633-
640. 
He. 1. . Chen. Y., Farzan, M. • Choe. H. t Ohagen, A., Gartner, S., Busciglio. J. t Yang. X., 
Hofnwln. W.o Newman, W.o Mackay. C.R .• Sodroski, 1. & Gabuzda, D. (1997). 
CCRJ aDd CCRS are co-receptors for HIV -I infection of microglia. Nature. 
385:645-649. 
Hill, A. V.S., AlIaopp, C.E.M .. Kwiatkowski, D., Anley, N. . M., Twumasi, P., Rowe, P. . 
IIeonctt, S .• Brewster. D .• McMicbael, A.l. 81: Greenwood, B.M. (1991). 
Co~on West African HLA antigens are associated with protection from severe 
malana.Na/urt.3S2:S9S-600 
HokIcr. A.A (1988) . The pn::ctII'SOf to major meromite surface antigens: Structure and 
role in IJ'MlUIlity. Prog.AlItrgy. 41 :72-97 
HoIdias. P.A. a. Snow, RW. (2001). Impact of PlasmodiwnfaJc;parum malaria on 
perl'0fIIIIDCe aad learning: review of the evidence. Am.J.Trop.MedHYIl. '4:68-75. 
161 
University of Ghana http://ugspace.ug.edu.gh
HoI_ S.T .. Bocky. K.S .. Janezi<. A .. F. .... A.J .. Kaplin. A.P. & T~ L.M. (1997). 
Release of R.ANTf~ . MIP-la1pba and Me p-) into asthmatic AlJ'WI)'J followmg 
eDdobrooch.iJJ allergin chaHengc. A.w. J. lup. Cril. ew e. Med .156: !l77. 
Hollu.,dale. M.R., Nardin. E.N., Tharavanij, S., Schwarts. A.L. & Nussenzweig. R.S. 
(1984). Inhibition of entry of Plasmodium [o/clporum and PIDSmodillm v/vax 
sporozoites into cultwed cells; an Ui8.y of protective antibodies. J. ImmunoJ. 
\31, 909-913. 
lijima. W.o Ohtani , H .• Nakayama, T., SUg.lwanl. Y., SIlO, E., Nagwa. H .• Yoshie, O. &. 
SalaDO T.(2003). Infiltrating CD8+ T cells in oral lichen planus predominantly 
expreII CCRS and CXCR3 and carry respecti ve chemokine Iipodl 
RANTESJCCLS and [P-IOICXCLlO in their c)1oi)1ic granules: a potential self-
recruiting mechanism. AM. J. Pathol. 163:26 1-268. 
lakobson. P.H .• Bate. C.A., Tarveme. J. &. Playfair, J.H. (1995). Malaria: toxins. 
c:yt.okiDesanddisease. Parosite lmmllnol. 17:223-231 , 
-. B. • Teudalc. G. . Braakman. R .. Minderhoud. J. & Knill-Jones. R(1976). 
PmIictios outcome: in iodividual patients after severe head injury. Lance( 
7968,1031- 1034. 
JlDlett. 8 . &:, Tea'~da l e G. (1978). Assessment of coma and severity of brain injury. 
Aflt SlhtSIO/. 49: 22 S~226 . 
Kameyoshi. Y. . Dorschner A. . MaJle~ A.I.. Christopher. E. & Schroeder. J.M. (1992). 
Cytokioe RANTES re1eased by thrombin-stimulated platelets is a potent 
.ttnlc• •• " Co< human eosinophils..l Exp. M,d. 176,187. 
Kaal, D.K.. Liu, X.D., Nagel, R.t .. & Shear. H.L. (1998). Microvascular 
bemod)'1lllm.ia and in vivo evidence for the role of intercellular adhesion 
moLecule-1 in the sequestration of infected red blood cells in a mouse model of 
1e1haJ maWia. Am. .l Trop. M,d .Hyg. 58,240-247. 
\(oW. O=.K.. N""I. R..L.,  L1_ J.F. & Shear. H.L (1994 ). Cet<bral malaria in mice, ~f~~~~~~~~~7~~2~~d blood cells and microrhmlogH: 
162 
University of Ghana http://ugspace.ug.edu.gh
Keaoe. M.P .• Arenberg. D.A .• Moore. B.~., A~SOn. C.L. & Strieter, R.M. (.1998). 
CXC chemokines and angiogeneslslanglostasis. Proc.Assoc. Am. PhySl. I JO ' 
288·296. 
KDn. M.O .. Sub. H.S .• Brosnan. C.F. & Lee, S.C (201)4). Regulation ofRANTESlCCLS 
expressioninhumanastrocytc:sbyinterJeukin.1 andinterferon·bcta. 
J.Neurochem.90:297-308. 
Kobayashi. F.. Ishida. H., Matsui T. & Tsuji, M. (2000). Effects of in vivo 
tdministration of anti-IL~10 or rNF-y monoclonaJ antibody on the host defense 
mechanism against PlasmodiUlff yoelJi)'M1li infection. J. Ye/. Med Sci. 62: 583-
587 
KUIIIM, S., Miller, L.H., Quakyi, I.A., Keister, D.B., Houghton. R.A., Maloy, W.L, 
Moss. B. • Ber7.ofsky, J.A. & Good, M.F. (1988). Induction ofcircwnsporomite 
protein-specific CTL by malaria sporozoites and epitope identification. Natwe. 
334,258·260 
K_ P., AIIm, R., R. ... U. & Gorski, P. (1998). RANTES induces nasal mucosal 
inf1ammII:ioo rich in eosinophils, basophils, and lymphocytes in vivo. 
A. ..J .RupIr.Cril Can Mod. 157,873·879. 
Liu.d, lW. • Boyaka, P.N .• Singh, S. &: McGhee, lR. (2001). SaJmonella~mediated 
mucosal ccll~mediated immunity. Cell Mol. Bioi. 47: 1115-1120. 
UIIard, l.W., Sinsb. U.P., Boyaka, P.N., Sing, S., Taub, D.O. & Mcghee, l.R. (2003). 
~llP-laJpba and MlP-lbeta differentially mediate mucosal and systemic 
adaptive immunity. Blood. 101 : 807-814. 
Uu, Y., Yu, Y.M. & Weng, E.Q. (1999). Upregulalion of the chemokines RANTES, 
~~P~I, MlP~Ia.. and MJP-2 in early infection with trypanosoma brucei and 
:~~on by sympt1betic deoervation of the spleen. Trop. Med Inl. Health. 4: 
lope. .D.E., McGregor, I.A., Rowe, D.S 8< Billewicz, WZ. (1973). Pi ..... 
IIDIIlUDOglobulin concentration in mothers and newborn cbildmt with special 
163 
University of Ghana http://ugspace.ug.edu.gh
refermce to placentaJ malaria. Studies in The Gambia, NiBeria and Switzerland. 
Bull. WHO. 49:547-554. 
Lou. I ., Lucas, R. & Grau, G.E. (2001). Pathogenesis of cerebral malaria: Recent 
experimental data aDd possible applications for bwnaDS. Clin. Micro. Rev . •• : 
8111-820. 
Macpherson, G .• Warrel, M. . White, N. (1985). Human cerebral malaria: a quantitative 
ultrastructure analysis of parasitized erythrocytes sequestration. Am.J. Pathoi. 
119:385-401. 
Mtlik, A., E_ I.E .. Hough .... R.A., Sadoff, J.e. & Hoffman. S.L. (1991). Hwnan 
cytOtOxic T lymphocytes against the Plasmodium /a/ciparum circumsporozoite 
protein. Proc. Natl. Acad Sci. 88:3300-3304. 
Maonbeimer, S.B., Hariprasbad, J., Stoeckle, M.Y. & Murray, H.W. (1996). Induction 
of macrophage anti protozoal activity by monocyte chemotactic and activating 
factor.lmmll1'lo/. Med Microbial. 14:59-61. 
MIDeeret, Y., Pongponram, E., Viriyavejaku, P., Punpoowong.. B. & Looa-reesuwan. 
S., Udomsangpetcb. (1999). Cytokines associated with pathology in the brain 
tissue of fatal malari •. Soulhtasl Asian J. Trap. Med. Public Health. 30:643-
649. 
Maneerat, Y., ViriyavejakuJ, P. • PWlPOOWOng. B., Jones, M., Wilairatana, P .• 
Pongpooratn, E. . Turner, G.D. & Udomsangpetch, R. (2000). Inducible nitrie 
oxide synthase expression is increased in the brain in fatal cerebral malaria. 
Hi"OfXJlhol.37:269-277. 
MasbaaI, H.A. (1986). Splenomegaly in malaria. Indian J. Malariol. 1:1-18. 
MtCutehan, T.F., de I. Cruz, V.F., Good, M.F. & Wellcms, T.E. (1988). Antiaenie 
diYef'5ity in Plcumodilmt /alciparum. Prog. Allergy. 41: 173-192. 
164 
University of Ghana http://ugspace.ug.edu.gh
~~~~o~~· ~:.~;.  AS~F~=~ ::~~a~~;~A~'~4 
Murphy. P.M. (2000). Chemokine ~S promoter po~ymorphlsm affects nsk 
of both HIV infection and disease progressIOn in the Multicenter. AIDS. 17:2611-
2678. 
McGregor. LA .• c.mngton. S.P. '" Cohen. S. (1962). Treatment of East Afric~ 
Plasmodium /alciparum malaria with West African human gammaglobuhn. 
TrlUU. R.. Soc. Trap. Med. Hyg. 56:364-367. 
M"'- L. M. • Day. N.P .• Hien. T.T .• Mai. N.T.H .• Bethell. D. • Phu. N.H .• Farrar. J .. 
EIiri. M .. M .• White. N.J. & Turner. G. D. (2002). Axonal injury in cerebral 
mmna. Am. J. Palhol. 160:655-666. 
Mel" •• K.S .• HaIanIw. A.R .• Makwma, P.D. • Torane. P.P .• Satija. P.S. '" Shah, V.B. 
(2001) S .......1 It< ",na1 WI. ... in rnaIario. J. Posrgrad. M.d. 47:24-26. 
Mogil. R.J .• patton, CoL. &: Green. D.R. lI987). Cellular subsets involved in cell-
mediakd immWlity to mwine Plasmodium yoelii 17X maJana. J. Iml1funol. 138: 
1933-1931. 
Molyneux. M_E. • Taylor. T.E .• Wirim .. JJ. '" Borgstein. A. (1989). Clinical features 
and prognostic indic:alOf'S in p.cdiatric cerebral malaria: A study of 131 
COma1OSe Malawian children. Q, J Med.71:441-459. 
Millcr. LH.. Baruch. D. I.. Marsh. K. '" Downbo. O. K. (2002). The pathogenic basis 
ofmalaria.NOIW'e. "IS:673-679. 
Mturi, N. • MUlUlllba. C.O.~ Womoia, B.M .• Oguru, B.R. '" Newton. C.R. (2003). 
Cerebral malaria: op!lmlsmg management.eN.S. Drugs. 17: 153-65. 
Neil. A.I-. ChaolliJ&. T. '" Hun~ N.H. (1993). Comparison between ~ 
~Dl~lDdoon-«Tebralmalariainmice,usingtheretinaJ.wbolc>­
IIIOIIDltecbDique.".,as/JoI.107:477-487. 
165 
University of Ghana http://ugspace.ug.edu.gh
N"teOlas., P., Hovette, P., Merouze. F .. Touze. J.E. & Martel. G. (1994). Cytokmes and 
malari..a. A stUdy ofTNF-a. lL-lp.lL-6, IL-2R in 28 patients. Bull. Soc. PQlhol. 
£JuN. 87. 91 -95. 
Nilcbeu, J. • Bonduelle. 0 .. Combadm, C. . Teflt. M. • SeiU.ean D., Mazier D. " 
Combadiett, B. (2003). Perforin-dependent brain-infiltratinK cytotoxic C08+ T 
lymphocytes mediale cxperimenlal cerebral malaria pathogenesis. J. Immunol. 
170, 222 1·2228 
N..&er. A.K. • Renia. L.. Pasquetto. V. . Miltgen. F., :\1alile. H. &. Mazier, D. (1993). In 
vtYo induction of nitric oxide pathway in bepalOCytes: after injection with 
irnd.i8&cd malaria sporozoites.. malaria blood parasileS or adjuvants. Elii'. J. 
Immunol. 23:882-187. 
Otkenhouse, C.F., Maaowan, C. &: Chuley, J.D (IQ89). Activation ofmonocy!C$ and 
platelets by monoclonal antibodies or malaria-infected erythrocytes binding to the 
CD36 surface receptor in vitro. J.Clin.lnvesl. 84:468-475 
Potier. J.S .• Cotran, R.S. (1991). Immunologic interactions of T lymphocytes with 
\'UCUlIrendothelium. Adv. lmmunol. 50:261-302. 
-. I., Can"a, A .. Pizzolato, G.P .. Wildi, E .. Widmer, M.C. , Morgairaz, C., Ora .. 
G.E. (1993). lmmwaopathologicaJ cbanaes in human cerebral malariL elin. 
N. ...o ptJIhDl.12(3)'142-146. 
Price. R.N., Brew, B., Sidtis, I ., Rosenblum, U., Schneck, A.C. & Cleary, P. (1990). 
The br3UI LD AIDS: central nervous system HlV -I infection and AIDS dementia 
complex. Science. 939, 586-592. 
~, K.: Hamid Q. & O' Brien F. (l997) .. RANfES in human allergen-
~Grt'~ ~~~6~urceaodrclation to tissue eosinophilaa.Am. J. Rtlp. 
Rat. I.R. (1913). Paoho&enesis of =braI ma1aria in aolden """'-' and inl=I mice. 
CtWr'tb. MlCToblaJ. lmmJU1OI. 7:139-147. 
166 
University of Ghana http://ugspace.ug.edu.gh
1Wey. E.M .• Allen. S.l .• Bennett, S .• Thomas. P.l .• O·Donneli. A .• Lindasy. S.W .• Go~ 
M.F. & Greenwood, B.M. (1990). Recognition of dominant T cell sttmulating 
epitopes from the circwnsporozoite protein of Plasmotiillm /alclparum and 
relltioosbip to malaria morbidity in Gambian children. Trans. R. 
Soc. Trop.MedHyg. 84:648·657. 
RiDpaId. P. • Peyroo. F. 8< Lepers, l. (1993). Parasite virulence factors during 
Pf alclponntt malaria: resetting. cytoadherence and modulation of cytoadherence 
bycytokines. In!ect.lmmull. 61: 5198-5204. 
Riva. D. &. Giorgi C. (2000). The cerebellwn contributes to higher functions during 
drvelopment: evidence from series ofch.ildren surgically treated for posterior 
fossatumours./Jrain.123:IOSI-I06t. 
Rockett, K., Awbum. M .• Rockett, E. 8< Clark. I. (1994). TNF and IlA synergy in the 
conlext of malaria pathology. Am.J. Trop. Med Hyg. so: 735-742. 
Rockett. K.A .• Awburn. M .. M .• Aggarwal. B.B .• Cowden. W.B. &. Clark. I.A. (1992). 
In vivo induction of nitrite and nitrate by tumor necrosis factor, Iymphotoxin and 
inlerIeuJrin.J: possible roles in malaria Infocl. /mmun. 60:3725-3730. 
Rogerson. SJ. • Cbaiyaroj. S.C .• Ng K. Reeder. l.C. 8< Brown. G.V. (1995). Chondroitin 
sulfate A is a cell surface receptor for Plasmodium falciparum-infeewJ 
erythrocytes . .!. Exp. Med. 182:15-20. 
RollBack Malaria. (2002). Pr. .. rel ..... f""sheetno: 203 
Roicnberg, C. M .• Seen.' M. G .• Gold,. M. R .• Hancock. R.E. &. Finlay. B. B. (2000). 
~~lIa 'YPh.,murlum infection and hpopolysaccharide stimulation induce 
smullr changes 10 macrophage gene expressiOD. J. lmmunol. 164:5894-5904. 
University of Ghana http://ugspace.ug.edu.gh
Rudin, W. . Eugster. H.P., Bordmann, G., Sonato, I.. Muller. M. • Y_: M. & Ryffel 
B. (1991). Resistance to cerebral malaria in TNF-a!l3-deticleol ~ce IS 
assocWed witb reduction OD intercellular adhesion molecule- J up regulaUon and 
Thelpertype I response.Am . .l Polho/.ISO: 257-266. 
Sachs, J. 4: Malaney, P. (2002). The economic and social burden of malaria 
Nallll'e.41S:680-685. 
SaPo, H.. Nakapwa, N., Chiba, R. . Kurasawa, K. . Saito. Y. & Iwamoto I. (1998). 
Cross-llnkingofintercelluJaradhesion mo]ecule-1 inducesinterleukin-8and 
RANTES production through the activation of N1AP kinases in hwnan vascular 
endothelial cells. Biochem. 8ioph)'3. Res. Commun.19:694-698. 
Soroj. K.M., ShnodlwwId, M., Sanj;b. M., Pa. .l , N.C. & Mohapalra, D.N. (2002). 
Acute renal failure injalciparu", maiaria.J. Ind. Aca. C/in. Med.3: 141-147. 
Scbmahmann. J.D. (1992). An emerging concept. The cerebellar contribution to higher 
function.ATckNelU'oI.49:1229-12230. 
Scbub, J.M .. BI ....,  K. & Hogaboam, C.M. (2002). The role of CC chemokine 
rccepcor S (CCRS) and RANTESlCCL5 during chronic fungaJ asthma in mice. 
Fed American Soc. Exp.BioU. 16:228-2230. 
s. ... K.K., Maeao, Y., Thuc. H.V .. Anb, T.K. & Aile.wa, M. (1993). DHferential 
seqUCllratioo of parasitized erythrocytes in the cerebnun and cerebellum in 
buman c:ad>ra1 malaria. Am. J. Trop. M_d. Hyg. 48: 504.511. 
SIWo, M.F, u.., P.R, Liu, J.Y. & Y_ K.D. (1995). Generation ofinlerleukin-8lJom 
IDIIM mooocytes in response to Trichomonas vaglnali, stimulation. Infect. 
1-...63:2379-2382. 
Sbaru.klin, A., Eltayeb, R., PBlbenkov, M., Bakhiet, M. (2000). Chemokines ... 
produced in.the brain early during the course of experimental African 
ttypanosomiasls.JNevrollftmunoi.l03:167_170. 
III>ca H.L, Morino, M.W., Wanidwonuwn, C., Bennan, J. W. & Nagel, R.L. (1998). 
168 
University of Ghana http://ugspace.ug.edu.gh
Correlation of increased expression of intercellular adhesion molec~e-l. but .~t 
bigh lewis of tumor necrosis factor-al~ha. with lethality of Plasmo~,um >«Ill 
17)(, a roden, mcdel of",. .b raI malana Am.J. Trap. Med .Hyg. 59.852-858. 
slRstha. B. . Gottlieb. D. & Diamond, M.S. (2003).lnfection and injury of neurons by 
West Nileencephalilis vlrus. J.Viroi. 77:13203-13213. 
Silamul. K.. Phu. N.H .• Whitty .• Turner, G.O., Louwrier. K. • Mai. N.T .. Simpson, l.A., 
Him. T.T. Ii. White, N.J. (1999) Quantitative analysis of the microvascular 
sequestration of malaria parasites in the human brain. Am. J. PQthol. 155.395-410. 
SmIth, C.D., Brown. A.E., Nakazawa. S. . Fujioka. H. & Aikawa. M. (1996) Multi-organ 
erythrocyte sequestration and ligand expression in rhesus monkeys infected with 
Plasmodium coatneyi malaria. Am. J. Trop .Med .Hyg. 55:379-383. 
Smythe. lA.. Peterson. G.M .• Coppel. R. • Saul. A.J .. Kemp. D.J. & Anders, R. (1990) 
Structural diversity in the 45-kllodalton merozoite 5Urface antigen of 
Plasmodium falclparum. Mol. Biochem.Paras;'ol. 39:227-234. 
Sliles. J.K.. Melde, J.C., Kucerova. Z.O., Thompson, W. . Zakeri Z. & Whittaker. J. 
(2001). Trypanosoma brucei infection induces apoptosis and up-regulales 
oeuroleuk.in expression in the cerebellum. Ann. Trop. Med &: ParQ.Si'QI. 95: 797-
810 
Stoelcker. B. . Hehlgans. T .. Weigl. K. • Bluethmann, H. • Grau.. G.E. &. Mannel. D.N. 
(2002). Requirement for twnor necrosis factor receptor 2 expression on vascular 
cells to induce experimental cerebral malaria Infecl. Immun.70:5857-5859. 
s., z. ~ Stev~n, fI:1.M. (2002). JL-.12 is required for antibody-mediated protective 
~uruty agamst blood-stage Plasmodium chobaudi AS malaria infection in 
ntJOe.J.lmmwnol.I:I34B-1355_ 
169 
University of Ghana http://ugspace.ug.edu.gh
,... G., Choo& W.L., Li, J., Berney, S.M., Kimpel, D. & VanDdcT, H.C. (2003). 
lnhibitiOllofplalele'lIdbereocclobralnml~ro\'ISCu1atureproleCUagainStsevere 
PJQSIIIOII/iwM bttrghei malariL Inject. I"',"un. 71:6553.0561. 
Tatte, M. tl Bazaz·Ma1ik. G. (J989). Brain histomorphology in protein deprived rhesus 
monk~s with r.ta1 malarial infection. lndion J .Med ReJ. 89:404·410. 
TaYCtIIC. J. • Bale, C.A .• KWiatkowski. D" Jakohsen. P.H. &. Playfair, J.H. (1990). Two 
30IubIe antigens of Plasmodium !alc/porum induced rwnor necrosis factor 
rek:ae &om macrophages. Infect, [",mlln. 58:2923·2928. 
1behuk. AN., Moormann. A.M .• Poore. J .~ .• Rochford. R.A .• Chensue, S.W. • 
M~ V. &: Meabnkk. S.R. (2001). Malaria enhances expression of CC 
cbemokine receptor 5 onplKcntaJ macropbages. J.lnjeci. Dis 183: 967·972. 
TIID, R.S., Kara, A.U., Feng. C., Asano, Y. & Sinniah, R. (2000). Differential !L-IO 
expression in interferon regulatory faclor-) deficient mice during Plasmodium 
IHrgiwiWood-stage infection. Parasite immlmol. 21:425-435. 
Tnpp.e.S .. Wolf, S.F. & Unanue, U.R. (1993). InterJeukin 12 and tumor necrosis factor 
alpha are c:cslimulalors of interferon gamma production by natura] killer cells in 
severecombinedimmunodeficiencymicewithlisteriosis,andinterleukinlOisa 
physiologic antagonist Proc. Na,l. Acad. Sci. 90: 3725. 
Tom, D., Spcnnza. F., Gioia, M., Maneelli, A, Tambini, R. & Biondi (2002). Role of 
lbl aod Th2 cytokines in immune response to uncomplicated PJa.rmodium 
faJclpanlMmalariL Clift DiIzgn. Lab.lmmunol. 9:348·351. 
T_ _,  G. (1997) Cerebnl Malaria &01. Pathol. 7:569-582. 
Twner, G.O., Morrison, H., Jones., M. • Davis. T.M., l...ooarttsuwan, S., Buley. J.D., 
G:atf:er. K.C .• ~ewbold: C.I.. Puknta)·akamee. S. & Nagachinta, B. (1994). 
~ unmuooru5tOc:henucal study of the pathology of fatal malaria. Evidence (or 
widesprad.c:adcxheliaJ activation and a pot.entiaJ role for intercellularadhcsion 
ZIIO&ecWc-lmcerebnJ.sequcstrarion.Am. J. Parhol. 1"5: 1057.1069. 
170 
University of Ghana http://ugspace.ug.edu.gh
UdD_h. R., R.inhard~ P.H .. Scbollaard~ T .• Elliott, J.F .• Kubes. P. & Ho,. M. 
(1997). Promiscuity of clinical Plasmodium !a/c;pa11Im isolates (or mulbple 
adhesion molecules under now conditions. J. Immunol. 158:43584364. 
Villaloa. F., Zbang, Y., Bibb, K.E., Kappes. J.C .. Lima, M.F. (1998). The <yst.il» 
cysteine family of cbemokines RANTES. MIP-Ia and MJP·tll mduce 
trypanocidaIactivity in human macrophages via nitric oxide. Infoct.lmmun. 66: 
4690-4695. 
Waki, S., Udwa, S .. Kanbe, K., 000, K., Suzuki, M. & Nariuchi. H (1992). The role of 
T cells in pathogenesis and protective immunity to murine malaria. 
1""",_(75:646·651 
Wassmer. S.C, Collet, N., Combes, V. '" Grau, a.E. (2003). Pathogenesis of cerebral 
malaria: facts and bypotheses. MedTrop63:2S4-2S7 
Vo!IeIawoa, U., Li, L., Pekna, M., Berthold. C.H .. Blom. S .. Eliassen. C., Renner, 0 .. 
Bushong, E. . Ellisman. M. , Morgan. T.E. & Pekny, M. (2004). Absence of glial 
fibrillaJyacidicproleinandvimenlinpreventshypertrophyofaslrOC}1icprocesses 
and improvespost-uaumaticregeneration, J.\'euroscl. 24:50\6-5021. 
World Hea1th Organization. {l996}. World Health Organization revised facts on 
malaria. IntemationaJ (global). Voce. Weekly: 11-13. 
World Health Organization. (2000).Severe falciparum malaria. Trans. Royal. Soc. 
Trop. MId & Hyg. 94:SI·S90. 
www.dpd.cd<.gov/ .. JM·R/MaIariaibody_MalariaJlagel.htm 
ntW·gpertreyiews.Qrg 
www.who.intfmf-fsleniinfonnatioSbeetlO.pdf 
171 
University of Ghana http://ugspace.ug.edu.gh
Xi.,. 1... Owen. S.M .• Rudolph, D.l., Lal, R.B. &. LaJ, A.A. (1998). Pla.smo~ju"! . 
foIciptIruIn antiac.n-induced buman immunodeficiency virus type 1 ~phcabon 15 
nxdiaed tbrouch induction o(tumor necrosis (actor·aJpha. J.11f/tct .01$. 177:437-
44S. 
y",. .. O.M.. M. ....S . D.O .• Cooley. AJ .. Wcidanz. W.P. 8< Heyde. H.C. (19%). 
ParticipatiOD of lymphocytes subpopulalions in the palhogenesis of experimental 
murine cerebra.! malaria. J Immunol. IS7: 1620-1724 
Yu, Y., &: Cbadec, K. (I 997}. En/amoeba hislOlyt;ca stimulates intetieukin I from 
bumIYI colonic epithelial cells wilhow parasite-enterocyte contact. 
GastrMIfII'o/, 111: 1536·1547. 
lana. V.c.. Halder. J.B. . Swnanta, A.K .• Hong. J .. Rivera, Y.M. 8< Zhang. J.Z. (2001). 
Regulation of chemokine receptor CCRS and production of RANTES and MIP. 
I alpha by inlerferon-beta. J . NeurOlmmuno/: 112:174-180. 
Zbona. S. & Stc.venson. ~ .M. (2002). lL·12 is regujred for antibody-mediated 
protective lnununity ap.inR itlood·stagc Plas1t1ociium chabaudi AS malaria 
infectioai.nrrucc. J "","unol. I68 . 1348-13SS. 
172 
University of Ghana http://ugspace.ug.edu.gh
APPENDICES 
Publicatioo Sarro BY. Singh S. Lillard IW. Gyasi RK. Annab H. Adjei AA 
Jolly P and Stiles JK (2005). Plasmodium yoelii upregulates 
RANJ'ES, CCRI. CCRJ and CCRS expression and induces 
ultrastructural changes in the cerebellwn. Malaria Journal, 4:63. 
Publication Sarro BY. Singh S. Lillard JW. Quarshie A. Gyasi RK. Annab H. 
Adjei AA. Jolly P &. Stiles IK (2004) The cerebral-malaria-
associated expression of RANTES, CCRJ and CCRS iD post-
mortem tissue samples. Ann Trap Med Parasitol. 98:297-303 
m Publication StilcsJK, WhittakerJ, Sarlo BY, Thompson WE. Powell MD & 
Bond VC (2004) Trypanosome apoptotic factor mediates apoptosis 
in human brain vascular endothelial cells. Mol Biochem Parasi/ai. 
133:229·240. 
fV PublK:ation Stiles JK. Kucerova Z, Sarfo 8, Meade CA, Thompson W, Shah P. 
Xue l & Meade Je (2003) Identification of surface-membrane p. 
type ATPases resembling fungaJ K (+)- and Na(+)-ATPases. in 
Trypanosoma bruc~;. Trypanosoma cruz; and Leishmania 
donovani. Ann Trop Med Parasltol. 97:351 -366. 
Publication Jacqueline M. Hibbert, le'A;s L. Hsu, Sam Bhathcna, lrune I, 
Sarlo B, Melissa Creary, Beatrice E. Gee, Ali I. Mohamed, Iris 
Buchanan and Jonathan K. Stiles. (2005). Metabolic stress and 
pr,oinflammatory cytokilles in children with sickle cell anemia. Exp 
BlolMed 230:68·74 
University of Ghana http://ugspace.ug.edu.gh
VI Procedunftrdgiarnipgaprimer 
ThefoJlowing steps describe tbe design of primers 
t. Enter www.ncbj.com website 
2. Draw md enter nucleotide window 
J. Entertbe name of the gene 
4. SelecttheCDS(codingsequence) 
S. HigbJ.igbtandcopythesequence 
6. Minimisetbewindow 
7. Open the website wwwgenome wi .mjl edvlcgj-bjnmnAler/primer1 cRi 
8. P3iCetbecopiedsequcnceintheopenedwiodow 
9. Selectgeoeralprimerpickingconditions 
10. Sdectproductsize 
II . CIk:kprimmbutlon 
12. CopylDdpast.e primer sequence 
13. Open NCBI si1e and click BLAST 
14. Select mx:leotide-nucJeotide BLAST 
15. Paste copied primersequeoce in the BLAST 
16. Click BLAST 
17. Compare E·vaJues of resulLS and select the best primer pair (The lower the E-
value the better the primer) 
174 
University of Ghana http://ugspace.ug.edu.gh
VII T.bl, 1: Mope and byman milDer segul'Dce with oorrspopding annealipe. 
telll.perstum 
.... - ...... -Ge ...... Soquen<e(forww) Sequenoe(nverse) Toml G<oe l~ 56 PEeAM L06039 TGCTCTCGAAGCCCAGT AI T AT GGGTGCAGTTCCA lTTTC 
MlP-2a NMOO9140 GCCAAGGGTTGACITCAAGA 
GCCCTTGAGAGTGGCT A TGA 54 
JCAM·1 BE6J04IS AAACCAGTGCCAGTCCACAT 
AAAGATCACA TGOOTCGAGG 58 
NM01169J TGGAGGAAA TG GCAT AAAG ACCTAGCGAGGCAAACAAGA 5S VCAM GAGCGTGCGAACTTClTGTT 58 
IWITES AF252215 GGAAATCTfCGCACCTCAAG 
1Nf., KOOOiJ ACTGGCAAAAGGATGGTGAC GeTGA TGGeCTGA TTGTCTr 
59 
NM013693 CCAGTGTGGGAAGCTGTCTT AAGCAAAAGAGGAGGCAACA 55 MoO 
MB6671 GCAACGlTGGAAAGGAAAGA AAAGCCAACCAAGCAGAAGA SO L-12 
OCRI NM009912 CCACTCCATGCCAAAAGACT AI TA GGACA TTGCCCACCAC 
53 
ccaJ NM009914 T AT CA ITA CCTGGGGCCTTG CGAGGACTGCAGGAAAACTC 
52 
ens 083648 CGAAAACACATGGTCAAACG GTTCTCCTGTGGATCGGCiT A S5 
JNOS AF427516 AA TCTTGGAOCGAGTTGTGG GCAGCCTCTTGTCTTTGACC 51 
GAPDU NM_008084 CACAA lTfCCATCCCAGACC GTGGGTGC' AGCGAAClTf AT 55 
Ilyman Geno..k Sequence (forw.rd) SeqUC!OCC (reveRe) Anne 
:ns :;'~298S GAGGCTTCCCCTCACTATCC TCMGTGATCCACCCACCTT r~p 
eOl' BC064991 GGCTGTGCACCTGGTTAAAT GTTGGCCTCCTATGGTCTGA S' 
lCQ3 NM_OO1837 nTGGTGTCATCACCAGCAT GCAGAGGGAGAACGAGACAG S4 CCRS BC03l391 GGCAAAGACAGAAGCCTCAC CTAGCCTTGTCCTTCCTCCC S6 GAPDH BCOI40IS GAGTCAACGGATTTGGTCGT lTGATTTTGGAGGGATCTCG 57 --
University of Ghana http://ugspace.ug.edu.gh
GENE FOLD CHANGE DESCRIPTION OF GENE 
EXPRESSSION 
PECAM·I Platelet Endothelia Cell Adhesion Molecule--I 
MII'.2a 18.0 MacrophaaelntlammatoryProtein-2a1pha 
ICAM·I Il .O lntercellularAdhesionMolecule-1 
IRF2 12.0 lnterferonregulaloryfactor-2 
/oICP·1 7.0 MODOCytcChcmoettnctantProtcin_) 
VCAM·I 6.0 VascuJarCeliAdhesionMolecule-1 
IWITES 6.0 ReguJlted upon Activation NannaJ T cell Exptnsed 
andSecrtted 
INF-y 6.0 Interferon-gamma 
TGF· ~ 6.0 TransfonninggrowthfOC1Orbeta 
Gl YeAM·1 6.0 EnthotheliailigandforL-sclectin 
lNF... 5.0 Tumor Necrosis FltCtor-alpha 
JL.12 4.0 lnterleuk.in-12 
enl 4.0 c-c chemokine receptor I 
eCRJ 4.0 C-C chemokine receptor 3 
CCIll 4.0 C-CchemolUnercceptorS 
!NOS 4.0 lnducible Nitric Oxide Synthase 
JL.lR 3.0 lnterleuk.in-3receptor 
10-6 3.0 Inl<grinalpha6 
n.·I~ 2.0 [nterleukin-I beta precursor 
ZO-I 2.0 ZonuJa Occludin - I 
VECiF 2.0 VascularendotheliaJgrowth factorprecusor 
JL.4 1.8 lnterleukin-4 
JL.II 1.5 Interlukjnll 
JL.7 1.5 lnterleukm1precursor 
R.-liR 1.5 lnleTleukin 6 receptor 
CD40l I.S 
PGPI 1.5 Cluster of differentiation 40 ligand Phogocyticglycoprotein I 
lIAR 1.5 Interleukin-I receptor 
INF-yR I.S 
IL-IO 1.0 lnterferon gam.ma receptor InterleukinlO 
CD27Ut 1.0 
CDlOUt 1.0 CIUSlcTOfdiffermtiation 27 ligand receptor 
(OKS 1.0 ~~d:~ln~~=;o ligand receptor 
GAPOH 0.0 
IL-IS 0.9 =~~~Yde.3.Pbosp/we Dehydrage .... 
n 0.7 
I!Gf Interleukinconvertingenzym.e 0.6 Epidennalgrowth(actor 
University of Ghana http://ugspace.ug.edu.gh
0.6 lnJulio growth factorreoeplOr 0 JGfRII 
n,SR O.S InterieulciJl..Sreceptor Growth arrest and DNA-damage-protein 4S 
GADD4S 0.4 
0.1 VascuJareodotbeliai growth factor tyrosine kinase VEGFTKR 
recepto< 
IRfI 0.1 In&erferon resuJatory factor I 
r,,* J: PI4s""odium yoe/ii /7X j,,!ec/iorr allen jltflfllUlomudulalor gene express;o~ lit 
.., brailf Q/ peDk parasitemia (day 8 poJ/-irr/ection). eDNA m;croarray analysIs 0/ 
P.yotlil 17X IItfeclN and IJnin/ecled mONU! brain. Gene listed ~re Qlle~ed 01 peak 
pwiltwri4 FoUl c~ in expreuion is defined as GAPD,! normalIZed mRNA 
aprwioll ratio 0/g e. signQls ofi nfected 10 uninjecled mouse brain. 
IX §psS'ropbolomelric analysi' of tolal RNA samples 
I. Add S~ of RNA sample to 995",1 of RNase-free water 
2. Measure ipCCtrOphotometer absorbance at 260nm and 280nm 
l. AI>oorbaoi;e in 260 multiply by lOis the amount of RNA in ~gI~1 
4. Ratio 0(2601280 absorbance gives the purity of the RNA sample 
5. PlftRNA bu a ratio of > 1.5 
X Pap_ntioD loading and rugpige of 1 % fonnaldehyde RNA agarnse gel 
I. U. RNaseZ.AP (Ambion Inc. TX) 10 remove any contaminating RNase from 
gdtaDklcombandconica1flask 
2. Add Igofagorose powder into IOml of MOPS (3-[N-Morpbolino) 
PropaneSulfonic acid) (Ambion Inc. Tx.) in 90 ml ofRNase~free water 
l Microwave ~ aprose solution 
4. CooI ....... solulioDtoSO'C 
S. -Cut SOmI of aprose solution in a bood and allow gel to solidify at room 6. PrepIre IX Nnning buffer with SOmJ of MOPS in 450m1 ofRNa&e-free water 7. Aftcr rem.ovinl comb. pour running buffer to a depth ofO.S·IOcm 
8. "- 5~gI~1 of RNA sample in I S~I forma1debyc1e dye containing 2~1 of 
10ma1m1 ethidium bromide stain 
9. Electropborese", IOOvolts until the fonnaldehyde dye has migrated to within 
21D1Doftbeaooc1e 
10. Remove the gel from the electropboresis unit and observe bands UDder UV-
bUIiIlumioator 
177 
University of Ghana http://ugspace.ug.edu.gh
XI Pom.ratio. loading aDd meRiog 0(2% DNA aprose gel 
I. Weigh 2g of agarose powder and place it in a I DOml of I X Tris-Acetate 
EDTA(TAE)buffec 
2. SwirllOmixthesolution 
3. Heat the fWk in. microWive until the $Olutioo is completely clear (2-3 
minutes). Do not allow the agarose to boil over 
... Cool the solution to S50C 
5. Add Sill of 10000ml ethidium bromide stain 
6. Pilee a plutK: comb in the slots on the side of the casting tray 
7. Pour the aprose solution into the gel tray until the c:omb teeth are immersed 
abOld lA inlOtheagarose 
8. Allow the agarose gel to cool until solidified 
9. Remove the comb from the wells 
10. Pour IX TAE buffer to c:overthe gel 
II . Add 2111 of lOX loading dye (7.58 Fic:oll 400 + 0.12S Bromophenol blue in 
SOml deionized water) to I Dill of PCR sample and load into separate wells 
12. Load 10)!lofDNA size marker 
13. Electrophorese 81 10000its until the bromophenol blue has migrated to within 
2mmoftbeaoode 
14. Remove the gel &om the eJecbOphoresis unit and observe bands under UV-
IlaDsillwnilwor 
118 
University of Ghana http://ugspace.ug(.eJdu .gBhioMed Centl 
..aaria Journal 
-'''POf----lothe amcle as 't.~ upon ~-. Thelully-formotU.r 
......... beC;Om8 av3II8bI8 8hOrttY after the daCe of pubWcaOOn. from the URl listed below 
E
,......,dium yoelii 17XL infection up-regulates RANTES, CCR1, CCR3 and 
CCR5 Ixpresslon, and induces ultrastructural changes in the cerebellum 
Mal8naJoomal200S , 4:63 doI:10.1186/1 475-287S-4-63 
ISSN 1475-2875 
Artk:a.typeResearch 
Submission date 23 Aug 2005 
AuepCance date ' 6 Oec 2005 
Publlcattondate160ec2005 
Attlcl. URL http://WWW.malariajoumal com/conlenV4/1/63 
.. _~ -::-.was putMtshed wnmediately upon acceptance. It can be downloaded pnnted and 
~freetyforanypurposes(MeCOpynghlno(lCebelow). • 
Artic::Iet In Malana Journal are listed tn PubMed and archived at PubMe(I Central 
r.~ about publishing your research In Ma/ana Jouma/or any BIOMed CentraIJ~mal, go to 
http.llww'vt malanatOUrnal.cqmlmf9lInstrudm" 
For inkIt'matIon about othef BioMed Central publications go to 
I::..~~_~,_._ ... ... ...., ..... c...-.. ~c:. .a. 0.I'-qI~\ It_u:-..::::::'--~~---,a0l...,.." 
University of Ghana http://ugspace.ug.edu.gh
Pks",ot/I".. .vtWlii l7XL Infection up-regulates RANTES,CCRI , CCR3.nd CCRS 
e.pressiol'l,and Indttcesultrastructunlcbangt'sla the cerebellum 
I n J: I 
BiUDll"k Y. Sarlo. Henry B Annah . Ikovwaiza INne • Andrew A. Adjel • 
'PwIsnoq:y Urnt. Nopchi MemoriallndiMe for Medical RetearCh, UnivenilY ofGhIM, P.O. 
8oIW581.l..qoa, Acaa.Ghanll 
~I of Nicrobio&op. 8tochcmilb)' and lmmunolop. :\11.rehousc School of Mcdicine. 
72(1WestVKwDrivc S. W. Allana..GA, 30310-1495. USA 
'Dq.runcnt of P.lthology. University of Ghana Medical School & Korle-Du Teaching Hu<;pltai. 
P.O. BoI.4236. Acaa,GhanI 
'oep.nmmt of PatboIos:Y. Coklrado Stale UnIVcnilY. Fort Collins. CO. 80523. USA. 
BYS: b\mo~no~chl. mlmcom nc-I 
HA: hamWtC(lflrum.cdu 
AAA: ~dre .... adJcl50flthtl(m.'II .l ('m 
CSO: ('hnsllne.oIvcrfilfcoiu"-alecdu 
University of Ghana http://ugspace.ug.edu.gh
JWL:jlillardfitm<; m..:du 
University of Ghana http://ugspace.ug.edu.gh
... .,...,"" 
MaI.,.atffictsJOO.500mlllionpeopkeaus.inaovulmllhondellthsglobailypnyear. Tht 
,ntcl;)t,.11<,"' i~vin~ co-regulaton sl.Kh u cytokll'lt~ and adhesion molecules. Ho.,ever, lhe role 
of (hc'mokme~ and theu fettplon In malant. immunop.lholo~y remains undear. RANTl:.S 
(Rttul-.J on AC1ivllion NonnaJ T-Cell Expressed and Secreted) is a ChemolciM Involved in the 
pniDOll of Inflammatory mfiltrates Recent studies indll:alc thai the dcJ11ldation of ccU-«1I 
JIIIICbOIU. blood ·hl'1lJn barric:rdysfun(:hoo,n:crunrncruof leukocytcs and PloS1PtOdiwm-inCecu:d 
d)1tIrocyte5InloandocciustonofmlcroYeUelsrck\'anllomalanapalhogencsl\area. . ~cillted 
nh kANlES upreuion AckhllonaJly. activated lymphocytes, platelets Dnd endothelial cells 
lad m&illkrw¥:c of the malana,·mduced 1Of1;unmarory response. The hypotheSIS of thi~ Mooy is 
... RANTES and IU cOC'lc'(IOndmj:! receptors (eeR I. CCR3 and CCR5) mooulate malaria 
.........O iC-JlCSIS. A mUrine malma model was utilized 10 evaluate the role of thiS chemokme 
_ib.~lnmalan.l 
-1W llltf'abOI15 in lRununomodulalOf cenc expuuion in bnUru or Plosmnt/jum .wwlii 17Xl. 
"encd nuce • .< 1, anaJ)Vd ulm, eDNA mKtOalTl)' screening. fo1lowed by. temporal 
""".jI;U'~1fI of mRNA and protelo CIpressioa of RANTES and It, cone~pondin~ fectpcon by 
qRT·f'{ ·W. n1 Wcstun blot anaI)'Iil, respectively. Plasm. RA.'lTES levels wa.. . decenmned by 
I IUSA. .. ulu.structural \11!dae1 of brain ICCtions from IRfc~·tcd and unlRfcclcd mlU wu 
University of Ghana http://ugspace.ug.edu.gh
Reslll"" 
RANlES (p < 0 002). ('CRI (p < 0,036). CCR3 (p < 0.033). and CCR5 (p < 0.026) mRNA wen: 
\lJrurlC.anllyupregulatcd at pc:ak pat;l.\ilac:mia and remainc:dhigh thereafter in the experimen tal 
~ model RANTES protem 111 Ihe bram of mfecteU mice was upregulatcd (p < 0.034) 
~ With controls. RANTES plastnllevels were significantly uprcgulalcd ; fWO to three 
fold Ullnfected mice compared with controls (p < 0.026). Some d islal mlcro\ ascular 
cndoChc:lium In Infected ee«brllum apptMed degraded. bul remained inlact in controls. 
The uprc'gulatiOIl of RANTES, CCR I. CCR3, and CCRS mRNA. and RANTES protein 
IDCdIatt Infi.unmallon and ceUular degrad.tlion in the cerebellum dunng P. y~lii J7XL 
University of Ghana http://ugspace.ug.edu.gh
~alana alfli..:t\ bcl\loecn JOO·500 million people causm!\: up to 2 milium dcalh~ globally per year 
jll Cmbral ma1ana (CM). chancleriz.ed by sctlW1:l>;uld lo\!o otcon~clousnc!o~. IS lhe 11"10'1 
\(\c:ft complKJI1Im. of PlfJ.J11tOdjllRljolCiporum infection with monalilY rate~ ranging from 15 to 
m [2. 1) Malma-induced brain innammalltHlI~ known 10 be mediated partly by complu 
cdIIaW aDd Imnluoomociulator mleractions. involvmg co-regul.mTS such as Cy10lntICs and 
daioa l1KJkcu~. rauillng in the s.equnuation of par-mle ·infected erythrocytes m lhe br.m In 
... CM. AJ*1 from the sequestration of P./alnpafum-infected crythrocytc~, recenl 'Iudie~ 
' .... 71 hive rnakId sipifKMlI occumublloo of plMelcls and leukocytes in the diliilaJ 
mlm,v&~ulwre of the: brains of human cases of C\1. 'u~nl' role rot plMele1 and leukocyte 
wqucurlUon In human CM pathology. However, the role of chemokines and cnemnk.inc 
~OR in malana bram Immunopathogenesis slill remain unclear. Recently, lbe up-regulated 
uprnuon of RANTES and 11 \ m:eplOn (C CR3 and CCRS) In the cerebellar and cerebral 
qIOni of post·mortem human eM brains has been reported IS! Additionally, o,hen 19. 10! have 
Iq)ONd I~ mlghtKm ofCCRS· leukocytCl into the brain In experimental munne CM 
.... Thnc "udKs liiupport the hypothesis thac leukocyte recrultmenl by chernokmes may play 
• role ill Ibt pathogeneiis of human CM. Indeed, malarill has bec~ one of the many 
..n..tmaory di~ in wtuch RANTES .wi its receptors appear to play II role. RANTF.s, a 
'~in.Yolyed in the generauon of inflammatory infilttMn, plays a special role in the 
IIImlelWlCCandJWO'ongaiJOnoflhe innamnwory re~ponse. Tbelraffickingofinflammaaory 
Thl c:clh IIIlo the brain is mediated partly by RANTE...'i interactior" with CCRS. RANTES binds 
.,& vmety of rttqJIOn includiDJ CCRI. CCRJ Iftd CCR5. el.prnKd by 
~1MCTUpha~.memoryT<eUs..eosinopruls.endotheILalcclll. ba~lland mast cells 
III J It. comparab~ study tWa, Pltu1ltodilUft beT~hei Al'-OKA mfected CS78U6 and 8AL8/<: 
University of Ghana http://ugspace.ug.edu.gh
mice I~th. bodl strains of mlcc expressed CXCLJO(inlerf'cron-induced pr04:em 10. IP· 
10) JOd CCU (monocyte che~uc proteiD-I . Mep· l) chemokme genes as carly as 24 hours 
p""'lDfccuon 112). Moreover. the expression of lP·IO and Mep-I ~"In KTS. an L. .. rocyte 
orIbae. wu induced III "IITO upon .. llmulalion with. crude antigen of malana parasllesl121. 
0Ihtf more Tt'«nl sl\ldies.. using maJana ammal models, showed lhat e .. penmental cerebral 
..wu (El'M! was IndUCed In perforio·dcficienl rruce (PFP ) after adoptive transfer of cylOloxlc 
CDS' T cclb from iofected C578U6 mice. which were direcled 10 the brains of PFP ' mice ThiS 
qx:aflC rt(:lUItmcnt Involved chcmoldacs and IMir n:ceplDn. and indicated thai lymphocyte 
.:ytotO'UClty and craffkking are key players In ECM [101 While CCR2 was not obltrved to be 
fttCftll.&llotthedevdopmcnt ofECM 1131, CCR5 defictelKY In mice rq'IOrtedlydecreased 
IalCCptlbibtyloECM (9J. Thesesludles. together, ')upportthehypothemlhal leukoc ytc 
IUnUlnxntbychcmokmean<iciK-mokmc rc,"cplor InlcracuOfl\ play a role in Ihc pashtlgcn(SI! iof 
...,. In these arumal models. It seems thai plasmodial mfectlon has a 51gnificanl lmpacl on 
t..CDdothetiaIaodparcnchymalcclh. and,lhu\.ptll\ldcsanc=wdlnlCnsionloourunderstand 
.. oIlberokof s)'IlemJc and 10cahLed (br,lln) chemokme expression inCM 
immuopa&bogc~ •. The C)1:a.dhaCrK:C of mfe,",cd red blood cells URBCs) to the postcapillary 
.-a is the ...... Cliuse of IRSC sequC\lRlJon and vessel blockage 10 the cerebral form of 
.... malariL In both human cerebral malMia cau5Cd by P. falcifUJrum and the Plasmod;wn 
J(Jt1u 17Xl'lnffClCd rodent model of malaria, the sequestration of IRBCs in the brain vcuels is 
IlICmdIry to the cytoadhercnce of IRBCs CO t.hc pDSlcaplliary ... enuln 1141. In thli study, we 
-.lysed Ibc aJtcrarioll\ In lmmunumodul~or gc:nc expressIOn In brain samples of P. ,/«1iJ 17XL-
iaIacIed mx:e Ultng eDNA ffilcroarray screening. coupled with anal)'1is of temporal expressIOn 
..-as of RANTES and its c:orJ'npondins ~ors ,C('R I, CCRJ and CCR5 , In brain s.ampk\ 
-plauu oj P. yodu 17XL'lnfcl'lcd mice to IdeDtify aDd characlCnlc Ihe role of lhe!ie 
~dunn,rodenlmalana 
University of Ghana http://ugspace.ug.edu.gh
M"- model or P. YHlii .7XL malaria and preparation or brain samples 
AIl .......r dlledexpenmenis werc conducted acCOfdlng 10 the principles sel fonh in Iht 
NfIn,oNJ/ IfIJ'''IIl~J of HftJllle G __ for 1M ClJU and Ule qf lAborator)' Animo/l and approved by 
!lit In\lltutional Animal Care and Use COmnUltce (lACUC) of Morehouse School or Medicine 
Female s~· ... wetater (SW) mice (6-8 weeks) obl8lned from bcbon Laboratory (Bar HamOUI • 
..... USA) were rnaJntained on I 12ht ligbtldatk cycle wilh access to food and water ad 
Ubttwrt. In accOflbncC' \IOlth lACUC regulations of lhe ASSOCiatIOn ror Assessment and 
Accrrdualion or Laboratory Ammal c.rc: (AAALAC). Humane methods were u5ed 10 sedate 
IPCepnor to mtn·pcntoneal injection and tail·snipping. Briefl}". the mhaled anesthetic (O.I..o.2 
"11IOf1u.raneorhalothaneperliterorinductionctwnbervolumelogiveaga~concentratiOliof 
2. .... ,. reqUired 10 indute anestheSIa) were adminIstered to the remale SW mice. The induction 
proc:a5WiUvisaaalizedthrou~lheanestheticcbambcrandthcabolitinnoflheloe·pincbpUn 
rdlexule,\Cdbyapplyini~toindicatelhesuccessfutinductionofanesthesla.Mlcewere 
.JCCkd Inuapcntonally with P. ,oeliJ 17XL p.u."tized bloud. k..tndly provided by Dr. Chn!>lmc 
Oha (Department of Pathology. Colorado Slate Umversity. USA). This rodent malaria strain 
~asyadtumctblll"t\Cmbk'huf1W\malari .. cblr_lenlcdbyrever.spte:oo-and 
Ilqwomeply by day eight post·mfection (14,15]. Parasitaemia was detcnnined in a total cOUDt 
oIlOOlO SOO red bLood cell. (RBes) on Wright-GicmWl.,tained (Sigma Diagnos.tics. USA) thin 
Mood sman, EulbMwi£ was conducted by the mhalatlon of C02 0( cervical djslocalion. and 
Darp;offifteeD1nfcaedandtmiftfeclednucev.-ere-=rifkcdafterdaytwo,fow,slxandClghc 
1IOIt-lI1f~oa. For ea:b lime poInt, five brains from infected mice were stored in RNA Iatcr 
IAmbtonTM lnt;". USA)al--80° C for RNA i50lation. fivcbrains werestorW in Lysi!i 8ulltral 
University of Ghana http://ugspace.ug.edu.gh
tJ)'C for prokm maJ)'5is. and 5 were cryoproca:lcd In 4% paraformaldehyde al 4 C for li~ and 
IJ'IfIt.nussion electron mu:roscopy, Similarty. brains from unmfected nucc wen: ",lorN for RNA 
lIOlabon. protein ..wysis. and hgbt and transmisstOfl ekcltOO mlcro~opy. 
RNAiIoIatiOD 
Meuengcr RNA (mRNA) wu iiWlaied from brain samples uSing TRlzol Reap' (Life 
TedIaoIogics inc • Rockville, MD .. USA) KCOtdjog to the manufacturer's prolOcol. Genomic 
DNA eonwnuWllJll was removed rrom these sample!!. by trealR'lCnl wllh RNase· free DNa.'OC 
(IDmrogen. San Otego, CA. USA) for 15 minule\ at 37°C. RNA wu then precipitated and re· 
~lndidbY'pyrocarbonatedCDEPC)-treated waler 
cDNAmkroarraYliere-enlng 
Fn1: micrograms <Spg) of DNA· free RNA from day 8 posHn(eeted (peak parnllacmla) 
.-enn wu reVCDt IJ~Kflbed, in the presence of 100 "Ci oflalpha-up) dATP. for 
_ .......y  anal)'1is The commcraalsystem tiled 1(Ilnve~llgalc eDNA mieroorray ~ne 
espa'ton (Atl"TM 1.0; CLONTECH. Palo Allo. CA., USA) consists of two Identical 
ayton mcm~. spoaed with 588 diffcfC'nt mouse gene~ ~upcd in funcclOnaJ blocks • 
......n g ImmunomoduJalors, neurotropluns. neurotransmllters and pro- and anll-
1pIIpIO\I' genes. A complete list orlhc eDNA umple\ and (unlml\ on each iUTay. a\ well 
allle!t ronnponding GenBank accessIOn numbers, may be found at CLONT1:.CH's Atl • 
.. ute (www.alwdORlCCh.com). Bmfly. [aipIla-'~PJ dA1 1'-labrlled eDNA synlhe'lled 
-- 5. . 1 DNA-flee RNA by revene uanscnpcton was column purified and hybndlud•  
• ~SCrinJCIICY.lOamOU5ecDNAanayovernigblal70"C. Meminne\ W~ .a\hedal 
~Slnnpaey Ind npolCd to X-ray film AI -8O"C ovemighl. u recommended by the 
-.ufktllftn. Meuage e~presslOn was analysed uSing the AtluTM Image to software 
to.oNn_nt. Palo Alto. CA , USA) and the daLa exprnted as Ihe ratios of Ihe relallv( 
University of Ghana http://ugspace.ug.edu.gh
... iDlbe roRNA levels in lhe "aCeeted brrun :wuplesand umn(octed controls. 
&pICUKlfI 01 mRNA popul.arions (!'rom mfected and urunCected ml~) aI day 8 polll-
.,ecuoa were compared and analysed by aulOr.Khography and 4Uanllficd by ClONTECH 
~ne an &lY)1\ wn-are. An approximate e$Ornate of the .bundlnc:e level of. wgel cDNA 
III an RNA populahon can be rna by companng It\ ~.gnal to the signals obtained with 
~,genes of known abundance (e.g. GAPDH) 
IT-PCR "aliUti_ oIlmmunomodul.tor mRNA expression 
Gales enro:bn. induced RANTES. CCR I, CCR3 and CCRS were selectively confirmed by 
1CD-qU&nI.lCMIlve RT·PCR. Mouse mRNA sequence~ of RANTES, CCRI. CCR3, CCR5 and 
~yde-3-phosph.lC dehydrogena~ (GAPDU) ....- ereoblaincd (rom the Nalional ln~litule 
of Keakh ·NIItiooaI Center for Biolechnolo~y InfonnatlOn t~IH-!':(:81) GeneBank database 
respectively 1bese iCquence~ were then used to de~lgn pnmers for RT-PCR analym. which 
p:IIaMed amphwns of97. 103.96.100. and 95 bao,.e p:ms m sizes for RANTES. CCRI. CCR3, 
CCR.511'1d GAPOH mRNA respectively Pnmen were designed uiling the primer 3 softwue 
pI"OIAm from lhc Whileheold In)lIlule allhe Ma's~huseus Institute of Technology (MIT; 
...... MA., USA) Thermodynamtc an~lySIS of the pnmers was conducted using computer 
PftI&J"ami· Pnmer Premier TM (lnltgr~ted DNA Technologies. CoraJviUe, Iowa, USA), and \11 1 
Pn.er III (Bostoa, MA., USA). The resultmg primer sels were compared agamsllhe enlire 
-.c FftOI1le Il5lOit Neal to confinn specificity and eftlure that the primers nanked mRNA 
.-u. Iqiom. Complementary DNA (eDNA) was generaled (Maxim Biotech Inc .. CA .• USA), 
• .ptflCd wltb specifIC primen ..i nB TiIII pol)'Dlft"Ue and polymerase cham reae-lion (PCR) 
~ (Qu.sa'llDc. VUencIa. CA .. USA). The levell of band inren.,ille!l of mRNA of these 
... ~t.ul"e 10 GAPDJI were CY.lJIWed by PCR anaIy\.\ u~lflg lhennocycler (Penm.Elmer. 
University of Ghana http://ugspace.ug.edu.gh
Norwalk. Conn. USA). Conditions for DNA amplificalions were sci as follows· healing at 94"C 
for fi¥c minutes. foUowed by 25 cycks of DNA denaturallon al 940(; for Olle minute. an 
mnealln,ttcpll XOC (see Table J for rt:~pccllvC Icmpcrotturc values for each pnmer) fOfane 
IIUIIIIIC. wand el.lC11 SIOO II 72"C fot one mlnule and a final extenslOO 51ep at n"c for J 0 
.-....a. The number of cycles reqUired 10 aU.;un prodUCI~ In the linear range of the PCR was 
ascrnuned before the final assay WM run Working within this range. II was possible to 
dclt:rm1ftC cxprcsston differences after 25-30 cycles. PCR products wen: anaIywd on 2*· 
apto~dedUdium-bromidc gels and quantified using Gek:xpen ~oftware (NuclcoTech. San 
..... CA. USA). Band miensilies m each eli.penment wen: nonnaiized to the mean mlensity of 
GAPDH. Data \Wrt: e~p'e,~-d a.~ lhc rdative chuge In mRNA level in mfected and unlnfected 
\\"ntcfTl bioi: anal)')ls ..u s used to confirm RANTES prot.ein UpreUIOO In mouse brain durinl P. 
twIll 17XL Infection. Inf«ted and !lninfected mice wains wa-e lysed and their total protem 
~ by IIMdud method, usioS' cOl11m«Ciai kit (BioRad. Hercules. CA. USA). Twemy 
fiw: IlUCrograMS (25~g) of totaJ protein from mouse brain was subjected to J 5% SOS·PAGE. and 
lID DCd onto muoceliulolC mcmbr.mts. Mcmbnnn were then probed with I: 1000 biotinylaled 
•.. ausc recombinant RANTES (R&D Systems. mc. MN. USA) and 1:2000 anli-~ alpha· 
IIbIhn ISlpna-AIdridl. MO. USA) MtiboJy. Membranes probed with biottnylated anti-mouse 
rr.;umhlnaDI RANTES were incubaled with su-eplavidin-horseradish peroll.icia-.c tHRP) sC\:uOO&ry 
-body wiule those ptabcd witb a1p1U1.lubulin were IncUbaied wllh anti· mouse (gO leCondary 
1IIbbo.ty allbe SMIe coodluon~ 1be methods u§Cd for prc·incubalM> n. IncUNllOn and dcIection 
"~ebaYealtcadybcendescribedI16J.BarMkofprolemcorrC5pondinilO 
IlAHr f.S 0.1 kDaJ and alpha-tubulln (55k.Da) Weft' quantified !llomg Versa Doc lma~nl 
University of Ghana http://ugspace.ug.edu.gh
5,-.. (BioRad. CA. USA). RASTt::S proteiD eXIJIU'lOn \u.' norm.di/cd to that of alpha-
lIbWin 
[LISA dNnnb. .t iou of plasma RANTES levels 
Todettnnine whether RANTES and its rt.:cptor IntenCCiOfU were localized (brain) or systenUc 
IJICnpha'al blood). plasma RANTES levels were detemnned In P. ytHlil 17XL'lnf«tcd and 
COIIII'OI rrucc, ~Inl RANTES specirlC EUSA (Biosoun;e In~ionaJ, Camarillo. CA. USA) 
.xoflhn~ 10 thr manufacturer's specifications. Since RANTES may be n:leased by platelets 
JJnn~ -crum 1.:"lIe':lloo. hcpanmled bJood w&Scolkcted, centrifuged at 13,OOOrpm for 10 
aunllle~ 10 obtain plasma ~amples, and j;ub~equentl}' stored at -2O"C until uKd. Brieny. 
~alC\ (If \&IDdatd controls, and samples were ahquutcd mlo RANTES-coated microlitcr 
wdls Bloon-conJlIgMlld antibody was added to the wells and mcubatedat roorntempchlilln: for 
2IDn. StrtptaridiQ-bonn~l .. h peroxidase (SltCptavidin ·HRP) wa~ then added to each well and 
rrnbMed .. room kmperature for 30 min. The plates were dC\'clopcd with stabilized chromogen 
ISIIbt dark " room ICmperatwe. 1be reaction was stopped and optical densitic: .. of samples wm:: 
......S Oftm 
......l boIogie analysis of P. yoelii .7XL Infe«:ted mouse brain 
Wbok nn, of Infected and uninfectcd mKe at peak parasilaemill wcre examined by light 
~to"alualterythrocytlCandkucocyticsequtitratioolnbrainmKro\l,""ulature 
WWc mouse braim; flXc« in 4., parafonnatdchyde were processed for roullne histology. with 
~ytiaaodeosinstaJnlng_SectlOmorthcseparaformaJdehyde_fis.edsunp~(20 
~selcaediCCtionsofmicmvn.ds)fromeacbbrainwerescoredpositiveornelalivefor 
tr)tbroc)'k"Jeako(;)1~lequcstratlon . Thepercenta&ei.ofmlcrovessel'fromeachbrainthal 
I .... C':r)1hrocybcandkucO!O:)1if,;..cqu~tr.lCionwerenotcd 
University of Ghana http://ugspace.ug.edu.gh
I.1InSIrucru .... ""y. ot P. PHIii 17Xl hlfeeled mouse brain. 
Wklk brains of mfC(;ted and uninfec'Cd miIx al peU. paI<UllaemiOi were cxamlned by etectron 
lIIJCfOKOPy 10 evaluu poarasite induced morphological changes In brain ffilcrovucularure . 
8dmI were dissected. C\lllnlO smaUer cubes (2 nun' ). washed twice with phosphale buffered 
__ IPBSI and fixed for60 minutes in 100 mM potasSium phosphite buffer pH 7.2, 
(_wnlAS 0.1 .., ,Iulcnldehyde and 2% frelhJy prepared fonnaJdthyde . After fixation the 
InaM ~ dehydrated IR methanol and embedded in LowlCryl K4M 11-20 · C. Thin sections 
~ ,oIle.::led nn l00·mc~ nICkel grids and examined by traftSmiuion dectron microscopy at 
60eV tidescnbed prevIOusly 1171 
Stati5dcalanalysis 
1\e raults obtained in this work were from triplicate upenmentli petfonned IOdependendy by 
.... mecbods. ELISA dalaand densitometric measurements from agarose gel 
dcc:Cropboresil. as well b Weltern blot: analyses, ..... en: log-trandonncd 10 nonnaJize lhe: 
~foriftfc:eted(n.IS)andcontrol(n.15)samples,andalsolocorrec' for small sample 
Ue. DMa wen: expreucd as the mean :tswldard error of mean (SEM). Data from the P. yoelii 
17XL Infected and control poops were that compued, and lhe: p ,-.a.lues were delenmned by 
... oon~DlC Mann.Whllncy U-lCit. A valuc ofp < 0.05 was con~ldcn:d l>1..111\tu;ally 
.......... 
~yodi; t7XLmartnemalaria 
Allbr mICe Infected WIth P yoelii 17XL 1*&,\lle, dc\-ckiped rnalaria-rrlated·symptotni, which 
~theappearanceofrvffledfurandShi\lmngMpeakparasi1aemiabYda)'ClghIPOU' 
University of Ghana http://ugspace.ug.edu.gh
lOIectlOll , FII'uro! I) E...arninalion Oflhe vi&eef3 ofdissccted mice confirmed spkno-and 
bq*OItl~j:31)' JI peak paBSillCm .... concordaru: with reported P. yo~/" 11XL malana Inftctlurl\ 
114. 151 ~"I1C "t the control or uninfecled rruce showed any of IMse ~Igm, T he mice Infecttd 
wtdI p )~/'; I 7XL dtd not dc:vek>p (be clanK: signs of oerebnll pathoIoSY (such as hemlpk"a.  
.....p a. .lnl. '-'llh bllwJ hmb paralysis. convulsIons and coma aSSOCIated with mUnT'Ir eM 
pm1OUuydeKT1bed In the PlasrNJdi""" be,gltei ANKA munneCM modclllS. 19» 
~y.bisaopatbo&oPcanaJYSlsofbnunsoflheP. ,W)elii 17XL-lnfectedmrcere"eaJc:d 
plaaIng()fbrajnmicrovesleb,wllhparasiliuderythrocytes.bUldidnoerevealevldenceof 
IirucmlnakdpdeduaJhaunorrbaJesandexlcnsiveleukocyleaccumulationrnthe 
lDKTOC,fC\IlatlOn. However,thc:rewasulu3-.. INcluralevMlenceofoedemaanddislnlegnrlinl 
lIICIOu$C\lwendothebain !he cerebellum, which reflect locaJ perturbaliOnsrnducedbYlhe P 
1Dflu 17XLIOfcciiOfI 
cDNAmJcroarray.;crtenin2 
-"""'OOuJ.lon. IfOwth faclOTS. s~ss factors. transcnplloo raclon and neurotransmitters 
.-. II: peak patbu.aemla In the infected mKe vantd when compared with that in the urunfected 
IIU IbJUfe 2), Matked alteratIons 10 el~"I('J n 0( Immunomoduiator mRNA. includJng C-C 
ck:moLlne RANTES. C-C chemoJtine t«e:pcon. CCR), CCRl and n'R;. adhesion molecule .. 
PICAM·1. ICAM-I. and VCAM·I, (;yIOkJnes IF N·pmrna. TNF-alp. ... IL·12. lL-4. and INOS 
I ~ ob5.erved kI be uP-~1Ul3lcd. wbi~ growth fac:lors. GOt--2 and TGF·beta pr«unor, WttC 
.....~ rr.tJlc2.p«J.Oji)atpeakpar.ultac:mla 
RT·ptll validation oIimDlunomodulator mRNA expression 
University of Ghana http://ugspace.ug.edu.gh
The ClpK"I'''' of RANTES and 115 corrc~pOllt.ling m;C'ptors . CCR I. CCR3 and CCR S. wert 
IIIcruI by 1'. 1«111 t1XL lnf~tltln and .... ere signiflCaAlly up-regulated (p < 0 .002 (or RMIES, 
p < 0 0)6 rOt CCR I. P < 0.033 for CCR3 and p < 0.026 for CCR5) in lhe brain dunng malana 
IIIfection Up-regulallOO of RANTES mRNA bepn (our days afler mfecbon. until ciahl da)''10 
pm.mfc(llOn.appnnimatelylhree-fold increase in mfeclcd mouse braio al day s jxanddayelghl 
p*-infection c:ompamt .... llh coouub (figure 3A) . Messenger RNA expression kvds of CCRI. 
CCRJIftd CCR5 wen- approximately two to Ihree fold higher in infeclcd mice than in control~ 
(fi&:uru) B, 3C" 3D). CCR3 and CCRS c:x~:r.Iun profiles were similar to the expression 
profiIr oIlhell corre)polKling RANTES ligand. The degree o( variation of GAPDH mRNA from 
...pc 10 wnpk wa.\ "Ithin 5% oCthc: me&n eXpIU\lon level in both infected and umnfec ted 
CICIMfOI~througbO\ntbecourseortheinfection . 
WeIImlbioI auI)'5ls 
kaults from I.bc Western blott M1aJySlS indicaled tbtllhe expressIOn of RANTES (7 KkDa) 
proIaDmbraifttUsuesamplc:sfrommfocledmlccaldayfotJr.5Ixandeighlpost-infeccioo.w. . \ 
~1)'up-~gulaled(p=O.049atdayfourandp<003balday~ixanddayeight)lfigun: 
4A I- uplcuioo of RANTES protein in brain tissues followed a limllar profile: con"I\I~'n' wilh 
IIIItNA Cl.prcsUon Indicmng that RANTES mRNA cJlpre~sion in brwns of P. )'Oem l1XL 
Ilfeacdl11iczweretrarllitatcdintoprotein. EJlprt'lOs,lonnfalpha-lubulinpn>lClnfromumpleto 
taIIIpk",awittunS%ofthcmeanexpresslonkveimbothlnfcctedandunmfectedslft1p&es 
dlruugt!uut the cour<;eof the infection 
Plasma RANTES procria kn) duriag P. joei,i 17XL Inreclion 
Plwna 'WnplcJ; from Infected mice at each time POlOt '" well as W1iGfected conttols were 
-Jed (or RANTf...'i prok:ln express","_ S~lemlc Increase in RANTES protein exprt''ilion 
University of Ghana http://ugspace.ug.edu.gh
bepD four (bY' after P.  .'t«i;; I1XL Infecuon. unul peak ~llXmia 011 day eight with about: 
6Iu.f~ upre~lat:Jon In Infected pl.lsnuI compared with controllFipre 4B). 
Hlswp.tboIoIicanalywofmousebrain 
~paJ3Sltiuderythrocytc,,,,ereob5ervedinbrainmicrovesselsofallthcP.\(Jf'·fll 
J7Xl'lnfCC1ed nuce IIudttd at peak par.mlaenua. but none 01 the uninfectednUec Therc:wasno 
hliWpIlholop:evidencc:of!ICqUC\ICrcdoraccumulatedmOflonuclearleukucytcs 
(lIIOIIOC)lnJmIC"I"OJIMlesandlymphoc)1es)orexten~lVepetechialhaemorrhagC:!l.lnthebrainsof 
bodId!cllllet:ledandunlnf«ledmlce In lhebr;unoflheinfectedmK:e,theerythrocyte 
~ob~edlRtllewh'leandgreymallerregiooswa~.tJenucal 
BlUlS from para5llued mice were ultruUUC:turaUy analysed by transnuulOn elttlron mKroscopy 
Io~effecuof P. ytWfi; l1XL infection on brain nUcrovesscl endothelium Uninfected 
IIKMC ttn:bellar tusues (Mag X) 5000) \hawed normal.nlae! mlcrove'iosel endO(helia (ME) .. 
I*Iod b ram t.mn (88B). lnfected mouse cerebellar tiJsues (Mag. X 15(00) showed pcri-
Y1SCU1ir ckmn~ concomitant with oedema u well u some disintegrating ME and 88B IFlgure 
5] "llrI. endothtbal cell damage (ieiions) was observed in 6 out of 10 mice examined .. day aatll 
fII* .. tecoon. Erythrocytic (RBC) adherence in the nticrovcueb, but not leukocytiC (WBC) 
1IAamce. was observed In the infected mouse brains examined 
DiInrwon 
llIcbnWlp.lhoktgyu.rocialtdwithmalariarcm.lln,arnajOfcal,l5cofdealhduring5evereP 
~ Infection. CcrebnI malat:ia, clmactenred by coma and seizures in patients with p. 
1tIc~ ulfccUon. is a major cause ofmalan" ",\OciaIed morulilY. and may be accompanied 
University of Ghana http://ugspace.ug.edu.gh
by JOd;Iboiic -=wJOOs and hypoJlycaemil in African children 120 I. USing experimenlll models 
.111 faobwe a bettcr uftdentlndin&ofthe pathogenesis of this syndrome and lhercfore ensurin& 
dlatbcacr IntcrVenllon stratcJic.i; can be developed to mInimize or abrogate the severity or the 
dnc8IC_T he cytoadherence of infected red blood cells (lRBCs) to the postcapillary venulcs ;1 che 
IMp causc of lROC scquestralKm and vesliiel blockage In the cerebral form of human miliaria. In 
bolhbuman cerebral mallrilcau5ed by P. fakipaTUnl and chc P. yot'/II 17XL·infccted rodent 
-*I of malana. the lCquestration of IRBCs In the bratn vessels is secondary co the 
q1OIdtIm:nceof IRBCs 10 tbe pOIlcaplllary venules 114. 1;1 Thlsobservltion hIlS resuhcd in che 
.-nJ IUgc:soon thai the p. ~Ii; 17XL mouse model resembles human P./alctpQnmt 
afutJon more dosdy than the P. '-"xlwi ANKA mDUIe model. since it showllinle 
~ofmonocytes/macrophageslnthebrammicrovesseIsI14.ISJ.Howe\lcr.reccnt 
.... eM ICudia (4-7) . Indiutlnl):: \Igmficaltt .. cumulallun 01 plaaelets and kuko~·ytc\ m the 
tMuJ cerebral ffiJCfOvasculature In eM. suggest some other slIru lanllCs bel ween human eM and 
.'·ltnPei ANkA InOUIC eM model. In Iddileon to the similarities In ~ymptum;lIoJo~y II R. 
19).n.escrec::cntrepons 14.7] 01 sl/;!Ollicam leukocyte accumulations m the brain 
1IIiavv~ In bwuaCM draws a sinularity with the P. bn,;h" ANKA-Infectcd rodem~, 
-.0 1 maa.ia. In W.hiCh. the major. IuSl0patho.. ,og;c fmding i, "'en,,," accumu'"ion of ~:( 
~ or maaopbq:ea. rather thaD scqucJfCfed erythn~ytcs. In the brain 118. 191. "', 
III tIIiI snady. III Ik auce Infected with P ..w JeIIl 17XL developed malaria-related symptoms. 
wfIidJ mcluded lbc appearance of ruffled fur and $h",'ering by peak paB,i\aC1n.ia AI day elghC 
fOSI-lIlftaion. SpImo- and hcpaao-mrpJy at peak: parasitemia was common. and concordant 
-reponed P. )1M';; 17XL malaria infections r14. 15). The OMervatlon of the absence of the 
.... Sipu. ofeadnl ~(O!y 1ft the P. yoelu 17XL·mfected mice at peak pMCbIt.aem .. MIl 
-~c findings of (ROC ~1IICICJalion and veuel piugging with theabscnce of 
'-oc,tell:CUmulabonlnbrunso(p. )IH'11l17XL.lftfec~dmice.c:onfllTll5prnious1yrepone:d 
University of Ghana http://ugspace.ug.edu.gh
obieJ"o~_ll'. lSI ThedassicsignsafcerdMaJ pMbology,namcly hemiplesia, paraplegia. 
...... WJtbhrnd.hmbparalysis.coavulsionsandroma.h.lvtbeenprevioullydescribedintheP. 
berKhn ANKA mouM: model I J8 . I YJ These observations provuk a juscifJC&tion far the 
o:wnplcmenwy use of both munne malaria models to sNdy human CM. The P. lw'ghei ANKA 
...xl Wl," wmdanty ..,;tb human CM In terms of symplomalology, whilst the P. yoelii 17XL 
.odel ~xlubilS simit.rity 10 human CM in terms of histopathology. This study focused mainly on 
rulanIlnducai ebemoIcine and chcmolone receptor expression in lhe P. yoefij 17XL ffiunne 
IIIOdcI. Arumal modcb ha\'c provided compelling evidence Implicating the role of inflammatory 
proa:ucs in the devclopmem of malaria brain pathoaoaY (21). Adhesion molecules and platelet-
~ Immunc·mediakd damage 0( vascular endothelium of the brain have also been fcponed 
1211.1bclwJc and coUeaJ\lCsobserved that maJaria infection induced thecllpression ofCCR3 
udCCR5 on plxeata1lUCrophagc\ In pregnant women [22]. Sarto and colleagues indicated 
.... RANTES and lIS receptors CCRl and CCR5 were upregulated in the cerebellum lind 
cmhnlmoipoll-mortcm human CM tissue samples 18J . Funhennore, activated T·lymphocytes, 
P'*ku Ind en60thebaJ cells release large amount of RANTES 3·S days after acth·ation, gIVIng 
IIIaIchemokiataunlqucro&eintheJenetalJon,nwntenanccandprolongiltlOnofimmuneand 
~rc~ponse (231. By understanding the role ofRANTES and ih U:ccplors during 
..... iInmunopathogennll, a new str1U1)' (or pre\letlling or mmimizlng the OUlcome of CM 
-~sevaefOfllal ofnuJana can be developed . The nticroarrayresults (Tlbk 2)confinned 
"'1enU-quanll!abve RT·PCR analysis hom tlus study revealed changes in the expreuion ar a 
-.berollntmunomodulMorsthlilhad prevlouslybeenusoc1l1led Wllh malari.·induced brain 
d,m.ction (12). In du, study. the CXPR"IOfI\ of RANTES and its corresponding receptors 
en. I. CCR3 .ad CCR 5 were up·~gula[ed In the brain during P. yoetill7XL infection. rurthrr 
1IIIpI~ these molecula in the patOOgtnelis of rodent cerebral malaria_ This study IS a fint 
...... lb:drvekJpmentof.~lar6nierprint(diaposQc)forbrunlmmunopalboaenni\ 
University of Ghana http://ugspace.ug.edu.gh
.,ciIIcd with malaria . In this regard. rocentstudlcs with infe<:tiousagcnh ~lJChasSalIftOft~/14. 
~aadTrypa1IOsomQ.usingcDNAmleroam.Ylechoologyhaverevealedumquegene. 
(1.pr«sion profiks 124.261 which may be ofdlagnoslic value. 
nus study demon~ICs (hal cbemokine RANTES (eeLS) and its IUepiors (CeR 1. CCR3 and 
CCR5) nuy play an important rok in P. yaelii 17XL Infection in mice. Chemoklnes nre 
~1.loryfacIOf';thal pl.yan important rok in the chemotuis. activallon and 
lIIanIfOpOieaisofk:uk.ocytesI27-29J.Chemok..ineactioninvolvesinilialbindlrl~tospeclfic, 
.nen·uanunembnnc·domain. G·(guanine·nucleolide-bindlrl~l-prolcm·coupled n:ccplor!> 0fI 
'-ielcells.lnresponseloarelativelyhigherconcentrationot"chemokinesatthesileof injury or 
ulfc:ruon. leukocytCS are acllvated to perfonn effector funclions such as release ofthcir granule 
corIlCnu and Increased production of cytokines. 1be temporal expression profile of chemokines 
lIId&beu f"n:tplOOo as early immunomodulators in the immunopatho~isofma1lriacould 
saw as imponant new blo-markers for monitoring the course and predicting lht outcome of the 
diIcuc. The eDNA mlCroamty analysis has revealed significant up-regulation of RANTF_'i (6-
foMl). peak pcaI1laerrua. The results of RT- PCR analysIs mdicate that by days 61brougb 8 
pDSHnfeccion. mRNA exprc:nuXI of RANTES is significantly up-regulated (p < 0.002) in 
lllfa:rcdmicecomp.tedwitbc:ontroll,indicaungthat It is involved in the immuntlpalhogenesis In 
P. JOrW 17XL-infccted mou'ie. RANTES in addlliun to CCR I and CC~ are expressed by 10 I 
cdk 1301. lDdecd, uafficlung of inflammatory Th I cells into the brain wu reportedly medialed 
....,. by RAN1'ES inleraction with CCR5 receptor (30]. Also the absence of CCRS receptor in 
~lImlurrhLi ANKA-infected moU5e bram resulted in a reduced Thl cytokinc production 
191. The QpresUoa of RM.'TES and CCRS mRNA in p, "orlii 17XIAnfecied mouse brain in this 
Mud~' 'uqem. Th I-mediated Immune response, and that factOR capable of inducmg Thl 
~ wukf play an Important role io modulallng miliaria infections. MacropMlel and other 
~reIease promflarnm.aIOl")' c)'IOkines, mcludmg TNI--alpba. lFN-gamma and IL-l -beta, 
University of Ghana http://ugspace.ug.edu.gh
ndtlntufllwillpromoeelhe releascol t.:he:mokiDesl30l- Thtc'(prt~5ionofchemokine.IP-IO 
_Mep.l. gepes lit KT-5, anuuocyte cell line. have been shown ItI be upregulated in vitro 
.,a snmularioa witb I crude anllgen of malana paruiles(121. A soluble gradicnt ofthes.e 
ckmOkineswltbinlhe IiUUC: ra:nllh variou" cell types thai exptcs5 receptors forthc differenl 
cbernolunes. lbe exprt"IOI1$ of all the C-C chemoklne receptor .. for RANTES. CCR I, CCR3 
.-I CCR3. were UJRpl8led in the brain' of P. )"fW/iI 17XL-infecled mice. The eJll~uion of 
lANTES probably enhanced tht expres.slon of liS recepton. Sano and c:ollelJues demonstraled 
lUI K"AM-llnduced RANTES mRNA upre. ... lun and also increased Its protein .. ynthesis InCl 
vcmionbyendotheliaJ cells 1311. It IS likely thai the P. )'oel,i 17XL-indu«d RANTES 
procMcbonobtcrvcdiDtbeCUlTefltstudywouldanmctandactivaaeleukocyt«lowards 
IIf\Imma&ory ,ites to mediate localized hyper-Inflammatory response. thlt could eXicerbale lhe 
-.c JlIIlbolo~ in the cerrMlium. Be!noue and colkagues 5howcd that the brains of Wild -type 
mace 'IIIIdI CM have slgllIfacantly tujl:her levels of CCR~ than the knockout-type, implK:aling 
IIrIaemo&ecuksiDlhepatbolottlcaldun~,producedinlhebrainduringtheinfeclion(91.Thc 
IIiMIks of thiS wdy demonslrate that the Increase In productiOn of RANrES follows the COUI'l\e of 
I' :-ow I7XL malaria infection. thus RANTES and its receptDni CCR I, CCR3 and CCR5 were 
dctcdcd MlhrIr hipesc levels al day MX and day elghl post-Infection. TIus o~erved temporal 
IItOaation of the progrenlOfi of P.)"odii 17XL infeclion wllh lhe mcre.a,mg prndul"tlUn (lr 
RAN1ES and its receplOfS AlpaIS" che cwo evenls might be linked. Western blot analY~ls 
ItteIkd thai brain tisiUe traDicripli of RANTES were actually tranilat.cd into protein, and were 
~y ..r egullled(p"'O.046forday4andp<O.034fordaysixanddayeia.hlpo4lt_ 
'~IeroooJ In anfected mice (Figure 3A). The ELISA daIa from this study i~ sipiftcane 
IIptgllluioa(P=O.(M9forday4andp<O.026rordaysixanddayeigIUpOit_infectionlof 
RA,"IES IDP.yoeln 17XL-mfecCed JI\OUIIe plasma dun ancontrob (Figure 30). Most of the: 
Ikrastrucrural patboIocica.I ~Ift. otKen-ed;n endothelial cell damage (leaioru.llfl ~llI. out of 
University of Ghana http://ugspace.ug.edu.gh
IOtbe boit f121, 11 has been observed that C·C chemokine!., ~lKh as 
"""""'"II" p "thelb'ood brain barrier in the cerebellar region of intected mOIl~ebrain Thj\ 
JnsiJ.OUlofI0nuceeXilmiaed,occulRde~P'=(lall} alday 
• p",·",.laem •• ) ,ond was similar to the ObservatiOM of Tbumwood and 
Ff.'Wii'P<iANKA-i.IOcted All and CBAIH .... [35]. The ••r «ted Cf)1lIrocytes 
T"wding '"",n .no,rom,,', ob,,,,,,.d in the sections. examined. 5ugestlhll the 
,hecf<d>ell·"',cro. .. ,ulatendotheliailaycrcouldbea!.'>(lcl;uedwlfhpanasite_induced 
""""m,,,",, t ~_• •.. Perivascu. ... oedema was also observed in this region of infected 
...........n  l~ly u .rault oftbe endothelial ceU danuge a1lowins eIcess nuid to move 
~. die ,,'+ ,_ homer. EacI olbtlial «lis interactmg with p, Jt¥lii 17XL-JWUilized 
.._  ....., ., been ,bown to be induced toproducc: and present spccifie chemokines. such u 
bybrainmdothclililc:db(37.J81.8raincndothelwceUs.~lia 
the 3 ....J Of cellular components of the 88B. c:.~u CCR5 fettptor 
University of Ghana http://ugspace.ug.edu.gh
f'Jl," bcDoc the binding of RANTES 10 Its receptur. on thc~ cells can serve to further 
acOva&e them Ind cnhMce a ioc;lhzcd hreakdown of tM microvessel end()(hehallayer observed 
.tbe infocted moute brain in the current invesugauon 
III ««Iusioa. P. )'WIll 17Xl infection upn:guJale~ RANTES and lis corre~pondmg receptOR. 
CCRI. ernl and CCRS, in. mouse tnin.. and that ultra'truclural changes in the microvascular 
mdodIehal layerOCCWTeCl in the cerebellum of infecled mice. This is thefirsl lemporal 
uprewon study of RANTES lind its recepulB associated with murine malaria. Funher studies 
_ -SUWay eo euminc the eltpnuion of these .::hemolones and cbemokine receplors in .l 
"'-CM sympcomMOloJy· like model such as P. be,gh~1 ANKA. (0 a~cenaln difference) and 
I\Ulllarities. As it is not dear which cell types in the mouse eM brain samples over-express 
1tANTES. CCR I. CCR3 and CCR5. funher comparcuive immunolocalizallon and antibody 
...... scudiel~currenUyunderwayIOeltaminelhcphysiologicaJrelevancc,lOUJ'Ceand 
apra.uoo~, of ttltw: Important biomarken. in. both murine and humMl eM brain samples. 
U.tlabbreviaDouused 
888. BIood·Bram 8urier: 
o.t.m.almalari~ 
a:w..e:r.penmenlAlcerehralmalana 
ME. microvas.cularcndolhrlium; 
NCM. non-atdnJ malana~