<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>1756-3305-7-157</ui>
	<ji>1756-3305</ji>
	<fm>
		<dochead>Research</dochead>
		<bibl>
			<title>
				<p>Implications of low-density microfilariae carriers in <it>Anopheles</it> transmission areas: molecular forms of <it>Anopheles gambiae</it> and <it>Anopheles funestus</it> populations in perspective</p>
			</title>
			<aug>
				<au id="A1"><snm>Kwansa-Bentum</snm><fnm>Bethel</fnm><insr iid="I1"/><insr iid="I2"/><email>bethelnyame@yahoo.com</email></au>
				<au id="A2"><snm>Aboagye-Antwi</snm><fnm>Fred</fnm><insr iid="I1"/><insr iid="I2"/><email>faboagye-antwi@ug.edu.gh</email></au>
				<au id="A3"><snm>Otchere</snm><fnm>Joseph</fnm><insr iid="I2"/><email>jotchere@noguchi.ug.edu.gh</email></au>
				<au id="A4"><snm>Wilson</snm><mnm>David</mnm><fnm>Michael</fnm><insr iid="I2"/><email>mwilson@noguchi.ug.edu.gh</email></au>
				<au ca="yes" id="A5"><snm>Boakye</snm><mnm>Adjei</mnm><fnm>Daniel</fnm><insr iid="I2"/><email>dboakye@noguchi.ug.edu.gh</email></au>
			</aug>
			<insg>
				<ins id="I1"><p>Department of Animal Biology and Conservation Science, University of Ghana, P.O. Box LG 67 Legon, Accra, Ghana</p></ins>
				<ins id="I2"><p>Parasitology Department, Noguchi Memorial Institute for Medical Research, P.O. Box LG 581 Legon, Accra, Ghana</p></ins>
			</insg>
			<source>Parasites &amp; Vectors</source>
			<issn>1756-3305</issn>
			<pubdate>2014</pubdate>
			<volume>7</volume>
			<issue>1</issue>
			<fpage>157</fpage>
			<url>http://www.parasitesandvectors.com/content/7/1/157</url>
			<xrefbib><pubidlist><pubid idtype="pmpid">24690378</pubid><pubid idtype="doi">10.1186/1756-3305-7-157</pubid></pubidlist></xrefbib>
		</bibl>
		<history><rec><date><day>5</day><month>12</month><year>2013</year></date></rec><acc><date><day>27</day><month>3</month><year>2014</year></date></acc><pub><date><day>1</day><month>4</month><year>2014</year></date></pub></history>
		<cpyrt><year>2014</year><collab>Kwansa-Bentum et al.; licensee BioMed Central Ltd.</collab><note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (<url>http://creativecommons.org/publicdomain/zero/1.0/</url>) applies to the data made available in this article, unless otherwise stated.</note></cpyrt>
		<kwdg>
			<kwd>Mass drug administration</kwd>
			<kwd>Low-density microfilariae carriers</kwd>
			<kwd>
				<it>Wuchereria bancrofti</it>
			</kwd>
			<kwd>
				<it>Anopheles gambiae</it>
			</kwd>
			<kwd>
				<it>Anopheles funestus</it>
			</kwd>
		</kwdg>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st>
						<p>Background</p>
					</st><p>Previous studies have shown a general reduction in annual transmission potential (ATP) of <it>Anopheles</it> species after mass drug administration (MDA) in lymphatic filariasis endemic communities. Whereas results obtained from a monitoring programme after three years of MDA revealed a decrease in ATP of <it>Anopheles funestus</it> this was not the same for <it>An. gambiae</it> s.s. in Ghana. In this study, the ability of these vectors in transmitting <it>Wuchereria bancrofti</it> in nine lymphatic filariasis endemic communities in Gomoa District of Ghana after four rounds of MDA with ivermectin and albendazole was investigated.</p>
				</sec>
				<sec>
					<st>
						<p>Methods</p>
					</st><p>After mass screening of inhabitants in these communities, twelve consenting volunteers with different intensities of microfilariae (mf) slept under partly opened mosquito nets as sources of mf blood meal. Hourly collection of mosquitoes and finger-pricked blood were taken from 21.00 to 06.00&#160;hours the following day. For each hour, half of the mosquitoes collected were immediately killed and dissected for mf. The remaining half were maintained up to 13&#160;days for parasite maturation. Parasitaemia and infection rates in the mosquitoes were determined by microscopy. The mosquitoes were identified by microscopy and molecular techniques.</p>
				</sec>
				<sec>
					<st>
						<p>Results</p>
					</st><p>A total of 1,083 participants were screened and the overall parasite prevalence was 1.6% with mf intensities ranging from 0 to 59 per 100&#160;&#956;l and geometric mean intensity of 1.1 mf per ml of blood. Of the 564 mosquitoes collected, 350 (62.1%) were <it>Anopheles</it> spp., from which 310 (88.6%) were <it>An. funestus</it> and 32 (9.1%) <it>An. gambiae</it>. Six anopheline mosquitoes (1.7%) were found infected with L<sub>1</sub>, but no larva was observed in any of the mosquitoes maintained up to 13&#160;days. Molecular studies showed all <it>An. gambiae</it> s.l. to be <it>An. gambiae</it> s.s., of which 21 (70%) were of the M molecular form.</p>
				</sec>
				<sec>
					<st>
						<p>Conclusion</p>
					</st><p>At low-level parasitaemia after 4 rounds of MDA, there was no recovery of infective stage larvae of <it>W. bancrofti</it> in <it>An. funestus</it> s.l. as well as M and S forms of <it>An. gambiae</it>.</p>
				</sec>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Background</p>
			</st><p>
				<it>Wuchereria bancrofti</it> is one of the three filarial worms responsible for about 90% of all lymphatic filariasis (LF) cases in the world <abbrgrp>
					<abbr bid="B1">1</abbr>
				</abbrgrp>. These parasites are transmitted through the bite of infective mosquitoes of various genera. A competent vector is one that is capable of ingesting microfilariae (mf) from an infected human, supporting their development to the infective stage larvae (L<sub>3</sub>) and subsequently transmitting them to other uninfected persons. Depending on the vector species, its region of origin and the parasite density ingested, this ability to sustain the maturation and transmission of LF may be enhanced or restricted <abbrgrp>
					<abbr bid="B2">2</abbr>
					<abbr bid="B3">3</abbr>
				</abbrgrp>. Low density mf is defined as the density of circulating mf in a specified blood compartment that cannot be detected in a significant number of instances when commonly used blood sampling techniques are applied in epidemiological studies; thus 4 mf per 20&#160;&#956;l (200 mf per ml) <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. Zhang <it>et al.</it>
				<abbrgrp>
					<abbr bid="B5">5</abbr>
				</abbrgrp> in their study reported that between 1.55 and 2.23% prevalence, there was a threshold provided no individual had an mf density of more than 12 mf per 60&#160;&#956;l of blood.</p><p>The Global Programme to Eliminate Lymphatic Filariasis (GPELF) was launched in 2000, with the main goal of halting transmission and reducing disability through annual mass drug administration (MDA) to all persons at risk of infection, particularly if the vectors are <it>Anopheles</it> species <abbrgrp>
					<abbr bid="B6">6</abbr>
				</abbrgrp>. The strategy relies on the assumption that if the mf reservoir in the human host is reduced below a certain threshold, transmission of <it>W. bancrofti</it> by anopheline vectors could be interrupted <abbrgrp>
					<abbr bid="B7">7</abbr>
				</abbrgrp>. This is due to the observation that even though <it>Anopheles</it> mosquitoes yield more infective stage larvae than <it>Culex</it> species, the latter is more efficient at ingesting and developing low-density mf (limitation) than the former <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. Thus <it>Anopheles</it> mosquitoes are presumed to be efficient vectors of LF when the parasite density in the human population is high, a phenomenon known as &#8220;facilitation&#8221; <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. This observation has been the source for the heightened interest in the advocacy for the possible elimination of anopheline-transmitted filariasis; however, a study has observed &#8220;facilitation&#8221; in <it>An. gambiae</it> s.s. and <it>An. arabiensis</it> but not in <it>An. melas</it> in Gambia or <it>An. merus</it> in Tanzania <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. Additional health benefits of MDA targeting LF is the reduction in soil transmitted helminths and scabies <abbrgrp>
					<abbr bid="B8">8</abbr>
				</abbrgrp>.</p><p>A study in the Bongo district of northern Ghana <abbrgrp>
					<abbr bid="B9">9</abbr>
				</abbrgrp> indicates a plausible &#8220;limitation&#8221; in <it>An. gambiae</it> s.l. and/or <it>An. funestus</it> in the transmission of the parasite contrary to other reports <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. Results from a study in the Gomoa district of southern Ghana also indicated that although transmission potential by <it>An. funestus</it> has decreased significantly after mass chemotherapy with ivermectin and albendazole, there appears to be no change in <it>An. gambiae</it> s.s. in the area (Boakye DA, unpublished data). This suggests that probably not all anophelines exhibit facilitation in their transmission of LF. This work was therefore conducted to determine the roles of these two <it>Anopheles</it> species in the transmission of low level <it>W. bancrofti</it> human mf, since this information is fundamental to the success of GPELF.</p>
		</sec>
		<sec>
			<st>
				<p>Methods</p>
			</st>
			<sec>
				<st>
					<p>Study sites</p>
				</st><p>Nine LF endemic communities in the Gomoa district of Ghana (between Latitude 5&#176; 24&#8217; - 35&#8217;N and Longitude 0&#176; 25&#8217; - 36&#8217;W) were selected based on available data on the disease epidemiology in the population and vector species distribution <abbrgrp>
						<abbr bid="B10">10</abbr>
						<abbr bid="B11">11</abbr>
						<abbr bid="B12">12</abbr>
					</abbrgrp>. These are Amanful, Ayesuano, Dago, Fawomanye, Hwida, Kyiren, Mampong, Obiri and Okyereko. The district lies in the coastal savannah zone of Ghana and is located 50&#160;km west of Accra, the capital city of Ghana. Average annual rainfall ranges between 760 and 1000&#160;mm, whilst mean annual temperature ranges between 26 and 30&#176;C. The main occupations of the inhabitants are farming and fishing for those living near the shores of the Atlantic Ocean.</p>
			</sec>
			<sec>
				<st>
					<p>Mass screening for microfilariae in the communities</p>
				</st><p>This study was conducted from April to June 2004, the fourth year of MDA with ivermectin and albendazole in these communities. The areas also form part of an on-going annual longitudinal community-based intervention study. Human participation and the mosquito collection were done by cluster sampling method. Mass screening of the study population for mf was done by collecting 100&#160;&#956;l finger-pricked blood from each individual into heparinised capillary tubes and immediately mixing with 900&#160;&#956;l 3% acetic acid. Quantification of parasitaemia used the Sedgwick-Rafter counting chamber method with the compound microscope set at &#215;100 magnification <abbrgrp>
						<abbr bid="B13">13</abbr>
					</abbrgrp>.</p>
			</sec>
			<sec>
				<st>
					<p>Mosquito collection, maintenance and dissection</p>
				</st><p>After consenting to participate, twelve adult volunteers with varying mf levels slept under partially opened mosquito nets hung over beds in their rooms. At the mid-point of each collection hour, finger-pricked blood was taken and mf density estimated using the same procedure described above. Mosquitoes trapped in the nets were collected each hour from 21.00&#160;hours to 06.00&#160;hours on the next day using an aspirator. About half the number of mosquitoes collected were killed immediately and dissected for ingested mf. The remaining mosquitoes were fed on 10% sugar solution and maintained for up to 13&#160;days in paper-cups at 26-28&#215;C, relative humidity 70-80% and 12-hour photoperiod in the insectary <abbrgrp>
						<abbr bid="B14">14</abbr>
					</abbrgrp>. Mosquitoes that died before day 13 were dissected for developing stages of <it>W. bancrofti</it>, whilst those that survived until the last day were dissected for the presence of infective stage L<sub>3</sub> larvae of the parasite.</p>
			</sec>
			<sec>
				<st>
					<p>PCR identification of <it>Anopheles</it> species</p>
				</st><p>Molecular identifications of <it>An. gambiae, An. funestus</it> and <it>W. bancrofti</it> were conducted using already established methods <abbrgrp>
						<abbr bid="B15">15</abbr>
						<abbr bid="B16">16</abbr>
						<abbr bid="B17">17</abbr>
					</abbrgrp>. For the vector species identification, genomic DNA was extracted from the carcasses of mosquitoes after homogenisation with sterile Konte&#8217;s plastic pestles in 100&#160;&#956;l bender buffer. The homogenate was then incubated at 65&#176;C for 30&#160;min, followed by the addition of 125&#160;&#956;l of phenol. The Centrifuge 5415 C (Eppendorf) was used in all spinning of samples, unless otherwise stated. The mixture was vortexed and spun at 14,000&#160;rpm for 10&#160;min. The supernatant was transferred into a fresh tube and 250&#160;&#956;l of pre-chilled absolute ethanol and 10&#160;&#956;l of 8&#160;M potassium acetate were added. This was incubated at -40&#176;C for an hour, spun at 10,000&#160;rpm for 10&#160;min and supernatant poured off. The pellet was then rinsed with 200&#160;&#956;l of 70% ethanol, spun at 10,000&#160;rpm for 5&#160;min, and supernatant poured off. The pellet was dried and re-dissolved in 50&#160;&#956;l TE + RNAse and then kept at 4&#176;C until ready for PCR (Table&#160;<tblr tid="T1">1</tblr>). Each PCR reaction mixture of 25&#160;&#956;l contained 1&#215; PCR buffer (Sigma, USA), 200&#160;&#956;M each of the four deoxyribonucleotide triphosphates, 10&#160;&#956;M each of the oligonucleotide primers (Table&#160;<tblr tid="T1">1</tblr>), and 0.125 units of <it>Taq</it> Polymerase enzyme (Sigma, USA). A microliter of the genomic DNA was used as template for the amplification reaction. <it>Anopheles gambiae</it> s.s. were further identified and differentiated into the M and S molecular forms by enzymatic restriction of the PCR product as described by Fanello <it>et al</it>. <abbrgrp>
						<abbr bid="B18">18</abbr>
					</abbrgrp>. This was done by amplification of 1.3&#160;kb rDNA followed by restriction fragment length polymorphism (RFLP) with restriction enzyme <it>Hha</it> I (Sigma-Aldrich, USA).</p>
				<table id="T1">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>
							<b>Oligonucleotide primer sequences and PCR reaction conditions for species identification</b>
						</p>
					</caption>
					<tgroup align="left" cols="4">
						<colspec align="left" colname="c1" colnum="1" colwidth="1*"/>
						<colspec align="center" colname="c2" colnum="2" colwidth="1*"/>
						<colspec align="center" colname="c3" colnum="3" colwidth="1*"/>
						<colspec align="left" colname="c4" colnum="4" colwidth="1*"/>
						<thead valign="top">
							<row rowsep="1">
								<entry colname="c1">
									<p>
										<b>Primer for species ID</b>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>
										<b>Sequence 5&#8217;</b> &#8658; <b>3&#8217;</b>
									</p>
								</entry>
								<entry align="center" colname="c3">
									<p>
										<b>PCR product size (bp)</b>
									</p>
								</entry>
								<entry colname="c4">
									<p>
										<b>PCR conditions</b>
									</p>
								</entry>
							</row>
						</thead>
						<tbody valign="top">
							<row>
								<entry colname="c1" nameend="c4" namest="c1">
									<p>
										<b>
											<it>Anopheles gambiae </it>
										</b><b>s.l. species</b>
									</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>Universal primer</p>
								</entry>
								<entry align="center" colname="c2">
									<p>GTGTGCCCCTTCCTCGATGT</p>
								</entry>
								<entry align="center" colname="c3">
									<p>468</p>
								</entry>
								<entry align="left" colname="c4" morerows="4" valign="top">
									<p>93&#176;C 3&#8217; followed by 35&#160;cycles (93&#176;C 30&#8221;; 50&#176;C 30&#8221;; 72&#176;C 1&#8217;); 93&#176;C 30&#8221;; 50&#176;C 30&#8221;; 72&#176;C 10&#8217;</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Anopheles gambiae s.s.</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>CTGGTTTGGTCGGCACGTTT</p>
								</entry>
								<entry align="center" colname="c3">
									<p>390</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Anopheles merus/melax</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>TGACCAACCCACTCCCTTGA</p>
								</entry>
								<entry align="center" colname="c3">
									<p>464</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Anopheles arabiensis</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>AAGTGTCCTTCTCCATCCTA</p>
								</entry>
								<entry align="center" colname="c3">
									<p>315</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Anopheles quadrianulatus</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>CAGACCAAGATGGTTAGTAT</p>
								</entry>
								<entry align="center" colname="c3">
									<p>153</p>
								</entry>
							</row>
							<row>
								<entry colname="c1" nameend="c4" namest="c1">
									<p>
										<b>
											<it>Anopheles funestus </it>
										</b><b>s.l. species</b>
									</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>Universal primer</p>
								</entry>
								<entry align="center" colname="c2">
									<p>TGTGAACTGCAGGACACAT</p>
								</entry>
								<entry align="center" colname="c3"/>
								<entry align="left" colname="c4" morerows="5" valign="top">
									<p>30&#160;cycles (94&#176;C 30&#8221;; 40&#176;C 30&#8221;; 72&#176;C 30&#8221;); 72&#176;C 10&#8217;</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Anopheles funestus</it> s.s.</p>
								</entry>
								<entry align="center" colname="c2">
									<p>GCATCGATGGGTTAATCATG</p>
								</entry>
								<entry align="center" colname="c3">
									<p>460</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Anopheles vaneedeni</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>TGTCGACTTGGTAGCCGAAC</p>
								</entry>
								<entry align="center" colname="c3">
									<p>555</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Anopheles rivulorum</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>CAAGCCGTTCGACCCTGATT</p>
								</entry>
								<entry align="center" colname="c3">
									<p>400</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Anopheles parensis</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>TGCGGTCCCAAGCTAGGTTC</p>
								</entry>
								<entry align="center" colname="c3">
									<p>235</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Anopheles leesoni</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>TACACGGGCGCCATGTAGTT</p>
								</entry>
								<entry align="center" colname="c3">
									<p>146</p>
								</entry>
							</row>
							<row>
								<entry colname="c1" nameend="c4" namest="c1">
									<p>
										<b>
											<it>Wuchereria bancrofti</it>
										</b>
									</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>NV-1</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>CGTGATGGCATCAAAGTAGCG</p>
								</entry>
								<entry align="center" colname="c3">
									<p>188</p>
								</entry>
								<entry align="left" colname="c4" morerows="1" rowsep="1" valign="top">
									<p>94&#176;C 3&#8217;; followed by 35&#160;cycles (94&#176;C 1&#8217;; 55&#176;C 1&#8217;; 72&#176;C 2&#8217;); 94&#176;C 1&#8217;; 55&#176;C 1&#8217;; 72&#176;C 10&#8221;</p>
								</entry>
							</row>
							<row rowsep="1">
								<entry colname="c1">
									<p>
										<it>NV-2</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>CCCTCACTTACCATAAGACAAC</p>
								</entry>
								<entry align="center" colname="c3">
									<p>188</p>
								</entry>
							</row>
						</tbody>
					</tgroup>
				</table><p>After gene amplification and digestion, the PCR products were electrophoresed separately in 2% agarose gel. The gel was prepared by adding TAE buffer to the powder, which was placed in a microwave oven (230&#160;V, 50&#8201;Hz, 2660&#160;W, 12.0A) for 1&#160;minute to dissolve the solute, and then stained with 0.5&#160;&#956;g/ml Ethidium Bromide. For the electrophoresis, 8&#160;&#956;l of each sample was added to 1&#160;&#956;l of orange G (5X) gel loading dye after placing the solidified gel in 1X TAE buffer in a mini gel system (BIORAD USA). One hundred volts of electric current was passed through it for an hour and the gel photographed over a UV trans-illuminator (UPC, USA) at short wavelength using a Polaroid camera and film type 667 (Polaroid, USA). The sizes of the PCR products were estimated by comparison with the mobility of a 100 base pair molecular weight size marker (Sigma).</p>
			</sec>
			<sec>
				<st>
					<p>Molecular identification of <it>Wuchereria bancrofti</it> larvae in mosquito vectors</p>
				</st><p>After the carcass of infected mosquito was scrapped into 1.5&#160;ml eppendorf tubes, DNeasy Tissue Kit (QIAGEN Inc., USA) was used in the extraction of the parasite&#8217;s genomic DNA from animal tissues following the manufacturer&#8217;s recommended protocol. After the DNA extraction, aliquots of 5&#160;&#956;l of the filarial DNA extract from the mosquitoes were used as templates for the amplification reaction. The PCR assay was performed using two published specific oligonucleotide primers, NV-1 and NV-2 <abbrgrp>
						<abbr bid="B17">17</abbr>
					</abbrgrp>. The PCR products were electrophoresed in 2% agarose gel as described in the previous section.</p>
			</sec>
			<sec>
				<st>
					<p>Molecular identification of <it>Wuchereria bancrofti</it> microfilariae in human blood</p>
				</st><p>Microfilariae (mf) in human blood samples that were preserved in 3% acetic acid were also characterised after extracting the genomic DNA using the same kit described above. Infected blood samples were amplified and identified using the same procedure described in previous sections.</p>
			</sec>
			<sec>
				<st>
					<p>Ethical considerations</p>
				</st><p>For the yearly MDA and mass screening for mf prevalence in the communities, oral informed consent was sought from all participants. Subsequently, written consent was obtained from each volunteer who slept under bed nets after the study purpose, procedures, entry and exit criteria were explained to them. All volunteers and the entire community members received that year&#8217;s round of MDA immediately after the blood sample collection. The Institutional Review Board of Noguchi Memorial Institute for Medical Research approved the study.</p>
			</sec>
			<sec>
				<st>
					<p>Statistical analysis</p>
				</st><p>Data were entered into Microsoft Access and analysed for the vector competency of <it>Anopheles</it> spp. in supporting the development of mf to the infective stage larvae. The same software was used to calculate the geometric mean intensity on mf in the human population. One-way analysis of variance (ANOVA) was used to test for the significance of age- and gender-specific variations between the human population and mf, with <it>p</it> value set at 0.05.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Results</p>
			</st>
			<sec>
				<st>
					<p>Human microfilariae load in the communities after four rounds of MDA</p>
				</st><p>The overall prevalence of mf in the study communities (<it>N</it> =&#8201;1083) was 1.6%; mf prevalence among males and females (2.05% and 1.10% respectively) was not significantly different (<it>p</it>&#8201;=&#8201;0.39). The mf levels ranged from 0 to 59/100&#160;&#956;l blood with geometric mean intensity of 1.1 mf/ml of blood (Table&#160;<tblr tid="T2">2</tblr>). There was no significant variation in mf intensity and age-group (<it>p</it>&#8201;=&#8201;0.40); likewise no significant difference between mf intensity and gender of participants (<it>p</it>&#8201;=&#8201;0.91) (Table&#160;<tblr tid="T2">2</tblr>). Four out of the nine communities namely Ayesuano, Dago, Hwida and Okyereko recorded positive cases, with Okyereko having the highest number of cases (Table&#160;<tblr tid="T3">3</tblr>). Among the positive cases, Okyereko recorded 155.6 mf/ml of blood whilst Dago recorded 15.3 mf/ml of blood.</p>
				<table id="T2">
					<title>
						<p>Table 2</p>
					</title>
					<caption>
						<p>
							<b>Prevalence of mf and the geometric mean intensity in the study area</b>
						</p>
					</caption>
					<tgroup align="left" cols="11">
						<colspec align="left" colname="c1" colnum="1" colwidth="1*"/>
						<colspec align="center" colname="c2" colnum="2" colwidth="1*"/>
						<colspec align="center" colname="c3" colnum="3" colwidth="1*"/>
						<colspec align="center" colname="c4" colnum="4" colwidth="1*"/>
						<colspec align="center" colname="c5" colnum="5" colwidth="1*"/>
						<colspec align="center" colname="c6" colnum="6" colwidth="1*"/>
						<colspec align="center" colname="c7" colnum="7" colwidth="1*"/>
						<colspec align="center" colname="c8" colnum="8" colwidth="1*"/>
						<colspec align="center" colname="c9" colnum="9" colwidth="1*"/>
						<colspec align="center" colname="c10" colnum="10" colwidth="1*"/>
						<colspec align="center" colname="c11" colnum="11" colwidth="1*"/>
						<thead valign="top">
							<row rowsep="1">
								<entry colname="c1" morerows="1" valign="top">
									<p>
										<b>Age group (yrs)</b>
									</p>
								</entry>
								<entry align="center" colname="c2" nameend="c4" namest="c2">
									<p>
										<b>Individuals examined</b>
									</p>
								</entry>
								<entry align="center" colname="c5" nameend="c7" namest="c5">
									<p>
										<b>mf positive individual (%)</b>
									</p>
								</entry>
								<entry align="center" colname="c8" nameend="c11" namest="c8">
									<p>
										<b>*mf geometric mean intensity</b>
									</p>
								</entry>
							</row>
							<row rowsep="1">
								<entry align="center" colname="c2">
									<p>
										<b>Female</b>
									</p>
								</entry>
								<entry align="center" colname="c3">
									<p>
										<b>Male</b>
									</p>
								</entry>
								<entry align="center" colname="c4">
									<p>
										<b>Total</b>
									</p>
								</entry>
								<entry align="center" colname="c5">
									<p>
										<b>Female</b>
									</p>
								</entry>
								<entry align="center" colname="c6">
									<p>
										<b>Male</b>
									</p>
								</entry>
								<entry align="center" colname="c7">
									<p>
										<b>Total</b>
									</p>
								</entry>
								<entry align="center" colname="c8">
									<p>
										<b>Female</b>
									</p>
								</entry>
								<entry align="center" colname="c9">
									<p>
										<b>Male</b>
									</p>
								</entry>
								<entry align="center" colname="c10">
									<p>
										<b>Total</b>
									</p>
								</entry>
								<entry align="center" colname="c11">
									<p>
										<b>mf positives only</b>
									</p>
								</entry>
							</row>
						</thead>
						<tfoot>
							<p>
								<b>*</b>Antilog [&#931; log (x + 1)/ n], where x is the number of mf per ml of blood in mf individuals and n is the number of people examined <abbrgrp>
									<abbr bid="B9">9</abbr>
								</abbrgrp>.</p>
						</tfoot>
						<tbody valign="top">
							<row>
								<entry colname="c1">
									<p>1-14</p>
								</entry>
								<entry align="center" colname="c2">
									<p>242</p>
								</entry>
								<entry align="center" colname="c3">
									<p>252</p>
								</entry>
								<entry align="center" colname="c4">
									<p>494</p>
								</entry>
								<entry align="center" colname="c5">
									<p>2 (0.36)</p>
								</entry>
								<entry align="center" colname="c6">
									<p>3 (0.56)</p>
								</entry>
								<entry align="center" colname="c7">
									<p>5 (0.46)</p>
								</entry>
								<entry align="center" colname="c8">
									<p>1.05</p>
								</entry>
								<entry align="center" colname="c9">
									<p>1.05</p>
								</entry>
								<entry align="center" colname="c10">
									<p>1.05</p>
								</entry>
								<entry align="center" colname="c11">
									<p>127.85</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>15-24</p>
								</entry>
								<entry align="center" colname="c2">
									<p>114</p>
								</entry>
								<entry align="center" colname="c3">
									<p>137</p>
								</entry>
								<entry align="center" colname="c4">
									<p>251</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0</p>
								</entry>
								<entry align="center" colname="c6">
									<p>5 (0.93)</p>
								</entry>
								<entry align="center" colname="c7">
									<p>5 (0.46)</p>
								</entry>
								<entry align="center" colname="c8">
									<p>0</p>
								</entry>
								<entry align="center" colname="c9">
									<p>1.18</p>
								</entry>
								<entry align="center" colname="c10">
									<p>1.05</p>
								</entry>
								<entry align="center" colname="c11">
									<p>86.40</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>25-34</p>
								</entry>
								<entry align="center" colname="c2">
									<p>57</p>
								</entry>
								<entry align="center" colname="c3">
									<p>44</p>
								</entry>
								<entry align="center" colname="c4">
									<p>101</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0</p>
								</entry>
								<entry align="center" colname="c6">
									<p>0</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
								<entry align="center" colname="c8">
									<p>0</p>
								</entry>
								<entry align="center" colname="c9">
									<p>0</p>
								</entry>
								<entry align="center" colname="c10">
									<p>0</p>
								</entry>
								<entry align="center" colname="c11">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>35-44</p>
								</entry>
								<entry align="center" colname="c2">
									<p>42</p>
								</entry>
								<entry align="center" colname="c3">
									<p>30</p>
								</entry>
								<entry align="center" colname="c4">
									<p>72</p>
								</entry>
								<entry align="center" colname="c5">
									<p>1 (0.18)</p>
								</entry>
								<entry align="center" colname="c6">
									<p>0</p>
								</entry>
								<entry align="center" colname="c7">
									<p>1 (0.09)</p>
								</entry>
								<entry align="center" colname="c8">
									<p>1.10</p>
								</entry>
								<entry align="center" colname="c9">
									<p>0</p>
								</entry>
								<entry align="center" colname="c10">
									<p>1.06</p>
								</entry>
								<entry align="center" colname="c11">
									<p>51</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>45+</p>
								</entry>
								<entry align="center" colname="c2">
									<p>92</p>
								</entry>
								<entry align="center" colname="c3">
									<p>73</p>
								</entry>
								<entry align="center" colname="c4">
									<p>165</p>
								</entry>
								<entry align="center" colname="c5">
									<p>3 (0.55)</p>
								</entry>
								<entry align="center" colname="c6">
									<p>3 (0.56)</p>
								</entry>
								<entry align="center" colname="c7">
									<p>6 (0.55)</p>
								</entry>
								<entry align="center" colname="c8">
									<p>1.10</p>
								</entry>
								<entry align="center" colname="c9">
									<p>1.23</p>
								</entry>
								<entry align="center" colname="c10">
									<p>1.16</p>
								</entry>
								<entry align="center" colname="c11">
									<p>53.66</p>
								</entry>
							</row>
							<row rowsep="1">
								<entry colname="c1">
									<p>
										<b>All</b>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>
										<b>547</b>
									</p>
								</entry>
								<entry align="center" colname="c3">
									<p>
										<b>536</b>
									</p>
								</entry>
								<entry align="center" colname="c4">
									<p>
										<b>1083</b>
									</p>
								</entry>
								<entry align="center" colname="c5">
									<p>
										<b>6 (1.10)</b>
									</p>
								</entry>
								<entry align="center" colname="c6">
									<p>
										<b>11 (2.05)</b>
									</p>
								</entry>
								<entry align="center" colname="c7">
									<p>
										<b>17 (1.57)</b>
									</p>
								</entry>
								<entry align="center" colname="c8">
									<p>
										<b>1.05</b>
									</p>
								</entry>
								<entry align="center" colname="c9">
									<p>
										<b>1.10</b>
									</p>
								</entry>
								<entry align="center" colname="c10">
									<p>
										<b>1.07</b>
									</p>
								</entry>
								<entry align="center" colname="c11">
									<p>
										<b>79.45</b>
									</p>
								</entry>
							</row>
						</tbody>
					</tgroup>
				</table>
				<table id="T3">
					<title>
						<p>Table 3</p>
					</title>
					<caption>
						<p>
							<b>Blood sampling results showing number of people infected with microfilaria of </b><b>
								<it>Wuchereria bancrofti </it>
							</b><b>in the year 2004 (four years of MDA)</b>
						</p>
					</caption>
					<tgroup align="left" cols="4">
						<colspec align="left" colname="c1" colnum="1" colwidth="1*"/>
						<colspec align="center" colname="c2" colnum="2" colwidth="1*"/>
						<colspec align="center" colname="c3" colnum="3" colwidth="1*"/>
						<colspec align="center" colname="c4" colnum="4" colwidth="1*"/>
						<thead valign="top">
							<row rowsep="1">
								<entry colname="c1">
									<p>
										<b>Study communities</b>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>
										<b>Number examined</b>
									</p>
								</entry>
								<entry align="center" colname="c3">
									<p>
										<b>Number positive (mf density/ml of blood)</b>
									</p>
								</entry>
								<entry align="center" colname="c4">
									<p>
										<b>Geometric mean intensity (mf/ml)</b>
									</p>
								</entry>
							</row>
						</thead>
						<tbody valign="top">
							<row>
								<entry colname="c1">
									<p>Amanful</p>
								</entry>
								<entry align="center" colname="c2">
									<p>61</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>Ayesuano</p>
								</entry>
								<entry align="center" colname="c2">
									<p>69</p>
								</entry>
								<entry align="center" colname="c3">
									<p>1 (4)</p>
								</entry>
								<entry align="center" colname="c4">
									<p>1.0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>Dago</p>
								</entry>
								<entry align="center" colname="c2">
									<p>228</p>
								</entry>
								<entry align="center" colname="c3">
									<p>4 (1 &#8211; 15.3)</p>
								</entry>
								<entry align="center" colname="c4">
									<p>1.0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>Fawomanyo</p>
								</entry>
								<entry align="center" colname="c2">
									<p>66</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>Hwida</p>
								</entry>
								<entry align="center" colname="c2">
									<p>88</p>
								</entry>
								<entry align="center" colname="c3">
									<p>2 (5 &#8211; 21)</p>
								</entry>
								<entry align="center" colname="c4">
									<p>1.0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>Kyiren</p>
								</entry>
								<entry align="center" colname="c2">
									<p>161</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>Mampong</p>
								</entry>
								<entry align="center" colname="c2">
									<p>63</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>Obiri</p>
								</entry>
								<entry align="center" colname="c2">
									<p>70</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
							</row>
							<row rowsep="1">
								<entry colname="c1">
									<p>Okyereko</p>
								</entry>
								<entry align="center" colname="c2">
									<p>277</p>
								</entry>
								<entry align="center" colname="c3">
									<p>10 (1 &#8211; 155.6)</p>
								</entry>
								<entry align="center" colname="c4">
									<p>1.2</p>
								</entry>
							</row>
						</tbody>
					</tgroup>
				</table>
			</sec>
			<sec>
				<st>
					<p>Mosquito species composition and entomological indices</p>
				</st><p>The 564 mosquitoes collected consisted of 350 (62.1%) <it>Anopheles</it>, 182 (32.3%) <it>Mansonia</it>, 28 (5%) <it>Aedes</it> and 4 (0.7%) <it>Culex</it> species, (Figure&#160;<figr fid="F1">1</figr>). The <it>Anopheles</it> species comprised of 310 (88.6%) <it>An. funestus,</it> 32 (9.1%) <it>An. gambiae</it> and 8 (2.3%) <it>An. Pharoensis,</it> (Figure&#160;<figr fid="F1">1</figr>). The hourly biting rates of <it>An. gambiae</it> and <it>An. funestus</it> were 6.4 and 62 bites/person/night respectively (Table&#160;<tblr tid="T4">4</tblr>). Of the mosquito species collected, 192 (34%) were engorged with blood-meals (Table&#160;<tblr tid="T5">5</tblr>). Whereas 6/350 (1.7%) of the <it>Anopheles</it> and 6/182 (3.3%) of the <it>Mansonia</it> species were found with the mf (L<sub>1</sub> stage) of <it>W. bancrofti</it>, there was no recovery of L<sub>3</sub> or L<sub>2</sub> stage larvae after 12&#160;days of maintenance. While each of the infected <it>An. gambiae</it> had an average of one mf, each <it>An. funestus</it> had an average of eight mf when killed immediately after collection (Table&#160;<tblr tid="T5">5</tblr>). The mf load in the peripheral blood and biting rates of <it>Anopheles</it> mosquitoes peaked concurrently between 0.30 and 2.30&#160;hours (Figure&#160;<figr fid="F2">2</figr>).</p>
				<fig id="F1"><title><p>Figure 1</p></title><caption><p>Hourly distribution of the mosquito species that were caught from the bed nets under which volunteers were sleeping</p></caption><text>
   <p>
      <b>Hourly distribution of the mosquito species that were caught from the bed nets under which volunteers were sleeping.</b>
   </p>
</text><graphic file="1756-3305-7-157-1"/></fig>
				<table id="T4">
					<title>
						<p>Table 4</p>
					</title>
					<caption>
						<p>
							<b>Entomological indices of the various mosquito species that were caught during the study</b>
						</p>
					</caption>
					<tgroup align="left" cols="7">
						<colspec align="left" colname="c1" colnum="1" colwidth="1*"/>
						<colspec align="center" colname="c2" colnum="2" colwidth="1*"/>
						<colspec align="center" colname="c3" colnum="3" colwidth="1*"/>
						<colspec align="center" colname="c4" colnum="4" colwidth="1*"/>
						<colspec align="center" colname="c5" colnum="5" colwidth="1*"/>
						<colspec align="center" colname="c6" colnum="6" colwidth="1*"/>
						<colspec align="center" colname="c7" colnum="7" colwidth="1*"/>
						<thead valign="top">
							<row>
								<entry colname="c1" morerows="1" rowsep="1" valign="top">
									<p>
										<b>Mosquito species</b>
									</p>
								</entry>
								<entry align="center" colname="c2" nameend="c7" namest="c2" rowsep="1">
									<p>
										<b>Entomological indices (%)</b>
									</p>
								</entry>
							</row>
							<row rowsep="1">
								<entry align="center" colname="c2">
									<p>
										<b>Biting rate</b>
										<sup>
											<b>a</b>
										</sup>
									</p>
								</entry>
								<entry align="center" colname="c3">
									<p>
										<b>Infection rate</b>
										<sup>
											<b>b</b>
										</sup>
									</p>
								</entry>
								<entry align="center" colname="c4">
									<p>
										<b>Infectivity rate</b>
										<sup>
											<b>c</b>
										</sup>
									</p>
								</entry>
								<entry align="center" colname="c5">
									<p>
										<b>Intensity of infection</b>
										<sup>
											<b>d</b>
										</sup>
									</p>
								</entry>
								<entry align="center" colname="c6">
									<p>
										<b>Survival rate</b>
										<sup>
											<b>e</b>
										</sup>
									</p>
								</entry>
								<entry align="center" colname="c7">
									<p>
										<b>Vector efficiency</b>
										<sup>
											<b>f</b>
										</sup>
									</p>
								</entry>
							</row>
						</thead>
						<tfoot>
							<p>
								<sup>a</sup>Number of mosquitoes caught/ number of collectors x number of captures (bites/ person/ night); <sup>b</sup>Number of mosquitoes infected/ number of mosquitoes dissected; <sup>c</sup>L<sub>3</sub> in the head and proboscis/ number of surviving mosquitoes; <sup>d</sup>Number of mosquitoes with L<sub>3</sub> in the head and proboscis/ number of mosquitoes with L<sub>3</sub>; <sup>e</sup>Number of surviving mosquitoes at the end of study/ number of engorged mosquitoes. <sup>f</sup>Number of L<sub>3</sub> x 100/ number of mf ingested among dissected mosquitoes <abbrgrp>
									<abbr bid="B19">19</abbr>
									<abbr bid="B20">20</abbr>
									<abbr bid="B21">21</abbr>
								</abbrgrp>.</p>
						</tfoot>
						<tbody valign="top">
							<row>
								<entry colname="c1">
									<p>
										<it>An. gambiae</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>6.4</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0.13</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0</p>
								</entry>
								<entry align="center" colname="c6">
									<p>0.50</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>An. funestus</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>62.0</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0.03</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0</p>
								</entry>
								<entry align="center" colname="c6">
									<p>0.47</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>An. pharoensis</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>1.6</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0</p>
								</entry>
								<entry align="center" colname="c6">
									<p>1.0</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Culex</it> sp</p>
								</entry>
								<entry align="center" colname="c2">
									<p>0.8</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0</p>
								</entry>
								<entry align="center" colname="c6">
									<p>0</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Aedes</it> sp</p>
								</entry>
								<entry align="center" colname="c2">
									<p>5.6</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0</p>
								</entry>
								<entry align="center" colname="c6">
									<p>5.0</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
							</row>
							<row rowsep="1">
								<entry colname="c1">
									<p>
										<it>Mansonia</it> sp</p>
								</entry>
								<entry align="center" colname="c2">
									<p>36.4</p>
								</entry>
								<entry align="center" colname="c3">
									<p>0.07</p>
								</entry>
								<entry align="center" colname="c4">
									<p>0</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0</p>
								</entry>
								<entry align="center" colname="c6">
									<p>0.12</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
							</row>
						</tbody>
					</tgroup>
				</table>
				<table id="T5">
					<title>
						<p>Table 5</p>
					</title>
					<caption>
						<p>
							<b>Number of mosquitoes caught and examined before and after maintenance in the laboratory</b>
						</p>
					</caption>
					<tgroup align="left" cols="9">
						<colspec align="left" colname="c1" colnum="1" colwidth="1*"/>
						<colspec align="center" colname="c2" colnum="2" colwidth="1*"/>
						<colspec align="center" colname="c3" colnum="3" colwidth="1*"/>
						<colspec align="center" colname="c4" colnum="4" colwidth="1*"/>
						<colspec align="center" colname="c5" colnum="5" colwidth="1*"/>
						<colspec align="center" colname="c6" colnum="6" colwidth="1*"/>
						<colspec align="center" colname="c7" colnum="7" colwidth="1*"/>
						<colspec align="center" colname="c8" colnum="8" colwidth="1*"/>
						<colspec align="center" colname="c9" colnum="9" colwidth="1*"/>
						<thead valign="top">
							<row>
								<entry colname="c1" morerows="1" rowsep="1" valign="top">
									<p>
										<b>Mosquito species</b>
									</p>
								</entry>
								<entry align="center" colname="c2" nameend="c3" namest="c2" rowsep="1">
									<p>
										<b>No: of mosquitoes</b>
									</p>
								</entry>
								<entry align="center" colname="c4" nameend="c5" namest="c4" rowsep="1">
									<p>
										<b>No: of mosquitoes examined immediately after collection</b>
									</p>
								</entry>
								<entry align="center" colname="c6" nameend="c7" namest="c6" rowsep="1">
									<p>
										<b>No: of mosquitoes examined from days 1-8 of maintenance</b>
									</p>
								</entry>
								<entry align="center" colname="c8" nameend="c9" namest="c8" rowsep="1">
									<p>
										<b>No: of mosquitoes examined from days 9-13 of maintenance</b>
									</p>
								</entry>
							</row>
							<row rowsep="1">
								<entry align="center" colname="c2">
									<p>
										<b>Caught</b>
									</p>
								</entry>
								<entry align="center" colname="c3">
									<p>
										<b>Engorged with blood</b>
									</p>
								</entry>
								<entry align="center" colname="c4">
									<p>
										<b>Dissected</b>
									</p>
								</entry>
								<entry align="center" colname="c5">
									<p>
										<b>Infected (no: mf)</b>
									</p>
								</entry>
								<entry align="center" colname="c6">
									<p>
										<b>Dissected</b>
									</p>
								</entry>
								<entry align="center" colname="c7">
									<p>
										<b>Infected (no: mf)</b>
									</p>
								</entry>
								<entry align="center" colname="c8">
									<p>
										<b>Dissected</b>
									</p>
								</entry>
								<entry align="center" colname="c9">
									<p>
										<b>Infected</b>
									</p>
								</entry>
							</row>
						</thead>
						<tfoot>
							<p>All mf found in mosquitoes were of L<sub>1</sub> stage, neither L<sub>2</sub> nor L<sub>3</sub> stages were found. All mosquitoes caught were dissected latest by end of the maintenance (13&#160;days).</p>
						</tfoot>
						<tbody valign="top">
							<row>
								<entry colname="c1">
									<p>
										<it>An. gambiae</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>32</p>
								</entry>
								<entry align="center" colname="c3">
									<p>12</p>
								</entry>
								<entry align="center" colname="c4">
									<p>16</p>
								</entry>
								<entry align="center" colname="c5">
									<p>2 (2)</p>
								</entry>
								<entry align="center" colname="c6">
									<p>10</p>
								</entry>
								<entry align="center" colname="c7">
									<p>2 (3)</p>
								</entry>
								<entry align="center" colname="c8">
									<p>6</p>
								</entry>
								<entry align="center" colname="c9">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>An. funestus</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>310</p>
								</entry>
								<entry align="center" colname="c3">
									<p>98</p>
								</entry>
								<entry align="center" colname="c4">
									<p>155</p>
								</entry>
								<entry align="center" colname="c5">
									<p>4 (33)</p>
								</entry>
								<entry align="center" colname="c6">
									<p>109</p>
								</entry>
								<entry align="center" colname="c7">
									<p>4 (4)</p>
								</entry>
								<entry align="center" colname="c8">
									<p>46</p>
								</entry>
								<entry align="center" colname="c9">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>An. pharoensis</it>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>8</p>
								</entry>
								<entry align="center" colname="c3">
									<p>2</p>
								</entry>
								<entry align="center" colname="c4">
									<p>4</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0 (0)</p>
								</entry>
								<entry align="center" colname="c6">
									<p>2</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
								<entry align="center" colname="c8">
									<p>2</p>
								</entry>
								<entry align="center" colname="c9">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Culex</it> sp.</p>
								</entry>
								<entry align="center" colname="c2">
									<p>4</p>
								</entry>
								<entry align="center" colname="c3">
									<p>2</p>
								</entry>
								<entry align="center" colname="c4">
									<p>2</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0 (0)</p>
								</entry>
								<entry align="center" colname="c6">
									<p>2</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
								<entry align="center" colname="c8">
									<p>0</p>
								</entry>
								<entry align="center" colname="c9">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Aedes</it> sp.</p>
								</entry>
								<entry align="center" colname="c2">
									<p>28</p>
								</entry>
								<entry align="center" colname="c3">
									<p>2</p>
								</entry>
								<entry align="center" colname="c4">
									<p>14</p>
								</entry>
								<entry align="center" colname="c5">
									<p>0 (0)</p>
								</entry>
								<entry align="center" colname="c6">
									<p>4</p>
								</entry>
								<entry align="center" colname="c7">
									<p>0</p>
								</entry>
								<entry align="center" colname="c8">
									<p>10</p>
								</entry>
								<entry align="center" colname="c9">
									<p>0</p>
								</entry>
							</row>
							<row>
								<entry colname="c1">
									<p>
										<it>Mansonia</it> sp.</p>
								</entry>
								<entry align="center" colname="c2">
									<p>182</p>
								</entry>
								<entry align="center" colname="c3">
									<p>76</p>
								</entry>
								<entry align="center" colname="c4">
									<p>90</p>
								</entry>
								<entry align="center" colname="c5">
									<p>6 (12)</p>
								</entry>
								<entry align="center" colname="c6">
									<p>82</p>
								</entry>
								<entry align="center" colname="c7">
									<p>7 (7)</p>
								</entry>
								<entry align="center" colname="c8">
									<p>9</p>
								</entry>
								<entry align="center" colname="c9">
									<p>0</p>
								</entry>
							</row>
							<row rowsep="1">
								<entry colname="c1">
									<p>
										<b>Total</b>
									</p>
								</entry>
								<entry align="center" colname="c2">
									<p>
										<b>564</b>
									</p>
								</entry>
								<entry align="center" colname="c3">
									<p>
										<b>192</b>
									</p>
								</entry>
								<entry align="center" colname="c4">
									<p>
										<b>281</b>
									</p>
								</entry>
								<entry align="center" colname="c5">
									<p>
										<b>12 (47)</b>
									</p>
								</entry>
								<entry align="center" colname="c6">
									<p>
										<b>209</b>
									</p>
								</entry>
								<entry align="center" colname="c7">
									<p>
										<b>13 (14)</b>
									</p>
								</entry>
								<entry align="center" colname="c8">
									<p>
										<b>73</b>
									</p>
								</entry>
								<entry align="center" colname="c9">
									<p>
										<b>0</b>
									</p>
								</entry>
							</row>
						</tbody>
					</tgroup>
				</table>
				<fig id="F2"><title><p>Figure 2</p></title><caption><p>Biting rate of <it>Anopheles</it> species and the geometric mean intensity (Geomean) of mf that were observed during the night of sample collection</p></caption><text>
   <p>
      <b>Biting rate of </b>
      <b>
         <it>Anopheles </it>
      </b>
      <b>species and the geometric mean intensity (Geomean) of mf that were observed during the night of sample collection.</b>
   </p>
</text><graphic file="1756-3305-7-157-2"/></fig>
			</sec>
			<sec>
				<st>
					<p>PCR identification of <it>Anopheles</it> mosquitoes and <it>Wuchereria bancrofti</it>
					</p>
				</st><p>Of the 32 <it>An. gambiae</it> s.l. collected, 30 were identified as <it>An. gambiae</it> s.s. as they showed the expected diagnostic band size of 390 base pairs. After restriction enzyme treatment with <it>Hha</it> I, M forms remained a single band of 390&#160;bp since there was no digestion. S forms on the other hand resulted in two bands of 110 and 280&#160;bp. Of the <it>An. gambiae</it> s.s digested, 21 (70%) were M forms with 9 (30%) S molecular forms. Among the 310 <it>An. funestus</it> s.l. collected, 286 were identified by PCR; of which 267 (86%) were <it>An. funestus</it> s.s. with diagnostic band sizes of 460 base pairs, and 19 (6%) were <it>An. Leesoni</it> with band sizes of 146 base pairs. The presence of <it>W. bancrofti</it> in 20 infected mosquitoes and 10 human blood samples were confirmed at 188&#160;bp.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Discussion</p>
			</st><p>An LF-endemic community is said to have low mf density when the density of circulating mf is less than 200 mf per ml of blood, an amount which cannot be detected in a significant number of instances when commonly used blood sampling techniques are employed <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. Nonetheless, this depends on variables such as volume of blood examined, source of blood sampled (venous or capillary) and method of mf detection that is employed. In this study, 100&#160;&#956;l of finger-prick blood was used, which is an appreciable amount of blood compared to the popular technique for mf detection in routine public health practice of 20&#160;&#956;l finger-prick blood <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. As such it could be inferred that the mean mf intensity of 1.07 and 79.45 mf per ml of capillary blood in the entire study communities and mf positive individuals respectively were really low in the studied area. This may be due to the 66.6% overall coverage rate in MDA with ivermectin and albendazole for 4&#160;years leading to a reduction in mf densities among the inhabitants (Boakye DA, unpublished data). Evidence from Okyereko supports this view that MDA has been effective; in this study period, 155.6 mf per ml of blood were recorded among mf positive individuals, hitherto the commencement of MDA, as high as 819 mf/ml of blood were recorded among this group <abbrgrp>
					<abbr bid="B12">12</abbr>
				</abbrgrp>.</p><p>Various observations have been made regarding mf prevalence and intensities in study populations <abbrgrp>
					<abbr bid="B9">9</abbr>
					<abbr bid="B11">11</abbr>
					<abbr bid="B12">12</abbr>
					<abbr bid="B22">22</abbr>
				</abbrgrp>. These could be attributed in part to the occupational activities of inhabitants of the study areas as well as the biting pattern of the local anopheline vectors, which are presently known to be the main vectors of LF in Ghana <abbrgrp>
					<abbr bid="B10">10</abbr>
					<abbr bid="B11">11</abbr>
					<abbr bid="B12">12</abbr>
				</abbrgrp>. Studies on the relationship between mf density in blood meals and the percentage of <it>Anopheles</it> mosquitoes that ingest mf have not provided consistent results <abbrgrp>
					<abbr bid="B3">3</abbr>
					<abbr bid="B9">9</abbr>
					<abbr bid="B22">22</abbr>
					<abbr bid="B23">23</abbr>
					<abbr bid="B24">24</abbr>
					<abbr bid="B25">25</abbr>
				</abbrgrp>. Southgate and Bryan <abbrgrp>
					<abbr bid="B26">26</abbr>
				</abbrgrp> showed that although many of the mf ingested by <it>Anopheles</it> vectors are damaged by the mosquito&#8217;s foregut armature, the proportion of mf destroyed does not depend on the number of mf ingested and varies between members of the <it>An. gambiae</it> complex and <it>An. funestus</it>. It is therefore not proper to extend findings from a given area to the other even for the same species. Additionally, other anatomical structures and immune factors other than the foregut armature could be modulating mf density following ingestion. Further studies are thus required to provide more understanding into the vector-parasite relationships.</p><p>Indeed the significance of distinctly different host-parasite relationships lies in the importance of low-density mf in sustaining transmission in various endemic areas with different genera of mosquito vectors <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. As hypothesised, the theory of &#8220;limitation&#8221; allows transmission to occur and build-up when most infected human hosts have low mf densities, whereas situations of well marked &#8220;facilitation&#8221; will give rise to transmission thresholds below which transmission will ultimately cease leading to parasite elimination from the human population. However, such predictions of parasite extinction or parasite resurgence can only be made with confidence when characteristics of the local vector-mf relationship are well understood <abbrgrp>
					<abbr bid="B7">7</abbr>
				</abbrgrp>.</p><p>As part of our study, we described the circadian pattern of mf periodicity in southern Ghana. Based on hourly examination of twelve volunteers for nine hours, we observed that mf concentration in peripheral blood followed a wave-like concentration peaking around 01.00&#160;hours, which was similar to other findings <abbrgrp>
					<abbr bid="B12">12</abbr>
					<abbr bid="B27">27</abbr>
					<abbr bid="B28">28</abbr>
				</abbrgrp>. This interesting behavioural pattern of mf is said to be the parasite&#8217;s response to oxygen tension, which is high in peripheral circulation at night due to the low human activity at this time of the day <abbrgrp>
					<abbr bid="B29">29</abbr>
					<abbr bid="B30">30</abbr>
				</abbrgrp>.</p><p>In their study, Dzodzomenyo M. <it>et al</it>. <abbrgrp>
					<abbr bid="B12">12</abbr>
				</abbrgrp> observed <it>An. funestus</it> to be the most abundant mosquito species in the early dry season while <it>An. gambiae</it> was predominant in the wet season. Our study was conducted in March, which is the peak of the dry season in Ghana and thus may contribute to the low number of <it>An. gambiae</it> that were captured. Studies show that the M and S forms of <it>Anopheles gambiae</it> s.s. do occur in sympatry in southern Ghana <abbrgrp>
					<abbr bid="B31">31</abbr>
				</abbrgrp>. Our study revealed that most of the <it>Anopheles gambiae</it> s.s. were M form, which has a remarkable ecological flexibility and is known to prevail in inundated areas where dry season breeding opportunities exist <abbrgrp>
					<abbr bid="B10">10</abbr>
				</abbrgrp>. Further studies could look at the role of these molecular forms of <it>Anopheles gambiae</it> s.s. in transmission of <it>W. bancrofti</it> following MDA.</p>
		</sec>
		<sec>
			<st>
				<p>Conclusion</p>
			</st><p>After 4 rounds of mass drug administration, parasitaemia was brought to a low level in the study communities. Low levels of circulating microfilariae in the inhabitants might have contributed to the no recovery of infective stage larvae of <it>W. bancrofti</it> in <it>An. funestus</it> s.l. as well as M and S forms of <it>An. gambiae</it>. Although the mosquito numbers were low, a further study is recommended to ascertain this observation.</p>
		</sec>
		<sec>
			<st>
				<p>Competing interest</p>
			</st><p>The authors declare that they have no competing interests.</p>
		</sec>
		<sec>
			<st>
				<p>Authors&#8217; contributions</p>
			</st><p>All authors contributed significantly to this study. DAB and MDW conceived the idea and design of the study. BKB, FAA and JO carried out the field and laboratory studies. BKB prepared the manuscript, while all authors read and approved the final manuscript.</p>
		</sec>
	</bdy>
	<bm>
		<ack>
			<sec>
				<st>
					<p>Acknowledgements</p>
				</st><p>We acknowledge the technical contributions of Sampson Otoo and Philip Doku. We thank the chiefs and elders of the study communities, and all persons who provided blood samples without whom this work would not have seen the light of day. We thank all members of Parasitology Department (NMIMR), and appreciate the support of Professor Alexander Nyarko Director, NMIMR. This work was supported by WHO/ TDR Research Grant to DAB (WHO/TDR grant No. A00638).</p>
			</sec>
		</ack>
		<refgrp><bibl id="B1"><title><p>Re-assessing the global prevalence and distribution of lymphatic filariasis</p></title><aug><au><snm>Michael</snm><fnm>E</fnm></au><au><snm>Bundy</snm><fnm>DA</fnm></au><au><snm>Grenfell</snm><fnm>BT</fnm></au></aug><source>Parasitol</source><pubdate>1996</pubdate><volume>112</volume><fpage>409</fpage><lpage>428</lpage><xrefbib><pubid idtype="doi">10.1017/S0031182000066646</pubid></xrefbib></bibl><bibl id="B2"><title><p>Experimental infection of <it>Anopheles gambiae</it> and <it>Culex quinquefasciatus pipiens fatigans</it> with <it>Wuchereria bancrofti</it> in coastal East Africa</p></title><aug><au><snm>Crans</snm><fnm>WJ</fnm></au></aug><source>J Med Entomol</source><pubdate>1973</pubdate><volume>10</volume><fpage>189</fpage><lpage>193</lpage><xrefbib><pubid idtype="pmpid">4707754</pubid></xrefbib></bibl><bibl id="B3"><title><p>Ingestion and development of <it>Wuchereria bancrofti</it> in <it>Culex quinquefasciatus, Anopheles gambiae</it> and <it>Aedes aegypti</it> after feeding on humans with varying densities of microfilariae in Tanzania</p></title><aug><au><snm>McGreevy</snm><fnm>PB</fnm></au><au><snm>Kolstrup</snm><fnm>N</fnm></au><au><snm>Tao</snm><fnm>J</fnm></au><au><snm>McGreevy</snm><fnm>MM</fnm></au><au><snm>Marshall</snm><fnm>TF</fnm></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1982</pubdate><volume>76</volume><fpage>288</fpage><lpage>296</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/0035-9203(82)90170-5</pubid><pubid idtype="pmpid">6126022</pubid></pubidlist></xrefbib></bibl><bibl id="B4"><title><p>The significance of low density microfilareamia in the transmission of lymphatic filarial parasites</p></title><aug><au><snm>Southgate</snm><fnm>BA</fnm></au></aug><source>J Trop Med Hyg</source><pubdate>1992</pubdate><volume>95</volume><fpage>79</fpage><lpage>86</lpage><xrefbib><pubid idtype="pmpid">1348543</pubid></xrefbib></bibl><bibl id="B5"><title><p>Threshold of transmission of <it>Brugia malayi</it> by <it>Anopheles sinensis</it></p></title><aug><au><snm>Zhang</snm><fnm>SQ</fnm></au><au><snm>Zhang</snm><fnm>QJ</fnm></au><au><snm>Cheng</snm><fnm>F</fnm></au><au><snm>Wang</snm><fnm>LL</fnm></au><au><snm>Pen</snm><fnm>GP</fnm></au></aug><source>J Trop Med Hyg</source><pubdate>1991</pubdate><volume>94</volume><fpage>245</fpage><lpage>250</lpage><xrefbib><pubid idtype="pmpid">1880826</pubid></xrefbib></bibl><bibl id="B6"><title><p>Global alliance launches plan to eliminate lymphatic filariasis</p></title><aug><au><snm>Yamey</snm><fnm>G</fnm></au></aug><source>BMJ</source><pubdate>2000</pubdate><volume>320</volume><fpage>269</fpage><xrefbib><pubid idtype="doi">10.1136/bmj.320.7230.269</pubid></xrefbib></bibl><bibl id="B7"><title><p>Eradication of <it>Wuchereria bancrofti</it> through vector control</p></title><aug><au><snm>Webber</snm><fnm>RH</fnm></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1991</pubdate><volume>73</volume><fpage>722</fpage><lpage>724</lpage></bibl><bibl id="B8"><title><p>Soil transmitted helminths and scabies in Zanzibar, Tanzania following mass drug administration for lymphatic filariasis &#8211; a rapid assessment methodology to assess impact</p></title><aug><au><snm>Mohammed</snm><fnm>KA</fnm></au><au><snm>Deb</snm><fnm>RM</fnm></au><au><snm>Stanton</snm><fnm>MC</fnm></au><au><snm>Molyneux</snm><fnm>DH</fnm></au></aug><source>Parasit Vectors</source><pubdate>2012</pubdate><volume>5</volume><fpage>299</fpage><xrefbib><pubidlist><pubid idtype="doi">10.1186/1756-3305-5-299</pubid><pubid idtype="pmcid">3543323</pubid><pubid idtype="pmpid" link="fulltext">23259465</pubid></pubidlist></xrefbib></bibl><bibl id="B9"><title><p>Vector competence for <it>Wuchereria bancrofti</it> of the <it>Anopheles</it> populations in the Bongo District of Ghana</p></title><aug><au><snm>Boakye</snm><fnm>DA</fnm></au><au><snm>Wilson</snm><fnm>MD</fnm></au><au><snm>Appawu</snm><fnm>MA</fnm></au><au><snm>Gyapong</snm><fnm>J</fnm></au></aug><source>Ann Trop Med Parasitol</source><pubdate>2004</pubdate><volume>98</volume><fpage>501</fpage><lpage>508</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1179/000349804225003514</pubid><pubid idtype="pmpid" link="fulltext">15257800</pubid></pubidlist></xrefbib></bibl><bibl id="B10"><title><p>Species composition and inversion polymorphism of the <it>Anopheles gambiae</it> complex in some sites of Ghana, West Africa</p></title><aug><au><snm>Appawu</snm><fnm>MA</fnm></au><au><snm>Baffoe-Wilmot</snm><fnm>A</fnm></au><au><snm>Afari</snm><fnm>EA</fnm></au><au><snm>Nkrumah</snm><fnm>FK</fnm></au><au><snm>Petrarca</snm><fnm>V</fnm></au></aug><source>Acta Trop</source><pubdate>1994</pubdate><volume>56</volume><fpage>15</fpage><lpage>23</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/0001-706X(94)90036-1</pubid><pubid idtype="pmpid">8203292</pubid></pubidlist></xrefbib></bibl><bibl id="B11"><title><p>Lymphatic filariasis on the coast of Ghana</p></title><aug><au><snm>Dunyo</snm><fnm>SK</fnm></au><au><snm>Appawu</snm><fnm>M</fnm></au><au><snm>Nkrumah</snm><fnm>FK</fnm></au><au><snm>Baffoe-Wilmot</snm><fnm>A</fnm></au><au><snm>Pedersen</snm><fnm>EM</fnm></au><au><snm>Simonsen</snm><fnm>PE</fnm></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1996</pubdate><volume>90</volume><fpage>634</fpage><lpage>638</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/S0035-9203(96)90414-9</pubid><pubid idtype="pmpid">9015499</pubid></pubidlist></xrefbib></bibl><bibl id="B12"><title><p>Bancroftian filariasis in an irrigated project community in southern Ghana</p></title><aug><au><snm>Dzodzomenyo</snm><fnm>M</fnm></au><au><snm>Dunyo</snm><fnm>SK</fnm></au><au><snm>Ahorlu</snm><fnm>CK</fnm></au><au><snm>Coker</snm><fnm>WZ</fnm></au><au><snm>Appawu</snm><fnm>MA</fnm></au><au><snm>Pedersen</snm><fnm>EM</fnm></au><au><snm>Simonsen</snm><fnm>PE</fnm></au></aug><source>Trop Med Int Health</source><pubdate>1999</pubdate><volume>4</volume><fpage>13</fpage><lpage>18</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1046/j.1365-3156.1999.00354.x</pubid><pubid idtype="pmpid" link="fulltext">10203168</pubid></pubidlist></xrefbib></bibl><bibl id="B13"><title><p>Bancroftian filariasis: a comparison of microfilariae counting techniques using counting chamber, standard slide and membrane (Nucleopore) filtration</p></title><aug><au><snm>McMahon</snm><fnm>JE</fnm></au><au><snm>Marshall</snm><fnm>TF d C</fnm></au><au><snm>Vaughan</snm><fnm>JP</fnm></au><au><snm>Abaru</snm><fnm>DE</fnm></au></aug><source>Ann Trop Med Parasitol</source><pubdate>1979</pubdate><volume>73</volume><fpage>457</fpage><lpage>464</lpage><xrefbib><pubid idtype="pmpid">393190</pubid></xrefbib></bibl><bibl id="B14"><title><p>Vector competency of <it>Culex quinquefasciatus</it> (Haitian strain) following infection with <it>Wuchereria bancrofti</it></p></title><aug><au><snm>Janousek</snm><fnm>TE</fnm></au><au><snm>Lowrie</snm><fnm>RC</fnm><suf>Jr</suf></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1989</pubdate><volume>83</volume><fpage>679</fpage><lpage>680</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/0035-9203(89)90395-7</pubid><pubid idtype="pmpid">2694503</pubid></pubidlist></xrefbib></bibl><bibl id="B15"><title><p>A ribosomal RNA gene probe differentiates member species of the <it>Anopheles gambiae</it> complex</p></title><aug><au><snm>Collins</snm><fnm>FH</fnm></au><au><snm>Mendez</snm><fnm>MA</fnm></au><au><snm>Rasmussen</snm><fnm>MO</fnm></au><au><snm>Mehaffey</snm><fnm>PC</fnm></au><au><snm>Besansky</snm><fnm>NJ</fnm></au><au><snm>Finnerty</snm><fnm>V</fnm></au></aug><source>Am J Trop Med Hyg</source><pubdate>1987</pubdate><volume>37</volume><fpage>37</fpage><lpage>41</lpage><xrefbib><pubid idtype="pmpid" link="fulltext">2886070</pubid></xrefbib></bibl><bibl id="B16"><title><p>Identification of single specimens of the <it>Anopheles gambiae</it> complex by the polymerase chain reaction</p></title><aug><au><snm>Scott</snm><fnm>JA</fnm></au><au><snm>Brogdon</snm><fnm>WG</fnm></au><au><snm>Collins</snm><fnm>FH</fnm></au></aug><source>Am J Trop Med Hyg</source><pubdate>1993</pubdate><volume>49</volume><fpage>520</fpage><lpage>529</lpage><xrefbib><pubid idtype="pmpid" link="fulltext">8214283</pubid></xrefbib></bibl><bibl id="B17"><title><p>A polymerase chain reaction&#8211;based assay for detection of <it>Wuchereria bancrofti</it> in human blood and <it>Culex pipiens</it></p></title><aug><au><snm>Ramzy</snm><fnm>RM</fnm></au><au><snm>Farid</snm><fnm>HA</fnm></au><au><snm>Kamal</snm><fnm>IH</fnm></au><au><snm>Ghada</snm><fnm>HI</fnm></au><au><snm>Zakariah</snm><fnm>SM</fnm></au><au><snm>Rifky</snm><fnm>F</fnm></au><au><snm>Weil</snm><fnm>GJ</fnm></au><au><snm>Williams</snm><fnm>SA</fnm></au><au><snm>Gad</snm><fnm>AM</fnm></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1997</pubdate><volume>91</volume><fpage>156</fpage><lpage>160</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/S0035-9203(97)90205-4</pubid><pubid idtype="pmpid">9196756</pubid></pubidlist></xrefbib></bibl><bibl id="B18"><title><p>Simultaneous identification of species and molecular forms of the <it>Anapheles gambiae</it> complex by PCR-RFLP</p></title><aug><au><snm>Fanello</snm><fnm>C</fnm></au><au><snm>Santolamazza</snm><fnm>F</fnm></au><au><snm>della Torre</snm><fnm>A</fnm></au></aug><source>Med Vet Entomol</source><pubdate>2002</pubdate><volume>16</volume><fpage>461</fpage><lpage>464</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1046/j.1365-2915.2002.00393.x</pubid><pubid idtype="pmpid" link="fulltext">12510902</pubid></pubidlist></xrefbib></bibl><bibl id="B19"><title><p>A comparison of two Brazilian populations of <it>Culex quinquefasciatus</it> (Say, 1823) from endemic and non-endemic areas to infection with <it>Wuchereria bancrofti</it> (Cobbold, 1877)</p></title><aug><au><snm>Brito</snm><fnm>AC</fnm></au><au><snm>Williams</snm><fnm>P</fnm></au><au><snm>Fontes</snm><fnm>G</fnm></au><au><snm>Rocha</snm><fnm>EMM</fnm></au></aug><source>Mem Inst Oswaldo Cruz</source><pubdate>1997</pubdate><volume>92</volume><fpage>33</fpage><lpage>36</lpage><xrefbib><pubid idtype="doi">10.1590/S0074-02761997000100007</pubid></xrefbib></bibl><bibl id="B20"><title><p>Suggestions concerning an index of experimental filarial infection in mosquitoes</p></title><aug><au><snm>Kartman</snm><fnm>L</fnm></au></aug><source>Am J Trop Med Hyg</source><pubdate>1954</pubdate><volume>3</volume><fpage>329</fpage><lpage>337</lpage><xrefbib><pubid idtype="pmpid" link="fulltext">13138835</pubid></xrefbib></bibl><bibl id="B21"><title><p>A guide to methods and techniques in Filariasis Investigations</p></title><aug><au><snm>Ramachandran</snm><fnm>CP</fnm></au></aug><source>Filar Res Off Inst Med Res, Kuala Lumpur</source><pubdate>1970</pubdate><fpage>39pp</fpage></bibl><bibl id="B22"><title><p><it>Wuchereria bancrofti</it> transmission pattern in southern Mali prior to and following the institution of mass drug administration</p></title><aug><au><snm>Coulibaly</snm><fnm>YI</fnm></au><au><snm>Dembele</snm><fnm>B</fnm></au><au><snm>Diallo</snm><fnm>AA</fnm></au><au><snm>Kristensen</snm><fnm>S</fnm></au><au><snm>Konate</snm><fnm>S</fnm></au><au><snm>Dolo</snm><fnm>H</fnm></au><au><snm>Dicko</snm><fnm>I</fnm></au><au><snm>Sangare</snm><fnm>MB</fnm></au><au><snm>Keita</snm><fnm>F</fnm></au><au><snm>Boatin</snm><fnm>BA</fnm></au><au><snm>Traore</snm><fnm>AK</fnm></au><au><snm>Nutman</snm><fnm>TB</fnm></au><au><snm>Klion</snm><fnm>AD</fnm></au><au><snm>Tour&#233;</snm><fnm>YT</fnm></au><au><snm>Traore</snm><fnm>SF</fnm></au></aug><source>Parasit Vectors</source><pubdate>2013</pubdate><volume>6</volume><fpage>247</fpage><xrefbib><pubidlist><pubid idtype="doi">10.1186/1756-3305-6-247</pubid><pubid idtype="pmcid">3765776</pubid><pubid idtype="pmpid" link="fulltext">23981378</pubid></pubidlist></xrefbib></bibl><bibl id="B23"><title><p>Factors affecting transmission of <it>Wuchereria bancrofti</it> by anopheline mosquitoes. 3. Uptake and damage to ingested microfilariae by <it>An. gambiae</it>, <it>An. arabiensis</it>, <it>An. merus</it> and <it>An. funestus</it> in East Africa</p></title><aug><au><snm>Bryan</snm><fnm>JH</fnm></au><au><snm>McMahon</snm><fnm>P</fnm></au><au><snm>Barnes</snm><fnm>A</fnm></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1990</pubdate><volume>84</volume><fpage>265</fpage><lpage>268</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/0035-9203(90)90281-I</pubid><pubid idtype="pmpid">2202106</pubid></pubidlist></xrefbib></bibl><bibl id="B24"><title><p>Factors affecting transmission of <it>Wuchereria bancrofti</it> by anopheles mosquitoes. 1. Uptake of microfilariae</p></title><aug><au><snm>Bryan</snm><fnm>JH</fnm></au><au><snm>Southgate</snm><fnm>BA</fnm></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1988</pubdate><volume>82</volume><fpage>128</fpage><lpage>137</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/0035-9203(88)90286-6</pubid><pubid idtype="pmpid">3051542</pubid></pubidlist></xrefbib></bibl><bibl id="B25"><title><p>Factors affecting transmission of <it>Wuchereria bancrofti</it> by anopheles mosquitoes. 2. Damage to ingested microfilariae by mosquito foregut armatures and development of filarial larvae in mosquitoes</p></title><aug><au><snm>Bryan</snm><fnm>JH</fnm></au><au><snm>Southgate</snm><fnm>BA</fnm></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1988</pubdate><volume>82</volume><fpage>138</fpage><lpage>145</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/0035-9203(88)90288-X</pubid><pubid idtype="pmpid">3051543</pubid></pubidlist></xrefbib></bibl><bibl id="B26"><title><p>Factors affecting transmission of <it>Wuchereria bancrofti</it> by anopheline mosquitoes. 4. Facilitation, limitation, proportionality and their epidemiological significance</p></title><aug><au><snm>Southgate</snm><fnm>BA</fnm></au><au><snm>Bryan</snm><fnm>JH</fnm></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1992</pubdate><volume>86</volume><fpage>523</fpage><lpage>530</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/0035-9203(92)90096-U</pubid><pubid idtype="pmpid">1475823</pubid></pubidlist></xrefbib></bibl><bibl id="B27"><title><p>Periodicity of microfilariae of human filariasis analysed by a trigonometric method (Aikat and Das)</p></title><aug><au><snm>Tanaka</snm><fnm>H</fnm></au></aug><source>Jpn J Exp Med</source><pubdate>1981</pubdate><volume>51</volume><fpage>97</fpage><lpage>103</lpage><xrefbib><pubid idtype="pmpid">7024589</pubid></xrefbib></bibl><bibl id="B28"><title><p>The microfilarial periodicity pattern of <it>Wuchereria bancrofti</it> in Kenya</p></title><aug><au><snm>Gatika</snm><fnm>SM</fnm></au><au><snm>Fugimaki</snm><fnm>Y</fnm></au><au><snm>Njuguna</snm><fnm>MN</fnm></au><au><snm>Gachihi</snm><fnm>GS</fnm></au><au><snm>Mbugua</snm><fnm>JM</fnm></au></aug><source>J Trop Med Hyg</source><pubdate>1994</pubdate><volume>97</volume><fpage>60</fpage><lpage>64</lpage><xrefbib><pubid idtype="pmpid">8107176</pubid></xrefbib></bibl><bibl id="B29"><title><p>The periodicity of microfilariae XI. The effect of body temperature and other stimuli upon the cycles of <it>Wuchereria bancrofti, Brugia malayi, B. ceylonensis</it> and <it>Dirofilaria repens</it></p></title><aug><au><snm>Hawking</snm><fnm>F</fnm></au><au><snm>Pattanayak</snm><fnm>S</fnm></au><au><snm>Sharma</snm><fnm>HL</fnm></au></aug><source>Trans R Soc Trop Med Hyg</source><pubdate>1966</pubdate><volume>60</volume><fpage>496</fpage><lpage>513</lpage></bibl><bibl id="B30"><title><p>Brugian filariasis: epidemiological and experimental studies</p></title><aug><au><snm>Denham</snm><fnm>DA</fnm></au><au><snm>McGreevy</snm><fnm>PB</fnm></au></aug><source>Adv Parasitol</source><pubdate>1977</pubdate><volume>15</volume><fpage>243</fpage><lpage>309</lpage><xrefbib><pubid idtype="pmpid">17276</pubid></xrefbib></bibl><bibl id="B31"><title><p>Species abundance and insecticide resistance of <it>Anopheles gambiae</it> in selected areas of Ghana and Burkina Faso</p></title><aug><au><snm>Yawson</snm><fnm>AE</fnm></au><au><snm>McCall</snm><fnm>PJ</fnm></au><au><snm>Wilson</snm><fnm>MD</fnm></au><au><snm>Donnelly</snm><fnm>MJ</fnm></au></aug><source>Med Vet Entomol</source><pubdate>2004</pubdate><volume>18</volume><fpage>372</fpage><lpage>377</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1111/j.0269-283X.2004.00519.x</pubid><pubid idtype="pmpid" link="fulltext">15642004</pubid></pubidlist></xrefbib></bibl></refgrp>
	</bm>
</art>