Animal Gene 27 (2023) 200139 Contents lists available at ScienceDirect Animal Gene journal homepage: www.sciencedirect.com/journal/animal-gene Single Nucleotide Polymorphisms in Insulin-like Growth Factor 2 (IGF2) gene and their associations with body weight and growth rate traits in indigenous guinea fowls (Numida meleagris) of northern Ghana Kurukulasuriya Mariesta Jayaroshini Ahiagbe a, Christopher Adenyo b, Miho Inoue-Murayama c, Esinam Nancy Amuzu-Aweh d, Patrick Bonney a, Boniface Baboreka Kayang d,* a Animal Research Institute, Council for Scientific and Industrial Research, P.O. Box AH 20, Achimota, Accra, Ghana b Livestock and Poultry Research Centre, University of Ghana, Legon, Ghana c Wildlife Research Center, Kyoto University, Kyoto, Japan d Department of Animal Science, University of Ghana, Legon, Ghana A R T I C L E I N F O A B S T R A C T Edited by Dr. M Mousel Insulin-like Growth Factor 2 (IGF2) plays important roles in stimulating cell proliferation, differentiation and migration culminating its effects as a modulator of juvenile growth in animals. Although the gene that codes for Keywords: IGF2 (IGF2) has been investigated as a candidate gene in several livestock species, there is no information on Growth rate polymorphisms in IGF2 in guinea fowls (gIGF2), an important indigenous poultry species from West Africa. Guinea fowl Therefore, this study sought to identify the Single Nucleotide Polymorphisms (SNPs) in three populations of Insulin-like Growth Factor 2 gene Northern Ghana indigenous guinea fowls in northern Ghana. Target genomic regions in gIGF2 were amplified and sequenced from Polymorphism 84 indigenous guinea fowls from Upper East Region (n = 17), former Northern Region (n = 22) and Upper West Region (n = 45) of Ghana together with domesticated French variety (n = 3). The sequences were aligned with the reference genomic sequence (domesticated French variety) of chromosome 6 (GenBank accession no., NC_034414.1) to identify SNPs. Statistical associations among the genotypes arising from the SNPs and juvenile growth traits were estimated using linear models. Two novel SNPs were identified in gIGF2 among the indigenous guinea fowls. An insertion of a Guanine (G) within a poly G motif of the intron following the third exon at the 13,955,730 bp location was identified in the majority (84.5%) of indigenous guinea fowls, while the wild type allele was observed in the minority of indigenous guinea fowls and in the domesticated French variety sampled. Also, a biallelic transition arising from the substitution of G by Adenine (A) at position 13,956,496 bp (13,956,496 G > A) located on the fourth exon, which codes for most of the extension peptide of prepro IGF2, was observed in the minority (11.9%) of indigenous guinea fowls. No significant associations among the ge- notypes arising from the two SNPs, with body weights and weekly growth rates, were identified. Abbreviations: A, Adenine; BLAST, Basic Local Alignment Search Tool; BLASTN, Nucleotide BLAST; BW, Body weight; BW1, Body weight at week 1; BW11, Body weight at week 11; BW2, Body weight at week 2; BW3, Body weight at week 3; BW4, Body weight at week 4; BW6, Body weight at week 6; BW7, Body weight at week 7; BW9, Body weight at week 9; C, Cytosine; cIGF2, Chicken Insulin-like Growth Factor 2 gene; CP, Crude Protein; DNA, Deoxyribonucleic acid; EDTA, Ethyl- enediaminetetraacetic acid; FNR, Former Northern Region; G, Guanine; GF, Guinea fowl; gIGF2, Guinea fowl Insulin-like Growth Factor 2 gene; GR, Growth rate; GR1, Growth rate from week 1 to week 2; GR2, Growth rate from week 2 to week 3; GR3, Growth rate from week 3 to week 4; GR4, Growth rate from week 4 to week 6; GR5, Growth rate from week 6 to week 7; GR6, Growth rate from week 7 to week 9; GR7, Growth rate from week 9 to week 11; GRO, Overall growth rate; HR, Homologous region; IGF, Insulin-like Growth Factor; IGF2, Insulin-like Growth Factor 2; IGF2, Insulin-like Growth Factor 2 gene; MAS, Marker Assisted Selection; ME, Metabolizable Energy; MJ, Megajoules; NCBI, National Center for Biotechnology Information; PCR, Polymerase Chain Reaction; SNP, Single Nucleotide Poly- morphism; T, Thymine; TPNG, Three Populations of Northern Ghana; UER, Upper East Region; UTR, Untranslated Region; UWR, Upper West Region. * Corresponding author. E-mail address: bbkayang@ug.edu.gh (B.B. Kayang). https://doi.org/10.1016/j.angen.2022.200139 Received 29 January 2022; Received in revised form 3 November 2022; Accepted 14 November 2022 Available online 17 November 2022 2352-4065/© 2022 Published by Elsevier Inc. K.M.J. Ahiagbe et al. A n im a l G e n e 27 (2023) 200139 1. Introduction form of housing. Hence, there were no phenotypic records kept by the farmers to calculate pedigree of the offspring and populations can best Growth is an important quantitative trait in poultry breeding and be described as randomly mating outbred populations. Eggs collected genetics. Growth in farm animals is influenced by multiple genetic, across 32 sample locations (Fig. 1) were assembled at a central point and environmental factors and their interactions (Lawrence and Fowler, airlifted to the Hatchery unit of the Animal Research Institute, Accra, 2012). The somatotropic axis plays a central role in regulation of growth Ghana where they were hatched in a single batch. Eggs were handled and development in animals. Growth hormone secreted by the hypo- according to standard procedures of handling breeding eggs from point thalamus triggers the secretion of Insulin-like Growth Factors (IGFs) that of collection until incubation. bind to their receptors in target tissues and initiate signal transduction at In total 1200 eggs were collected from the Three Populations of cellular level that ultimately results in cell proliferation, differentiation Northern Ghana (TPNG). Upon arrival, all the eggs collected from the and migration culminating in overall growth of animals (Kim, 2010). TPNG were stored for 24 h in a storage room maintained at 18 ◦C and Due to the pivotal roles played by the proteins of the somatotropic 70–80% relative humidity. Eggs that were too small, cracked or grossly axis that include growth hormone, IGFs, their high affinity receptors and misshapen were discarded (n = 351). The eggs were surface-disinfected binding proteins, the genes that code for them are considered good and incubated at 37.5 ◦C and 60% relative humidity for 25 days on candidate genes to study growth and development particularly during separate setter trays in an artificial incubator (Hyderabad Incubators, the early stages of growth in poultry. These genes are also ideal targets Hyderabad, India). A total of 509 fertile eggs were transferred to the for development of molecular markers for Marker Assisted Selection hatcher on the 25th day and maintained at a temperature of 36.5 ◦C and (MAS) for faster growth (Nie et al., 2005; Xu et al., 2013). a relative humidity of 70%. A total of 280 guinea keets that hatched Insulin-like Growth Factor 2 (IGF2) is one of the key components of were individually tagged and moved to the brooder house. the complex protein network of the somatotropic axis. Therefore, IGF2 gene (IGF2) has been considered as a major candidate gene for growth in 2.2. Management of experimental animals and collection of phenotypic poultry (Yan et al., 2017). Several workers have studied the poly- data morphisms within IGF2 in several livestock species using Single Nucle- otide Polymorphisms (SNPs), due to their association with functional Keets hatched from eggs were brooded at the brooder facility of the regions of genes and related phenotypic traits. Some associations be- Guinea Fowl Resource Centre of Animal Research Institute, Accra, tween these SNPs and growth have also been reported. Ghana up to the eighth week according to guidelines detailed by Zwierzchowski et al. (2010) studied the polymorphisms in IGF2 and Ahiagbe et al. (2016) with artificial light and heat provided by gas their associations with some economic traits including growth rate in brooders while strictly adhering to guidelines to ensure biosafety. Keets Polish Holstein-Friesian cattle. Associations between SNPs, their hap- (0–8 weeks) were fed with a formulated starter diet containing 24% lotypes of IGF2 with growth have been established in Quinchuan cattle Crude Protein (CP) and 12.5 MJ Metabolizable Energy (ME)/kg as rec- of China (Huang et al., 2014). Similarly, Hou et al. (2010) identified ommended by Amoah et al. (2018) and Ahiagbe et al. (2021) for local SNPs within porcine IGF2 in a native Chinese pig breed and established guinea fowls. Growers were then raised in a deep litter house up to 11 their associations with growth. weeks on a guinea fowl grower diet containing 16.4% CP and 11.23 MJ Chicken IGF2 (cIGF2) is present on the fifth chromosome and is by Metabolizable Energy/kg. Feed and water were available ad libitum. A far the most studied avian counterpart of IGF2 genes. Chicken IGF2 has vaccination schedule was also followed according to Ahiagbe et al. been isolated and characterized (Darling and Brickell, 1996) and the (2016). nucleotide sequence for the complete cIGF2 is available (GenBank gene Body weights (BW) were recorded at weeks 1 (BW1), 2 (BW2), 3 ID, 395097; GenBank accession no., NC_052536; REGION: (BW3), 4 (BW4), 6 (BW6), 7 (BW7), 9 (BW9) and 11(BW11) from in- 13375612.0.13394087). Several studies have reported SNPs within dividual birds using an electronic balance. Growth rates (GR) from week cIGF2 in several breeds of chicken (Amills et al., 2003; Tang et al., 2010; 1 to 2 (GR1), week 2 to 3 (GR2), week 3 to 4 (GR3), week 4 to 6 (GR4), Wang et al., 2005). Further, Yan et al. (2017) observed associations week 6 to 7 (GR5), week 7 to 9 (GR6), week 9 to 11 (GR7) and overall between juvenile bodyweights and a SNP within IGF2 in Langshan growth rate (GRO) were determined as weekly weight gains using the chicken. formula 1. However, neither the IGF2 protein nor the gene in guinea fowl (Numida meleagris) (gIGF2) has been isolated or characterized. Vignal Final BW–Initial BWGrowth Rate = (1) et al. (2017) recently published the annotated genomic sequence of Time interval (weeks) gIGF2 as part of the whole genome sequence of guinea fowls. To the best of our knowledge there is currently no information on the SNPs within 2.3. Sample collection and sex determination gIGF2 gene. This study therefore sought to identify SNPs within gIGF2 in three indigenous guinea fowl populations from northern Ghana. In the 12th week, 5 ml whole blood was collected aseptically from Further, we carried out preliminary investigations to identify associa- the wing vein of the birds into Ethylenediaminetetraacetic acid (EDTA) tions of SNPs in gIGF2 with body weight and growth rate during early coated tubes and DNA was extracted using DNeasy Blood and Tissue Kit growth in birds originating from outbred populations to lay the foun- (Qiagen Inc., Valencia, CA, USA). All the 84 remaining birds were used dations to evaluate SNP-trait associations for populations with pedigree for SNP identification within gIGF2. In addition, three DNA samples data in the future. were obtained from exotic domesticated French variety for comparisons. Due to low level of accuracy of sex determination based on pheno- 2. Materials and methods typic methods or vent sexing in guinea fowls, sexes of all surviving birds were determined by PCR using methods described by Ahiagbe et al. 2.1. Source of experimental animals (2017). Eggs were collected from three main populations of guinea fowls 2.4. Amplification of IGF2 genomic sequences in guinea fowls by PCR and (Numida meleagris) raised in Upper East Region (UER), Former Northern sequencing Region (FNR) and Upper West Region (UWR) of northern Ghana. In these regions, guinea fowls are widely raised under semi-intensive Due to the unavailability of genomic sequence of gIGF2 in public production system where birds were left to scavenge for most of the sequence databases during the laboratory phase of this study, the day but were provided with supplementary feeding, water, and some primers (Table 1) originally designed by Nie et al. (2005) to amplify 2 K.M.J. Ahiagbe et al. A n im a l G e n e 27 (2023) 200139 Fig. 1. Map of northern Ghana showing the sampling locations. Table 1 Primers used for amplification of genomic targets of guinea fowl IGF2. Homologous region in cIGF2 Primer name Primer sequence (5′ to 3′) Length of amplicona (bp) Annealing temperature (◦C) 5’ UTR, exon 1, intron 1 IGF2E1F CAGAGATGTGTGCTGCCAGG 339 60 IGF2E1R CGAAAGCAGCACTCCTCCA Exon 2 902F GGTAGACCAGTGGGACGAAAT 470 60 902R CCTTTGGGCAACATGACATAG Intron 2 904F ATCCCACTCCTATGTCATGTTGC 469 61 904R GGGAAGGGAGAACAACACAGTG 3’ UTR, Exon 3 903F GGGCGAGCAGCAATGAGTAGAGG 449 68 903R CCGGAGCGGCGTGATGGTG a Amplicon sizes in chicken IGF2 gene. homologous cIGF2 sequences were used. An additional primer pair The PCR products of fragments that amplified successfully were (IGF2E1F and IGF2E1R) was designed based on cIGF2 genomic sequence purified using a commercial PCR product purification kit (Roche Di- (GenBank accession no., AH005039) using Primer 3 (Untergasser et al., agnostics, Mannheim, Germany) and sequenced in both forward and 2012) targeting the 5’UTR and exon 1 of gIGF2. The PCR reaction con- reverse directions with respective primers using BigDye Terminator tained 20 ng of template DNA, 400 μM of each dNTP, 0.4 μM of each version 3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, forward and reverse primers, 0.75 U TaKaRa LA-Taq DNA Polymerase, 1 USA) and electrophoresed on an ABI PRISM 3130xl sequencer (Applied x GC buffer I and 1.5 mM Magnesium Chloride (Takara Bio Inc., Shiga, Biosystems, Foster City, CA, USA). Japan) in a final volume of 15 μl. PCR was performed with initial denaturation at 94 ◦C for 10 min, followed by 35 cycles of denaturation 2.5. Sequence alignment and SNP discovery at 95 ◦C for 30 s, annealing at specific temperatures within 60–68 ◦C (Table 1) for 30 s, elongation at 74 ◦C for 60 s and final extension for 10 Consensus genomic sequences of DNA targets were obtained by min at 74 ◦C. aligning forward and reverse sequences for each individual animal Gel electrophoresis was performed to resolve 5 μl aliquots of the genotyped. In total genomic sequences of selected IGF2 targets of 84 amplicons on 1.5% agarose gel in TBE buffer (1 M Tris base, 1 M Boric local guinea fowls and three exotic guinea fowls of French origin were acid, 0.02 M EDTA) at 100 V for 20 min. Resolved amplicons were obtained. The FASTA formatted consensus sequences from all 87 birds stained with gel red and visualized under a UV transilluminator relative genotyped were aligned using MEGA 7 (Kumar et al., 2016) using the to ΦX174 DNA-Hae III digest as the DNA size marker (Promega Corpo- default parameters for SNP identification and genotyping. ration, Madison, USA). Genomic sequences representing the amplified targets of IGF2 in 3 K.M.J. Ahiagbe et al. A n im a l G e n e 27 (2023) 200139 guinea fowls were submitted to GenBank genomic database (Table 2). 3. Results Presence of novel SNPs and their locations were determined by per- forming Nucleotide BLAST with BLASTN version 2.8.0+ of NCBI (Na- 3.1. Amplified guinea fowl IGF2 genomic sequences tional Center for Biotechnology Information, United States National Library of Medicine, National Institutes of Health, Maryland, USA; Out of the four primer pairs originally designed from cIGF2 genomic Zhang et al., 2000) with respect to reference guinea fowl sequence sequences, the primer pairs 902 F, 902 R and 903 F, 903 R yielded (GenBank accession no. NC_034414.1; Vignal et al., 2017). specific PCR products with guinea fowl DNA (Fig. 2). The remaining two primer pairs did not yield specific PCR products with guinea fowl genomic DNA amidst several optimization trials. The guinea fowl DNA 2.6. Determination of frequency of SNPs and genotypes sequences amplified by the primers 902 F and 902 R yielded a 486 bp long genomic sequence that was mapped to exon 3 of the guinea fowl Frequency of SNP variants and genotypes arising from poly- IGF2 and part of the adjacent intron (Table 2) according to computa- morphisms among the three populations from UER, FNR and UWR were tional annotation of gIGF2 sequence (GenBank gene ID, 110400777; calculated using the formulae 2 and 3 implemented in GenAlEx software GenBank accession no., NC_034414.1). Guinea fowl genomic sequence ver. 6.5 (Peakall and Smouse, 2012). amplified by the primers 903 F and 903 R produced a 450 bp sequence 2 No of homozygotes No of heterozygotes that was mapped to the protein coding segment of the exon 4 of gIGF2 ( . ) + . SNP Frequency = (2) 2 Total No of birds genotyped (Table 2). Relative locations of genomic sequences generated within ( . ) gIGF2 established by Nucleotide BLAST are further represented in Fig. 3. No.of individuals with the given genotype AA (or AB,BB) Genotypic frequency = (3) Total No.of birds genotyped 2.7. Estimation of association between body weight traits, growth rates and individual SNPs The effects of genotypes at each of the SNP identified in gIGF2 on the dependent variables including body weights at selected weeks (1, 2, 3, 4, 6, 7, 9, 11), weekly growth rates measured at weekly intervals of 1 and 2, 2 and 3, 3 and 4, 6 and 7, 9 and 11 and the overall growth rate were determined using the linear model Yijkl = μ + Pi + Sj + GTSNPk + eijkl where, Yijkl was the dependent variable per each model, μ was the overall mean for a given dependent variable, Pi the effect of ith sample Population, Sj, the effect of jth Sex, GTSNPk, the effect of the kth genotype at a given SNP and eijkl, the random error. The linear models were implemented using the statistical package R version 0.99.489 (R core team, 2016). Fig. 2. Appearance of successfully amplified genomic targets of guinea fowl IGF2 gene upon gel electrophoresis. Amplified 902 FR in lanes 2 to 5 (486 bp); amplified 903FR in lanes 6 to 9 (450 bp); ΦX174 DNA-Hae III digest as the DNA size marker (lane 1). Table 2 Locations of guinea fowl IGF2 genomic targets generated and comparison with the homologous chicken sequences. Primer Location on GF Location in Observed Target GenBank HRs Location of HRs on % Homology name chromosome 6a the GF IGF2 amplicon regions in Accession numbers in chicken chicken between target GF geneb size GF IGF2 c of submitted chromosome 5d and chicken genomic sequences sequences 902F 13,955,499 bp 12,566 bp to 486 bp Exon 3 and a LC491601 Exon 3 and a 13,781,432 bp to 93% to 13,955,984 bp 13,051 bp portion of intron LC491602 portion of intron 13,781,840 bp 902R between exons 3 between exons 3 and 4 and 4 903F 13,956,345 bp 13,412 bp to 450 bp Exon 4 or third LC491599 Exon 4 13,782,253 bp to 96% to 13,956,794 bp 13,861 bp protein coding LC491600 13,782,702 bp 903R Exon GF, Guinea Fowl; HRs, Homologous Regions; a Location on guinea fowl chromosome 6 with reference to GenBank accession no., NC_034414.1; bLocation within the guinea fowl IGF2 gene with reference to sequence of GenBank gene ID, 110400777; c Identification of functional regions of amplicons was according to annotation provided by NCBI for GenBank gene ID, 110400777; d Homology of amplicons with chicken chromosome 5 with reference to GenBank accession no. NC_052536 (Region: 13375612.0.13394087). 4 K.M.J. Ahiagbe et al. A n im a l G e n e 27 (2023) 200139 Fig. 3. Schematic representation of locations of genomic sequences generated during the current study within gIGF2 (gIGF2 gene map was proposed based on annotation provided by NCBI for GenBank gene ID, 110400777; not drawn to scale of bp length). Table 3 Summary of Single Nucleotide Polymorphic markers identified within IGF2 gene in guinea fowl. SNP location SNP location Nucleotide in Nucleotide/ Type of SNP variation Amino Acid Genomic region Description of on in the GF reference Nucleotide change SNP chromosome IGF2 geneb sequence sequence in 6a (bp) alternative allele (bp) 13,955,730 Followed by T TG Indel none Intron between third and 13,955,730 T > TG 12,797 (Insertion with respect to the fourth exon reference) 13,956,496 13,563 G A substitution none fourth exon 13,956,496 G > A GF, Guinea Fowl; SNP, Single Nucleotide Polymorphisms; a SNP location within chromosome six with reference to GF reference sequence (GenBank accession no. NC_034414); b SNP location within GF IGF2 gene with reference to GenBank gene ID 110400777. 3.2. Single Nucleotide Polymorphisms in guinea fowl IGF2 present in the majority of birds sampled in all the three populations. The distribution of allelic variants of the indel was significantly different Two novel Single Nucleotide Polymorphic sites including a substi- among the three populations (χ2 = 7.28, p ˂ 0.05). The 13,956,496 G > tution and an indel were identified within gIGF2 of guinea fowls sampled A substitution was only present in the minority (11.9%) of the total from the three populations of northern Ghana. The location of each SNP population while, the majority reported the allelic variant (G) in the with respect to the reference genomic sequence of chromosome six and reference genome. Distribution of 13,956,496 G > A substitution was within gIGF2 and other salient features of each SNP are summarised in not significantly different among guinea fowls in the three populations Table 3 according to the convention used in Variant Call Format of northern Ghana (χ2 = 2.16, p > 0.05). accepted by NCBI (Danecek et al., 2011). The indel was observed next to a Thymine (T) residue which is located at 13,955,730 bp on chromo- 3.3.2. Genotypic frequencies some 6. In the reference sequence and also in the wild type allele The 13,956,496 G > A substitution gave rise to three genotypes GG, sequence of sample population (GenBank accession no. LC491601) AA, and GA (Table 5) within the populations. Majority of birds carried following the T residue, there is a polyG segment consisting of eight GG genotype in all the three populations with no significant difference in Guanine (G) residues while the alternative allele that was found only in their distribution across populations (χ2 = 3.64, p > 0.05). The homo- local populations (GenBank accession no. LC491602) contains a nine- zygote genotype for the alternative allele (AA) was only seen in one residue long polyG segment giving rise to an insertion with respect to individual from the Upper West Region. the reference sequence (Fig. 4). The substitution of G (GenBank acces- The indel was distributed in the three genotypes GG (homozygote for sion no. LC491599) by Adenine (A, GenBank accession no. LC491600) at the alternative allele or insertion reported here), G0 (heterozygotes 13,956,496 bp location of the guinea fowl chromosome six is a biallelic carrying the allele in the reference genome, 0 and the insertion, G), and transition. 00 (homozygotes for allele present only in the reference sequence). The distribution was not statistically different (χ2 = 8.87, p > 0.05) but had a higher likelihood ratio of 9.296 (p ≤ 0.05) for varied distribution. The 3.3. Distribution of single nucleotide polymorphisms genotype present in the reference sequence and also in the exotic guinea fowls (n = 3) of French origin was only present in the minority of the 3.3.1. Frequency of SNP variants birds in all the three populations of northern Ghana. Frequencies of allelic variants identified within gIGF2 among the three guinea fowl populations from UER, FNR and UWR are given in Table 4. The insertion of a G at the 13,955,730 T > TG indel site was 5 K.M.J. Ahiagbe et al. A n im a l G e n e 27 (2023) 200139 Table 5 Genotypic frequencies for SNPs in IGF2 in local guinea fowls from the three populations of northern Ghana. SNP Genotype UER FNR UWR (n = 17) (n = 22) (n = 45) 13,955,730 T > TG GG 0.235 0.636 0.600 G0 0.529 0.182 0.289 00 0.235 0.182 0.111 13,956,496 G > A GG 0.647 0.864 0.778 GA 0.353 0.136 0.200 AA 0.000 0.000 0.022 GG, Homozygotes for the novel insertion observed only among the local pop- ulations; 00, Homozygotes for the wildtype allele found in the reference sequence and the domesticated French birds included in the study; G0, Het- erozygotes with the novel insertion and the wild type allele. Table 6 Least Squared Means for Body Weights and Growth Rates for various genotypes at novel polymorphic sites in gIGF2. Trait 13,955,730 T > TG 13,956,496 G > A GG G0 00 GG GA AA BW1NS 38.60 ± 38.80 ± 37.39 ± 38.62 ± 37.92 ± 37.09 ± 0.99 1.25 1.65 0.84 1.42 6.02 BW2NS 47.74 ± 46.37 ± 46.98 ± 47.54 ± 46.12 ± 46.02 ± 1.44 1.70 2.37 1.20 2.04 8.64 BW3NS 66.05 ± 63.22 ± 63.97 ± 64.38 ± 66.25 ± 57.94 ± 2.70 3.37 4.44 2.26 3.84 16.24 BW4NS 85.12 ± 80.56 ± 80.81 ± 82.27 ± 84.90 ± 79.41 ± 4.23 5.36 6.93 3.59 6.00 25.39 BW6NS 135.92 ± 125.01 ± 129.12 ± 126.86 ± 143.32 ± 126.32 ± 8.79 11.29 13.87 7.47 11.91 50.41 BW7NS 181.60 ± 178.30 ± 172.41 ± 172.45 ± 195.28 ± 157.01 ± 11.56 15.15 18.45 10.00 15.53 64.06 BW9NS 262.91 ± 264.93 ± 246.19 ± 251.72 ± 281.07 ± 244.35 ± Fig. 4. Appearance of chromatograms in genotypes present in the reference 17.36 21.62 25.52 14.41 22.56 92.72 NS allele and alternative allele (with insertion). Insertion is immediately followed BW11 366.96 ± 367.08 ± 350.20 ± 349.04 ± 400.48 ± 330.41 ± 22.56 27.86 32.89 18.51 28.79 118.33 by the T (Thymine) at 13,955,730 bp adding an additional Guanine residue to GR1NS 9.14 ± 7.57 ± 9.59 ± 8.91 ± 8.19 ± 8.93 ± the eight-residue long poly Guanine in the reference allele according to NCBI 1.01 1.26 1.66 0.85 1.44 6.11 Nucleotide BLAST with guinea fowl reference sequence of chromosome 6 GR2NS 18.31 ± 16.85 ± 16.98 ± 16.85 ± 20.13 ± 11.92 ± (GenBank accession no., NC_034414.1). 1.74 2.18 2.86 1.44 2.45 10.38 GR3NS 18.98 ± 17.09 ± 16.84 ± 17.72 ± 18.66 ± 21.31 ± 1.98 2.52 3.26 1.69 2.82 11.93 GR4NS Table 4 25.03 ± 22.45 ± 24.11 ± 22.16 ± 29.17 ± 23.38 ± Allelic frequencies for novel SNPs identified in IGF2 in the three guinea fowl 2.64 3.40 4.17 2.22 3.54 14.99 GR5NS 43.77 ± 50.44 ± 39.99 ± 43.42 ± 48.92 ± 31.97 ± populations of northern Ghana. 3.70 4.84 5.90 3.26 5.06 20.86 Reference Description SNP variant UER FNR UWR GR6NS 48.03 ± 47.68 ± 37.71 ± 45.11 ± 46.53 ± 45.51 ± sequence of SNP (n = (n = (n = 3.45 4.33 5.11 3.03 4.59 18.41 17) 22) 45) GR7NS 51.91 ± 51.08 ± 52.00 ± 48.67 ± 59.70 ± 43.02 ± 3.64 4.50 5.31 2.94 4.57 18.79 GenBank 13,955,730 Null (0; allele 0.324 0.273 0.322 GRONS 31.44 ± 29.39 ± 30.70 ± 28.96 ± 35.83 ± 29.15 ± accession no., T > TG reported in the 2.09 2.61 3.44 1.70 2.90 12.26 NC_034414.1 reference sequence1) BWn, Body weight at week n, n = 1,2,3,4,6,7,9,11; GR, Growth Rate; GR1, GR Insertion 0.676 0.727 0.678 between weeks 1 and 2; GR2, GR between weeks 2 and 3; GR3, GR between (G; alternative weeks 3 and 4; GR4, GR between weeks 4 and 6; GR5, GR between weeks 6 and allele with 7; GR6, GR between weeks 7 and 9, GR7, GR between weeks 9 and 11; GRO, insertion) overall GR between weeks 1 and 11; NS Comparisons among the means of ge- GenBank 13,956,496 A 0.176 0.136 0.089 accession no., G A G 0.824 0.864 0.911 notypes per SNP were not statistically significant at 95% confidence level. > NC_034414.1 1 Allele/SNP variant in the reference sequence, wild type allele, also observed 4. Discussion among the domesticated French breed included in the study (n = 3). The primers used in this study were those originally designed by Nie 3.4. Effect of SNPs on body weight and growth rate traits et al. (2005) to amplify IGF2 genomic targets in chicken. The genomic regions in guinea fowls corresponding to exon 3 and exon 4 were suc- None of the novel SNPs identified with gIGF2 had significant effects cessfully amplified by 902 F, 902R and 903F, 903R, respectively. Perfect on weekly body weights or weekly growth rates during the study period alignment of the nucleotide sequences of these amplicons with the an- (Table 6). notated guinea fowl reference sequence of chromosome 6 confirms the identity of the generated genomic sequences and the specificity of primers for chicken and guinea fowl IGF2. Therefore, primers 902F, 6 K.M.J. Ahiagbe et al. A n im a l G e n e 27 (2023) 200139 902R and 903F, 903R can be utilized for studying and genotyping exon 3 using SWISS-MODEL workspace version 8.05 (Swiss Institute of Bioin- and exon 4 in guinea fowls. However, the other primers were not suc- formatics, Lausanne, Switzerland) (Waterhouse et al., 2018). We used cessful in amplifying homologous regions within gIGF2. This may be due amino acid sequences predicted for IGF2 isoform X2 (GenBank protein to complete absence of complementary primer binding sites within the ID., XP_021256640.1), as well as amino acid sequences predicted from homologous genomic sequences or dissimilarities of homologous se- genomic sequences generated in our current study and compared with quences. This suggests that these regions exhibit greater sequence human IGF2 as a template (Fig. 5). variation between the two species compared to sequences spanning exon Of the two SNPs found within gIGF2, the 13,956,496 G > A substi- 3 and exon 4. tution could be specifically located on the Extension peptide of the The genomic sequences amplified from primer pairs 902F, 902R predicted pro IGF2 protein. The function of E peptides in IGF2 is not were mapped to a region spanning exon 3 and beyond including part of clear. However, there is evidence that they play important roles in the adjacent intron in IGF2 in both guinea fowl (Fig. 3) and chicken tethering the propeptides to extracellular matrix, thereby increasing inferring a higher degree of homology of these sequences between the autocrine functions in growth factors in mouse models (Hede et al., two species. However, the guinea fowl amplicon was 487 bp long 2012). The substitution at 13,956,496 bp was a transition. BLASTX re- compared to the homologous chicken sequence which was 410 bp long. sults revealed that this did not result in an amino acid change and hence This region covers amino acids coding exon 3 present in both Insulin-like is a synonymous mutation. Growth Factor 2 isoform X1 (GenBank accession no., XP_015142011.1) Thus, this substitution is not likely to alter the primary structure, and Insulin-like Growth Factor 2 precursor (GenBank accession no., tertiary structure or the biological function. Consolidated report on SNPs NP_001025513.1). A BLASTX performed with BLASTX 2.2.29+ interface in chicken revealed that the most substitutions within exonic regions of UniProt Protein database (The UniProt Consortium, 2017) revealed were transitions (Schmid et al., 2005). Therefore, notwithstanding the that this genomic sequence is homologous to chicken sequences coding ambiguity of function of IGF2 in avian growth regulation, it is unlikely for amino acid residues 53 to 107 including part of mature protein and that these can influence the bioavailability and autocrine functions of 15 residues of E peptide. Although guinea fowl IGF2 protein sequence the protein. Indeed, we found no significant association between the has not been isolated or sequenced so far, translation of mRNA predicts a genotypes arising from this mutation with juvenile body weights and similar amino acid sequence. growth rates in guinea fowls from randomly mating outbred populations Genomic sequence amplified with primers 903F and 903R represents in northern Ghana. the amino acid coding fragment of the exon 4 in both chicken (UniProt An extensive review of literature revealed no other previously re- accession number, P33717) and guinea fowl. Based on the BLASTX and ported SNPs within IGF2 gene in guinea fowl and so the SNPs reported homology to chicken sequences, it can be predicted that this region here are novel. However, there were several other SNPs reported within codes for the Extension peptide (E peptide). Extension peptides are IGF2 genes in chicken. Wang et al. (2005) reported a C > G transition present at the C-terminus of prepro proteins and get cleaved before within the second exon within the codon, coding for the 71st amino acid release. in a cross between a broiler line and Tauhe Silky chicken. Yan et al. To the best of our knowledge, there are no reports of isolated IGF2 (2017) also reported a synonymous mutation in Langshan chicken of protein in guinea fowls or its three-dimensional structure. Therefore, we China. The two SNPs reported by Amills et al. (2003) including C > T predicted a three-dimensional structure for guinea fowl IGF2 protein transition within exon 3 and G > A substitution within intron 2 were not Fig. 5. Predicted three-dimensional structure of guinea fowl IGF2 protein: (A), The three-dimensional structure predicted using SWISS-MODEL workspace version 8.05 based on comparisons with human IGF2 as a template (SWISS-MODEL Template Library ID, 2 l29.1.B) (B), Alignment between proposed model guinea fowl IGF2 protein and human IGF2 (SWISS-MODEL Template Library ID, 2 l29.1.B). 7 K.M.J. Ahiagbe et al. A n im a l G e n e 27 (2023) 200139 homologous to the two SNPs identified during the current study. associations with growth and feeding traits. Poult. Sci. J. 82, 1485–1493. https:// Majority of local guinea fowls sampled had the insertion at doi.org/10.1093/ps/82.10.1485. Amoah, K.O., Nyameasem, J.K., Asiedu, P., Adu-aboagye, G.A., Wallace, P., Ahiagbe, K. 13,95,5730 T > TG polymorphic site following 13,955,730 bp (GenBank M.J., Rhule, S.W.A., 2018. Protein and energy requirements for indigenous guinea accession no., NC_034414.1), unlike the allelic variant present in the keets (Numida meleagris) in southern Ghana. Ghana J. Agr. Sci. 52, 105–111. reference sequence and the exotic birds of French origin. The insertion Danecek, P., Auton, A., Abecasis, G., Albers, C.A., Banks, E., DePristo, M.A., et al., 2011. The variant call format and VCF tools. J. Bioinform. 27 (15), 2156–2158. https:// adds a G residue to a short GC rich segment of the intron (Fig. 4). doi.org/10.1093/bioinformatics/btr330. Although introns were initially described as ‘Junk DNA’, recent research Darling, D.C., Brickell, P.M., 1996. Nucleotide sequence and genomic structure of the has unveiled some functional elements within them and their influence chicken Insulin-like Growth Factor-II (IGF-II) coding region. Gen. Comp. Endocrinol. on gene expression including regulation of transcription and splicing 102, 283–287. https://doi.org/10.1006/gcen.1996.0071. Hede, M.S., Salimova, E., Piszczek, A., Perlas, E., Winn, N., Nastasi, T., Rosenthal, N., control (Zhu et al., 2016). Enrichment of short GC rich regions have been 2012. E-peptides control bioavailability of IGF-1. PLoS One 7 (12), e51152. https:// implicated in controlling function of the next exon and transcriptional doi.org/10.1371/journal.pone.0051152. splicing among others (Khuu et al., 2007). However, the genotypes Hou, G., Wang, D., Guan, S., Zeng, H., Huang, X., Ma, Y., 2010. Associated analysis of single nucleotide polymorphisms of IGF2 gene’s exon 8 with growth traits in arising from the 13,955,730 T > TG indel had no significant effect on the Wuzhishan pig. Mol. Biol. Rep. 37, 497–500. https://doi.org/10.1007/s11033-009- body weight traits and growth rates during the early growth of guinea 9681-5. fowls. Therefore, insertion of G within this GC rich short sequence is not Huang, Y.Z., Zhan, Z.Y., Li, X.Y., Wu, S.R., Sun, Y.J., Xue, J., Lan, X.Y., Lei, C.Z., Zhang, C.L., Jia, Y.T., Cheng, H., 2014. SNP and haplotype analysis reveal IGF2 likely to have any influence in RNA splicing as observed by Khuu et al. variants associated with growth traits in Chinese Qinchuan cattle. Mol. Biol. Rep. 41, (2007) within this context. 591–598. https://doi.org/10.1007/s11033-013-2896-5. None of the two SNPs identified within the gIGF2 including Khuu, P., Sandor, M., DeYoung, J., Ho, P.S., 2007. Phylogenomic analysis of the emergence of GC-rich transcription elements. Proc. Natl. Acad. Sci. U. S. A. 104 (42), 13,955,730 T > TG and 13,956,496 G > A located at 13,955,730 bp and 16528–16533. https://doi.org/10.1073/pnas.0707203104. 13,956,496 bp on chromosome 6 had any statistical effects on body Kim, J.W., 2010. The endocrine regulation of chicken growth. Asian-Australas. J. Anim. weight traits and growth rates during early growth in local guinea fowls Sci. 23 (12), 1668–1676. https://doi.org/10.5713/ajas.2010.10329. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular Evolutionary Genetics and, hence, are not likely to be useful as candidate SNPs for early growth Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33 (7), 1870–1874. https:// in guinea fowls. Nevertheless, the influence of these SNPs on other doi.org/10.1093/molbev/msw054. phenotypes could be a subject for future research. Influence of these Lawrence, T.L.J., Fowler, V.R., 2012. Growth of Farm Animals, 2nd ed. CABI Publishing, genotypes should also be explored with a larger sample size of outbred CAB International Wallingford, Oxfordshire, England. Nie, Q., Lei, M., Ouyang, J., Zeng, H., Yang, G., Zhang, X., 2005. Identification and populations. So far, there have been no dedicated breeding programmes characterization of single nucleotide polymorphisms in 12 chicken growth- with phenotypic recording schemes to improve local guinea fowls for correlated genes by denaturing high performance liquid chromatography. Genet. Sel. early growth. Therefore, we could not examine the effects of these novel Evol. 37, 339–360. https://doi.org/10.1186/1297-9686-37-4-339. Peakall, R., Smouse, P.E., 2012. GenALEx 6.5: Genetic Analysis in Excel. Population SNPs with pedigreed populations. We recommend initiation of such genetic software for teaching and research - an update. J. Bioinform. 28 (19), programmes to enable exploration of effects of these SNPs in pedigreed 2537–2539. https://doi.org/10.1093/bioinformatics/bts460. populations. R Core Team, 2016. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. URL. https://www.R-project. org/. Declaration of Competing Interest Schmid, M., Nanda, I., Hoehn, H., Schartl, M., Haaf, T., Buerstedde, J.M., et al., 2005. Second report on chicken genes and chromosomes. Cytogenet. Genome Res. 109 (4), 415–479. https://doi.org/10.1159/000084205. The authors declare that they have no conflict of interest. Tang, S., Sun, D., Ou, J., Zhang, Y., Xu, G., Zhang, Y., 2010. Evaluation of the IGFs (IGF1 and IGF2) genes as candidates for growth, body measurement, carcass and Data availability reproduction traits in Beijing you and Silkie chickens. Anim. Biotechnol. 21 (2), 104–113. https://doi.org/10.1080/10495390903328090. The UniProt Consortium, 2017. UniProt: the universal protein knowledgebase. Nucleic Data will be made available on request. Acids Res. 45 (D1), D158–D169. https://doi.org/10.1093/nar/gkw1099. Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M., Rozen, S. Acknowledgements G., 2012. Primer3-new capabilities and interfaces. Nucleic Acids Res. 40 (15), 1–12. https://doi.org/10.1093/nar/gks596. Vignal, A., Thebault, N., Boitard, S., Yapi-gnaore, V., Youssao, I., Tixier-boichard, M., Authors acknowledge the World Bank for providing funding support Warren, W., Rognon, X., 2017. Guinea fowl whole genome assembly and application for the field and on station work of this study through the West Africa for genetic diversity in African and European populations. In: Proceeding of the Xth European Symposium on Poultry Genetics, Saint Malo, France, pp. 84–88. Agricultural Productivity Programme, Phase 11(A). We are also grateful Wang, G., Yan, B., Deng, X., Li, C., Hu, X., Li, N., 2005. Insulin-like growth factor 2 as a to the Wildlife Research Center, Kyoto University, for supporting Mrs. K. candidate gene influencing growth and carcass traits and its bialleleic expression in M. J. Ahiagbe to conduct laboratory analysis of this study. This work was chicken. Sci. China Ser. C.-Life Sci. 48, 187–194. https://doi.org/10.1007/ BF02879672. partially financially supported by KAKENHI Grant No. 16H05801 to Waterhouse, A., Bertoni, M., Bienert, S., Studer, G., Tauriello, G., Gumienny, R., Heer, F. Professor Miho Inoue-Murayama. T., de Beer, T.A.P., Rempfer, C., Bordoli, L., Lepore, R., Schwede, T., 2018. SWISS- MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res. 46, 296–303. https://doi.org/10.1093/nar/gky427. References Xu, Z., Nie, Q., Zhang, X., 2013. Overview of genomic insights into chicken growth traits based on genome-wide association study and microRNA regulation. Curr. Genomics Ahiagbe, K.M.J., Amuzu-Aweh, E.N., Bonney, P., Nyameasem, J.K., Avornyo, F.K., 14 (2), 137–146. https://doi.org/10.2174/1389202911314020006. Adenyo, C., Amoah, K.O., Naazie, A., Kayang, B.B., 2021. Comparison of early Yan, L., Fang, X., Liu, Y., Elzo, M.A., Zang, C., Chen, H., 2017. Exploring the genetic growth and survivability in indigenous guinea fowls from Northern Ghana. Trop. variants of insulin-like growth factor II gene and their associations with two Anim. Health Prod. 53 (89) https://doi.org/10.1007/s11250-020-02510-4. production traits in Langshan chicken. J. Appl. Anim. Res. 45 (1), 60–63. https:// Ahiagbe, K.M.J., Karbo, N., Avornyo, F., Nyameasem, J.K., Adu-Aboagye, G., Amoah, K. doi.org/10.1080/09712119.2015.1124328. O., Affedzie-Obresi, S., Beckley, C.S.K., Duncan, J.L., 2016. Improving Guinea Fowl Zhang, Z., Schwartz, S., Wagner, L., Miller, W., 2000. A greedy algorithm for aligning Keet Survivability in Ghana, a Manual for Management of Keet Mortalities Using an DNA sequences. J. Comput. Biol. 7 (1), 203–214. https://doi.org/10.1089/ Integrated Approach. CSIR-Animal Research Institute, Accra, Ghana, pp. 1–28. ISBN, 10665270050081478. 978–9988–2-41248-5. Zhu, S., Li, W., Liu, J., et al., 2016. Genome-scale deletion screening of human long non- Ahiagbe, K.M.J., Kayang, B.B., Naazie, A., Avornyo, F.K., Botchway, P.K., Ali, S.Z., 2017. coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat. Biotechnol. 34 Non-invasive sex determination of guinea fowl keets (Numida meleagris) by (12), 1279–1286. https://doi.org/10.1038/nbt.3715. Polymerase Chain Reaction. Ghana J. Sci. 57, 3–11. https://doi.org/10.4314/gjas. Zwierzchowski, L., Siadkowska, E., Oprządek, J., Flisikowski, K., Dymnicki, E., 2010. An v52i1. association of C/T polymorphism in exon 2 of the bovine insulin-like growth factor 2 Amills, M., Jiménez, N., Villalba, D., Tor, M., Molina, E., Cubiló, D., Marcos, C., gene with meat production traits in polish Holstein-Friesian cattle. Czech J. Ani. Sci. Francesch, A., Sànches, A., Estany, J., 2003. Identification of three single nucleotide 55 (6), 227–233. https://doi.org/10.17221/94/2009-CJAS. polymorphisms in the chicken insulin-like growth factor 1 and 2 genes and their 8