1756-3305-7-157 1756-3305 Research <p>Implications of low-density microfilariae carriers in <it>Anopheles</it> transmission areas: molecular forms of <it>Anopheles gambiae</it> and <it>Anopheles funestus</it> populations in perspective</p> Kwansa-BentumBethelbethelnyame@yahoo.com Aboagye-AntwiFredfaboagye-antwi@ug.edu.gh OtchereJosephjotchere@noguchi.ug.edu.gh WilsonDavidMichaelmwilson@noguchi.ug.edu.gh BoakyeAdjeiDanieldboakye@noguchi.ug.edu.gh

Department of Animal Biology and Conservation Science, University of Ghana, P.O. Box LG 67 Legon, Accra, Ghana

Parasitology Department, Noguchi Memorial Institute for Medical Research, P.O. Box LG 581 Legon, Accra, Ghana

Parasites & Vectors 1756-3305 2014 7 1 157 http://www.parasitesandvectors.com/content/7/1/157 2469037810.1186/1756-3305-7-157
51220132732014142014 2014Kwansa-Bentum et al.; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Mass drug administration Low-density microfilariae carriers Wuchereria bancrofti Anopheles gambiae Anopheles funestus

Abstract

Background

Previous studies have shown a general reduction in annual transmission potential (ATP) of Anopheles species after mass drug administration (MDA) in lymphatic filariasis endemic communities. Whereas results obtained from a monitoring programme after three years of MDA revealed a decrease in ATP of Anopheles funestus this was not the same for An. gambiae s.s. in Ghana. In this study, the ability of these vectors in transmitting Wuchereria bancrofti in nine lymphatic filariasis endemic communities in Gomoa District of Ghana after four rounds of MDA with ivermectin and albendazole was investigated.

Methods

After mass screening of inhabitants in these communities, twelve consenting volunteers with different intensities of microfilariae (mf) slept under partly opened mosquito nets as sources of mf blood meal. Hourly collection of mosquitoes and finger-pricked blood were taken from 21.00 to 06.00 hours the following day. For each hour, half of the mosquitoes collected were immediately killed and dissected for mf. The remaining half were maintained up to 13 days for parasite maturation. Parasitaemia and infection rates in the mosquitoes were determined by microscopy. The mosquitoes were identified by microscopy and molecular techniques.

Results

A total of 1,083 participants were screened and the overall parasite prevalence was 1.6% with mf intensities ranging from 0 to 59 per 100 μl and geometric mean intensity of 1.1 mf per ml of blood. Of the 564 mosquitoes collected, 350 (62.1%) were Anopheles spp., from which 310 (88.6%) were An. funestus and 32 (9.1%) An. gambiae. Six anopheline mosquitoes (1.7%) were found infected with L1, but no larva was observed in any of the mosquitoes maintained up to 13 days. Molecular studies showed all An. gambiae s.l. to be An. gambiae s.s., of which 21 (70%) were of the M molecular form.

Conclusion

At low-level parasitaemia after 4 rounds of MDA, there was no recovery of infective stage larvae of W. bancrofti in An. funestus s.l. as well as M and S forms of An. gambiae.

Background

Wuchereria bancrofti is one of the three filarial worms responsible for about 90% of all lymphatic filariasis (LF) cases in the world 1 . These parasites are transmitted through the bite of infective mosquitoes of various genera. A competent vector is one that is capable of ingesting microfilariae (mf) from an infected human, supporting their development to the infective stage larvae (L3) and subsequently transmitting them to other uninfected persons. Depending on the vector species, its region of origin and the parasite density ingested, this ability to sustain the maturation and transmission of LF may be enhanced or restricted 2 3 . Low density mf is defined as the density of circulating mf in a specified blood compartment that cannot be detected in a significant number of instances when commonly used blood sampling techniques are applied in epidemiological studies; thus 4 mf per 20 μl (200 mf per ml) 4 . Zhang et al. 5 in their study reported that between 1.55 and 2.23% prevalence, there was a threshold provided no individual had an mf density of more than 12 mf per 60 μl of blood.

The Global Programme to Eliminate Lymphatic Filariasis (GPELF) was launched in 2000, with the main goal of halting transmission and reducing disability through annual mass drug administration (MDA) to all persons at risk of infection, particularly if the vectors are Anopheles species 6 . The strategy relies on the assumption that if the mf reservoir in the human host is reduced below a certain threshold, transmission of W. bancrofti by anopheline vectors could be interrupted 7 . This is due to the observation that even though Anopheles mosquitoes yield more infective stage larvae than Culex species, the latter is more efficient at ingesting and developing low-density mf (limitation) than the former 4 . Thus Anopheles mosquitoes are presumed to be efficient vectors of LF when the parasite density in the human population is high, a phenomenon known as “facilitation” 4 . This observation has been the source for the heightened interest in the advocacy for the possible elimination of anopheline-transmitted filariasis; however, a study has observed “facilitation” in An. gambiae s.s. and An. arabiensis but not in An. melas in Gambia or An. merus in Tanzania 4 . Additional health benefits of MDA targeting LF is the reduction in soil transmitted helminths and scabies 8 .

A study in the Bongo district of northern Ghana 9 indicates a plausible “limitation” in An. gambiae s.l. and/or An. funestus in the transmission of the parasite contrary to other reports 4 . Results from a study in the Gomoa district of southern Ghana also indicated that although transmission potential by An. funestus has decreased significantly after mass chemotherapy with ivermectin and albendazole, there appears to be no change in An. gambiae s.s. in the area (Boakye DA, unpublished data). This suggests that probably not all anophelines exhibit facilitation in their transmission of LF. This work was therefore conducted to determine the roles of these two Anopheles species in the transmission of low level W. bancrofti human mf, since this information is fundamental to the success of GPELF.

Methods

Study sites

Nine LF endemic communities in the Gomoa district of Ghana (between Latitude 5° 24’ - 35’N and Longitude 0° 25’ - 36’W) were selected based on available data on the disease epidemiology in the population and vector species distribution 10 11 12 . These are Amanful, Ayesuano, Dago, Fawomanye, Hwida, Kyiren, Mampong, Obiri and Okyereko. The district lies in the coastal savannah zone of Ghana and is located 50 km west of Accra, the capital city of Ghana. Average annual rainfall ranges between 760 and 1000 mm, whilst mean annual temperature ranges between 26 and 30°C. The main occupations of the inhabitants are farming and fishing for those living near the shores of the Atlantic Ocean.

Mass screening for microfilariae in the communities

This study was conducted from April to June 2004, the fourth year of MDA with ivermectin and albendazole in these communities. The areas also form part of an on-going annual longitudinal community-based intervention study. Human participation and the mosquito collection were done by cluster sampling method. Mass screening of the study population for mf was done by collecting 100 μl finger-pricked blood from each individual into heparinised capillary tubes and immediately mixing with 900 μl 3% acetic acid. Quantification of parasitaemia used the Sedgwick-Rafter counting chamber method with the compound microscope set at ×100 magnification 13 .

Mosquito collection, maintenance and dissection

After consenting to participate, twelve adult volunteers with varying mf levels slept under partially opened mosquito nets hung over beds in their rooms. At the mid-point of each collection hour, finger-pricked blood was taken and mf density estimated using the same procedure described above. Mosquitoes trapped in the nets were collected each hour from 21.00 hours to 06.00 hours on the next day using an aspirator. About half the number of mosquitoes collected were killed immediately and dissected for ingested mf. The remaining mosquitoes were fed on 10% sugar solution and maintained for up to 13 days in paper-cups at 26-28×C, relative humidity 70-80% and 12-hour photoperiod in the insectary 14 . Mosquitoes that died before day 13 were dissected for developing stages of W. bancrofti, whilst those that survived until the last day were dissected for the presence of infective stage L3 larvae of the parasite.

PCR identification of Anopheles species

Molecular identifications of An. gambiae, An. funestus and W. bancrofti were conducted using already established methods 15 16 17 . For the vector species identification, genomic DNA was extracted from the carcasses of mosquitoes after homogenisation with sterile Konte’s plastic pestles in 100 μl bender buffer. The homogenate was then incubated at 65°C for 30 min, followed by the addition of 125 μl of phenol. The Centrifuge 5415 C (Eppendorf) was used in all spinning of samples, unless otherwise stated. The mixture was vortexed and spun at 14,000 rpm for 10 min. The supernatant was transferred into a fresh tube and 250 μl of pre-chilled absolute ethanol and 10 μl of 8 M potassium acetate were added. This was incubated at -40°C for an hour, spun at 10,000 rpm for 10 min and supernatant poured off. The pellet was then rinsed with 200 μl of 70% ethanol, spun at 10,000 rpm for 5 min, and supernatant poured off. The pellet was dried and re-dissolved in 50 μl TE + RNAse and then kept at 4°C until ready for PCR (Table 1). Each PCR reaction mixture of 25 μl contained 1× PCR buffer (Sigma, USA), 200 μM each of the four deoxyribonucleotide triphosphates, 10 μM each of the oligonucleotide primers (Table 1), and 0.125 units of Taq Polymerase enzyme (Sigma, USA). A microliter of the genomic DNA was used as template for the amplification reaction. Anopheles gambiae s.s. were further identified and differentiated into the M and S molecular forms by enzymatic restriction of the PCR product as described by Fanello et al. 18 . This was done by amplification of 1.3 kb rDNA followed by restriction fragment length polymorphism (RFLP) with restriction enzyme Hha I (Sigma-Aldrich, USA).

<p>Table 1</p>

Primer for species ID

Sequence 5’3’

PCR product size (bp)

PCR conditions

Anopheles gambiae s.l. species

Universal primer

GTGTGCCCCTTCCTCGATGT

468

93°C 3’ followed by 35 cycles (93°C 30”; 50°C 30”; 72°C 1’); 93°C 30”; 50°C 30”; 72°C 10’

Anopheles gambiae s.s.

CTGGTTTGGTCGGCACGTTT

390

Anopheles merus/melax

TGACCAACCCACTCCCTTGA

464

Anopheles arabiensis

AAGTGTCCTTCTCCATCCTA

315

Anopheles quadrianulatus

CAGACCAAGATGGTTAGTAT

153

Anopheles funestus s.l. species

Universal primer

TGTGAACTGCAGGACACAT

30 cycles (94°C 30”; 40°C 30”; 72°C 30”); 72°C 10’

Anopheles funestus s.s.

GCATCGATGGGTTAATCATG

460

Anopheles vaneedeni

TGTCGACTTGGTAGCCGAAC

555

Anopheles rivulorum

CAAGCCGTTCGACCCTGATT

400

Anopheles parensis

TGCGGTCCCAAGCTAGGTTC

235

Anopheles leesoni

TACACGGGCGCCATGTAGTT

146

Wuchereria bancrofti

NV-1

CGTGATGGCATCAAAGTAGCG

188

94°C 3’; followed by 35 cycles (94°C 1’; 55°C 1’; 72°C 2’); 94°C 1’; 55°C 1’; 72°C 10”

NV-2

CCCTCACTTACCATAAGACAAC

188

Oligonucleotide primer sequences and PCR reaction conditions for species identification

After gene amplification and digestion, the PCR products were electrophoresed separately in 2% agarose gel. The gel was prepared by adding TAE buffer to the powder, which was placed in a microwave oven (230 V, 50 Hz, 2660 W, 12.0A) for 1 minute to dissolve the solute, and then stained with 0.5 μg/ml Ethidium Bromide. For the electrophoresis, 8 μl of each sample was added to 1 μl of orange G (5X) gel loading dye after placing the solidified gel in 1X TAE buffer in a mini gel system (BIORAD USA). One hundred volts of electric current was passed through it for an hour and the gel photographed over a UV trans-illuminator (UPC, USA) at short wavelength using a Polaroid camera and film type 667 (Polaroid, USA). The sizes of the PCR products were estimated by comparison with the mobility of a 100 base pair molecular weight size marker (Sigma).

Molecular identification of Wuchereria bancrofti larvae in mosquito vectors

After the carcass of infected mosquito was scrapped into 1.5 ml eppendorf tubes, DNeasy Tissue Kit (QIAGEN Inc., USA) was used in the extraction of the parasite’s genomic DNA from animal tissues following the manufacturer’s recommended protocol. After the DNA extraction, aliquots of 5 μl of the filarial DNA extract from the mosquitoes were used as templates for the amplification reaction. The PCR assay was performed using two published specific oligonucleotide primers, NV-1 and NV-2 17 . The PCR products were electrophoresed in 2% agarose gel as described in the previous section.

Molecular identification of Wuchereria bancrofti microfilariae in human blood

Microfilariae (mf) in human blood samples that were preserved in 3% acetic acid were also characterised after extracting the genomic DNA using the same kit described above. Infected blood samples were amplified and identified using the same procedure described in previous sections.

Ethical considerations

For the yearly MDA and mass screening for mf prevalence in the communities, oral informed consent was sought from all participants. Subsequently, written consent was obtained from each volunteer who slept under bed nets after the study purpose, procedures, entry and exit criteria were explained to them. All volunteers and the entire community members received that year’s round of MDA immediately after the blood sample collection. The Institutional Review Board of Noguchi Memorial Institute for Medical Research approved the study.

Statistical analysis

Data were entered into Microsoft Access and analysed for the vector competency of Anopheles spp. in supporting the development of mf to the infective stage larvae. The same software was used to calculate the geometric mean intensity on mf in the human population. One-way analysis of variance (ANOVA) was used to test for the significance of age- and gender-specific variations between the human population and mf, with p value set at 0.05.

Results

Human microfilariae load in the communities after four rounds of MDA

The overall prevalence of mf in the study communities (N = 1083) was 1.6%; mf prevalence among males and females (2.05% and 1.10% respectively) was not significantly different (p = 0.39). The mf levels ranged from 0 to 59/100 μl blood with geometric mean intensity of 1.1 mf/ml of blood (Table 2). There was no significant variation in mf intensity and age-group (p = 0.40); likewise no significant difference between mf intensity and gender of participants (p = 0.91) (Table 2). Four out of the nine communities namely Ayesuano, Dago, Hwida and Okyereko recorded positive cases, with Okyereko having the highest number of cases (Table 3). Among the positive cases, Okyereko recorded 155.6 mf/ml of blood whilst Dago recorded 15.3 mf/ml of blood.

<p>Table 2</p>

Age group (yrs)

Individuals examined

mf positive individual (%)

*mf geometric mean intensity

Female

Male

Total

Female

Male

Total

Female

Male

Total

mf positives only

*Antilog [Σ log (x + 1)/ n], where x is the number of mf per ml of blood in mf individuals and n is the number of people examined 9 .

1-14

242

252

494

2 (0.36)

3 (0.56)

5 (0.46)

1.05

1.05

1.05

127.85

15-24

114

137

251

0

5 (0.93)

5 (0.46)

0

1.18

1.05

86.40

25-34

57

44

101

0

0

0

0

0

0

0

35-44

42

30

72

1 (0.18)

0

1 (0.09)

1.10

0

1.06

51

45+

92

73

165

3 (0.55)

3 (0.56)

6 (0.55)

1.10

1.23

1.16

53.66

All

547

536

1083

6 (1.10)

11 (2.05)

17 (1.57)

1.05

1.10

1.07

79.45

Prevalence of mf and the geometric mean intensity in the study area

<p>Table 3</p>

Study communities

Number examined

Number positive (mf density/ml of blood)

Geometric mean intensity (mf/ml)

Amanful

61

0

0

Ayesuano

69

1 (4)

1.0

Dago

228

4 (1 – 15.3)

1.0

Fawomanyo

66

0

0

Hwida

88

2 (5 – 21)

1.0

Kyiren

161

0

0

Mampong

63

0

0

Obiri

70

0

0

Okyereko

277

10 (1 – 155.6)

1.2

Blood sampling results showing number of people infected with microfilaria of Wuchereria bancrofti in the year 2004 (four years of MDA)

Mosquito species composition and entomological indices

The 564 mosquitoes collected consisted of 350 (62.1%) Anopheles, 182 (32.3%) Mansonia, 28 (5%) Aedes and 4 (0.7%) Culex species, (Figure 1). The Anopheles species comprised of 310 (88.6%) An. funestus, 32 (9.1%) An. gambiae and 8 (2.3%) An. Pharoensis, (Figure 1). The hourly biting rates of An. gambiae and An. funestus were 6.4 and 62 bites/person/night respectively (Table 4). Of the mosquito species collected, 192 (34%) were engorged with blood-meals (Table 5). Whereas 6/350 (1.7%) of the Anopheles and 6/182 (3.3%) of the Mansonia species were found with the mf (L1 stage) of W. bancrofti, there was no recovery of L3 or L2 stage larvae after 12 days of maintenance. While each of the infected An. gambiae had an average of one mf, each An. funestus had an average of eight mf when killed immediately after collection (Table 5). The mf load in the peripheral blood and biting rates of Anopheles mosquitoes peaked concurrently between 0.30 and 2.30 hours (Figure 2).

<p>Figure 1</p>

Hourly distribution of the mosquito species that were caught from the bed nets under which volunteers were sleeping

Hourly distribution of the mosquito species that were caught from the bed nets under which volunteers were sleeping.

<p>Table 4</p>

Mosquito species

Entomological indices (%)

Biting rate a

Infection rate b

Infectivity rate c

Intensity of infection d

Survival rate e

Vector efficiency f

aNumber of mosquitoes caught/ number of collectors x number of captures (bites/ person/ night); bNumber of mosquitoes infected/ number of mosquitoes dissected; cL3 in the head and proboscis/ number of surviving mosquitoes; dNumber of mosquitoes with L3 in the head and proboscis/ number of mosquitoes with L3; eNumber of surviving mosquitoes at the end of study/ number of engorged mosquitoes. fNumber of L3 x 100/ number of mf ingested among dissected mosquitoes 19 20 21 .

An. gambiae

6.4

0.13

0

0

0.50

0

An. funestus

62.0

0.03

0

0

0.47

0

An. pharoensis

1.6

0

0

0

1.0

0

Culex sp

0.8

0

0

0

0

0

Aedes sp

5.6

0

0

0

5.0

0

Mansonia sp

36.4

0.07

0

0

0.12

0

Entomological indices of the various mosquito species that were caught during the study

<p>Table 5</p>

Mosquito species

No: of mosquitoes

No: of mosquitoes examined immediately after collection

No: of mosquitoes examined from days 1-8 of maintenance

No: of mosquitoes examined from days 9-13 of maintenance

Caught

Engorged with blood

Dissected

Infected (no: mf)

Dissected

Infected (no: mf)

Dissected

Infected

All mf found in mosquitoes were of L1 stage, neither L2 nor L3 stages were found. All mosquitoes caught were dissected latest by end of the maintenance (13 days).

An. gambiae

32

12

16

2 (2)

10

2 (3)

6

0

An. funestus

310

98

155

4 (33)

109

4 (4)

46

0

An. pharoensis

8

2

4

0 (0)

2

0

2

0

Culex sp.

4

2

2

0 (0)

2

0

0

0

Aedes sp.

28

2

14

0 (0)

4

0

10

0

Mansonia sp.

182

76

90

6 (12)

82

7 (7)

9

0

Total

564

192

281

12 (47)

209

13 (14)

73

0

Number of mosquitoes caught and examined before and after maintenance in the laboratory

<p>Figure 2</p>

Biting rate of Anopheles species and the geometric mean intensity (Geomean) of mf that were observed during the night of sample collection

Biting rate of Anopheles species and the geometric mean intensity (Geomean) of mf that were observed during the night of sample collection.

PCR identification of Anopheles mosquitoes and Wuchereria bancrofti

Of the 32 An. gambiae s.l. collected, 30 were identified as An. gambiae s.s. as they showed the expected diagnostic band size of 390 base pairs. After restriction enzyme treatment with Hha I, M forms remained a single band of 390 bp since there was no digestion. S forms on the other hand resulted in two bands of 110 and 280 bp. Of the An. gambiae s.s digested, 21 (70%) were M forms with 9 (30%) S molecular forms. Among the 310 An. funestus s.l. collected, 286 were identified by PCR; of which 267 (86%) were An. funestus s.s. with diagnostic band sizes of 460 base pairs, and 19 (6%) were An. Leesoni with band sizes of 146 base pairs. The presence of W. bancrofti in 20 infected mosquitoes and 10 human blood samples were confirmed at 188 bp.

Discussion

An LF-endemic community is said to have low mf density when the density of circulating mf is less than 200 mf per ml of blood, an amount which cannot be detected in a significant number of instances when commonly used blood sampling techniques are employed 4 . Nonetheless, this depends on variables such as volume of blood examined, source of blood sampled (venous or capillary) and method of mf detection that is employed. In this study, 100 μl of finger-prick blood was used, which is an appreciable amount of blood compared to the popular technique for mf detection in routine public health practice of 20 μl finger-prick blood 4 . As such it could be inferred that the mean mf intensity of 1.07 and 79.45 mf per ml of capillary blood in the entire study communities and mf positive individuals respectively were really low in the studied area. This may be due to the 66.6% overall coverage rate in MDA with ivermectin and albendazole for 4 years leading to a reduction in mf densities among the inhabitants (Boakye DA, unpublished data). Evidence from Okyereko supports this view that MDA has been effective; in this study period, 155.6 mf per ml of blood were recorded among mf positive individuals, hitherto the commencement of MDA, as high as 819 mf/ml of blood were recorded among this group 12 .

Various observations have been made regarding mf prevalence and intensities in study populations 9 11 12 22 . These could be attributed in part to the occupational activities of inhabitants of the study areas as well as the biting pattern of the local anopheline vectors, which are presently known to be the main vectors of LF in Ghana 10 11 12 . Studies on the relationship between mf density in blood meals and the percentage of Anopheles mosquitoes that ingest mf have not provided consistent results 3 9 22 23 24 25 . Southgate and Bryan 26 showed that although many of the mf ingested by Anopheles vectors are damaged by the mosquito’s foregut armature, the proportion of mf destroyed does not depend on the number of mf ingested and varies between members of the An. gambiae complex and An. funestus. It is therefore not proper to extend findings from a given area to the other even for the same species. Additionally, other anatomical structures and immune factors other than the foregut armature could be modulating mf density following ingestion. Further studies are thus required to provide more understanding into the vector-parasite relationships.

Indeed the significance of distinctly different host-parasite relationships lies in the importance of low-density mf in sustaining transmission in various endemic areas with different genera of mosquito vectors 4 . As hypothesised, the theory of “limitation” allows transmission to occur and build-up when most infected human hosts have low mf densities, whereas situations of well marked “facilitation” will give rise to transmission thresholds below which transmission will ultimately cease leading to parasite elimination from the human population. However, such predictions of parasite extinction or parasite resurgence can only be made with confidence when characteristics of the local vector-mf relationship are well understood 7 .

As part of our study, we described the circadian pattern of mf periodicity in southern Ghana. Based on hourly examination of twelve volunteers for nine hours, we observed that mf concentration in peripheral blood followed a wave-like concentration peaking around 01.00 hours, which was similar to other findings 12 27 28 . This interesting behavioural pattern of mf is said to be the parasite’s response to oxygen tension, which is high in peripheral circulation at night due to the low human activity at this time of the day 29 30 .

In their study, Dzodzomenyo M. et al. 12 observed An. funestus to be the most abundant mosquito species in the early dry season while An. gambiae was predominant in the wet season. Our study was conducted in March, which is the peak of the dry season in Ghana and thus may contribute to the low number of An. gambiae that were captured. Studies show that the M and S forms of Anopheles gambiae s.s. do occur in sympatry in southern Ghana 31 . Our study revealed that most of the Anopheles gambiae s.s. were M form, which has a remarkable ecological flexibility and is known to prevail in inundated areas where dry season breeding opportunities exist 10 . Further studies could look at the role of these molecular forms of Anopheles gambiae s.s. in transmission of W. bancrofti following MDA.

Conclusion

After 4 rounds of mass drug administration, parasitaemia was brought to a low level in the study communities. Low levels of circulating microfilariae in the inhabitants might have contributed to the no recovery of infective stage larvae of W. bancrofti in An. funestus s.l. as well as M and S forms of An. gambiae. Although the mosquito numbers were low, a further study is recommended to ascertain this observation.

Competing interest

The authors declare that they have no competing interests.

Authors’ contributions

All authors contributed significantly to this study. DAB and MDW conceived the idea and design of the study. BKB, FAA and JO carried out the field and laboratory studies. BKB prepared the manuscript, while all authors read and approved the final manuscript.

Acknowledgements

We acknowledge the technical contributions of Sampson Otoo and Philip Doku. We thank the chiefs and elders of the study communities, and all persons who provided blood samples without whom this work would not have seen the light of day. We thank all members of Parasitology Department (NMIMR), and appreciate the support of Professor Alexander Nyarko Director, NMIMR. This work was supported by WHO/ TDR Research Grant to DAB (WHO/TDR grant No. A00638).

<p>Re-assessing the global prevalence and distribution of lymphatic filariasis</p>MichaelEBundyDAGrenfellBTParasitol199611240942810.1017/S0031182000066646<p>Experimental infection of <it>Anopheles gambiae</it> and <it>Culex quinquefasciatus pipiens fatigans</it> with <it>Wuchereria bancrofti</it> in coastal East Africa</p>CransWJJ Med Entomol1973101891934707754<p>Ingestion and development of <it>Wuchereria bancrofti</it> in <it>Culex quinquefasciatus, Anopheles gambiae</it> and <it>Aedes aegypti</it> after feeding on humans with varying densities of microfilariae in Tanzania</p>McGreevyPBKolstrupNTaoJMcGreevyMMMarshallTFTrans R Soc Trop Med Hyg19827628829610.1016/0035-9203(82)90170-56126022<p>The significance of low density microfilareamia in the transmission of lymphatic filarial parasites</p>SouthgateBAJ Trop Med Hyg19929579861348543<p>Threshold of transmission of <it>Brugia malayi</it> by <it>Anopheles sinensis</it></p>ZhangSQZhangQJChengFWangLLPenGPJ Trop Med Hyg1991942452501880826<p>Global alliance launches plan to eliminate lymphatic filariasis</p>YameyGBMJ200032026910.1136/bmj.320.7230.269<p>Eradication of <it>Wuchereria bancrofti</it> through vector control</p>WebberRHTrans R Soc Trop Med Hyg199173722724<p>Soil transmitted helminths and scabies in Zanzibar, Tanzania following mass drug administration for lymphatic filariasis – a rapid assessment methodology to assess impact</p>MohammedKADebRMStantonMCMolyneuxDHParasit Vectors2012529910.1186/1756-3305-5-299354332323259465<p>Vector competence for <it>Wuchereria bancrofti</it> of the <it>Anopheles</it> populations in the Bongo District of Ghana</p>BoakyeDAWilsonMDAppawuMAGyapongJAnn Trop Med Parasitol20049850150810.1179/00034980422500351415257800<p>Species composition and inversion polymorphism of the <it>Anopheles gambiae</it> complex in some sites of Ghana, West Africa</p>AppawuMABaffoe-WilmotAAfariEANkrumahFKPetrarcaVActa Trop199456152310.1016/0001-706X(94)90036-18203292<p>Lymphatic filariasis on the coast of Ghana</p>DunyoSKAppawuMNkrumahFKBaffoe-WilmotAPedersenEMSimonsenPETrans R Soc Trop Med Hyg19969063463810.1016/S0035-9203(96)90414-99015499<p>Bancroftian filariasis in an irrigated project community in southern Ghana</p>DzodzomenyoMDunyoSKAhorluCKCokerWZAppawuMAPedersenEMSimonsenPETrop Med Int Health19994131810.1046/j.1365-3156.1999.00354.x10203168<p>Bancroftian filariasis: a comparison of microfilariae counting techniques using counting chamber, standard slide and membrane (Nucleopore) filtration</p>McMahonJEMarshallTF d CVaughanJPAbaruDEAnn Trop Med Parasitol197973457464393190<p>Vector competency of <it>Culex quinquefasciatus</it> (Haitian strain) following infection with <it>Wuchereria bancrofti</it></p>JanousekTELowrieRCJrTrans R Soc Trop Med Hyg19898367968010.1016/0035-9203(89)90395-72694503<p>A ribosomal RNA gene probe differentiates member species of the <it>Anopheles gambiae</it> complex</p>CollinsFHMendezMARasmussenMOMehaffeyPCBesanskyNJFinnertyVAm J Trop Med Hyg19873737412886070<p>Identification of single specimens of the <it>Anopheles gambiae</it> complex by the polymerase chain reaction</p>ScottJABrogdonWGCollinsFHAm J Trop Med Hyg1993495205298214283<p>A polymerase chain reaction–based assay for detection of <it>Wuchereria bancrofti</it> in human blood and <it>Culex pipiens</it></p>RamzyRMFaridHAKamalIHGhadaHIZakariahSMRifkyFWeilGJWilliamsSAGadAMTrans R Soc Trop Med Hyg19979115616010.1016/S0035-9203(97)90205-49196756<p>Simultaneous identification of species and molecular forms of the <it>Anapheles gambiae</it> complex by PCR-RFLP</p>FanelloCSantolamazzaFdella TorreAMed Vet Entomol20021646146410.1046/j.1365-2915.2002.00393.x12510902<p>A comparison of two Brazilian populations of <it>Culex quinquefasciatus</it> (Say, 1823) from endemic and non-endemic areas to infection with <it>Wuchereria bancrofti</it> (Cobbold, 1877)</p>BritoACWilliamsPFontesGRochaEMMMem Inst Oswaldo Cruz199792333610.1590/S0074-02761997000100007<p>Suggestions concerning an index of experimental filarial infection in mosquitoes</p>KartmanLAm J Trop Med Hyg1954332933713138835<p>A guide to methods and techniques in Filariasis Investigations</p>RamachandranCPFilar Res Off Inst Med Res, Kuala Lumpur197039pp<p><it>Wuchereria bancrofti</it> transmission pattern in southern Mali prior to and following the institution of mass drug administration</p>CoulibalyYIDembeleBDialloAAKristensenSKonateSDoloHDickoISangareMBKeitaFBoatinBATraoreAKNutmanTBKlionADTouréYTTraoreSFParasit Vectors2013624710.1186/1756-3305-6-247376577623981378<p>Factors affecting transmission of <it>Wuchereria bancrofti</it> by anopheline mosquitoes. 3. Uptake and damage to ingested microfilariae by <it>An. gambiae</it>, <it>An. arabiensis</it>, <it>An. merus</it> and <it>An. funestus</it> in East Africa</p>BryanJHMcMahonPBarnesATrans R Soc Trop Med Hyg19908426526810.1016/0035-9203(90)90281-I2202106<p>Factors affecting transmission of <it>Wuchereria bancrofti</it> by anopheles mosquitoes. 1. Uptake of microfilariae</p>BryanJHSouthgateBATrans R Soc Trop Med Hyg19888212813710.1016/0035-9203(88)90286-63051542<p>Factors affecting transmission of <it>Wuchereria bancrofti</it> by anopheles mosquitoes. 2. Damage to ingested microfilariae by mosquito foregut armatures and development of filarial larvae in mosquitoes</p>BryanJHSouthgateBATrans R Soc Trop Med Hyg19888213814510.1016/0035-9203(88)90288-X3051543<p>Factors affecting transmission of <it>Wuchereria bancrofti</it> by anopheline mosquitoes. 4. Facilitation, limitation, proportionality and their epidemiological significance</p>SouthgateBABryanJHTrans R Soc Trop Med Hyg19928652353010.1016/0035-9203(92)90096-U1475823<p>Periodicity of microfilariae of human filariasis analysed by a trigonometric method (Aikat and Das)</p>TanakaHJpn J Exp Med198151971037024589<p>The microfilarial periodicity pattern of <it>Wuchereria bancrofti</it> in Kenya</p>GatikaSMFugimakiYNjugunaMNGachihiGSMbuguaJMJ Trop Med Hyg19949760648107176<p>The periodicity of microfilariae XI. The effect of body temperature and other stimuli upon the cycles of <it>Wuchereria bancrofti, Brugia malayi, B. ceylonensis</it> and <it>Dirofilaria repens</it></p>HawkingFPattanayakSSharmaHLTrans R Soc Trop Med Hyg196660496513<p>Brugian filariasis: epidemiological and experimental studies</p>DenhamDAMcGreevyPBAdv Parasitol19771524330917276<p>Species abundance and insecticide resistance of <it>Anopheles gambiae</it> in selected areas of Ghana and Burkina Faso</p>YawsonAEMcCallPJWilsonMDDonnellyMJMed Vet Entomol20041837237710.1111/j.0269-283X.2004.00519.x15642004